text
stringlengths 69
4.31k
| labels
stringclasses 2
values |
|---|---|
There's news out regarding a 60-day extension for California residents "affected by the COVID-19 virus", but the wording they use is so vague. Everyone was affected. Do they mean directly contracted the virus? Or is this truly everyone in California can have an extra 60 days to file and pay? | virus |
I own a condo apartment in Schaumburg Illinois. The tenant has lost her job because of COVID-2019 and is unable to pay the rent. I however have to pay the monthly installments as mortgage for this house. What are the options for me? Can i terminate the lease which currently ends on October 2020? Is there a law where i can evict the tenant? | would |
I had symptoms that could have been corona symptoms last week. Unfortunately the testing capacity in my country (Germany) is not sufficient to test every person with symptoms at the moment, so only people who had verified contact can be tested, which I didn't. It would be very useful, though, to know in hindsight whether I had it, since this would probably make me immune and thus make me much more flexible. For example I could help old or infected people without having to fear infecting them or me. So is there or will there be a way to test later on whether I had it or not? Or will I never be able to know? | virus |
The government has issued guidelines saying that we must stay inside. I understand this has now passed into law. Can anyone please point me to a copy of the legislation, and point out which sections are the relevant ones? | would |
On Friday, Russia declined to participate in a plan devised by the Saudi-led Organization of the Petroleum Exporting Countries (OPEC) to cut oil production levels, in order to keep oil prices steady in response to the COVID-19 outbreak. The article describes this refusal as the cause of the 10% oil price crash on Friday alone, which was exacerbated by a further 30% crash on Monday. What reasons has Russia given for their refusal to participate in the OPEC group's plan? | would |
My u-GPA is about 2.8 and GRE is 330, from now on is a hypothetical scenario as I haven't done my masters yet so if you could treat it as an actual case and give me subjective answers that would be great. For the masters I have found this growing researcher who is doing amazing work and is eager for me to join his lab from the start of the program. Assuming that by the end of the MS, I get ~3.7GPA, a couple co-authored pub and 1 first authored pub in reputed journals along with going to conferences to present my work, altogether getting strong recommendations from the advisor and his colleagues. Will this in any way offset my u-GPA. Also apart from research in masters I have had about 2 years of research experience during undergrad (in and out of school) and have published a paper in a peer-reviewed journal. I am looking to get into the biomedical engineering PhD programs at university of chicago, northwestern university, university of pittsburgh, john hopkins university, york university, and university of pennsylvania. Do you think that I am aiming too high? If so, what else should I look to do to improve my chances? Also if I start MS this Fall should I apply for PhD at Fall 2022 or Fall 2023? Additional Info: I did a decent undergrad thesis (not great, 8 months), soon after I did a 2 month internship a another research lab. During my undergrad I worked w/ a prof for 1.2 years (Got two papers out - one in a conf and another in a journal). Currently I am working in a top research lab, now remotely due to covid-19 outbreak. Some people have mentioned other questions thinking that those had the same information that I wanted. But, they did not as the questions talked about how to get into "a/some" PhD Program after a low U-GPA and maybe decent masters. The schools that I have mentioned above are ranked pretty high and would appreciate if you could tailor your answers to my specific question of getting into these schools. I picked these school not to show of the "rank" or "prestige" which seems stupid honestly. I chose the because of the strength in the field (F1) that I'm looking to do research in. In one of my previous questions I had mentioned that I got a PhD offer from university of houston which does the research in F1 but it isn't very strong in other area such as: number of grants that they pull in to do amazing research on large patient populations, intellectual cohorts, and industrial connections and startup resources. I picked these schools as I believe them to be the best in F1 and NOT for the main purpose of prestige. So if you don't have anything to suggest I IMPLORE you to not ask me to look at other schools as I did not ask for alternatives but solutions or ideas | would |
My wife had a return flight ticket from Seoul to Barcelona via Istanbul at Turkish Airlines for March 6th. We received a mail today (March 2nd) saying please call our Call Center. We called and they said the flight was cancelled. They gave us the options for a refund or change. When asking which changes were possible, they offered the same flight for the 11th of March. I asked if there could be some problem because of the novel coronavirus and they said they had no information. We changed our flight to March 11th, because they said that if the same happened again and it was cancelled again we could get the refund. Now I've learnt in IATA's list (https://www.iatatravelcentre.com/international-travel-document-news/1580226297.htm, update from March 1st) about Turkish ban of non-turkish nationals who have been to Korea recently. I think it isn't likely this ban will disappear soon (right?) so we're looking for alternatives like flights via Germany or direct flights to Barcelona. Now I'm worried that if Turkish Airlines actually does their March 11th flight but they don't let any non-turkish nationals on, they may argue that no refund is possible because it's the passenger responsibility to check that they have all the rights to enter the countries for every layover, at the time they get the flight. Are we going to get a refund? I called the Call Center again but they said they had no information about this. My wife is Korean but she is currently living in the EU. I think they should have known that because of my wife's nationality she was not allowed to travel. The ticket fare was the cheapest, no cancellations allowed. We had booked the 1st flight before the novel coronavirus was discovered. | would |
Dr. Raoult, who promotes Hydroxychloroquine, has some really intriguing statement about statistics in the biomedical field: It's counterintuitive, but the smaller the sample size of a clinical test, the more significant its results are. The differences in a sample of 20 people may be more significant than in a sample of 10,000 people. If we need such a sample, there is a risk of being wrong. With 10,000 people, when the differences are small, sometimes they don't exist. Is this a false statement in statistics? If so, is it therefore also false in the Biomedical field? On which basis can we refute it properly, by a confidence interval? Dr. Raoult promotes Hydroxychloroquine as a cure for Covid-19, thanks to an article about a study on 24 patients. His claims have been repeated a lot because of for this study, but mainly in the mainstream media, not in the scientific press. In machine learning, the SciKit workflow states that before choosing any model, you NEED a dataset with at least 50 samples, whether it be for a simple regression, or the most advance clustering technique, etc., which is why I find this statement really intriguing. EDIT: some of the answers below make the assumption of no result bias. They deal with the concept of power and effect size. However it seems there is a bias in Dr. Raoult data. The most striking being removing data for the dead, for the reason they could not provide data for the entire duration of the study. My question remains however focused on the impact of using a small sample size. Source of the statement about Statistics in a French magazine Reference to the scientific paper in question. | would |
I understand that we say something as a gold standard when it involves human intervention/judgement/review. But can someone help me understand what's the difference between probabilistic gold standard and deterministic gold standard. For ex: Patient has cancer or not - binary response - Deterministic gold standard which can be provided by humans. Whereas Patient has 60% chance of being a cancer and 40% chance of not being a cancer. Am I right to understand that this is called as probabilistic gold standard but this can't be produced by Humans right? Can any human/doctor for example, say this patient has 60% chance of being a cancer and 40 % chance of not being a cancer? | would |
Not an economist by far, just a layman, and that's a layman question. How is this possible that it's difficult to find mask for the Corona Virus? I have been several times to 7/11, boots, Watson, and other pharmacies, and everytime they did not have it as they ran out. How is it possible that the producers of masks give up on additional earning by not producing more masks, now that it's pretty obvious the demand is going up? The fact that there are not enough masks is my personal experience in Bangkok - however, some friends of mine have the same experience in Italy, where the Corona Virus outbreak has reached a scary stage. Generally. I would explain capitalism failure by pointing at government regulations - however in this case I don't see how the government can be involved into mask production. Any idea? | virus |
There are several aggregate central trackers for the spread of COVID-19. Like this one, for example. Is there anything similar for trials? Or trials in the pipeline? Either vaccines or treatments? | virus |
There has been some electron micrograph of SARS-COV-2 published; but are there any fluorescent/ confocal-fluorescent image of them? or is it possible to do them? I know that viruses are usually much smaller than capacity of light microscope but I think by using any immunofluorescent probe or FISH technique it is possible to visualise the locations occurance of the virus in cell or tissue. At least one website says it is possible to visualise viral infections using fluorescence techniques. Now is there any such image for SARS-COV-2, and is it possible to take? | virus |
Are there any open source projects that a novice data analyst and mathematician can do, to fight against covid-19 epidemic? I mean, I know that the best I can do is to stay away from people and now I have a laptop and plenty of time to work on some project. But the thing is that I don't know what kind of computations would be useful to save people. I have Ubuntu, LibreOffice, R, Python, and Sagemath installed on my computer. | virus |
I live in a fairly desirable area with one drawback: my apartment overlooks a multi-lane restricted access parkway. I'd prefer not to say more for privacy reasons. Until recently, it's been only a minor annoyance. But since things have been locked down due to the coronavirus outbreak, I've been spending a lot more time at home, and the traffic on the parkway has gotten lighter, meaning that at least anecdotally speeds have increased. The result is a huge increase in infrasound. It's like my whole apartment is shaking all day. I'm obviously not expecting the state to shut down traffic on the road completely for my comfort. It does seem like a reasonable expectation that the people driving on a roadway should get at least close to the legal speed limit, however. The posted speed on the road is 30 miles per hour, while drivers routinely flout this going 60 or 70 miles per hour. I've already tried writing to my city government, who referred me to a state agency who hasn't written back. I've also contacted the person who represents me in my state legislature. His office too has not written back to me. What's the most effective way to get my argument to a decision maker? Would I be better served addressing this complaint to the police department with jurisdiction over the roadway? Would I be better served organizing my neighbors and then returning to my state legislator with more of a coalition? (I live in Boston, Massachusetts.) | would |
In light of the coronavirus outbreak centred in Wuhan, many countries have taken steps to either prevent entry or require a quarantine period for arrivals from the affected area. Canada relies on arrivals declaring whether or not they have been to Wuhan in the past 14 days. Yes, some people will tell the truth. But some won't. With 2019 nCoV, someone who was in Wuhan the past two weeks can just lie. Why don't G8 countries just assume most people will lie and prepare for worst? | virus |
A friend of mine is currently in Cuba and was due to return to the UK on 2 April travelling Holguin> Montreal with Air Canada, and onwards to London Gatwick with BA (single PNR, booking made direct via the Air Canada website). Yesterday she received an email cancelling her flight but without giving any alternative. Long-distance communication from Cuba can be difficult, so far she has been unable to contact the airline to find out if they will re-book her on an earlier flight. I have tried to help her from the UK, but the ‘manage my booking’ option just directs me to a toll free number that doesn’t connect. I tried calling their Customer Services number in Canada but, unsurprisingly I suppose, could not get through. FWIW, she is a UK citizen married to a Cuban citizen/resident but will need to try to extend her 60 day visitor visa (usually the maximum allowed) if she is trapped in Cuba. She is a 15 hour bus journey away from Havana and if possible needs to depart from Holguin. Only a few airlines fly into Holguin, the only realistic alternative would be Condor via Frankfurt, then Lufthansa to UK. To date I don’t recall seeing many questions about Air Canada and flight cancellations. I am aware that they are offering a flexible change policy right now. My question is: has anyone else been in this situation with Air Canada since the COVID-19 emergency erupted? Given that her cancelled flight was more than 48 hours away, can we expect Air Canada to email her again in the next couple of days with information about an alternative flight? Any advice (apart from the obvious around continuing efforts to contact the airline)? | would |
I have been an employee at the company for over 5-year and I had requested time off work (4-months) to do sabbatical with some travelling. It was granted by my line manager. The request was made in person and then finalised in email. However, fast-forward to now and due to the coronavirus pandemic, I have had to return home early from my travels, at great financial cost. As such, I am keen to start working again as soon as possible and can do so from home with ease. FYI, before leaving I was working from home once a week anyway! I having had a call with my line manager, he says it won't be possible to return before the original return date, almost 2-months away. I am certain that in any normal situation (e.g. sans corona) they would be pleased to have me back early. After all, there was a reluctance to let me go in the first place. When I pressed him on why, I was told my pay wasn't in the budget for April and due to corona they were already down in their P&L. However, the UK government is willing to reimburse companies pay 80% of people's wages if the coronavirus has stopped them from working, so this seems a weak reason. Either way, this leaves me in a very strange situation: I am employee but I am not being payed. Therefore my questions are as such: Can my company legally stop me from returning to work, if it is not from something such as illness, etc? Alternatively, there is a mechanism in place that can allow me to return to work earlier? If I am not allowed to return to work, what does this mean for my employment status? If I was unemployed I could claim certain benefits, however, I would consider myself employed so I feel rather in limbo right now! Any advice on this would be REALLY appreciated. TL;DR I requested 4-months leave I have asked to start again 2-months early I am being denied that Do I have a right to start again early?/Are they obligated to allow me to return early? Outcome It seems that I am in a rather strange, but probably not entirely unique position, so I will detail some findings for those that might find them useful. My employment status remains "Employed", as suggested in the answers. However, I wrongly assumed this excludes me from claiming Universal Credits. As I am not current earning I can still apply (in fact you can apply if you are earning, that just take this into accounts and give you less). Hopefully this is useful to someone else in my position. | would |
I don't have any background in genetics and bioinformatics, so I ask you if you think that the arguments provided in the article The proximal origin of SARS-CoV-2 by Andersen et al. are convincing. In particular: While the analyses above suggest that SARS-CoV-2 may bind human ACE2 with high affinity, computational analyses predict that the interaction is not ideal and that the RBD sequence is different from those shown in SARS-CoV to be optimal for receptor binding. Thus, the high-affinity binding of the SARS-CoV-2 spike protein to human ACE2 is most likely the result of natural selection... I interpret this passage as "if the virus had been engineered, they would have done a better job". Is this interpretation correct? And if it is, does it sound convincing to you as a proof that the virus developed in nature? The second motivation given in the article is the following: Furthermore, if genetic manipulation had been performed, one of the several reverse-genetic systems available for betacoronaviruses would probably have been used Again, do you think that this exclude the possibility of a human intervention in the creation of the virus? Thank you for your opinions. Edit: I am a fan of Occam razor, I know that the scenario in which the virus originated in the wild is by far more likely than the human engineered scenario. I just want to know if, given our current knowledge in genetics, would have been possible for some high skilled researchers to engineered COVID19 (without implying that they did this with any bad purpose)? Edit 2: I share the concerns of the author of this post, that is, that the findings of the article are merely opinions and some of arguments are misleading. Anyone having a solid technical background can comment on this? China owns Nature magazine’s ass – Debunking “The proximal origin of SARS-CoV-2” claiming COVID-19 definitely wasn’t from a lab | virus |
On my 2019 Tax Return I claimed my 28 year old girlfriend as a dependent. This makes her ineligible to receive a COVID Stimulus Check. My return was already accepted and I have already received my refund. Should I amend my return, remove her as a dependent? Would she then be eligible to receive the stimulus check? | would |
This article describes the efforts of several European Union countries to agree to issue "corona bonds" or "Eurobonds", which are a joint EU mechanism to issue joint debt shared between different countries. This measure is being proposed in order to "mitigate the economic impact of the coronavirus". It says: “We need to recognize the severity of the situation and the necessity for further action to buttress our economies today,” the heads of state of Italy, France, Belgium, Greece, Portugal, Spain, Ireland, Slovenia and Luxembourg said Wednesday in a joint letter seen by CNBC. [...] “We need to work on a common debt instrument issued by a European institution to raise funds on the market on the same basis and to the benefits of all Member States,” the nine heads of state said. Given that there doesn't seem to be any restriction on European Union countries issuing their own government bonds, what are the benefits of these new proposed instruments over this conventional measure? | virus |
As many flights are cancelled due to COVID-19, it can be sometimes difficult to find a flight between a given country becomes available. How can I get notified when a flight between from a given airport to a given country becomes available within the next n days (where n can be defined by the user, e.g. n=7)? Or otherwise when the soonest available flight changes its date? I have crossposted the question at: Quora | would |
It is well-known that South-Korea has developed a powerful system of drive-through testing allowing them to test hundreds of thousands of person in the past two months. I was wondering whether the test-subjects all visit those testing stations on a voluntary basis (because they are worried about their health) or whether true random samples of the population are being tested, supposedly requiring a government order to have certain people take a test on a (semi)compulsory basis. To summarize: Is SK conducting random covid-19 tests on sizeable random samples of its population? Is any other country with a major outbreak doing such a thing? This question arose in my mind in the light of rumours that the covid-19 epidemic would have a tendency to create a pool of infected 10 times larger than reported because alledgedly the main bulk of the infected don't experience grave symptoms and do not seek out a test or diagnosis. | virus |
I found the there is a project Folding@home to fight against COVID-19. As far as I understand, it uses huge amount of computing power to find a cure. Why do we need such a huge number of potential candidates for compounds? I have understood that the limiting thing when developing drugs is the clinical tests, and one research team can't do really many tests in a day. So why don't researchers just use a normal laptop and run some simulation program which says that next one should test the following candidates? Or have I understood wrongly how the distributed computing or super computers helps on medicine? It sound really weird if researchers has so accurate heuristics that simulations can say that this candidate looks more promising as that one. | virus |
So a series of news articles are being spread around that purportedly attributes some of Bernie Sanders' losses in states due to low voter turnout. A quick search on Google reports tens of articles all claiming the same or similar findings: Google search However, I recently saw an article on Reddit that says this claim is being falsified by purposely misattributing one statistic as another, but I don't know how verifiable the information is considering it's not a news source I'm familiar with. Bernie Sanders and the Myth of Low Youth Turnout in the Democratic Primary If anything, I am more wary of the quantity of news reports. Earlier this month, Snopes.com published a fact-checking article disproving a wide swathe of news reports that Corona beer sales dropped due to fear about the coronavirus, and this is something I am not sure is also going on with the Sanders/youth voter turnout issue. In any case, did low youth turnout affect Bernie Sanders' results in the Super Tuesday primaries? Or, as the 2nd linked article claims, is it not true? | would |
OK. Short version, I'm stuck on my PhD because of coronavirus. My university is giving me an extension to my thesis deadline, but I am going to run out of funding pretty soon. I'm looking at marketable skills I can use to generate a bit of income to bridge the gap, and one of these is scientific writing. I know that there are plenty of people out there who have English as a second language, or who don't express themselves fluently and I think they'd be interested in proofreading / light copy editing. I absolutely don't want to become an essay mill, and I don't want to help people to cheat. Can anyone advise me on the ethics of this? Where do the boundaries lie? Thanks! | would |
I was on vacation in the US for 3 weeks. I am a Colombian citizen. Before I was to return on March 23 to Colombia my flight was cancelled due to Colombia closing its borders including to its citizens that were traveling overseas at the time. All international flights have been canceled. What happens if my visa travel date expires before I can leave to go to Colombia? | would |
Many countries have instructed their elderly population to stay at home because of COVID-19. Young people like myself are starting to volunteer to help deliver food and other supplies. But given asymptomatic transmission and virus spread from contact with contaminated surfaces, how I can make sure I don't accidentally do more harm than good? Is it enough to use hand sanitizer before I go to the store, then again use hand sanitizer when I unload the grocery bags from my car, and make sure I keep several meters of space between me and the person I deliver to? Should I wear a mask? Gloves? I'm guessing most older people will want to pay in cash. Is it possible to decontaminate change (coins, bills), or is it safer to only accept exact payment? | virus |
This is a strange case of difference in fatality rate between Chinese and Italian covid-19 outbreak. In my knowledge, fatality rate is a ratio between deaths from a certain disease compared to the total number of subjects diagnosed with the disease. Starting from this assumption, I attempted to analyze difference in fatality rate between Chinese/Italian outbreak. Herein, I propose a reproducible R example for exploring this variable: # Import dataset from authoritative source: # https://ourworldindata.org/coronavirus-source-data covid <- read.csv("https://covid.ourworldindata.org/data/ecdc/full_data.csv") # Subsetting only data from China and Italy dataset <- subset(covid, location == "China" | location == "Italy") # Fatality ratio: is the proportion of deaths from a certain disease compared to the # total number of people diagnosed with the disease for a certain period of time. dataset$fatality <- round(dataset$total_deaths/dataset$total_cases*100, 2) # Generating plot library(ggplot2) ggplot(dataset, aes(as.numeric(date), fatality, color = location, group = location))+ geom_smooth(size= .5, alpha=.25, color = "gray65")+ geom_line()+ geom_point()+ labs(x="Outbreak duration (days)", y= "Fatality rate (%)", color = "Location")+ theme_light(14) EDT: Bar Plot # Generating bar plot library(ggplot2) ggplot()+ geom_bar(data=subset(dataset, location == "China"), aes(as.numeric(date), fatality, fill = "China"), stat = "identity", position = position_dodge(), alpha = .75)+ geom_bar(data=subset(dataset, location == "Italy"), aes(as.numeric(date), fatality, fill = "Italy"), stat = "identity", position = position_dodge(), alpha = .75)+ labs(x="Outbreak duration (days)", y= "Fatality rate (%)", fill = "Location")+ scale_fill_brewer(palette = "Set1")+ theme_light(14) From this basis, I'm a little bit confused about such difference in terms of fatality rate between the two analyzed countries. In fact, China has the maximum fatality rate at 4%, while Italy at more than 6%. For this reason I've two questions: 1) Is my computation correct? 2) If yes, why such a huge difference in terms of fatality rate? EDT II I would like to improve this question reporting a recent Science paper which can partially explain these differences. In fact, Li et al reported that for each COVID+ patient, other 5-10 are undocumented COVID+ leading to missleading fatality rate. Moreover, as reported in the comments, to date, there are no univocal diagnostic methods wordwide. However, Italy is experiencing a huge increment in daily cumulative deaths compered to China: # Generating bar plot library(ggplot2) ggplot()+ geom_bar(data=subset(dataset, location == "China"), aes(as.numeric(date), new_deaths, fill = "China"), stat = "identity", position = position_dodge(), alpha = .75)+ geom_bar(data=subset(dataset, location == "Italy"), aes(as.numeric(date), new_deaths, fill = "Italy"), stat = "identity", position = position_dodge(), alpha = .75)+ labs(x="Outbreak duration (days)", y= "Daily deaths (n)", fill = "Location")+ scale_fill_brewer(palette = "Set1")+ theme_light(14) Something is happening there! Hubei province is almost similar to Italy in terms of surface and population but very different in terms of population mean age since Italy is one of the oldest EU country. | virus |
Recently, German Chancellor Angela Merkel gave a speech about the importance of slowing down Covid-19. Among her remarks were The most important thing, the chancellor said, is to slow down the spread of the coronavirus to win time for people to develop immunity How does that work? Can immunity be developed without actually catching the disease or via a vaccine? | virus |
Pls ELI5. 2013 was last time I opened macroeconomics textbook! I just have a B.A. economics. On r/Economics, u/ComfortableCold9 asked From your point of view, at what point would we [the USA in 2020] be approaching weimar? A QE program of 15 trillion? 25 trillion? Right under, u/Bumblewurth answered From my point of view, never. What made hyperinflation in the Weimar Republic and (most other regimes with hyperinflation) was printing marks to pay debts in gold. The whole point of QE is to provide liquidity (already there) and to prevent deflation/meet inflation targets (not there yet.) If we're at QE with 25 trillion it's because we still haven't seen inflation in consumer prices. Inequality will be through the roof though as asset prices inflate. u/Bumblewurth answers u/ComfortableCold9's follow-ups quoted in line. [u/ComfortableCold9 :] So seeing as we pay our debts in dollar, that suggests to me that we are effectively reliant on the dollar maintaining its strength [u/Bumblewurth :] No we aren't. If the dollar falls, the debts fall with the dollar. That's the difference between hyperinflationary economies in the past with non-sovereign debt and modern economies with sovereign debt. You aren't printing more dollars to chase the same amount of gold. But as soon as we start to see a level of inflation that would warrant a massive QT program, the economy would be held hostage. Economy is held hostage with deflation risk already. There's risk everywhere. That's life. But QE won't cause hyperinflation, just a whole lot of asset inflation and inequality. Most of this could be avoided if we weren't so tepid about using fiscal policy or if the fed had a fiscal tool to just send checks to everyone to manage deflation. Monetary policy is pushing on a string. But congress won't act, so here we are; Just like in 2008. Like u/ComfortableCold9 below, I too "don't see a difference"? I don't understand Bumblewurth's distinction between "future obligations" and "current debts". "Current debts are wiped out when you monetize them" — So what? [u/ComfortableCold9 :] I don't see a difference here; if the dollar started to lose lose strength, you would have to print more dollars to get the same value of what you're buying. Yes, that's a concern for future obligations, not current debts. Current debts are wiped out when you monetize them. But once you get inflation you stop QE because the entire point of QE is to create inflation so that demand is at productive capacity. You aren't printing money to cover obligations and then printing ever more to cover the same obligations as your currency falls. You're printing more to prevent deflation. That's the point. QE and Weimar aren't related. | would |
We planned a 3-week trip to Japan in March, but because of the recent increase in infections over there, we started to wonder if it wouldn't be smarter to cancel. This is our travel plan: 06-03-2020: Munich -> London -> Tokyo 27-03-2020: Tokyo -> London -> Munich We are mainly worried about two possibilities: The airports shutting down, preventing us from getting back (my boss wouldn't be too happy). Ending up in quarantine because we have an infected person on the plane. While there, we planned on staying mainly in the countryside anyways, so the risk of getting infected ourselves is rather low in my opinion. | virus |
I am looking for a maintained and updated data feed that has the times of all confirmed cases of COVID 19 and their Geo coordinates. Thanks. | virus |
My flight is from Detroit to Haneda Airport to Manila. Do I need to get a transit visa for Japan, because my layover at Haneda is 19 hours? I am a citizen of the Philippines. | would |
I read on https://immigration.go.th/content/visa_auto_extension (mirror): 👮♂️ The person whose visas has expired from 26th of March 2020 will be automatically extended to 30th of April 2020. There is no need to apply for a visa extension at Immigration Office for this period and will not be fined THB 500 per day for this case. Does the COVID-19-related automated visa extension till the 30th of April 2020 also apply to foreigners who entered Thailand visa-free? I have crossposted the question at: Quora Reddit | would |
My neighbor who also bakes has run out of yeast and can't find any in the store. We went shopping this afternoon and couldn't find any either. I have a fair-sized jar of the stuff in my fridge, but I'm also baking a lot. I'm worried about it running out, plus I'd like to share with my neighbor. Is there a recommended technique for propagating it myself so I don't run out, and have enough to share? | would |
I had a ski trip planned from 14th March - 21st March. I arrived in the French ski resort at 15:00 on 14th March and by 23:00 the French government went into lock down and ordered all non-essential businesses to close immediately - including ski resorts. Fearing being stuck in the resort, the next morning I changed my return flight from 21st March to 16th March and had to pay extra fees. I tried to contact my insurance company but they did not answer. I was also in a rush as my accommodation has ordered me to leave, but I do not have proof of this in writing unfortunately. I am now trying to claim these extra fees back from my insurance company but they are stating that because the FCO (UK Govt) did not announce non essential travel until the 17th March I have no claim. The exact wording in my travel policy for curtailment is: If you have to curtail your trip as a result of the Travel Advice Unit of the Foreign & Commonwealth Office (FCO), the World Health Organisation (WHO) or similar body recommending evacuation from the country or specific area in which you are travelling, providing the directive came into force after you purchased this insurance and after you have left your Country of Residence to commence the trip (whichever is the later). And the reply from my insurance company was: Unfortunately, from the information you provided, it would appear as shown above, the reason you abandoned your trip is not included in the specified incidents for which cover is provided under the policy. You paid the fee to amend your flight on the 15th of March, however, the FCO advice to travel to/from France came into force on the 17th of March. We are therefore unable to consider your claim further. This is really cheeky of them and they clearly don't want to pay out. I need some advice on the fact that I was already abroad at the time of this announcement - the host country has ordered everything to close and therefore my trip will be cut short. What points can I argue that my policy is in fact valid and I am due a refund? Thanks | would |
I am wondering if ICE has the legal authority to immediately arrest illegal immigrants after they have received medical care at U.S. hospitals for COVID-19. I am referring to people who voluntarily came into U.S. hospitals to receive this medical treatment. Moreover, if ICE does have the legal authority to do this, do the mayors of sanctuary cities currently have a legal right to intervene to stop ICE from arresting these particular illegal immigrants? I am thinking in particular about the mayors of cities throughout the state of California. | would |
What would be the situation for a visitor should they contract Covid-19 and require hospitalisation whilst in the US? Would it be classed as an emergency or secondary care? Does the US provide emergency care free of charge? Do charges vary e.g. by state or hospital? My question was prompted by this one Is it safe for an ESTA waiver visitor to return to Japan until the corona virus has been contained?, which made me wonder about the financial risks of extending a visit, given that many travel insurance policies limit the length of each trip. For example, I have an annual travel policy but cover is limited to 45 days. It also excludes any epidemic or pandemic. | virus |
In the UK, the Prime Minister has stated Restaurants, pubs and clubs must close Although our wedding venue has a bar, serves food and has a dance floor in the marquee, they have not closed and therefore our insurance is not paying out as the wedding can technically still go ahead. Is the Prime minister’s closure statement enough to claim on our wedding insurance? | would |
This may seem off-topic question but I am really wondering how CS folks could help in situations like coronavirus. What novel problems arise from such disease? From CS and ML/AI perspectives, is there anything that Computer Scientists could do to better combat the coronavirus? | virus |
In 2019 I booked a flight ticket with SAS to Svalbard. Unfortunately Covid19 happened. My ticket is from a flight outside the nordic countries, with a layover in Oslo. I'll be prevented from entering Norway, since I'm not a resident. Moreover, even if I was already in Norway right now, I'd be prevented from boarding the flight from Oslo to Longyearbyen, since Svalbard also separately restricted travel. To add to the complexity, when I tried to book this ticket, SAS doesn't offer a flight with a single layover. All of the flights I found have a further layover in Stavanger, Stockholm, Copenhagen... even if SAS offers direct flights to Oslo! The solution I found was to book with a travel agent which sold me a ticket with a single layover. So, SAS has a page for Covid19 information, with links to a search tool (a bit buggy and annoying to use) to check cancelled and confirmed flights, I haven't been able to confirm it for sure, but the closer we are to the departure date (it's less than 10 days from now), it seems that the less likely it'll be for it to be cancelled. I have the option of REBOOKING FREE OF CHARGE, unfortunately The rebooking can be made only once. and due to the current uncertainty, it's really difficult to pick another sensible date on which to plan my trip (no idea when Norway and Svalbard will reopen to visitors). In theory, I have the option to exchange my flight ticket for a voucher, that way I'd have the option to defer choosing the new date, which would suit me much better. Unfortunately The voucher is valid for bookings made directly with SAS (not for bookings made by travel agents). I already contacted my travel agent 6 days ago. They ask not to call, and contact them via their ticketing system only for trips in the next 4 weeks. Unfortunately, both messages I sent them have been replied with an automated reply which suggests to call them on the phone (phone which only has a recorded message, saying that they are unable to take calls due to the huge volume of requests). So, it seems that I'm stuck. I was thinking that given that in normal circumstances I have right to travel to norway (being an EEA citizen), if I'm denied boarding I should be able to at least hope for compensation according to EU regulation 261. Though it seems there's an exception For safety, security or health reasons, which usually is for different kinds of concerns, but it might be applied to a blanket ban on non-residents due to Covid19. Regardless if that exception happens, I'd have to actually attempt boarding (be at the airport on time) to actually claim compensation. I could do that, but that seems less than ideal: I'm social distancing, and I'd rather avoid a needless trip to the airport As described above, I don't know if I should realistically expect compensation (maybe you can help me here) I'd have to hope that the airline | would |
I am flying this week from Munich to London, and Bavaria just got the first contaminated person, who now has the Coronavirus 2019-nCoV after interacting with Chinese colleague. Two cases of the novel coronavirus have been confirmed in the UK, and the number of cases in Germany has grown. Moreover, the Coronavirus has now been declared a global health emergency by WHO. I got a bunch of emails from SOS International and such, on what methodology I should follow to mitigate the risk of getting infected, but none of them addresses the following (hopefully extreme) hypothetical scenario: I go to my seat, and I suspect the person next to me (or in neighboring seats) has the Coronavirus related symptoms (high fever, short breath, etc.). How should I react, without being too paranoid? Go in the back to secretly communicate that to the flight attendant, and request a seat change? Update (Feb 2): I am now in Munich airport, and both pharmacies (before and after security check) have no typical plastic masks (sold-out). They only have some conical-sized ones. The airport does not provide masks (asked in the Information). I advise you to buy a typical plastic mask before coming to the airport. | virus |
Italy now has the most deaths from COVID. It's even above China in that list. Italian government asked for international help, some countries responded: At first, China provided huge help then, suddenly, Cuba send medical crew and then Russia send military virusologists It is a very surprising to me, that western media not provide information about western help programs - Italy is a NATO member since it foundation, and also member of EU. Are there any western programs for helping Italy in fighting COVID-19? I'm sure there are - because it would be very strange if such alliances do not tight together on foreign threats. | virus |
On Monday, 06 April, 2020 the Financial Times reported that the Federal Reserve balance sheet could increase to $9 trillion. This is partly due to the myriad of initiatives, some new, to protect the economy of the United States during the 2020 Coronavirus Pandemic. A lot of online commentary is alarmist and centres on the threat of hyperinflation and many of the news articles don't inform the reader how the Federal Reserve purchases assets.. This puts the average citizen at a disadvantage when understanding the economic impact. My question is multi-faceted (but singlular) and aiming to focus purely on the economics. How does the Federal Reserve unwind the positions on their books? Do financial services have to purchase the assets back at a later date and does the Federal Reserve charge a premium for the service? Can a position of this size (60% of national output) actually be unwound? If this question is similar to the approaches of other Central Banks then please tag accordingly if appropriate. | would |
There is a lockdown in the UK. I'm a student living at Warwickshire. I planned a 2 day trip a long time ago to the south of England, and I will be travelling by car with my friend (only 1 friend). With the current lockdown rules, will I be stopped and fined? What are the possible consequences? Update: I'm not going anywhere! Thanks for the answers! | would |
It looks like I may completely write a paper while in coronavirus-related quarantine. Would it be appropriate to thank my local government in the acknowledgements? If I'm honest with myself, I don't think I would have been able to do this with such focus and efficiency if all other aspects of my life hadn't been suddenly shut down. People often acknowledge visits to other institutions, which seem to serve a similar purpose, hence why I pose the question seriously. Edit: I'm also in an at-risk group, and the government-mandated quarantine is kind of saving my life, so there's also that. | virus |
Is there anything known about the RNA structures of coronaviruses? More specifically - do they have any interesting known structures in the translatable region, like RRE of HIV or the double loops in flaviviruses? Update Here is a recent development on the side of structure prediction. | virus |
The corona virus appearantly does not like high temperature: High Temperature and High Humidity Reduce the Transmission of COVID-19 Also it seems that higher body temperatures helps the immune system to work better: Elevated body temperature helps certain types of immune cells to work better, evidence suggests Should therefore someone who suspect they may have the corona virus or possibly another cold virus and do not experience fever try to elevate their body temperature slightly (say 0.5-1 degrees celsius) by dressing extra warm? This is postulated here. Does this sound plausible to you? | virus |
Pictures of people clad in white protective gear, looking like SciFy and sparying streets, offices, factories and people have emerged in the media. What are they spraying and is there any evidence it will help stop or slow the spread of the disease? Making such large quantities of disinfectant must be costly, still the practice seems wide-spread especially in Asia. So there must be some assumed benefit, but is there any real evidence it helps? | virus |
Has anyone had success getting airlines to issue refunds, or at least extend the value of unused tickets, for upcoming travel that had been booked long before the COVID-19 outbreak? My question specifically concerns United Airlines and non-refundable tickets to destinations that are not otherwise covered by any explicit guidance. I'd be interested in hearing about others though. It seems like airlines are offering flexibility for new travel bookings but not ones made a while back. And travel insurance will only cover you if your travel is individually impacted due to illness or quarantine. | would |
I started grad school last September, and so far have been primarily busy with courses, but have been trying to do a little research on the side whenever I can. I recently finished all my courses though, and now I'm expected to dive into research. My advisor hasn't assigned me a project and expects me to come up with one on my own. I don't mind this really, I like the freedom to work on whatever I want. However, this was only really feasible when I was in my lab and surrounded by senior PhD students with whom I could bounce ideas off and get a lot of guidance from. However, now I'm stuck at home because of the COVID19 lockdown and don't really know how to productively spend my time doing research. My advisor is busy taking care of his family at home because of the lockdown, so he isn't very responsive right now understandably. I'm all alone at home so I don't have the guidance of senior PhD students either. I've tried messaging senior PhD students but it's not fair for me to constantly be harassing them for help... Apart from heavily guided stuff in undergrad, I have next to no real research experience... Since I assume I'll be stuck at home for the next several months, how can I be productive research wise with basically no guidance or help from anyone? I don't want to just waste the next few months... FYI, I'm doing research in engineering but everything is done using simulations, so while I have all the tools and equipment I need to do research at home, I just don't have the experience or guidance to efficiently do so. I've been trying to just read papers in the meantime, but I can only read so many before I get sick of it. I don't want to just be reading papers for 40 hours a week for the next 3 months... | would |
I have heard about the saying “It’s the economy stupid”, but I’m not sure about how true it is now. Let’s use Trump’s approval as an example. Even though there is a “rally around the flag effect” that is typical of leaders during crises (it is a lot smaller than governors and foreign leaders and especially President Bush in 2001), it does show that despite the stock market crashing, his approval continued to rise before presumably hitting a ceiling of about 46% on 538. For more context, in the years before, at 538, his approval was hovering at around 43% despite a relatively strong economy. I have read that the economy is not affecting people’s voting habits nearly as much as it used to. Is that true? | would |
COVID-19 has caused many large-caps' stocks to tumble like Spirit, Husky Energy ($2.75). Why don't they reverse stock split to uplift their share prices? Here are some benefits of unsplitting: A high stock price can make the company look prestigious. E.g. A company trading at $1,000 per share will be perceived as more valuable even though the firm's market capitalization may be the same as a company whose shares trade at $50. Share values mustn't fall too low! There have been cases where companies have split shares only to see the stock market dive, pushing shares below $10. Psychologically, this may turn off some shareholders, and in extreme cases, share prices may be too low for a company to be listed on an exchange. Companies will avoid splitting to protect themselves from this possibility. Doubtless large caps wouldn't fancy themselves dropping to being a penny stock! | would |
How many SARS-CoV-2 viruses are in circulation at the moment? And what is their total mass? To clarify: if there are 10 000 viruses on average in an infected human and 100 000 humans are infected the answer would be (if all viruses are in humans, which probably isn't true) 10^4 x 10^5 = 10^9 viruses. Of course I am only looking for a rough estimate, a number that, when multiplied with 10 or 0,1 (so two magnitudes) or so, is correct. | virus |
New York City's Department of Health has issued a warning against performing rim jobs on other people, saying that it might be a means of transferring the COVID-19 virus to others: Rimming (mouth on anus) might spread COVID-19. Virus in feces may enter your mouth,” the city warned in the section titled, “Take care during sex. Here's the link to the full article: https://nypost.com/2020/03/24/nyc-declares-war-on-rim-jobs-in-graphic-health-department-memo/ This is the first time I've heard this: We've been told, for a number of weeks now, that transmission of the disease is from touching our face with our hands. Is the NYC Dept. of Health statement based in reality? Should we stop performing rim jobs at the moment, in order to stop the spread of COVID-19? | virus |
Oseltamivir (tamiflu) is an antiviral medication used to treat and prevent influenza A and influenza B (flu). It is said (https://www.ncbi.nlm.nih.gov/pubmed/27660842) to reduce symptom duration even when initiated more than 2 days after symptom onset. Oseltamivir inhibits influenza virus replication and transmission following ocular-only aerosol inoculation of ferrets. https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5729277/. Can the replication and transmission of the SARS-CoV-2 (2019-nCoV) virus in humans be inhibited in a similar way by the use of oseltamivir? | virus |
The US government suspended travel from Europe to US, except for countries which are not in the Schengen area such as the UK and Ireland. Many comments from EU leader seem to assume that this is a political decision rather than a health-based decision, especially with regard to this exception. Is there any official rationale for this exception? | would |
I am a STEM teaching assistant. I know some professors were using physical class materials in engineering classes. How do you think they should respond to COVID-19-forced online education and still ensure the quality of their classes? It is a purposefully broad question. I was curious to hear what you think about the near term or futuristic/ideal approaches that could change STEM education. | would |
Could one be injected with an infinitesimal amount of Covid-19 viral particles, in a way that it would trigger an immune response long enough before the virus overran the body? Could it be injected into tissue that was far enough away from the lungs, so that some immunity could build up before the virus reached the lungs? I am talking about something similar to variolation, which was a method used to control the spread of smallpox. Material from smallpox sores (pustules) was given to people who had never had smallpox. This was done either by scratching the material into the arm or inhaling it through the nose. People usually went on to develop the symptoms associated with smallpox. However, fewer people died than if they had acquired smallpox naturally. | virus |
Somewhat controversially, China has had temporarily relocated those infected with Covid-19 in the Wuhan area to so-called Fangcang hospitals, large communal areas transformed into make-shift hospitals. Although there were up to 13 Fangcang hospitals opened at one point in Wuhan, these were apparently all closed by March 10. Fangcang shelter hospitals may seem similar to the makeshift and emergency field hospitals used during previous epidemics in other countries, for example, in the USA during the 1918–19 influenza pandemic, or in African countries during the 2014–15 Ebola epidemic. However, they differ in several important ways. First, the Fangcang shelter hospitals in China were established to isolate the patients who were most likely to transmit the infection because they had only mild to moderate COVID-19 and were thus likely to be active in their daily lives and in contact with family and community members. Second, the Fangcang shelter hospitals served an important triage function, separating patients by severity of symptoms, which was not a focus of previous makeshift and emergency field hospitals. [...] These Fangcang hospitals should not be confused with the other kind of emergency hospitals that China had built earlier, for those more seriously sick with Covid-19, such as the Huoshenshan Hospital. (The latter was a prefab hospital with separate rooms.) I've heard that some countries are already considering converting open-space structures to some kind of emergency/extra hospitals, e.g. as seen in this US footage. While the open-space conversion resembles more a Fangcang than the other type of prefab Chinese hospital, what do know about plans to mass-quarantine the mild cases in such open-space-conversion hospitals elsewhere, i.e. do (any of) these resemble Fangcangs in (intended) function, not just in looks? | virus |
For context, Australia, where I live, currently sits at ~130 confirmed cases, which makes me feel relatively safe for now, but naturally this will get worse with time as other countries' examples suggest. I will be working from home, avoiding public transport and limiting shopping to the minimum. I live in suburban Sydney, so one of the major population centers. How safe is it to continue solo outdoors training with the current and predicted COVID-19 situation? Specifically, I mean cycling without a group (i.e. maintaining a good degree of separation from any other humans at any given time). I imagine it has to be considerably safer than e.g. grocery shopping. Can the virus remain airborne outdoors for long periods of time? | virus |
I have a question about the novel coronavirus and swine flu. How do the death rates compare between the two diseases? How do the transmissions and rate of transmission compare? Was a vaccine developed quicker for swine flu? I ask because I don't recall this level of global disruption during the swine flu outbreak. | virus |
I am trying to calculate the basic reproduction number $R_0$ of the new 2019-nCoV virus by fitting a SIR model to the current data. My code is based on https://arxiv.org/pdf/1605.01931.pdf, p. 11ff: library(deSolve) library(RColorBrewer) #https://en.wikipedia.org/wiki/Timeline_of_the_2019%E2%80%9320_Wuhan_coronavirus_outbreak#Cases_Chronology_in_Mainland_China Infected <- c(45, 62, 121, 198, 291, 440, 571, 830, 1287, 1975, 2744, 4515) day <- 0:(length(Infected)-1) N <- 1400000000 #pop of china init <- c(S = N-1, I = 1, R = 0) plot(day, Infected) SIR <- function(time, state, parameters) { par <- as.list(c(state, parameters)) with(par, { dS <- -beta * S * I dI <- beta * S * I - gamma * I dR <- gamma * I list(c(dS, dI, dR)) }) } RSS.SIR <- function(parameters) { names(parameters) <- c("beta", "gamma") out <- ode(y = init, times = day, func = SIR, parms = parameters) fit <- out[ , 3] RSS <- sum((Infected - fit)^2) return(RSS) } lower = c(0, 0) upper = c(0.1, 0.5) set.seed(12) Opt <- optim(c(0.001, 0.4), RSS.SIR, method = "L-BFGS-B", lower = lower, upper = upper) Opt$message ## [1] "NEW_X" Opt_par <- Opt$par names(Opt_par) <- c("beta", "gamma") Opt_par ## beta gamma ## 0.0000000 0.4438188 t <- seq(0, 100, length = 100) fit <- data.frame(ode(y = init, times = t, func = SIR, parms = Opt_par)) col <- brewer.pal(4, "GnBu")[-1] matplot(fit$time, fit[ , 2:4], type = "l", xlab = "Day", ylab = "Number of subjects", lwd = 2, lty = 1, col = col) points(day, Infected) legend("right", c("Susceptibles", "Infecteds", "Recovereds"), lty = 1, lwd = 2, col = col, inset = 0.05) R0 <- N * Opt_par[1] / Opt_par[2] names(R0) <- "R0" R0 ## R0 ## 0 I also tried fitting with GAs (as in the paper), also to no avail. My question Am I making any mistakes or is there just not enough data yet? Or is the SIR model too simple? I would appreciate suggestions on how to change the code so that I get some sensible numbers out of it. Addendum I wrote a blog post based on the final model and current data: Epidemiology: How contagious is Novel Coronavirus (2019-nCoV)? | virus |
I have been hearing a lot of people say that it is recommended to wash your hands thoroughly in order to maximise protection against COVID-19 infection. I also heard that the washing hands rumours are just a way to make people believe that they are protecting themselves and that the washing hands thing is actually not backed up by real data. Question: Is washing hands really that useful? And if yes, is there any data backed up to defend this? The reason i'm asking this is because an expert in this field said that the "data is very week behind this" and "it's not going to have a big impact on preventing infection" (https://www.youtube.com/watch?v=E3URhJx0NSw) 43:32 and that the data behind the virus being infected through the eyes is very sparse (https://www.youtube.com/watch?v=E3URhJx0NSw) 44:00 | virus |
I have a train travel booked through Germany, Switzerland and Italy. All three legs of the travel are booked through bahn.de, and the Germany into Switzerland leg I can find back on the system of that site. I have asked a question and they will (or at least should) get back to me on that. The other two legs, (one from Basel to Milan, the other from Milan to Naples,) are booked by bahn.de on Trenitalia, and the German site does not recognize the PNR number for the booking. In most cases I would not bother to try to cancel/get a refund as they are super economy tickets which do not allow refunds, but with the health situation in Northern Italy, I want to try to get a partial or full refund, (just like I would get from the airlines if they have to cancel flight.) I hope someone is able to tell me how to ask for the (partial) refund or whether it is better to wait till almost the day of travel. The date on the ticket is 18th of March, 2020. | would |
Why are vaccines required for our body's immune system to destroy viruses that cause the likes of Covid-19 or Polio, while viruses that cause the common-cold are self-limiting (go away on their own)? What is so different about viruses that cause diseases requiring vaccines? | virus |
During July 2019, I booked flight UA7938 for March 30 through United Airlines for my honeymoon. With everything involving Covid-19 happening, I'm trying to see if I can get a refund for the ticket or an extension on the ticket. My main issue is that I do not know who is responsible for a potential refund. United is the marketing airline and ANA is the operating airline. United is waiving change fees for flights booked prior to March, which I can apply to my ticket online, but I would have to travel before July 2020. I don't know what kind of travel I can do before July and I do not want my money to go to waste. On the other hand, ANA has been issuing refunds for all international flights booked prior to March. Do I follow United's policies or can I follow ANA's? Has anyone had luck with similar situations? | would |
The "Daily" NY Times podcast for 3/12/20 described two effective management schemes for handling the epidemic. Briefly: Chinese: Check everyone's temperature frequently on a massive scale. Track individuals with QR codes. Use a flow chart procedure to confirm or eliminate a COVID hypothesis, and put affected individuals in government quarantine as needed, separating confirmed cases within a family so as to minimize contagion within families. The flow chart procedure was describe as follows: screen for body temperature and cough. Eliminate bacterial infection and allergy as possible. Cat scan for pneumonia. Also an NPR report described an online support group led by a social worker that included quarantine graduates who gave descriptions of quarantine living conditions, including food, and gave advice about what to take along to quarantine. These services apparently helped people cope positively with fears of quarantine. South Korean: Extensive testing and thorough, meticulous exposure tracing. My question is, would it be possible to implement one or both of these in the United States (or Europe)? | virus |
There seems to be a bit of a conspiracy theory brewing over some data in the NCBI database, and I don't have the necessary knowledge to make sense of it. It basically goes like this: Go to NCBI BLAST Click on the big Protein BLAST button Enter AVP78033 in the main search box and click BLAST Click on the first result that shows a 100% match and click "See 5 more title(s)" in the first entry This shows that the search is a complete match for a Bat SARS-like coronavirus protein from a 2018 research paper, for Wuhan seafood market pneumonia virus (which the NCIS site indicates is an alias for 2019-nCoV), and for Bat coronavirus from 29 Jan 2020. My question is - why would a protein from Bat SARS-like coronavirus and 2019-nCoV be showing up as a perfect match for one another? Does this mean that 2019-nCoV might actually be a previously-discovered coronavirus that very recently started infecting humans? Or could it be that a recently collected sample from Wuhan was mis-identified as 2019-nCoV when it is actually the same coronavirus from the 2018 submission? Clicking around the links on that site seem to bring up dozens of similar but different pages that I don't have the knowledge to distinguish, but the Accession column from the search results described above contains a link to this page, which says that it is a provisional refseq and acknowledges that it is identical to the bat coronavirus: PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. The reference sequence is identical to QHD43418. Annotation was added using homology to SARSr-CoV NC_004718.3. Can somebody who actually understands these things please make sense of this? | virus |
I am from Bangladesh. I recently applied for a non-immigrant type visa for entering Thailand for WordCamp Asia 2020 event. However, the event was cancelled recently for coronavirus outbreak. Since my air ticket is non-refundable and hotel refund cost etc are too much, I thought why not to go there still and spend a week over there. However, I am confused for the immigration procedure since I have got a non-immigrant visa under ED category, so I may not be allowed to travel after the event was cancelled. So, do any one of you have similar experience and suggest me anything on this? | would |
(This is not about the coronavirus pandemic, which I understand is a different issue, but about the six countries that had already been maintaining border controls since related to migration and terrorism since 2016.) Could someone explain to me the legal basis of Germany, Austria, Denmark, Sweden, and Norway's extension of "temporary reintroduction of border control" declarations past the original 2-year deadline in November 2017? I'm trying to understand what the legal justification was for that, and I just keep getting more and more confused the more I read. Was the Commission's recommendation of September 2017 on extending the time frames adopted at some point? Or did they find some other loophole? I have found some media references to them "switching to France's strategy" (which I don't understand well either) or switching from Article 29 provisions to Article 25 provisions. But when I read the Schengen Borders Code, I can't find anything in Article 25 that I can manage to interpret as allowing unlimited extensions. I understand that there's an argument that what these five countries and France have been doing is indeed illegal, but I want to also understand what their own lawyers' argument would be for its legality. Thanks in advance! | would |
Disclaimer: My PhD supervisor, while not a bad person, is a bad mentor and has given me bad advice in the past. So discussing this with him isn't really productive. I have talked to other people in real life about this, and the opinion of this community would also be welcome. I'm set to finish my PhD in theoretical physics in September 2020. I applied to several postdocs, got three interviews, and in one I was rated among the top choices but, in the end, I didn't secure any position. I don't know how similar this is to the fields, but for context I'll explain how postdoc appointments work in (edit: high energy) theoretical physics. In my field, postdoc applications run in cycles. The majority have roughly the same application periods and deadlines (around November), most offers are made at the same time (early January following year) and they all start roughly at the same time (September). There's the occasional outlier, but that's the basic pattern. This means that it's more or less hopeless that I can continue looking for a position, ask professors, etc, for September 2020. If I wanted to stay in academia, I would need to look for a postdoc in the next cycle, starting September 2021. I am unsure how realistic it is for me to try again or if I should simply throw the towel and quit academia. First, there's the issue of staying one year academically idle (obviously not professionally idle, that would be insane). I could work on leftover projects from my PhD on my free time, but between finishing my PhD in September 2020 and the deadline for the next cycle on November 2020, that leaves very little time to do so. Second, how do I even explain the gap in my cover letter? If I flat out say I failed the previous application cycle, it's a guaranteed trip to the garbage can. Some people have recommended me just lying in vague terms, like I didn't pursue a postdoc immediately after completing my PhD due to "health concerns that have since been resolved". I'm unsure if this is a good idea... If anyone has any other advice regarding my situation besides these two concerns I've raised, that would be welcome too. Basically, I would like to stay in academia as a first preference, but I have no desire to bang my head against the wall against something that, at this point, might be very close to impossible. I don't have any preference for country to work in, so feel free to give country-specific advice. | would |
News about Romania's COVID-19-driven, reverse diaspora: Over 200,000 Romanians who worked abroad have returned to the country since the outbreak of the novel coronavirus, with many of them coming from those EU countries strongly affected by the pandemic, PM Ludovic Orban said on Friday [March 27]. “On February 25 there was only one case in Romania, two cases of coronavirus in Spain, and several others in France. Look at the number of cases in Romania, less over 1,000, and if we also take into the account the cured ones, we have below 1,000 patients with COVID-19, while there are tens of thousands of infections in other countries. Romania has taken serious measures from the start”, the premier stated. Besides, he underlined that Romania had another particularity as against the other countries, namely that over 200,000 Romanians from Diaspora returned to the homeland. “If we had not taken severe containment measures, be it quarantine or isolation, the spread would have been larger”, Orban added. How did Romania manage to quarantine 200,000 people returning from abroad (if I understand correctly that's what they did)? What specific enforcement measures did they take? | virus |
I'm planning a trip to the Netherlands mid-April, and I've already made reservations. I understand that because of the current coronavirus pandemic, I may have to postpone my trip or cancel it entirely. However, instead of deciding now, I'd like to decide later (in April) if I should continue with my trip plans or cancel it (depending on travel advisories issued by my country (India) and the Netherlands, which would apply at that time). Which requires that I proceed with my visa application now (as I must apply at least 15 working days earlier). I understand that it is quite likely that I may have to cancel or postpone my trip (the global travel situation seems unlikely to get better by next month, but I want to stay optimistic, or at least not regret that I could have applied for visa in March if situations in mid-April do get favourable for a trip). My concern is if the current coronavirus pandemic can be cited as a reason for visa refusal by the Netherlands embassy. I.e., does the current pandemic increase the likelihood of visa refusal when compared to normal circumstances? Are there any rules in visa policy of Schengen Area that concern with situations like this? UPDATE: To clarify, my concern here is if the current pandemic will increase the likelihood of visa refusal. (Whether or not I'll be able to travel to the Netherlands in April is a different issue). The reason I'm separating these two concerns is because with new EU visa rules, I may qualify for a long validity visa (as I've been issued multiple Schengen visas in past), so if in the unfortunate case I've to postpone my April trip, I can do so & re-plan on a much shorter notice. Whereas if I don't apply for a visa now and do so later, I'll have to plan for weeks in advance again (as I must apply for a visa 15 working days / 3 weeks in advance). UPDATE: If the Netherlands issues a travel restriction in near future, will that result in a visa refusal or application rejection? | would |
Due to the outbreak of nCoV-19 (Novel Coronavirus) many Countries have imposed several entry restrictions. But these are quite confusing for a lot of people. Some countries allow transit through parts of China (like Shanghai) but some restrict transit even through Hong Kong/Macau. Philippines restricted passengers coming from Taiwan too, but I think that that was later changed. Where can one find a list of such restrictions for all the countries, ideally a source that is updated frequently | virus |
In the last couple of days, WHO officials have criticised the UK government's approach to the COVID-19 pandemic, describing the government's reliance on developing herd-immunity amongst the British population, and apparent reluctance to put in place quarantines as "ridiculous". China has also been criticised for its initial response to the virus, which the Financial Times describes as a "cover-up", and which US national security advisor Robert O'Brien says "cost the world community two months" in terms of preparation for the disease. This would appear to be in breach of the International Health Regulations (2005), Article 6 of which states that: Each State Party shall notify WHO, by the most efficient means of communication available, by way of the National IHR Focal Point, and within 24 hours of assessment of public health information, of all events which may constitute a public health emergency of international concern within its territory Given the criticisms above, does the World Health Organization have any powers to either enforce health recommendations such as quarantines or lockdowns, powers to punish or sanction countries that refuse to comply with said health recommendations, or powers to punish countries that breach their obligations under the IHR? I have been able to find this article which describes a panel which investigated this in the wake of the ebola crisis, but I can't find more information about the results of this investigation. | virus |
Currently there are talks of issuing a $1000 payout to all American citizens earning less than $130,000. Presuming the final number of recepients is 200 million people, this is equivalent to injecting 200 billion dollars into the economy out of thin air. But of course money cannot be artificially increased without causing inflation, as demonstrated by the extreme example of Zimbabwe in the last decade. So how much value could the US dollar be expected to lose if the plan goes ahead? | would |
Central Banks around the world have cut interest rates in the past few days in response to the COVID-19 pandemic, including the US Federal Reserve (0-0.25%), the Bank of England (0.1%), and the Reserve Bank of Australia (0.25%). Notably, the European Central Bank has not yet cut interest rates further, but this is partly because it is already in the negatives, at -0.5%. Why are central banks taking this measure in response to this pandemic in particular - i.e. how does this measure lessen the pandemic's economic impact - and what are the impacts on the average consumer of a cut in their country's central bank interest rate in general? | virus |
According to this article, chloroquine and hydroxychloroquine could be effective treatments for Covid-19. Assuming the drugs are well tolerated in clinical trials and seem effective at treating COVID-19, the FDA will take measures to increase the nation's supply, according to Hahn. Assuming best case scenario, when could these drugs be made widely available to treat the disease? By "when," I mean how long is it likely to take? | virus |
im new in data sience and machine learning but i have some mathematical and statistics backgroud. I really just want some information about models (like papers or raw models). So if you have any information please share them with me. thank you | would |
Two academic hospitals in The Netherlands (Nijmegen and Utrecht) just got approval to experiment with using a tuberculosis vaccine (BCG) to try to better protect hospital workers against coronavirus. I assume that "protect hospital workers" means something like decreasing the severity of the infection. Apparently the BCG vaccine is known to stimulate the immune system. Given that information, how exactly will it "protect hospital workers"? With or without BCG vaccine, the immune system does not yet have the antibodies against the SARS-CoV-2 (2019-nCoV) coronavirus. So, will the immune system, after BCG vaccination, create more or better antibodies or generate them faster? https://www.dutchnews.nl/news/2020/03/will-tb-vaccine-help-healthcare-workers-fight-corona-dutch-hospitals-experiment/ | virus |
I was waiting with bated breath for the CDC update on cases of COVID-19 in the U.S. by date of onset. To my eyes this looks like absolutely wonderful news - that it means that the exponential growth of the virus has been "flattened" - but I'm still afraid I may be misinterpreting what I see. It bothers me that the headline for the graph hasn't changed. But it APPEARS that the number of new cases stopped increasing after 3/3. Am I missing something? Top: before noon on 3/16, bottom: after noon on 3/16. Data from https://www.cdc.gov/coronavirus/2019-ncov/cases-in-us.html Note: In today's update (the first in three days) the CDC page shows the number of cases with onset on 3/4 to be 159, and 3/9 is 307. This doubled in five days rather than every two or three as other numbers would suggest, but given the dramatic changes in this curve, and their overall direction, I think the top answer below has been vindicated. | virus |
My prefix means to work together, and when written in full words, it means something almost rectangular. My infix is neves semit thgie semit enin in Italy, and when written in full words, it means something usually rectangular. My suffix is indivisible, and when written in full words, it can end its own suffix. My whole, despite not being Phileas Fogg, unfortunately managed to travel the whole world in less than 80 days (but it's rarely written in full words). (Note: The question can be a bit inappropriate, apologies to those who feels offended.) | would |
Coronavirus, HIV, 1918 Flu, etc. They all come from animals. Do any infectious diseases (in humans) come from plants? More specifically, are there viruses that infect plants that can mutate to infect humans? | virus |
As education moves to the internet, so are research seminars. Some of these seminars are regular and others appear to be temporary due to the covid-19 and the lockdown. Here are some examples from the American Economic Association Regular seminar(s) The Chamberlain Seminar - A regular open online international inter-institutional econometrics seminar in honor of Gary Chamberlain (1948–2020) Temporary Seminars Virtual Macro Seminar Series Online Seminar in Gender Economics Virtual IO seminar ... And also, Princeton Webinar Series on COVID Economics Beyond the AEA list and the Princeton webseminar, I am looking for links to find conferences, workshops, and talks hosted by economic research institutions from all over the world. One requirement is that registration be open to all, as some of the online seminars are reserved for faculty only. Update Virtual Economics stores various online seminars with a super useful calendar. | would |
I'm finding it hard to grasp the current status of the $2 trillion stimulus bill because news about the approval process frequently seem to contradict each other. As far as I'm aware, Bernie Sanders has threatened to stop the bill after Senate had already approved it. How would this be possible? What is the bill's current status and which further steps are necessary to begin the payouts? | would |
Disclaimer: I am a scientist, but this is not my main field so sorry if I've not used the correct terminology at this busy time... Since the coronavirus protein bonds with and gains entry to the cell by bonding to ACE2 receptor, does anyone happen to be currently working upon inhibition of the ACE2 receptor? Obviously it's not straight forward just to use an inhibitor of some sort without accounting for side effects, but is this form of therapy a potentially practical avenue? I anticipate that this relationship with ACE2 is why we get pneumonia with COVID19 since ACE2 is abundant in the lungs, heart and kidneys... And that perhaps it's why people with cardiovascular disease and problems have the highest mortality? From my understanding, there would be potential cardiac and renal issues. Possibly the negative effects of inhibitors may be reduced or managed by IV infusion of angiotensin 1-7, or supporting drugs (I.e. a vasodilator) as ACE2 won't be able to work on converting angiotensin 2? To anyone whom is working in this area specifically, what I am really asking is, is this a viable avenue to consider, as a management strategy to reduce spread of the virus in-vivo? The infection route and effects make me wonder how many people that recover from COVID19 may unfortunately suffer later cardiological or renal issues due to damage in ACE2 expression within the lungs... And not just lung damage from the virus or resulting pneumonia. (I.e fibrosis of cardiac tissues, etc) I've found this: https://www.hindawi.com/journals/ijpep/2012/256294/ Which seems to suggest that it has been studied to an extent in animals, but find limited information. *** Note I'm talking about ACE2 inhibition not ACE inhibitors that are often used in heart failure | virus |
I'm looking at a genome sequence for 2019-nCoV on NCBI. The FASTA sequence looks like this: >MN988713.1 Wuhan seafood market pneumonia virus isolate 2019-nCoV/USA-IL1/2020, complete genome ATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCTGTTCTCTAAA CGAACTTTAAAATCTGTGTGGCTGTCACTCGGCTGCATGCTTAGTGCACTCACGCAGTATAATTAATAAC TAATTACTGTCGTTGACAGGACACGAGTAACTCGTCTATCTTCTGCAGGCTGCTTACGGTTTCGTCCGTG ... ... TTAATCAGTGTGTAACATTAGGGAGGACTTGAAAGAGCCACCACATTTTCACCGAGGCCACGCGGAGTAC GATCGAGTGTACAGTGAACAATGCTAGGGAGAGCTGCCTATATGGAAGAGCCCTAATGTGTAAAATTAAT TTTAGTAGTGCTATCCCCATGTGATTTTAATAGCTTCTTAGGAGAATGACAAAAAAAAAAAA Coronavirus is an RNA virus, so I was expecting the sequence to consist of AUGC characters. But the letters here are ATGC, which looks like DNA! I found a possible answer, that this is the sequence of a "complementary DNA". I read that The term cDNA is also used, typically in a bioinformatics context, to refer to an mRNA transcript's sequence, expressed as DNA bases (GCAT) rather than RNA bases (GCAU). However, I don't believe this theory that I'm looking at a cDNA. If this were true, the end of the true mRNA sequence would be ...UCUUACUGUUUUUUUUUUUU, or a "poly(U)" tail. But I believe the coronavirus has a poly(A) tail. I also found that the start of all highlighted genes begin with the sequence ATG. This is the DNA equivalent of the RNA start codon AUG. So, I believe what I'm looking at is the true mRNA, in 5'→3' direction, but with all U converted to T. So, is this really what I'm looking at? Is this some formatting/representation issue? Or does 2019-nCoV really contain DNA, rather than RNA? | virus |
I used a Log-Likelihood Estimation (Poisson) Objective Function to estimate and fit a curve to a data of reported infected cases of COVID-19 using SEIR model in order to estimate its coefficients. How can I calculate the 95% confidence intervals for these estimated coefficients? Thank you | virus |
I'm an undergraduate in the US. My professor just told us via email that he will not be able to grade an exam until next week because his family member died from complications due to COVID-19. I don't care much about the delay, but I do like my professor, both as a person and an educator. Would it be out of line for me to send an email along the lines of "Hi professor, I'm sorry to hear your loved one passed." I'm not a very socially outgoing person and I don't speak up in class much, so I don't know if this would overstep the student-professor relationship. | would |
As specified in this link, COVID-19 tests start with taking samples from the nose or back or throat of people. Based on growth rate of this disease, I thought what if those samples are not positive (showing infection with COVID-19), but that person has that virus in other parts of his body, because he's in the early stages of the infection. So is it possible to be infected with COVID-19 and have no virus in nose and throat, and if it's possible, how long would it take to be certain that a sample shows the reality and a negative answer can be trusted? | virus |
My indoor cat has a (rotating) variety of toys, things to climb on and scratch, and places to run around; I'm not concerned about him getting enough physical stimulation. But I've heard that cats also need mental stimulation. How do I best provide that, both when I'm playing with him and when he's alone in the house? I know that there are "puzzle toys" that reward solving the puzzle by dispensing kibble or treats, but I'd rather not have that happening all over the house (especially where any missed kibbles could be ground into rugs). What other options do I have for exercising his mind as well as his body? The cat is probably 12 or 13 years old. Getting another cat isn't an option right now because of disease-transmission concerns. Other than being a carrier for something I'd rather not spread (coronavirus), my cat is healthy. | would |
The protease inhibitor lopinavir, originally developed as a cure against AIDS and HIV, has been shown efficient against SARS Coronavirus SARS-CoV. Dayer M R, Taleb-Gassabi S, Dayer M S. Lopinavir; A Potent Drug against Coronavirus Infection: Insight from Molecular Docking Study, Arch Clin Infect Dis. 2017 ; 12(4):e13823. doi: 10.5812/archcid.13823. Why is Lopinavir not efficient against SARS-CoV-2? Is there a difference in the gene encoding for the protease? | virus |
Because ACE2 is used by SARS-NCoV-2 to enter the cell, I am curious what factors determine its expression. Interestingly, myocardial infarction increases ACE2 expression in the heart in an animal model ( https://www.ncbi.nlm.nih.gov/pubmed/15671045 ). The paper found no significant effect from ramipril, an ACE inhibitor, but I don't think I can assume ARBs would work the same way. (I am suspicious they might increase it based on the increase in the product Ang(1-7) level - https://www.nature.com/articles/hr200974 ) Note that soluble sACE2 can bind cells that did not produce it, by an RGD independent association with integrin beta 1. Anything that influences the amount of ACE2 on cell surfaces is a useful answer. | virus |
I assumed a virus to be something with a very specific geometry, similar to a crystal, but more complex. In an answer to What is the size (diameter) of the SARS-CoV-2 virus? some SARS-CoV-2 virus particles are shown. It looks like they do not have the same geometry. They may be soft and influenced by external forces, but they could also be of different, but similar shape. Also, they could simply be defective in some way. I assume a structure of the size of a virus is not rigid. Assuming no external forces, would multiple exemplars of the same kind of virus have the same shape? Can a virus have a different molecular arrangement, but be equivalent for biological purposes? | virus |
We have one two year old Persian cat with some kidney problems. We live in Iran, which these days is not a good place relative to potential coronavirus outbreaks because of the government not giving true information about i. We think we will get the virus some time in the future. In this condition we would like to know, if we did contract the coronavirus, how can we protect our cat from our infection? If we become unable to protect ourselves, I don't know how could take care of him and who would accept him. I think he must trained to survive in nature, could I train him at this during his time period? If yes, how? | virus |
Quote: We found 4 insertions in the spike glycoprotein (S) which are unique to the 2019-nCoV and are not present in other coronaviruses. Importantly, amino acid residues in all the 4 inserts have identity or similarity to those in the HIV-1 gp120 or HIV-1 Gag. Interestingly, despite the inserts being discontinuous on the primary amino acid sequence, 3D-modelling of the 2019-nCoV suggests that they converge to constitute the receptor binding site. The finding of 4 unique inserts in the 2019-nCoV, all of which have identity/similarity to amino acid residues in key structural proteins of HIV-1 is unlikely to be fortuitous in nature. Source: https://www.biorxiv.org/content/10.1101/2020.01.30.927871v1 I know this is a preprint paper and it's not yet peer reviewed, but can someone tell me what the implications are if this is true? Does this mean that the virus is artificially constructed? | virus |
Some news reports suggested Czech Republic stopped issuing visa to Chinese citizens/nationals and closed visa centres in China after the outbreak of the novel coronavirus. The latter is of course understandable. But are all Chinese nationals, regardless of travel history/place of residence, affected by this? https://news.expats.cz/weekly-czech-news/the-czech-republic-has-stopped-issuing-visas-to-chinese-citizens-over-coronavirus-fears/ https://www.radio.cz/en/section/news/coronavirus-czechs-suspend-visas-for-chinese-citizens-flight-ban-considered | virus |
Suppose I get infected by covid-19. I am a healthy person but with weight issues, according to the standard weight tables. Can my immune system cure me by itself? That is, without the need of medications or drugs? and by only resting and eating healthy? I have read this page https://www.healthline.com/health/coronavirus-treatment#when-to-seek-care If you’re young and healthy with only mild symptoms, your doctor will likely advise you to isolate yourself at home and to limit contact with others in your household. You’ll likely be advised to rest, stay well hydrated, and to closely monitor your symptoms. then it says If your symptoms worsen with home care, it’s important to get prompt medical care. Here, Why could symptoms worsen? | virus |
Is it possible to extend the 14-day visa free entry in Vietnam? I have a Swedish passport, so I can enter Vietnam for 14 days without a visa. Is it possible to extend that for another 14 days or less somewhere near Saigon? Or at all? | would |
End of preview. Expand
in Dataset Viewer.
README.md exists but content is empty.
Use the Edit dataset card button to edit it.
- Downloads last month
- 2