Datasets:

ManuelAlv

/

Cancer

like 0

"decreased expression of Hsp70 caused by ibuprofen amplified the activation of caspase-9 significantly compared with that of Bax. Furthermore the similar increase in the activation of cisplatin-dependent Bax and release of cytochrome c by ibuprofen suggests that Hsp70 also inhibits the post mitochondrial steps between the release of cytochrome c and the activation of caspase-9. If Hsp70 were acting downstream of the mitochondria one would predict that it interferes with the activation of caspase-9 in response to cytochrome c either by inhibiting the formation of the apoptosome or by preventing the binding of pro-caspase-9 to this complex. When we studied the effects of Hsp70 on the formation of and recruitment of pro-caspase-9 to the apoptosome the cell lysates were immunoprecipitated although Hsp70 failed to migrate with Apaf-1 cytochrome c or caspase-9 (data not shown). These results may be supported by previous report that no association between Hsp70 and Apaf-1 or apoptosome complex was observed even under in vitro activation of caspase by the addition of cytochrome c and dATP.44 Furthermore we were unable to identify a new target for Hsp70 in the process of caspase-9 activation indicating that its inhibitory activity is attributable to another indirect effect instead of a direct one as previously reported. Altogether the data presented here are the first evidence of cell death inhibition by Hsp70 by its targeting of both upstream and downstream mitochondrial processes while the precise mechanisms by which it interferes with the activation of caspase-9 remains to be clarified. In ibuprofen potentiated the antitumoural properties of cisplatin in the cells of lung adenocarcinoma via a mechanism of action mediated by the suppression of Hsp70. These findings may promote the development of a new strategy to increase the effectiveness of cisplatin in the treatment of NSCLCs as well as highlight the putative merits of developing anticancer treatments targeting Hsp70. Materials and Methods Materials The mouse monoclonal anti-Hsp70 the rat monoclonal anti-Hsc70 and rabbit polyclonal HSF-1 antibodies purchased from Stressgen “ Enzo Life Sciences Inc. Plymouth Meeting PA USA. Anti-Bax rabbit polyclonal (N-20) and anti-VDAC-1 goat polyclonal (N-18) antibodies were purchased from Santa Cruz Biotechnology Inc. Santa Cruz CA USA. Anti-cytochrome c mouse monoclonal antibody (556433) was obtained from BD Pharmingen Inc. San Diego CA USA. Anti-caspase 9 and -ERK antibodies were acquired from Cell Signaling Technology Inc. Danvers MA USA. The mouse monoclonal antibody against actin was obtained from Chemicon International Inc. Temecula CA USA. Anti-Bax 6A7 monoclonal antibody and other reagents were purchased from Sigma-Aldrich St. Louis MO USA. Cell culture and viability assay A549 and H358 lung cancer cell lines were cultured in Dulbecco's modified Eagle's medium containing 10% foetal bovine serum at 37?°C. BEAS-2B cells were grown in bronchial epithelial basal medium. All NSAID and cisplatin were dissolved in dimethyl sulphoxide and added to the medium at indicated concentrations. The activity of mitochondrial dehydrogenase 3-(45-dimethylthiazol-2-yl)-25-diphenyltetrazolium bromide (MTT) assay was used to measure cell death/survival. The reaction product was measured at A570 and the relative viability of cells treated with reagents versus untreated cells was calculated. TUNEL staining The TUNEL assay was performed using an in situ cell death detection kit (F Hoffmann-La Roche Basel Switzerland) according to the manufacturer's instructions. The ratio of TUNEL-positive cells to the total number of cells was calculated. Immunoprecipitation and cell fractionation A549 cells were lysed in RIPA buffer (50?mM Tris-HCl pH 7.5 150?mM NaCl 1?mM sodium orthovanadate 1?mM EDTA 0.1% NP-40 10?mM NaF) containing the Calbiochem Protease Inhibitor Cocktail Set III (Merck KGaA Darmstadt Germany). The cell lysates and immunoprecipitates were resolved in Laemmli sample buffer. The samples underwent sodium dodecyl sulphate-polyacrylamide gel electrophoresis were transferred to a polyvinylidene difluoride membrane reacted with the respective antibodies and detected with an ECL chemiluminescence detection kit (GE Healthcare Fairfield CT USA). For the immunoprecipitation the cell lysates were incubated with the indicated antibodies for 1?h at 4?°C. Protein G-sepharose beads were added to collect the immunocomplexes for an additional 1?h of incubation. The pellets were washed three times with lysis buffer. The mitochondria and cytosol fractions were prepared as described previously.45 Chromatin immunoprecipitation (ChIP) assay ChIP assays were performed as described previously46 using an EZ ChIP kit (Upstate Biotechnology Inc. Waltham MA USA). Briefly after adding formaldehyde A549 cells were suspended in SDS lysis buffer and the chromatin DNA was disrupted by sonication. For the immunoprecipitation the lysate was incubated with anti-HSF-1 antibody followed by immobilization on salmon sperm DNA/Protein G agarose. The protein/DNA complexes extracted with elution buffer were heated to 65?°C for 6?h to reverse cross-links then digested with proteinase K. DNA fragments were amplified in PCR with the ChIP assay primers containing the heat shock element sites in human Hsp70 promoter. PCR primers for the ChIP assay were as follows: Hsp70 (?103/+7) (F) 5?-TGATTGGTCCAAGGAAGGCT-3? and (R) 5?-AAAAAGGTAGTGGACTGTCGC-3?. Reverse transcriptase-PCR RT-PCR was carried out using a Qiagen (Valencia CA USA) One-Step RT-PCR Kit. We used the following primer pairs to amplify. Hsp70 (F) 5?-ATGAAGCACTGGCCTTTCCA-3? (R) 5?-TTGTTCTGGCTGATGTCCTT-3? Hsc70 (F) 5?-TGGAACTATTGCTGGTCTCAA3? (R) 5?-AGAACCACCAACCAGGACAAT-3? HSF-1 (F) 5?-TTCGACCAGGGCCAGTTT-3? (R) 5?-AGAGCTGGCCACAGCATCA-3? actin (F) 5?-AGAGGCATCCTCACCCTGA-3? (R) 5?-CATCTCTTGCTCGAAGTCCA-3?. The products were examined by agarose gel electrophoresis after 23 cycles. RNA interference The sequences of the sense strands used to generate specific siRNA were obtained as follows: HSF-1 5?-AAGTACTTCAAGCACAACAA-3? 5?-AAGAGTGAAGACATAAAGAT-3? 5?-AAGTCGTCAACAAGCTCATT-3?. The siRNAs were synthesized using the Silencer siRNA construction kit (Ambion; Applied Biosystems Inc. Carlsbad CA USA). Double-stranded Hsp70 and control siRNA duplex were synthesized as followed by Qiagen: Hsp70-specific sequence 5?-CCAUUGAGGAGGUAGAUUAdTdT-3?. A549 cells were transfected with each siRNA (10?nmol/l) using the Lipofectamine 2000 (Invitrogen; Applied Biosystems Inc.) and grown for 72?h to allow an effective decrease in the expression of the respective target molecules. Quantification of apoptosis by flow cytometry A549 cells were washed with Annexin V staining buffer (10?mM HEPES pH 7.4 150?mM NaCl 5?mM KCl 1?mM MgCl2 1.8?mM CaCl2) and incubated with CF488A-Annexin V and propidium iodide (Biotium Inc. Hayward CA USA) in staining buffer for 30?min at 37?°C in the dark. Fluorescence was measured using a FACSCalibur (BD Biosciences San Jose CA USA) and the data were analyzed with CellQuest software (BD Biosciences). JC-1 staining and quantification A549 cells were cultured at 37?°C for 48?h on glass chamber slides and treated with ibuprofen and cisplatin at the specified concentrations for 48?h. Mitochondrial permeability transition was determined by staining the cells with 55?66?-tetrachloro-1133?-tetraethyl- benzimidazolylcarbocyanin iodide (JC-1; Molecular Probes Invitrogen Carlsbad CA USA) in the dark. The cells were subsequently washed with assay buffer according to the manufacturer's protocol and immediately imaged using a fluorescence microscope (Keyence Corporation Osaka Japan) with the red (?excitation: 560±40?nm band pass filter ?detection: 630±60?nm band pass filter) and green (?excitation: 470±40?nm band pass filter ?detection: 535±50?nm band pass filter) fluorescence channels. Flow cytometric analysis was assayed with the JC-1 Mitochondrial Membrane Potential Kit (AAT Bioquest Sunnyvale CA USA) according to the manufacturer's directions using a FACSCalibur and the results were analyzed by CellQuest software. In vitro casapse-9 activity determination Caspase-9 activity was measured by a fluorometric assay in whole-cell lysates using Ac-Leu-Glu-His-Asp-MCA substrate (Peptide International Inc. Louisville KY USA). A549 cell extracts were mixed with Ac-LEHD-MCA in ICE standard buffer (100?mM HEPES pH 7.5 10% sucrose 0.1% CHAPS 10?mM DTT 1?mM PMSF) and cleavage of the fluorogenic peptide substrate was monitored at 37?°C for 30?min by a SPECTRA max GEMINI EM (Molecular Device Sunnyvale CA USA) fluorometer with excitation at 370?nm and emission at 460?nm. This work was supported in part by a Grant-in-Aid (23591477) from the Ministry of Education Culture Sports Science and Technology of Japan. Apaf-1 apoptotic protease-activating factor 1 COX cyclooxygenase HSF-1 heat shock factor 1 MTT 3-(45-dimethylthiazol-2-yl)-25-diphenyltetrazolium bromide NSAID nonsteroidal anti-inflammatory drug NSCLC non-small cell lung cancer PCR polymerase chain reaction RNAi RNA interference RT reverse transcriptase TUNEL terminal deoxynucleotidyl transferase-mediated dUTP nick and labelling Edited by G Raschellà The authors declare no conflict of interest. Tavaria M Gabriele T Kola I Anderson RL A hitchhiker's guide to the human Hsp70 family Cell Stress Chaperones 1996 1 23 28 9222585 Jaattela M Escaping cell death: survival proteins in cancer Exp Cell Res 1999 248 30 43 10094811 Aghdassi A Phillips P Dudeja V Dhaulakhandi D Sharif R Dawra R Heat shock protein 70 increases tumorigenicity and inhibits apoptosis in pancreas adenocarcinoma Cancer Res 2007 67 616 625 17234771 Ciocca DR Clark GM Tandon AK Fuqua SA Welch WJ McGuire WL Heat shock protein hsp70 in patients with axillary lymph node-negative breast cancer J Natl Cancer Inst 1993 85 570 574 8455204 Cornford PA Dodson AR Parsons KF Desmond AD Woolfenden A Fordham M Heat shock protein expression independently predicts clinical outcome in prostate cancer Cancer Res 2000 60 7099 7105 11156417 Vargas-Roig LM Gago FE Tello O Aznar JC Ciocca DR Heat shock protein expression and drug resistance in breast cancer patients treated with induction chemotherapy Int J Cancer 1998 79 468 475 9761114 Igney FH Krammer PH Death and anti-death: tumor resistance to apoptosis Nat Rev Cancer 2002 2 277 288 12001989 Gabai VL Meriin AB Mosser DD Caron AW Rits S Shifrin VI Hsp70 prevents activation of stress kinases. A novel pathway of cellular thermotolerance J Biol Chem 1997 272 18033 18037 9218432 Meriin AB Yaglom JA Gabai VL Zon L Ganiatsas S Mosser DD Protein-damaging stresses active c-Jun N-terminal kinase via inhibition of its dephosphorylation: a novel pathway controlled by Hsp72 Mol Cell Biol 1999 19 2547 2555 10082520 Park HS Cho SG Kim GK Hwang HS Noh KT Kim MS Heat shock protein hsp72 is a negative regulator of apoptosis signal-regulating kinase 1 Mol Cell Biol 2002 22 7721 7730 12391142 Mosser DD Morimoto RI Molecular chaperones and the stress of oncogenesis Oncogene 2004 23 2907 2918 15077153 Beere HM Wolf BB Cain K Mosser DD Mahboubi A Kuwana T Heat-shock protein 70 inhibits apoptosis by preventing recruitment of procaspase-9 to the Apaf-1 apoptosome Nat Cell Biol 2000 2 469 475 10934466 Saleh A Srinivasula SM Balkir L Robbins PD Alnemri ES Negative regulation of the Apaf-1 apoptosome by Hsp70 Nat Cell Biol 2000 2 476 483 10934467 Zermati Y Garrido C Amsellem S Fishelson S Bouscary D Valensi F Caspase activation is required for terminal erythroid differentiation J Exp Med 2001 193 247 254 11208865 Schmitt E Gehrmann M Brunet M Multhoff G Garrido C Intracellular and extracellular functions of heat shock proteins: repercussions in cancer therapy J Leu Biol 2007 81 15 27 Gotoh T Terada K Oyadomari S Mori M Hsp70-DnaJ chaperone pair prevents nitric oxide- and CHOP-induced apoptosis by inhibiting translocation of Bax to mitochondria Cell Death Differ 2004 11 390 402 14752510 Stankiewicz AR Lachapelle G Foo CZ Radicioni SM Mosser DD Hsp70 inhibits heat-induced apoptosis upstream of mitochondria by preventing Bax translocation J Biol Chem 2005 280 38729 38739 16172114 Hosokawa N Hirayoshi K Nakai A Hosokawa Y Marui N Yoshida M Flavonoids inhibit the expression of heat shock proteins Cell Struct Funct 1990 15 393 401 2085852 Yokota S Kitahara M Nagata K Benzylidene lactam compound KNK437 a novel inhibitor of acquisition of thermotolerance and heat shock protein induction in human colon carcinoma cells Cancer Res 2000 60 2942 2948 10850441 Westerheide SD Kawahara TL Orton K Morimoto RI Triptolide an inhibitor of the human heat shock response that enhances stress-induced cell death J Biol Chem 2006 281 9616 9622 16469748 Aghdassi A Phillips P Dudeja V Dhaulakhandi D Sharif R Dawra R Heat shock protein 70 increases tumorigenicity and inhibits apoptosis in pancreatic adenocarcinoma Cancer Res 2007 67 616 625 17234771 Phillips PA Dudeja V McCarroll JA Borja-Cacho D Dawra RK Grizzle WE Triptolide induces pancreatic cancer cell death via inhibition of heat shock protein 70 Cancer Res 2007 67 9407 9416 17909050 Giardiello FM Offerhaus GJ DuBois RN The role of nonsteroidal anti-inflammatory drugs in colorectal cancer prevention Eur J Cancer 1995 31A 1071 1076 7576994 Thun MJ Henley SJ Patrono C Nonsteroidal anti-inflammatory drugs as anticancer agents: mechanistic pharmacologic and clinical issues J Natl Cancer Inst 2002 94 252 266 11854387 Smalley WE DuBois RN Colorectal cancer and nonsteroidal anti-inflammatory drugs Adv Pharmacol 1997 39 1 20 9160111 Shiff SJ Koutsos MI Qiao L Rigas B Nonsteroidal antiinflammatory drugs inhibit the proliferation of colon adenocarcinoma cells: effects on cell cycle and apoptosis Exp Cell Res 1996 222 179 188 8549662 Klampfer L Cammenga J Wisniewski HG Nimer SD Sodium salicylate activates caspases and induces apoptosis of myeloid leukemia cell lines Blood 1999 93 2386 2394 10090950 Shiff SJ Oiao L Tsai LL Rigas B Sulindac sulfide an aspirin-like compound inhibits proliferation causes cell cycle quiescence and induces apoptosis in HT-29 colon adenocarcinoma cells J Clin Invest 1995 96 491 503 7615821 Yao M Zhou W Sangha S Albert A Chang AJ Liu TC Effect of nonselective cyclooxygenase inhibition with low-dose ibuprofen on tumor growth angiogenesis metastasis and survival in a mouse model of colorectal cancer Clin Cancer Res 2005 11 1618 1628 15746067 Zhang L Yu J Park BH Kinzler KW Vogelstein B Role of BAX in the apoptotic response to anticancer agents Science 2000 290 989 992 11062132 Liou JY Ghelani D Yeh S Wu KK Nonsteroidal anti-inflammatory drugs induce colorectal cancer cell apoptosis by suppressing 14-3-3? Cancer Res 2007 67 3185 3191 17409426 Siddik ZH Cisplatin: mode of cytotoxic action and molecular basis of resistance Oncogene 2003 22 7265 7279 14576837 Cho HJ Kim JK Kim KD Yoon HK Cho MY Park YP Upregulation of Bcl2 is associated with cisplatin-resistance via inhibition of Bax translocation in human bladder cancer cells Cancer Lett 2006 237 56 66 16009487 Bonay M Soler P Riquet M Battesti JP Hance AJ Tazi A Expression of heat shock proteins in human lung and lung cancers A"

Lung_Cancer

"A decrease in Hsp70 by RNAi promoted cisplatin-dependent activation of Bax. A549 cells treated with Hsp70 or control siRNA were incubated in presence or absence of cisplatin; each cell extract was immunoprecipitated with an anti-active Bax antibody followed by immunoblotting with anti-Bax antibody. The data are representative of three separate experiments Synergistic effect of Hsp70 suppression on the cisplatin-mediated activation of caspase-9. (a) A549 cells were treated with cisplatin and/or ibuprofen and cell extracts were immunoblotted with active caspase-9 antibody. The lower panel shows the measurement of each caspase-9. (b) A549 cells exposed to siRNA targeting Hsp70 or control siRNA were incubated with or without cisplatin and the active caspase-9 was detected by western blot using an anti-caspase-9 antibody. The quantity of each protein was estimated by densitometric analysis (lower panels). (c and d). Assay for enzymatic activity of caspase-9 using a fluorogenic substrate. (c) After the incubation of the A549 cells with cisplatin (10??M) and/or ibuprofen (400??M) the caspase-9 activity of each cell extract was measured as described in Materials and methods section. (d) A549 cells transfected with Hsp70 siRNA or control siRNA were exposed to cisplatin for 48?h. The caspase-9 activity was then assessed using an enzymatic assay as described earlier. The value of caspase-9 activity was presented relative to the activity in untreated cells set at 1.0. The data represent mean values of three separate experiments. Significances were determined by Student's t-test (*P<0.05) Effects of nonsteroidal anti-inflammatory drugs on the expression of Hsp70 in A549 cells NSAIDs Hsp70 expression (%) Ibuprofen (400??M) 22.7±2.8 Aspirin (2500??M) 95.1±7.8 Diclofenac (200??M) 97.2±5.6 Sulindac (15??M) 98.9±2.9 Piroxicam (60??M) 96.6±6.2 Indometacin (10??M) 95.0±15.1 Mefenamic acid (25??M) 100.5±6.0 Values are shown as means±S.D. The expression of Hsp70 was measured by immunoblotting with an anti-Hsp70 antibody. The quantity of Hsp70 protein was estimated by densitometric analysis using Scion Image. The values in parentheses are the highest non-toxic concentrations (approximately 90% viability) used for each NSAID on the A549 cells for 48?h Effects of nonsteroidal anti-inflammatory drugs on the expression of HSF-1 in A549 cells NSAIDs HSF-1 expression (%) Ibuprofen (400??M) 16.2±3.9 Aspirin (2500??M) 93.5±2.9 Diclofenac (200??M) 96.7±6.6 Sulindac (15??M) 99.8±3.6 Piroxicam (60??M) 96.3±4.7 Indometacin (10??M) 98.1±1.6 Mefenamic acid (25??M) 98.5±1.1 Values are shown as means±S.D. The expression of HSF-1 was measured by immunoblotting with anti-HSF-1 antibody. The quantity of HSF-1 protein was estimated by densitometric analysis using Scion Image. The values in parentheses are the highest non-toxic concentrations (approximately 90% viability) used for each of the NSAID on the A549 cells for 48?h PLoS One one 1932-6203 Public Library of Science San Francisco USA 24505298 3914822 PONE-D-13-39952 .0087629 Research Biology Population Biology Epidemiology Medicine Clinical Research Design Epidemiology Drugs and Devices Drug Research and Development Epidemiology Cancer Epidemiology Clinical Epidemiology Oncology Cancers and Neoplasms Lung and Intrathoracic Tumors Non-Small Cell Lung Cancer Cancer Treatment Radiology Nuclear Medicine PET imaging [18F]FDG Positron Emission Tomography within Two Weeks of Starting Erlotinib Therapy Can Predict Response in Non-Small Cell Lung Cancer Patients Theranostic Use of FDG-PET in NSCLC Patients Hachemi Mammar 1 2 Couturier Olivier 1 2 3 Vervueren Laurent 1 2 Fosse Pac´me 1 2 Lacœuille Franck 1 2 3 Urban Thierry 1 3 4 5 Hureaux Jos 1 3 4 5 * 1 LUNAM Universit 49 000 Angers France 2 Universit d'Angers CHU Angers P´le de Radiologie Service de Mdecine Nuclaire Angers France 3 INSERM UMR_S 1066 Micro et Nanomdecines Biomimtiques Angers France 4 Universit d'Angers CHU Angers P´le des Spcialits Mdicales et Chirurgicales Intgres Dpartement de Pneumologie Angers France 5 Universit d'Angers Equipe Pyver Angers France Singh Pankaj K. Editor University of Nebraska Medical Center United States of America * E-mail: JoHureauxchu-angers.fr Competing Interests: The authors have declared that no competing interests exist. Conceived and designed the experiments: OC TU JH. Performed the experiments: MH OC LV PF FL JH. Analyzed the data: MH OC FL TU JH. Contributed reagents/materials/analysis tools: MH OC TU JH. Wrote the paper: MH OC JH. 2014 5 2 2014 9 2 e87629 29 9 2013 26 12 2013 2014 Hachemi et al This is an open-access distributed under the terms of the Creative Commons Attribution License which permits unrestricted use distribution and reproduction in any medium provided the original author and source are credited. Purpose The aim of this prospective study was to evaluate whether [18F]FDG-PET/CT performed within two weeks of starting erlotinib therapy can predict tumor response defined by RECIST 1.1 criteria after 8 weeks of treatment in patients with inoperable (stage IIIA to IV) non-small cell lung cancer patients. Patients and Methods Three [18F]FDG-PET/CT scans were acquired in 12 patients before (5±4 days) and after 9±3 days (early PET) and 60±6 days (late PET) of erlotinib therapy. Conventional evaluation including at least chest CT (baseline versus after 8 weeks of treatment) was performed according to RECIST 1.1 criteria. Change in [18F]FDG uptake was compared with conventional response progression-free survival (PFS) and overall survival (OS). Results By using ROC analysis the Area Under the Curve for prediction of metabolic non-progressive disease (mNP) by early PET was 0.86 (95% CI 0.62 to 1.1; P?=?0.04) at a cut-off of 21.6% reduction in maximum Standardized Uptake Value (SUVmax). This correctly classified 11/12 patients (7 with true progressive disease; 4 with true non-progressive disease; 1 with false progressive disease). Non-progressive disease after 8 weeks of treatment according to RECIST 1.1 criteria was significantly more frequent in patients classified mNP (P?=?0.01 Fisher's exact test). mNP patients showed prolonged PFS (HR?=?0.27; 95% CI 0.04 to 0.59; P<0.01) and OS (HR?=?0.34; 95% CI 0.06 to 0.84; P?=?0.03). Late PET analysis provided concordant results. Conclusion Morphologic response PFS and OS survival in non-small cell lung cancer patients can be predicted by [18F]FDG-PET/CT scan within 2 weeks after starting erlotinib therapy. The authors have no support or funding to report. Introduction Lung cancer is the leading cause of cancer-related death in both Europe[1] and the United States of America.[2] The most common forms of lung cancer are non-small cell lung cancer (NSCLC) histological subtypes. Systemic chemotherapy has contributed to a significant improvement in NSCLC therapy but progress appears to be stagnating.[3] [4] Over the last decade a better knowledge of cellular pathways has allowed the development of new therapies based on NSCLC-driving genetic abnormalities. Targeted therapies have been developed to block pathological cellular pathways involved in cancer cell survival proliferation and metastasis. Epidermal Growth Factor Receptor (EGFR) is overexpressed in NSCLC[5] and has been extensively studied as a potential therapeutic target. Two EGF Receptor blockers gefitinib and erlotinib have been demonstrated to be effective in front-line therapy in patients with inoperable NSCLC harboring EGFR-activating mutations.[6] [7] Erlotinib is also authorized after failure of previous chemotherapy and as maintenance therapy.[8] [9] In clinical practice evaluation of tumor response is based on changes in tumor size according to criteria proposed by the World Health anization[10] or RECIST criteria.[11] [12] This morphological evaluation may lead to underestimation of the efficacy of cytostatic therapeutic agents such as erlotinib that stabilize the disease in non-mutated patients whereas conventional cytotoxic drugs induce shrinkage of tumor dimensions in the case of tumor response. NSCLC tumor size evaluation can also be difficult due to atelectasis of normal lung. The major limitations to morphological imaging methods are their inability to assess response to therapy at an early stage and their inability to identify cancer in residual masses after treatment. In patients with NSCLC [18F]FDG-PET has been recognized as an adequate staging tool[13] [14] and several studies also suggest that the standardized uptake value (SUV) has a prognostic value in NSCLC.[15] [16] The value of SUV for evaluation of tumor response to targeted therapy is currently being investigated. We designed a preliminary study to evaluate tumor response in NSCLC patients eligible for erlotinib therapy. The aim of this prospective study was to determine whether [18F]FDG-PET/CT performed several days after starting erlotinib therapy could predict tumor response defined by RECIST 1.1 criteria and [18F]FDG-PET/CT after 8 weeks of treatment. Materials and Methods Patients Twelve consecutive eligible patients with stage IIIA to IV NSCLC (7 adenocarcinomas 3 large cell carcinomas 2 squamous cell carcinomas) in whom erlotinib therapy was indicated were studied at the Angers University Hospital France. Screening for EGF receptor mutations was carried out (patient characteristics are shown in ). Eligibility criteria were: histologically or cytologically proven NSCLC; unresectable stage III/IV disease or recurrent disease after surgery; age over 18 years; measurable disease according to RECIST 1.1 criteria; Eastern Cooperative Oncology Group (ECOG) performance status between 0 to 2; adequate bone marrow function liver function and renal function. Patients were not included if they had previous lung diseases such as interstitial pneumonitis or lung fibrosis identified by chest Computed Tomography (CT) scan or diabetes mellitus that could artefact PET imaging. Life expectancy was predicted to be longer than 12 weeks. Erlotinib was administered orally in a dosage of 150 mg/day on an empty stomach until clinical disease progression unacceptable toxicity or patient refusal. The medical ethics committee of the CHU of Angers approved the study protocol. All patients gave informed written consent before inclusion according to local medical ethical committee regulations and in accordance with the guidelines established by the World Medical Association Declaration of Helsinki. .0087629.t001 Clinical characteristics of the study population. Patients Male 6 (50) Female 6 (50) Total 12 (100) Histology Adenocarcinoma 7 (58) Large cell carcinoma 3 (25) Squamous cell carcinoma 2 (17) Clinical stage IIIA or IIIB 2 (17) IV 10 (83) Smoking status Current 5 (42) Former 2 (17) Never 5 (42) EGFR mutation status Presence 2 (17) Absence 10 (83) Previous chemotherapy Yes 10 (83) No 2 (17) Size of primary tumor (cm) 1.0€“2.0 4 (33) 2.1€“3.0 3 (25) 3.1€“5.0 5 (42) >5.1 1 (8) Metastasis Lymph nodes 12 (100) Lung 4 (33) Liver 2 (17) Bone 4 (33) Adrenal glands 0 Work Plan (study design) [18F]FDG PET/CT imaging Three [18F]FDG PET/CT scans were planned: PET1 before starting therapy PET2 within 2 weeks after starting therapy and a third [18F]FDG PET/CT scan (PET3) 8 weeks after starting erlotinib therapy. PET/CT examinations were obtained in 2D mode from the vertex to mid-thighs (5 minutes of emission scan per bed position with an average of 7 bed positions at 15 cm intervals) (Discovery-ST GE Healthcare France). Patients were instructed to fast for at least 6 hours prior to scanning. Unenhanced CT scan was performed from the skull base to the upper thighs. CT parameters were 120 kVp 100 mAs 0.8 second rotation 3.27 mm slice collimation and Pitch 1.5. CT data were used for attenuation correction and PET images were reconstructed by clinical standard 2D-iterative algorithm (ordered subset expectation maximization using 4 iterations and 16 subsets; zoom 100%; image matrix size: 128—128; and Gaussian post-smoothing of 5 mm in full width at half maximum). No corrections for partial volume effect lean body mass or blood glucose levels were applied. Conventional evaluation Conventional staging and follow-up were performed according to standards of care.[11] [12] Conventional evaluation included at least clinical examination plus CT scan performed before (CT1; 7±6 days) and 8 weeks after (CT2; 58±8 days) starting erlotinib therapy. None of the patients underwent additional CT scanning during the 2 weeks after starting erlotinib therapy. Chest abdomen and pelvis CT scans (Brillance 64 PHILIPS Medical System® France) were acquired from the lung apex to the symphysis pubis after an intravenous embolus of 130 mL of iodinated contrast agent (Xenetix350®). Helical scanning parameters were 130 kVp 120 mAs 1 second rotation 4 mm slice collimation 8 mm/s bed speed and 3 mm section width. Image analysis and response evaluation CT data were interpreted by two experienced physicians specialists in thoracic oncology blinded to PET/CT results according to the Response Evaluation Criteria in Solid Tumors (RECIST 1.1 criteria[12]) by comparison of baseline CT scan (CT1) and final CT scan (CT2). Therapeutic response evaluation was defined as: 1) complete response (CR: disappearance of all target lesions); 2) partial response (PR: at least 30% decrease in the sum of the longest diameter of five target lesions); 3) progressive disease (PD: at least a 20% increase in the sum of the longest diameter of five target lesions); and 4) stable disease (SD: neither sufficient shrinkage to qualify for PR nor sufficient increase to qualify for PD). Patients were then classified in the progressive disease (P) group or the non-progressive disease (NP) group including CR PR and SD therapeutic response. [18F]FDG PET interpretation was performed on an Imagys® workstation (Keosys Saint-Herblain France) qualitatively and semi-quantitatively by two experienced nuclear medicine physicians blinded to clinical and conventional evaluation results. Any focus of increased [18F]FDG uptake over background not located in areas of normal [18F]FDG uptake and/or [18F]FDG excretion was considered to be positive for tumor. For semi-quantitative analyses of [18F]FDG uptake 3D regions of interest (VOIs) were placed over all lesions considered to be positive for tumor by using Imagys® software (Keosys France). The maximum standardized uptake value (SUVmax) was calculated using the single hottest pixel inside the tumor VOI. SUV peak was also calculated using a 1.2 cm diameter spherical VOI containing the SUVmax. Bone lesions were not taken into account as they were considered to be non-measurable lesions. For patients with more than one tumor lesion the sum of SUVmax and SUVpeak were calculated and used for evaluation of changes between PET1 and PET2. PET measurements were performed in up to a maximum of five measurable target lesions. All SUVs were normalized to the injected dose and patient body weight. The percentage changes in SUV between PET1 and PET2 were finally calculated as follows: ?SUV?=?(SUV1?SUV2)/SUV1. The same protocol was used for PET1 and PET3. Statistical analysis Data are expressed as mean±SD excepted for survival data that were expressed as the median. The primary endpoint of the study was comparison of changes in tumor [18F]FDG uptake on PET2 versus PET1 PET3 versus PET1 and subsequent CT scan evaluation at 8 weeks after initiation of erlotinib therapy. Friedman test was used for non-parametric comparison of repeated measures. The secondary endpoints were to determine the Receiver Operating Characteristic (ROC) analysis for [18F]FDG changes with regard to predicting response to erlotinib therapy. The relationship between metabolic response (patients stratified according to the median value of SUV variations) and clinical response was analyzed by Fisher's exact test. Progression-free survival (PFS) and overall survival (OS) were determined by standard Kaplan-Meier survival analysis and between-group comparison was performed by log-rank test. PFS was defined as the time interval from the date of enrolment in the study until the first signs of progression. OS was calculated from the date of enrolment until death from any cause. All analyses were performed using Graphpad prism version 4.0 b 2004 (Graphpad Software San Diego CA). The limit of significance was set at 0.05. Results Population Twelve eligible patients with NSCLC 6 women (50%) and 6 men (50%) with a mean age of 60±13 years were included. Two patients presented tumors harboring an activating Epidermal Growth Factor Receptor mutation (2573T>G substitution (p.Leu858Arg) in exon 21 in one patient; deletion (L747_E749del) in exon 19 in the other patient). Patient characteristics are described in . The median duration of erlotinib therapy was 75 days. Due to rapid progression and death PET3 and CT3 could not be performed in 2 patients. Tumor 18F-FDG uptake The three [18F]FDG PET/CT scans were acquired as follows: PET1 5±4 days before starting therapy PET2 9±3 days after starting therapy and PET3 60±6 days after starting erlotinib therapy. Scanning started 68±17 min (PET1) 71±16 min (PET2) and 64±13 min (PET3) after [18F]FDG injection of 271±53 MBq (PET1) 270±61 MBq (PET2) and 263±54 MBq (PET3). Blood glucose level was less than 1.5 g/L for all PET examinations i.e. 1.1±0.1 g/L for PET1 1.1±0.2 g/L for PET 2 and 1.1±0.2 g/L for PET3. Non-parametric Friedman tests did not show any significant difference between PET1 PET2 and PET3 for FDG uptake time injected FDG dose or blood glucose. Fifty-five lesions were described on PET1 before treatment and 45 lesions were defined as target lesions for PET evaluation of response to treatment (up to five most hypermetabolic lesions per patient; mean 3.8 lesions/patient). The mean tumor SUVmax of the most [18F]FDG€“avid lesion (SUVmax) was 10.0±4.7 for PET1 and did not vary significantly over time with a mean of 10.1±6.6 for PET2 and a mean of 9.1±5.6 for PET3 (P?=?0.97). The SUVpeak was 8.6±4.3 for PET1 8.1±5.4 for PET2 and 7.1±4.6 for PET3 and did not vary over time (P?=?0.60). No variation over time was observed for the sums of SUV. The mean sum of tumor SUVmax of all target lesions was 30.1±19.5 for PET1 27.5±17.7 for PET2 and 28.3±22.4 for PET3 (P?=?0.83). Sums of SUVpeak of all target lesions were 22.7±14.3 for PET1 20.6±13.4 for PET2 and 22.2±18.6 for PET3 (P?=?0.44). [18F]FDG-PET response versus conventional evaluation CT scan data were interpreted by chest physicians blinded to PET/CT scan results (). Evaluation of response to treatment according to RECIST 1.1 criteria demonstrated 7 patients with progressive disease (group P) and 5 patients with non-progressive disease (group NP) including 4 cases of stable disease (SD) and 1 partial response (PR). .0087629.t002 CT and PET assessments of response rates OS and PFS. Patient PET2 versus PET1 PET3 versus PET1 RECIST 1.1 Evaluation PFS OS New lesion ? SUVmax * ? SUVpeak * ? SUVmax * ? SUVpeak * Response to Treatment Progressive (P) or not (NP) days days on PET3 #1 ?21.6 ?17.6 18.6 ?1.5 SD NP 267 915 ? #2 25.9 26.9 70.3 77.4 PD P 57 316 + #3 9.0 7.6 23.4 23.3 PD P 216 447 + #4 ?18.6 ?15.0 ?3.2 ?2.6 PD P 67 414 + #5 ?20.3 ?11.1 42.1 51.1 PD P 53 152 + #6 ?56.7 ?59.9 ?72.1 ?70.6 PR NP 190 296 ? #7 ?22.0 ?26.0 ?31.3 ?24.3 SD NP 727 1249 + #8 ?32.0 ?25.1 3.9 ?3.9 SD NP 317 1146 ? #9 16.4 7.8 ?5.4 ?10.8 SD NP 77 359 ? #10 2.1 4.4 MD MD PD P 37 92 MD #11 36.1 20.0 30.3 25.7 PD P 104 734 ? #12 ?7.2 ?10.5 MD MD PD P 61 71 MD * For patient with more than one tumor lesion the sum of SUVmax and of SUVpeak were calculated and used for the evaluation of changes between PET1 and PET2 (or between PET1 and PET3). Missing data are indicated as MD. On ROC analysis the AUC for prediction of non-progressive disease by PET2 was 0.86 (95% CI 0.62 to 1.1; P?=?0.04) corresponding to a maximum specificity of 0.80 and sensitivity of 0.86 for non-progressive disease at a cut-off of 21.6% reduction in SUVmax (Figure 1) and a positive predictive value (PPV) of 0.86 a negative predictive value (NPV) of 0.80 an accuracy of 0.83 and a maximum Youden index of 0.65. The use of this SUVmax cut-off value correctly classified 11/12 patients (7 with true progressive disease (Figures 2 and 3); 4 with true non-progressive disease (Figures 4 and 5); 1 with false progressive disease (). Non-progression after 2 months of treatment was significantly more frequent in patients with an early decrease in SUVmax of 21.6% or more (P?=?0.01 Fisher's exact test). The only misclassified patient (patient #9 false progressive disease on PET2 versus PET1) displayed a 16.4% increase of SUVmax but metabolic progression was not confirmed on PET3 with a 5.4% decrease of SUVmax compared to PET1. Similar results were observed for SUVpeak as non-progressive disease after 2 months of treatment was significantly more frequent in patients with a decrease in SUVpeak of at least 17.6% on PET2 (P?=?0.01 Fisher's exact test). Similar results were also obtained in terms of AUC sensitivity specificity PPV NPV and accuracy and with the same classification of patients (7 with true progressive disease; 4 with true non-progressive disease; 1 with false progressive disease). .0087629.g001 Figure 1 Percentage change in SUVmax on 18F-FDG PET/CT (cut-off: ?21.6%) within 2 weeks of starting erlotinib therapy in relation to conventional imaging response. Each red or green bar represents a patient NP or P respectively. .0087629.g002 Figure 2 Example of a progressive patient on PET (mP) and conventional imaging. Progressive patient with right upper lobe NSCLC associated with mdiastinal lymphadenopathy lung and bone metastases (patient #2). Sum of the SUVmax of the 5 most hypermetabolic lesions (2 lung lesions 2 mediastinal lymph nodes one hilar lesion) were 35.2 44.3 (+26%) and 59.9 (+70%) for PET1 PET2 (% versus PET1) and PET3 (% versus PET1) respectively. Based on a SUVmax cut-off value of ?21.6 the patient was classified as mP on PET2 in accordance with RECIST evaluation on CT scan (performed 57 days after starting erlotinib). mP was confirmed on PET3 with the appearance of a new lesion (subcarinal adenopathy) and a 70% increase of SUVmax. .0087629.g003 Figure 3 New subcarinal adenopathy on PET3 (same patient as Figure 2). .0087629.g004 Figure 4"

Lung_Cancer

"Twelve studies of various design reported statistically significant association between ICC and survival. General surgeons were surveyed to identify individual and anizational barriers to MCC adoption [22]. Surgeons said that MCCs were not well supported institutionally or widely accessible few had a designated coordinator and most reviewed only rare or select cases rather than all new cancer patients. Interviews and observation were used to explore MCC use in four hospitals [23]. Thirty-seven MCCs were observed at three hospitals and 48 clinicians and administrators were interviewed. Institutions lacked the capacity to fully implement MCCs as part of routine practice. MJD developed a measure of cancer services integration and conducted a population-based survey of Ontario health professionals to evaluate integration. The study identified 12 factors that accounted for the majority of variation in cancer services integration [24]. This work emphasized how leadership coordination resource allocation and communication influence overall integration of cancer services. Further analysis of this data revealed variability in access to electronic health records (EHRs) across different provider groups anization types and geographic locations which may limit ICC [25]. Another analysis focused specifically on the benefits of MCCs as a model of ICC [26]. Overall 74% of respondents were aware of MCCs within their region but only 58% were regular participants. Diagnostic assessment programs MCCs represent one model of ICC for treatment decision making. The time interval from suspicion to diagnosis of cancer involves numerous consultations and testing and is a confusing time for patients. Timely diagnosis can lead to improved access to MCCs or other consultation earlier treatment and a better prognosis [1-21]. Clinicians and managers suggested the need to improve ICC earlier in the cancer trajectory given barriers of access to and coordination of diagnosis and staging and recommended centralized diagnostic facilities [14-19]. An expert panel assembled by the provincial cancer agency issued anizational standards for Diagnostic Assessment Programs (DAPs) to coordinate diagnostic tests and integrate multidisciplinary expertise [2728]. A summary of recommended DAP features appears in . DAP standards Component Description Team composition Administrative ¢ Director/manager ¢ Reception clerical and bookings Health professionals ¢ Assessment coordinators (examples): ¢ Radiologists ¢ Pathologists ¢ Primary care ¢ Psychosocial support Specialists ¢ Surgeon specialists ¢ Respirologists (lung) ¢ Endoscopists (colorectal and other) Technicians ¢ Ultrasound technologists ¢ Mammographers (breast) Scope of diagnostic activity Examination (diagnostic activity differs depending on disease site) ¢ Physical exam ¢ Other disease site specific Imaging diagnostic and staging procedures ¢ Ultrasound ¢ MRI ¢ X-ray ¢ CT scan ¢ PET ¢ Upper endoscopy ¢ Colonoscopy ¢ Bronchoscopy ¢ Cystoscopy ¢ Bone scan ¢ Mammography ¢ Other disease site specific Surgical consultation and procedures ¢ Biopsy ¢ Fine needle aspiration cytology ¢ Biopsy Pathology and laboratory medicine ¢ Standardized surgical pathology requisition forms ¢ Routine analysis and pathology reporting ¢ Special pathological studies such as markers flow molecular etc ¢ Clinical lab testing of tumour markers hematology etc. Supportive care ¢ Education/psychosocial support ¢ Dietetics ¢ Genetic counselling ¢ Other supportive services ¢ Access ¢ Regionalized centralized ¢ One stop ¢ Virtual ¢ Entry point ¢ Primary care providers or specialist ¢ Screening program ¢ Self referral ¢ Operational features ¢ Entry ¢ Fast access booking ¢ Priority booking ¢ Open-access booking ¢ DAP core elements ¢ Assessment coordinator ¢ Multidisciplinary care conference (MCC) team/treatment team ¢ Cross-DAP collaboration ¢ Provincial indicators of quality for cancer DAPs ¢ Time intervals ¢ Clinical outcomes ¢ Quality of care ¢ Patient satisfaction ¢ Guidelines standards and services frameworks ¢ Guidelines and service frameworks for primary care providers ¢ Evidence-based investigative algorithms and guidance documents ¢ Wait-times benchmarks Study rationale ICC for cancer leads to multiple system anizational professional and patient benefits. However our analysis of conceptual literature did not reveal optimal ways to achieve ICC and our review of empirical literature revealed that no interventions apart from MCCs have been used to promote ICC for cancer care. Our research with health professionals identified limited support for use of and access to interventions that enable ICC for cancer particularly outside of designated cancer hospitals in community settings where the majority of cancer care takes place and for cancer diagnosis. DAPs appear to be a promising model by which to enable ICC. In 2007 the provincial cancer agency funded four pilot DAPs and all achieved reductions in wait times (http://www.cancercare.on.ca/pcs/diagnosis/diagprograms/). Hospital one reduced median time from suspicion of breast cancer to biopsy by 60% (38 to 15 days) and from suspicion to diagnosis by 53% (42 to 20 days); hospital two reduced time from referral to colonoscopy for patients with positive fecal occult blood test results by 78%; hospital three reduced lung cancer wait times from 113 to 69 days for referral to diagnosis; and hospital four reduced lung cancer wait times from 120 to 44 days for suspicion to diagnosis. Wait times are only one possible outcome of ICC. We require more information about how to design and implement DAPs to optimize ICC and achieve the range of associated beneficial outcomes. We conducted a systematic review of the cancer literature to describe clinical and economic evaluations of DAPs [29]. Most of the 20 eligible studies did not base their evaluations on guideline recommendations or quality indicators or include economic evaluations. Several DAPs were implemented across Ontario so more comprehensive evaluation was warranted and possible to better understand how various DAP models enabled ICC. The purpose of this study is to: 1. Describe DAP structure function and outcomes according to published DAP standards clinical guideline recommendations and a theoretical framework of ICC. 2. Conduct a pilot costing analysis of delivering diagnostic services with DAPs. 3. Explore challenges of DAP implementation and operation and associated ICC. 4. Issue recommendations that may optimize the implementation operation and outcomes of DAPs. This research will not evaluate DAPs from the perspective of patients. While crucial that objective warrants separate multi-year investigation to explore patient preferences for diagnostic care first through review of the literature then by interviewing patients with various characteristics who did and did not experience DAP care. This would establish patient-informed performance measures of diagnostic services and ICC which do not exist. We found that patient views about cancer care performance measures differed from those of health professionals thus development of patient-informed performance measures is necessary to fully evaluate the services provided by DAPs and the degree to which the DAP model enables ICC [30]. Instead this proposal responds to the expressed needs of our research partners and for multiple reasons including feasibility focuses first on evaluating DAPs according to evidence-based standards for DAPs and clinical care delivery and by soliciting the views of involved health professionals. This preliminary evaluation is needed to establish a baseline understanding of how DAPs were implemented and function. Only then will we have sufficient insight on factors influencing DAP outcomes that we could ask patients about and an established relationship with DAP collaborators to enable an expanded research study that would include patient recruitment. Methods Design A case study approach was chosen to explore multiple factors that influence ICC including DAP structure processes and outcomes [31]. These will be assessed according to DAP standards and guideline recommendations for staging and diagnosis of breast [32-34] and lung cancer [2728]. This will enable comparison between ˜cases™ (DAPs) that vary by type of cancer academic status and geographic region. This may identify whether and how differences in DAP leadership staffing resources and referral patterns influence ICC or whether ICC must be enabled differently by condition. This approach is suitable for examining complex issues that require holistic interpretation (˜triangulation™) of data collected in a variety of ways from different sources. Data will be collected from medical records and interviews. Four hospitals from different regions of Ontario agreed to participate. Two are considered academic teaching hospitals. Each site features a breast DAP and a lung DAP for a total of eight participating DAPs. This study was reviewed and approved by the University Health Network Research Ethics Board and research ethics boards at each of the four participating hospitals. Conceptual framework The overall goal of this study is to explore how DAPs enable ICC and associated outcomes. ICC was defined as ˜interaction among various types of health professionals to plan or evaluate services or plan provide or review results or outcomes for individual patients™. There is no single existing model or theory that describes factors influencing the quality of ICC so we compiled a conceptual framework from several sources. We had reviewed several bodies of knowledge describing models of health professional interaction for patient management according to the concepts of teamwork inter-professional collaboration continuity of care integrated service delivery inter-anizational collaboration and case management and extracted data on common domains and elements and associated outcomes [20]. This generated core components and enablers of ICC that were common across the models. anizational standards for DAPs that are described in [2728] were mapped onto this preliminary framework. The conceptual framework was expanded by adding challenges [10-26] and beneficial outcomes [9-21] identified in our background review of the literature. We also reviewed clinical guidelines for breast [32-34] and lung cancer [2728] to incorporate elements of desirable care delivery and outcomes. The resulting conceptual framework (Figure 1) will be used to inform the development of data collection instruments and data analysis. Findings will be used to validate and extend the conceptual framework to describe how DAP structure function and support enable ICC and associated outcomes. Figure 1 Conceptual framework describing factors that influence how DAPs achieve ICC and associated benefits. Medical record review to describe DAP services and outcomes Approach To describe DAP function and outcomes and gather information that will enable costing recommendations expressed in DAP standards and clinical guidelines will be assessed through retrospective observational study. Data will be acquired from databases maintained by participating DAPs and the provincial cancer agency and confirmed by and supplemented with review of medical records. Sampling Eligible patients include those 18 years of age or older with suspected lung or breast cancer who were referred to participating DAPs between 1 January 2012 and 31 December 2012. Based on input from collaborating sites we initially estimated that this includes a mean of 15 new patients per month by two types of cancer in four sites for an annual total of 360 patients per site and an overall total of 1440 patients. Assuming a type I error (alpha) rate of 0.05 power of 0.80 and equal sample sizes for two comparative groups (i.e. academic/community status or breast/lung cancer) 170 patients (85 in each group) in total would be required to detect a statistically significant difference in compliance with a given DAP or clinical guideline standard of 15%. Thus estimated patient sampling is more than sufficient to identify variations in process or outcome performance measures according to varying DAP features. However DAPs vary in case volume. To give equal weight to each DAP at each participating site based on patient volume 15% of patients will be randomly sampled from among those newly referred during the given time period. For all sites this is equal to or greater than minimal sample sizes estimated by traditional power calculation. Data collection and analysis Data reflecting DAP and guideline recommendations for diagnostic activity () will be extracted from medical records. A trained data abstractor will visit participating sites. Before this a data extraction form will be developed and independently pilot tested on five cases by two individuals. They will compare congruence of extracted data to assess how the form should be revised. This will be repeated until the format and content of the data extraction form is satisfactory and congruence of independently extracted data is high. During chart review 5% of charts will be re-abstracted for data quality monitoring. Summary statistics will be used to report compliance with DAP and guideline standards for patients overall and by DAP academic status and type of cancer. Statistical significance of differing outcomes will be reported with the Pearson™s chi-square test. A generalized linear mixed model approach will be used to address binary and continuous process and outcome variables. Hierarchical modeling (patient level one hospital level two) will be used to allow for clustering by hospital. Pilot costing analysis of DAP diagnostic visits and services Approach Our ultimate goal is to conduct a cost-effectiveness analysis (CEA) but this is a complex undertaking requiring considerable data on the actual number and nature of services provided per patient and their cost. The purpose of CEA is not hypothesis testing but rather it is estimation [35]. To do a CEA one needs to compute estimates of the extra cost (?C) and the extra effect (?E) of an intervention. The ratio of ?C to ?E is called the incremental cost-effectiveness ratio (ICER) and is the main statistic in CEA. Such data are not readily available in administrative databases and often requires primary data collection from medical records. We currently do not know whether data required for a CEA of DAPs is available in medical records."

Lung_Cancer

"Discussion This study supports the feasibility of performing a retrospective clinical validation of a companion diagnostic from prospective therapeutic clinical trials. The EGFR PCR test results were highly concordant (>96%) with the LDT results used to select patients for the EURTAC trial. As a consequence PFS and BORR of the subset of patients with EGFR mutations detected with the EGFR PCR test were comparable to the full cohort of patients enrolled in the EURTAC trial thus validating the use of the EGFR PCR test to select patients for treatment with anti-EGFR TKIs such as erlotinib. Median PFS survival was 9.7 versus 10.4 months for the erlotinib group and 5.2 versus 5.4 months for the LDTs and EGFR PCR test respectively. The BORR was 58% versus 59.3% months for the erlotinib group and 15% versus 14.0% for the LDTs and EGFR PCR test respectively. Among the 16 discordant specimens between the EGFR PCR test and LDTs a third mutation testing method agreed with the EGFR PCR test result in 11 cases. Of seven cases that were mutation detected by the EGFR PCR test and mutation not detected by the LDT 5 were confirmed by MPP. These patients could have potentially benefited from anti-EGFR TKI therapy. The EGFR PCR test had a number of technical advantages over the LDT used in the EURTAC trial. The LDT required laser capture microdissection of multiple tissue sections and involved 3 separate assays with a median turnaround time of 4.5 days. By comparison the EGFR PCR test required macrodissection only if the tumor content was <10% and can be performed in one day using a single 5 µm section. Furthermore the EGFR PCR test is a commercially available kit-based assay that provides an automated result rather than a manual process subject to interpretation and which can be performed by any qualified clinical laboratory. More than 80% of the specimens tested in this study were small biopsy specimens. The overall invalid rate for Sanger sequencing was 15.6% (76/487) compared to the EGFR PCR assay at 9% (43/487). However the invalid rate for the subset of specimens derived from resected specimens was 0% (0/109) likely because of sufficient tissue availability. Thus the assay is extremely robust when performed on resected tumor specimens and has an approximately 90% success rate on biopsy specimens which are often the only tumor sample available for testing in NSCLC. Sanger sequencing has been widely used to detect EGFR mutations.[30] [32] Similar to the overall invalid rates for the 134 EGFR mutation detected LDT samples enrolled in the EURTAC trial Sanger sequencing had a higher invalid rate (15.7%) compared to 8.2% for the EGFR PCR test. There were also 30 mutation not detected results for Sanger sequencing (22.4%) and 7 mutation not detected results for the EGFR PCR test (5.2%). With 21 invalid results and 30 mutation not detected results Sanger sequencing would have misclassified 38% of patients enrolled in the EURTAC trial. Similar invalid rates have been reported in three other studies suggesting that this methodology has limitations when applied to DNA from FFPET samples.[33] [34] [35] In addition Sanger sequencing has shown poor sensitivity in samples containing less than 20“25% mutant alleles.[35] [36] [37] When we compared the agreement between valid results for the EGFR PCR test with Sanger sequencing (n?=?406) there were 38 discordant cases of which 30 were confirmed by MPP. Twenty-nine of the 30 cases resulted in mutation detected status by the EGFR PCR test and would make these patients eligible for anti-EGFR therapy. Poor sensitivity of Sanger sequencing thus explains the relatively low NPA compared to EGFR PCR test observed in this study. Given the criticality of EGFR mutation testing in selecting specific therapies for life-threatening cancers such as advanced NSCLC robust and accurate assays with rapid turnaround time are preferred. Recent quality assurance studies to ascertain the mutation status of a standard panel of tumors have shown that different clinical laboratories do not correctly identify the mutation status of 100% of the panel members even when they are using the same or similar testing methodologies.[38] [39] For assays that involve mutation analysis of tumor samples important factors contributing to the assay performance include analytic standardization validation of reagents and methodology laboratory experience and the appropriate involvement of the pathologist. In results of the present study indicate that the cobas EGFR mutation test is a highly robust and highly accurate companion diagnostic assay to select patients for treatment with anti-EGFR therapies such as erlotinib. Supporting Information Table S1 Listing of MPP Result. (PDF) Click here for additional data file. Table S2 Outcome from samples discrepant between the cobas EGFR PCR test and LDT that were enrolled in the clinical trial (cobas MND/LDT MD). (PDF) Click here for additional data file. Table S3 Agreement results between discordant EGFR PCR and LDT tests. (PDF) Click here for additional data file. Table S4 MPP results from resolution analysis of discordant specimens between EGFR PCR test and Sanger sequencing. (PDF) Click here for additional data file. We would like to acknowledge Patrick O'Donnell and Karen Yu for their contributions to this study. References 1 ChapmanPB HauschildA RobertC HaanenJB AsciertoP et al (2011) Improved survival with vemurafenib in melanoma with BRAF V600E mutation. N Engl J Med364: 2507“251621639808 2 OuSH BartlettCH Mino-KenudsonM CuiJ IafrateAJ (2012) Crizotinib for the treatment of ALK-rearranged non-small cell lung cancer: a success story to usher in the second decade of molecular targeted therapy in oncology. Oncologist17: 1351“1375 3 O'BryantCL WengerSD KimM ThompsonLA (2013) Crizotinib: a new treatment option for ALK-positive non-small cell lung cancer. Annals Pharmacotherapy47: 189“197 4 SunJM ChoiYL WonJK HirschFR AhnJS et al (2012) A dramatic response to crizotinib in a non-small-cell lung cancer patient with IHC-positive and FISH-negative ALK. J Thorac Oncol7: e36“3823154564 5 Administration USFaD (2010) Class Labeling Changes to anti-EGFR monoclonal antibodies cetuximab (Erbitux) and panitumumab (Vectibix): KRAS Mutations. 6 HarbisonCT HorakCE LedeineJM MukhopadhyayP MaloneDP et al (2012) Validation of Companion Diagnostic for Detection of Mutations in Codons 12 and 13 of the KRAS Gene in Patients with Metastatic Colorectal Cancer: Analysis of the NCIC CTG CO.17 Trial. Arch Pathol Lab Med137: 820“82723030695 7 MaemondoM InoueA KobayashiK SugawaraS OizumiS et al (2010) Gefitinib or chemotherapy for non“small-cell lung cancer with mutated EGFR. N Engl J Med362: 2380“2388 8 MokTS WuYL ThongprasertS YangCH ChuDT et al (2009) Gefitinib or carboplatin-paclitaxel in pulmonary adenocarcinoma. N Engl J Med361: 947“95719692680 9 ZhouC WuYL ChenG FengJ LiuXQ et al (2011) Erlotinib versus chemotherapy as first-line treatment for patients with advanced EGFR mutation-positive non-small-cell lung cancer (OPTIMAL CTONG-0802): a multicentre open-label randomised phase 3 study. "

Lung_Cancer

"protein is a member of phosphoinositide 3-kinase (PI-3 kinases) and can be activated by DSBs caused by ionizing radiation or reactive oxygen intermediates [6] [7]. Once activated ATM can phosphorylate various downstream substates that function in cell cycle arrest apoptosis and DNA repair such as p53 NBS1 BRCA1 and Chk2 [8] [9]. Therefore genetic variants in ATM gene may lead to the structure and function change of the protein and act as important factors indicating individual susceptibility to cancer. ATM -111G>A (rs189037) resides in the promoter of ATM gene. Increasing studies have shown that variations in the DNA promoter sequence may potentially alter the affinities of multiple regulatory proteins-DNA interactions or the specificity of the transcriptional process [10]“[13]. Although this polymorphism makes no amino acid change the alleles may have different binding affinity to the transcription factor and exhibit different levels of mRNA expression [14] [15]. Zhang et al. [16]declared that ATM rs189037 AA genotype was associated with a lower ATM mRNA levels than GG genotype in lung tissue samples. Their results showed that the G-to-A change might create a transcriptional inhibitor-binding site for ATM rs189037 A allele promoter and subsequently reduce the ATM mRNA expression. Consequently lower expression of ATM might cause elevated sensitivity to ionizing radiation defects in the activation of cell cycle checkpoints a reduced capacity for DNA repair and abnormal apoptosis. All of these features would contribute to increased individual cancer susceptibility. In recent years a number of studies have evaluated the association between this polymorphism and cancer risk such as thyroid carcinoma [17] oral cancer [18] breast cancer [19] leukemia [20] nasopharyngeal carcinoma [21] glioma [22] and lung caner [23]“[25]. Previous studies of ATM rs189037 have included cigarette smokers as cases and controls that made it difficult to judge whether this polymorphism were associated with lung cancer or tobacco use. Considering the facts in China the incidence and death rate of lung cancer in women continues to increase and this phenomenon is frequently occurring in those who have never smoked. In order to have a better control of confounding of gender or smoking we performed a case-control study to identify the association between the polymorphism of ATM rs189037 and the risk of lung cancer in the non-smoking females in Chinese Han population. We also investigated the interaction between genetic polymorphism and environmental exposure in lung cancer. Methods Subjects This hospital-based case-control study included 487 lung cancer patients and 516 cancer-free hospital controls. All subjects were female non-smokers and they were from unrelated ethic Han Chinese. The cases were recruited during January 2002 to November 2012 at Liaoning Cancer Hospital & Institute. All patients were histologically confirmed to have lung cancer before any radiotherapy and chemotherapy. During the same time controls were selected from patients with other lung diseases but free of cancer history and symptom. Controls suffered mainly from bronchitis pneumonias fibrosis sarcoidosis chronic obstructive pulmonary disease and emphysema. Controls were all non-smoking females and frequency-matched to case subjects for age (±5 years). This study was approved by the institutional review board of China Medical University and written informed consent was obtained from each participant or each participant's representatives if direct consent could not be obtained. Data Collection A total of 10 ml of venous blood was collected from each patient. Patients were interviewed to collect information for demographics and environmental exposure at the time they were admitted to hospital. Information concerning demographic characteristics passive smoking cooking oil fume exposure fuel smoke exposure family history of cancer occupational exposure and dietary habit was obtained for each case and control by trained interviewers. An individual was defined as a smoker if she had consumed a total of 100 cigarettes in her lifetime; otherwise she was considered as a non-smoker. About fuel smoke exposure participants who used coal-fuel-burning stoves without chimneys were regarded as fuel smoke exposure. For exposure to cooking oil fumes participants were mainly asked about the method of cooking and eyes or throat irritation. For cooking methods participants were asked whether they cooked food in a stir-frying way and how many times a week; for eyes or throat irritation participants were asked how often they felt eyes or throat irritated by the oily smoke. There were four possible responses ranging from œnever œseldom œsometimes and œfrequently. Subjects were considered as cooking oil fume exposure if they met criteria as follows: (1) have cooked for over 15 years; (2) cooked food in a stir-frying way for more than twice a week; (3) felt eyes or throat irritated by oily smoke. Exposure for cooking oil fume was categorized as an indicator variable equal to 1 if participants reported frequently or sometimes and equal to 0 otherwise. Genotype Analysis Genomic DNA was extracted from peripheral blood samples by the conventional phenol-chloroform extraction method. SNP was genotyped by investigators blinded to case-control status in order to avoid any genotyping bias using TaqMan methodology and read with the Sequence Detection Software on an Applied Biosystems 7500 FAST Real-Time PCR System according to the manufacturer's instructions (Applied Biosystems Foster City CA). Amplification was done under the following conditions: 95°C for 10 min followed by 47 cycles of 92°C for 30 s and 60°C for 1 min. In this study 487 lung cancer patients and 516 controls were all genotyped successfully and 5% duplicated samples were randomly selected to assess the reproducibility for quality control with a concordance rate of 100%. Statistical Analysis The x2 test and t test were applied to estimate differences in demographic variables and distributions of genotypes between cases and controls. The association of genotypes of ATM rs189037 with risk of lung cancer was estimated by computing the odds ratios (ORs) and 95% confidence intervals (CIs) in unconditional logistic regression analysis. The Hardy-Weinberg equilibrium (HWE) was tested using goodness-fit x2 test to compare the genotype frequencies in the control subjects from those expected. A logistic regression model was used to evaluate gene-environment interactions. All data were analyzed with Statistical Product and Service Solutions (SPSS) v13.0 for Windows if not otherwise specified. All statistical analysis were two-sided and the significance level was set at P<0.05. Results Population characteristics A total of 487 lung cancer and 516 age-matched cancer-free controls were enrolled in this study. As shown in the mean ages of cases and controls (mean ±S.D.) were almost identical (56.5±11.7 and 56.3±12.5 respectively). All cases were female non-smoking lung cancer patients. No statistically significant difference was found between cases and controls in terms of age (P?=?0.248) and monthly income (P?=?0.084). Cases included 434 non-small cell lung cancer (NSCLC) patients and 53 small cell carcinoma patients. In the NSCLC cases there were 320 adenocarcinomas 73 squamous cell carcinomas and 41 other tumors with a variety of different pathologies (such as large cell carcinomas mixed cell carcinomas or undifferentiated carcinomas). .0096911.t001 Characteristics of lung cancer cases and controls. Variables Cases(%) Controls(%) P value Female 487 516 Mean age (years) 56.5±11.7 56.3±12.5 0.248a Income (yuan/month) 628.9±419.3 563.5±387.6 0.084a Never smoker 487 516 Histological type NSCLC 434(89.1) Adenocarcinoma 320(65.7) Squamous cell carcinoma 73(15.0) Small cell carcinoma 53(10.9) Other 41(8.4) a Student's t-test was used to compare the frequency distributions of demographic variables between the cases and controls. Association analysis The observed genotype frequencies among the control subjects was in agreement with that expected under the Hardy-Weinberg equilibrium (P?=?0.119). The distribution of ATM rs189037 genotypes among subjects were displayed in Table 2. Using subjects with the ATM rs189037 GG genotype as the reference group we calculated the ORs and 95%CIs for heterozygous carriers of GA genotype and homozygous carriers of AA genotype. No significant difference was observed between lung cancer cases and controls in each test (P>0.05). In order to increase the statistical power we combined the GA genotype with the AA genotype to compare with GG genotype as a dominant model and combined the GA genotype with the GG genotype to compare with AA genotype as a recessive model. The results indicated that individuals with AA genotype had a significantly elevated risk of lung adenocarcinoma compared with those carrying the GG or GA genotype (OR?=?1.44 95%CI 1.02“2.02 P?=?0.039). .0096911.t002 Table 2 Distribution of ATM rs189037 genotypes and ORs for lung cancer cases and controls. Genotype Cases(%) Controls(%) ORc 95%CI P overall (n?=?487) GG 148(30.4) 152(29.5) ref GA 240(49.3) 272(52.7) 0.91 0.68“1.20 0.494 AA 99(20.3) 92(17.8) 1.11 0.77“1.59 0.590 dominant modela 0.96 0.73“1.25 0.742 recessive modelb 1.18 0.86“1.61 0.313 NSCLC (n?=?434) GG 129(29.7) 152(29.5) ref GA 213(49.1) 272(52.7) 0.92 0.68“1.24 0.573 AA 92(21.2) 92(17.8) 1.18 0.81“1.71 0.397 dominant model 0.98 0.74“1.30 0.906 recessive model 1.24 0.90“1.71 0.192 Adenocarcinoma (n?=?320) GG 94(29.4) 152(29.5) ref GA 150(46.9) 272(52.7) 0.89 0.64“1.23 0.485 AA 76(23.7) 92(17.8) 1.33 0.90“1.99 0.156 dominant model 1.00 0.74“1.36 0.987 recessive model 1.44 1.02“2.02 0.039* Squamous cell carcinoma (n?=?73) GG 24(32.9) 152(29.5) ref GA 39(53.4) 272(52.7) 0.90 0.52“1.56 0.706 AA 10(13.7) 92(17.8) 0.69 0.32“1.51 0.355 dominant model 0.85 0.50“1.43 0.537 recessive model 0.74 0.37“1.50 0.400 *P<0.05. a GA+AA vs GG. b AA vs GA+GG. c adjusted for age and data were calculated by unconditional logistic regression. According to the results above we assumed that ATM rs189037 AA genotype might affect lung adenocarcinoma risk among non-smoking Chinese females. To test this hypothesis and explore the gene-environment interaction we adopted all the lung adenocarcinoma patients and cancer-free controls whose information about environmental risk factors were completely obtained such as fuel smoke exposure cooking oil fume exposure passive smoking and family history of cancer. Cases and controls were not included in the association analysis if any item of their environmental risk factors data was incomplete. After screening we had 242 lung adenocarcinoma cases and 277 cancer-free controls that were eligible. Selected demographic variables and environmental risk factors for the cases and controls were listed in Table 3. .0096911.t003 Table 3 Basic demographic data and environmental risk factor in lung adenocarcinoma cases and controls. Variable Cases(%) Controls(%) P value Female 242 277 Mean age (±S.D.) 55.7±11.6 56.6±11.0 0.346a Income(yuan/month) 626.5±384.0 558.1±391.4 0.066a Education Never 26(10.7) 26(9.4) 0.305 Elementary school 111(45.9) 141(50.9) Junior school 76(31.4) 69(24.9) Senior school and upwards 29(12.0) 41(14.8) Fuel smoke exposure 66(27.3) 76(27.4) 0.967b Cooking oil fume exposure 86(35.5) 70(25.3) 0.011b* Family history of cancer 26(10.7) 30(10.8) 0.975b Passive smoking exposure 141(58.3) 158(57.0) 0.778b *P<0.05. a Student's t-test was used to compare the frequency distribution of demographic variables between the cases and controls. b Peason's chi square was used to compare the frequency distribution of demographic variables fuel smoke exposure cooking oil fume exposure family history of cancer passive smoking between the cases and controls. As shown in Table 3 the mean ages of lung adenocarcinoma cases and controls (mean±S.D.) were similar (P>0.05). All cases were female non-smokers. There was no significant difference in the distribution of education fuel smoke exposure family history of cancer and passive smoking status between cases and controls. However the cases were more likely than the controls to report cooking oil fume exposure (P?=?0.011). Table 4 summarized the relationship between ATM rs189037 genotypes and lung adenocarcinoma risk with the stratification analysis of cooking oil fume exposure. The results indicated that in the recessive model (AA vs GA/GG) individuals carrying AA genotype had a 1.69-fold risk of lung adenocarcinoma compared with those carrying GA or AA genotype (95%CI 1.09“2.61 P?=?0.019). Considering the difference in the distribution of cooking oil fume exposure between cases and controls we conducted the stratification analysis. Our data revealed that AA homozygous carriers had an increased risk of lung adenocarcinoma among women who were never or seldom exposed to cooking oil fume (OR?=?1.89 95%CI 1.03“3.49 P?=?0.040). To well-understood the possible interaction between rs189037 polymorphism and cooking oil fumes exposure next we conducted a combined analysis. But there was no significant correlation found between this SNP and cooking oil fumes exposure. .0096911.t004 Table 4 Overall association stratification analysis and combined analysis between ATM rs189037 polymorphism and lung adenocarcinoma risk. Comparison model Genotype ORc 95%CI P value Overall GG ref GA 0.89 0.59“1.35 0.592 AA 1.57 0.93“2.62 0.089 dominant modela 1.05 0.70“1.55 0.825 recessive modelb 1.69 1.09“2.61 0.019* Stratified by cooking oil fuel exposure Yes GG ref GA 0.72 0.34“1.54 0.395 AA 1.19 0.43“3.24 0.740 dominant modela 0.81 0.39“1.68 0.573 recessive modelb 1.48 0.62“3.52 0.381 No GG ref GA 0.94 0.57“1.56 0.811 AA 1.89 1.03“3.49 0.040* dominant modela 1.16 0.72“1.87 0.542 recessive modelb 1.97 1.18“3.29 0.009* Cooking oil fumes exposure-genotype combined analysis non-exposed GG ref non-exposed GA 0.91 0.55“1.50 0.714 non-exposed AA 1.71 0.94“3.09 0.078 exposed GG 1.99 0.96“4.12 0.063 exposed GA 1.58 0.88“2.82 0.127 exposed AA 2.07 0.87“4.93 0.099 *P<0.05. a GA+AA vs GG. b AA vs GA+GG. c the overall test was adjusted for age fuel smoke exposure cooking oil fume exposure family history of cancer and passive smoking and the stratified analysis was adjusted for age fuel smoke exposure family history of cancer and passive smoking. Discussion It is well known that smoking is the most important risk factor for lung cancer but in the past 30years the incidence and death rate of lung cancer continues to increase in women who have a low rate of smoking [26]“[28]. Adenocarcinoma accounts for about 40% of all lung cancer with a higher incidence in women especially in those who have never smoked. Undoubtedly female non-smokers are the ideal subjects to examine unknown yet important environmental and genetic factors of lung adenocarcinoma. Exposure to cooking oil fume fuel smoke passive smoking and occupational exposures have been implicated as possible risk factors among Chinese women mainly based on Chinese people's traditional diet habits lifestyle and social environment [29] [30]. So we designed this study to evaluate the association between genetic variant and environmental risk factors and lung adenocarcinoma in female non-smokers. To date the association between ATM rs189037 and host susceptibility to lung "

Lung_Cancer

"The putative RrmJ domains of the 38 protein sequences were aligned with that of E. coli RrmJ using ClustalW and were slightly adjusted according to their predicted secondary structures which were calculated using the PORTER query (distill.ucd.ie/porter/) [27]. The Animals and the Heat Stress Treatment Twelve three-month-old female Landrace—Yorkshire crossbred (LYC) piglets were purchased from the Animal Industry Division of the Livestock Research Institute of the Council of Agriculture (COA) (Tainan Taiwan). The procedures used in this study were approved by the Institutional Animal Care and Use Committee (IACUC) of the COA Livestock Research Institute (Approval No. 98021). The piglets (n?=?4) were raised at 25°C and 60% humidity in animal houses which were equipped for temperature and humidity control [28] [29]. For the heat stress treatment the piglets that were raised at room temperature (25°C) were exposed to heat shock temperatures of 30°C or 35°C and maintained at 60% humidity for 1 week. The piglets were then sacrificed and tissue samples from 11 ans were isolated for total RNA extraction. Cell Culture The cancer cell lines of HepaG2 (ATCC No. HB-8065) TE671 (ATCC No. CCL-136) and A549 (ATCC No. CCL-185) were purchased from American Type Culture Collection (ATCC; Manassas VA USA). The lung adenocarcinoma CL1 sublines CL1-0 and CL1-5 were kindly provided by Dr. Jeremy J.W. Chen National Chung Hsing University Taichung Taiwan [30]. All of the cell lines were grown in Dulbecco™s Modified Eagle™s Medium (DMEM; Invitrogen Corp. Grand Island NY USA) containing high glucose (4500 mg/L) and supplemented with 10% fetal bovine serum (FBS) at 37°C and 5% CO2. At 80% confluence the cells were subcultured at a ratio of 1?3 to 1?5 and the medium was changed every three days as described previously [31] [32]. Heat Shock Treatment of the Cells In our heat shock response analysis the cancer cells that grew at 37°C and 5% CO2 were subjected to heat shock at 42°C or 45°C and 5% CO2 for 1 hour. After this heat shock treatment the cells were transferred to 37°C for 0 3 or 6 hours and then harvested for total RNA extraction. Cell Transfection via Electroporation The 6.74-kb pCMV-hFTSJ2-IRES2-DsRed plasmid was constructed by inserting the full-length human FTSJ2 (hFTSJ2) protein coding sequence into the EcoRI restriction site of the pIRES2-DsRed2 vector (Clontech Laboratories Inc. Mountain View CA USA). The TE671 and HepG2 cell lines were transfected with this plasmid via electroporation with a BTX ECM2001 system (BTX Holliston MA USA). Briefly 6—106 TE671 or 2—107 HepG2 cells were suspended in 400 µL of DMEM which contained 5 µg or 50 µg of plasmid DNA respectively and then the cells were subjected to electroporation at 200 V for 4 msec or 100 V for 30 msec respectively. After electroporation the cells were grown in a culture medium containing 400 µg/mL of the antibiotic G418 for the selection of cells that were stably expressing hFTSJ2. Isolation of the Mitochondrial and Cytosolic Protein Fractions The mitochondrial and cytosolic proteins of the TE671 cell fractions were isolated using the reagent-based method of the Mitochondria Isolation Kit (Pierce Rockford IL USA) according to the manufacturer™s instructions. Western Blot Analysis To analyze the expression of hFTSJ2 stable expression colonies of the TE671-hFTSJ2 and HepG2-hFTSJ2 cells were collected homogenized in 300 µL of RIPA buffer (5 mM Tris-HCl [pH 7.4] 0.15 M NaCl 1% NP-40 0.25% sodium deoxycholate 5 mM EDTA [pH 8.0] and 1 mM EGTA) held on ice for 30 min and then centrifuged at 14000 rpm for 30 min. The supernatants were collected as the total protein lysate. The supernatants (20 µg) were then separated by SDS-PAGE in a 12% acrylamide gel (acryl:bis of 30?0.8) and transferred to a polyvinylidene difluoride (PVDF) membrane [33] [34]. The membrane was blocked with 5% BSA (filtered through a 0.22-µm membrane) and immunoblotted with anti-hFTSJ2 (1?1000) and anti-GAPDH (1?500) antibodies overnight at 4°C. After washing with phosphate-buffered saline containing Tween 20 (PBST) the membrane was incubated with the appropriate horseradish peroxidase-conjugated secondary antibody for 1 hour at 25°C and the protein bands were detected by enhanced chemiluminescence (PerkinElmer Waltham MA USA) and an ImageQuant LAS 4000 mini system (GE Healthcare Biosciences Pittsburgh PA USA). For immunoblotting of the mitochondrial and cytosolic protein fractions 5 µg of protein from each fraction was separated by SDS-PAGE and immunoblotted with anti-hFTSJ2 (1?1000) anti-VDAC (mitochondrial fraction control 1?1000) and/or anti-MEK-1 (cytosolic fraction control 1?1000) antibodies. Immunofluorescence Microscopy The TE671-hFTSJ2 and HepG2-hFTSJ2 cells were grown to 80% confluence in 24-well dishes. Then the cells were fixed with 4% paraformaldehyde for 20 min and permeabilized with 0.1“0.3% Triton X-100 for 5 min followed by three washes with PBS. The cells were blocked with horse serum for 1 hour and incubated with an anti-hFTSJ2 antibody (1?1000) overnight at 4°C and then with the appropriate fluorescein isothiocyanate (FITC)-conjugated antibody for 1 hour. The cells were counter-stained with MitoTracker Red CMXRos (Invitrogen Corp. Grand Island NY USA) to stain the mitochondria and DAPI to stain the nuclei and then mounted with glycerol. The cells were examined by laser scanning confocal fluorescence microscopy in which FITC was excited at 488 nm MitoTracker Red was excited at 580 nm and DAPI was excited at 358 nm. Real-time RT-PCR and Semi-quantitative RT-PCR The total RNA was isolated from the cell lines or the porcine tissues using the TRIzol reagent (Invitrogen Corp. Grand Island NY USA) according to the manufacturer™s instructions. The total RNA was treated with DNase I (1 µL of DNase I per 1 µg of total RNA) at 37°C for 30 min to eliminate any genomic DNA contamination. Then 1 µL of a stop solution was added and the sample was incubated at 65°C for 10 min to inactivate the DNase I. The DNase I-treated RNA (1 µg) was used directly as a template for first-strand cDNA synthesis with the ImProm-II Reverse Transcription System (Promega Madison WI USA). Real-time RT-PCR was performed using the relative standard curve method with SYBR Green I (Sigma St. Louis MO USA) as the dsDNA fluorescence dye. The reactions were performed using a Roter-Gene 6000 system (Corbett Life Science Mortlake Australia) under the following conditions: 94°C for 5 min; 40 cycles of 95°C for 30 sec 59°C or 68°C for 30 sec and 72°C for 20 sec; and a melting curve from 65°C to 95°C [35]. Semi-quantitative RT-PCR reactions were performed under the following conditions: 94°C for 5 min and then 25 or 30 cycles at 95°C for 30 sec 59°C or 68°C for 30 sec 72°C for 20 sec and 72°C for 7 min. The amplified products were separated on a 1.5% agarose gel and then quantified using Kodak 1D software (Kodak New Haven CT USA). The primers which were used in real-time RT-PCR or semi-quantitative RT-PCR are listed in . .0090818.t001 Primer sequences for real-time and semi-quantitative RT-PCR. Species Gene Sense (5?-3?) Anti-sense (5?-3?) Human FTSJ2 GCTGGTGTGTGTTTCCTTTCA CAGAATCTGGTGCCTCTCGT HSP70.2 GCACGTTCGACGTGTCCAT GCTTGTTCTGGCTGATGTCCTT ?-actin CCGTCTTCCCCTCCATCGTGGG CGCAGCTCATTGTAGAAGGTGTGG GAPDH GAGAAACCTGCCAAGTATGATG ACCTGGTCCTCAGTGTAGCC Pig Ftsj2 ACGAGTTCCCAGGAGAATCAGA TGCTTTGGCAACGACCTTTAA Hsp70.2 GCACGTTCGACGTGTCCAT GCTTGTTCTGGCTGATGTCCTT ?-actin CATCACCATCGGCAACGA TTCCTGATGTCCACGTCGC Wound Healing Assay The TE671 or TE671-hFTSJ2 cells were grown in 60-mm dishes to 90% confluence. Then a wound was produced by scraping the cell monolayer with a sterile P200 pipette tip. During the wound healing process time-lapse images were obtained every 10 min for 12 hours and the cell migration area was calculated ([healing area/wounding area]—100%) using the ImageJ program (http://rsbweb.nih.gov/ij/index.html). Invasion Assay The invasion assay was performed on the TE671 and TE671-hFTSJ2 cells using Trans-well chambers with an 8-µm pore size (Merck Millipore Darmstadt Germany). The upper chamber of the Trans-well was pre-coated with Geltrex matrix gel (30 µL/well) (Invitrogen Corp. Grand Island NY USA) and inserted into the lower chamber which contained DMEM with 10% FBS. The cells (1—104) were suspended in 200 µL of DMEM and added to the upper chamber. After 12 hours the cells on the upper surface of the membrane were removed with a cotton swab and the cells on the lower surface of the membrane were fixed with methanol for 10 min and subjected to Giemsa staining. The Giemsa-positive area of the membrane was calculated ([Giemsa positive area/total area]—100%) using the ImageJ program. Statistical Analysis All of the data are presented as the means±standard error (SE). The statistical comparisons were performed using Student™s t-test. The Duncan method of one-way ANOVA was used for multiple group comparisons. The P<0.05 or P<0.01 level was considered significant. Results FTSJ2 is Closely Related to E. coli RrmJ RrmJ is a 23S rRNA 2?-O-ribose MTase and is conserved in nearly all of the different species. To evaluate the relationship among the RrmJ homologs a phylogenic tree with 39 RrmJ homologs was constructed. The NCBI BLASTp program was used to identify the homologs of the E. coli RrmJ protein in M. jannaschii S. cerevisiae Caenorhabditis elegans Drosophila melanogaster and in vertebrates. Using the minimum evolution method the phylogenic tree showed the following three phylogenies: FTSJ1/Trm7p FTSJ2/Mrm2p and FTSJ3/Spb1p (Figure 1). Using the JTT model to calculate the protein distances and comparing these distances within each phylogeny the protein distances within the FTSJ2/Mrm2p group were found to be larger than those within the FTSJ1/Trm7p and FTSJ3/Spb1p groups indicating that the RrmJ homologs FTSJ1 and FTSJ3 are more conserved between species than FTSJ2. However the distance between E. coli RrmJ and the root of the FTSJ2/Mrm2p group (distance: 0.84) was shorter than the roots of the FTSJ1/Trm7p and FTSJ3/Spb1p groups (distance: 1.25 and 1.28) suggesting that the FTSJ2/Mrm2p proteins are the most related to E. coli RrmJ and are presumed to be the orthologs of RrmJ. This assumption is supported by the known function of S. cerevisiae Mrm2p. Mrm2p catalyzes the methylation of 2?-O-ribose in the mitochondrial 21S rRNA [12] which has the same rRNA structure as the substrate of RrmJ. .0090818.g001 Figure 1 Phylogenetic tree of the E. coli RrmJ homologs from Eubacteria to Mammalia. This phylogenetic analysis represents the following three major homolog protein lineages: FTSJ1/Trm7p FTSJ2/Mrm2p and FTSJ3/Spb1p. The out-groups of the tree were catechol-O- methyltransferase VP39 and fibrillarin (PDB code 1VID 1AV6 and 1FBN respectively). These out-groups were chosen because of their similar functions and structures to E. coli RrmJ. The number at each branch node indicates the reliability of the splits (%) through the processing of 1000 bootstrap replicates. The GenBank accession numbers and species are shown for each protein. [F] and [S] denote proteins with known functions and protein structures respectively. The Protein Structures of the FTSJ2 Orthologs are Similar to that of E. coli RrmJ The protein sequence alignment of E. coli RrmJ M. jannaschii FtsJ S. cerevisiae Mrm2p and other FTSJ2 orthologs showed many similarities. The K50 D124 K164 and E199 residues which compose the catalytic center of RrmJ were present in all of the RrmJ orthologs. Furthermore the 19 residues involved in S-adenosylmethionine (S-AdoMet SAM) binding in RrmJ were also highly conserved in FTSJ2 (Figure 2). A comparison of the similarity of the full-length amino acid sequences of human FTSJ2 with E. coli RrmJ S. cerevisiae Mrm2p and porcine FTSJ2 which represented the Eubacteria Eukaryota and Mammalia homologs respectively showed that the E-values (and amino acid identities) were 3e-43 (35%) 3e-33 (29%) and 7e-140 (76%) respectively. .0090818.g002 Figure 2 Protein sequence alignment of E. coli RrmJ with its FTSJ2 orthologs in 7 different species. The ?-helices and ?-strands were based on the RrmJ protein structure (PDB code: 1EIZ). The stars and triangles indicate the K-D-K-E catalytic center and the SAM binding residues in RrmJ respectively. The residues with identical and similar chemical properties are highlighted in black and gray respectively. In addition a comparison of the two published three-dimensional protein structures of E. coli RrmJ and human FTSJ2 and a predicted structure of porcine FTSJ2 showed that these structures contain five ?-helixes and seven ?-strands that compose an open-sheet structure. The positions of the SAM binding residues and the amino acids of the catalytic center showed similar arrangements in the protein structures. Notably the first residue of the catalytic center lysine (K50 in RrmJ) showed an approximately 120° rotation in human FTSJ2 (PDB code: 2NYU) [36] compared with E. coli RrmJ (Figure S1). This rotation may account for the different structures of the rRNA substrates of the E. coli and the human proteins. FTSJ2 is Localized in the Mitochondria of Human Cells Mrm2p the FTSJ2 ortholog in S. cerevisiae is located in the mitochondria and is responsible for the 2?-O-ribose methylation of the 21S rRNA. Thus we detected the subcellular localization of the FTSJ2 protein in the human cell lines. A vector for the overexpression of hFTSJ2 driven by the CMV promoter was constructed (pCMV-hFTSJ2-IRES2-DsRed2; Figure 3A). The rhabdomyosarcoma (TE671) and hepatocarcinoma (HepG2) cell lines were transfected with the pCMV-hFTSJ2-IRES2-DsRed2 vector and the expression of the hFTSJ2 protein was detected by Western blot analysis. The results showed that the TE671-hFTSJ2 and HepG2-hFTSJ2 cells had higher expression levels of hFTSJ2 than the non-transfected cells (Figure 3B). Immunofluorescence showed that most of the hFTSJ2 protein was located in the cytoplasm but not in the nuclei in both the TE671-hFTSJ2 and HepG2-hFTSJ2 cells and the mitochondria which were stained with MitoTracker Red showed the same localization as hFTSJ2 (Figure 3C). In the analysis of the mitochondrial and cytosolic protein fractions hFTSJ2 was detected in the mitochondrial protein fraction but not in the cytosolic fraction (Figure 3D). These results indicated that human FTSJ2 as its ortholog in S. cerevisiae is a mitochondrial protein. .0090818.g003 Figure 3 Subcellular localization of human FTSJ2 in TE671 and HepG2 cells. (A) Schematic of the hFTSJ2 over-expression vector. (B) Over-expression of the hFTSJ2 protein in the TE671-hFTSJ2 and HepG2-hFTSJ2 stable clones. (C) Immunofluorescence staining with anti-hFTSJ2 (green) MitoTracker for mitochondria (red) and DAPI for nuclei (blue) in the TE671-hFTSJ2 and HepG2-hFTSJ2 cells. (D) Mitochondrial localization of the hFTSJ2 protein in non-transfected TE671 cells. VDAC and MEK-1 were used as the mitochondrial and cytosolic fraction controls respectively in the Western blot analysis. Ftsj2 mRNA is Expressed in all of the Porcine Tissues but at Different Levels Because of the higher similarity between human and porcine FTSJ2 (amino acid identity?=?76% and RrmJ domain identity?=?81%; Figure 2) and the similar physiological responses of humans and pigs we further analyzed the expression of the porcine Ftsj2 gene and sequenced the coding region of the porcine Ftsj2 mRNA (GenBank accession number: EU694400). Then 13 tissues from a female piglet were analyzed for the expression of porcine Ftsj2 mRNA by RT-PCR. The results showed that all of the 13 tissues expressed Ftsj2 mRNA at different levels. The heart and kidney showed the highest expression; the large intestine muscle lung spleen and liver showed mid-level expression; and the small intestine ovary brain stomach mammary gland and bladder showed the lowest expression (Figure S2). The Level of Ftsj2 mRNA Expression Increases in Several Tissues after Heat Shock Stress Previous studies have shown that the mRNA of E. coli rrmJ increased nearly 20-folds under heat shock stress [3] and was involved in the thermal adaptation of E. coli [7]. Thus the heat shock protein characteristics of mammalian FTSJ2 were also evaluated in piglets which are known to be thermally sensitive in the livestock industry. Three-month-old female piglets were raised at room temperature (25°C) and to produce enough heat shock stress in the warm-blooded piglets temperatures of 30°C or 35°C were used to stimulate the heat shock response for at least 1 week. The porcine Ftsj2 mRNA expression in 11 tissues from these piglets was detected and Hsp70.2 mRNA expression was used as the heat shock response positive control (Figures 4A and 4B). The results showed that Ftsj2 mRNA expression was up-regulated in the large intestine stomach lung and bladder and down-regulated in the small intestine muscle heart mammary gland kidney spleen and liver in the 30°C and 35°C environments (Figure 4A). Notably the only tissue that showed an up-regulation of both Ftsj2 mRNA expression and Hsp70.2 mRNA expression which corresponds to a positive heat shock response was the lung (Figure 4B). This result may have been caused by direct exposure of the lung tissue to the increased temperature through inhalation of the hot air. .0090818.g004 Figure 4 FTSJ2 mRNA expression after in vivo and in vitro heat shock treatments. Porcine Ftsj2 (A) and Hsp70.2 (B) mRNA expressions in piglets which were raised at 25°C 30°C or 35°C for 1 week. Human FTSJ2 (C) and HSP70.2 (D) mRNA expressions in A549 lung cells after 1 hour of heat shock at 42°C or 45°C followed by 0 3 or 6 hours of recovery at 37°C. Porcine Hsp70.2 or human HSP70.2 mRNA expression was used as the heat shock response control. The values are equal to?=?the means±SE; n?=?4. The bars with different letters represent a significant difference (P<0.05). The Level of Human FTSJ2 mRNA Expression Increases after Heat Shock in A549 Cells Our results showed that Ftsj2 mRNA was overexpressed in the porcine lung after heat shock; therefore a human lung adenocarcinoma epithelial cell line (A549) was used to further confirm the heat shock response in vitro to eliminate the systematic effects observed in the piglets. A549 cells were first grown at 37°C and 5% CO2. For the heat shock treatment the cells were grown at 42°C or 45°C 5% CO2 for 1 hour and then returned to 37°C for 03 or 6 hours respectively. Human FTSJ2 mRNA was detected by real-time RT-PCR. The results revealed that after both the 42°C and 45°C heat shock treatments the hFTSJ2 mRNA expression increased by more than 50% (50.6% and 52.6% at 3 hours and 0 hours respectively) (P<0.05) (Figure 4C) compared with the non-heat shock control. The up-regulation of the HSP70.2 mRNA indicated a positive heat shock response after the 42°C and 45°C treatments in the A549 cells (Figure 4D). FTSJ2 Inhibits Cancer Cell Migration and Invasion In a recent study in clinical samples of NSCLC the human FTSJ2 gene was located in a novel oncogenic locus of NSCLC. These results indicate that FTSJ2 may also be involved in the growth of cancer cells. To evaluate the roles of FTSJ2 in cancer the gene expressions in the NSCLC cell lines were detected. A human lung adenocarcinoma cell line (CL1) which was isolated from an adenocarcinoma from the lung of a 64-year-old man has been cloned and passed on for more than 60 generations. Using the Transwell invasion chamber the CL1 cell line was separated into six sublines according to their metastatic ability (CL1-0 to CL1-5 from lowest to highest invasiveness) [41]. The hFTSJ2 mRNA expression was detected in two of these sublines (CL1-0 and CL1-5). Surprisingly the more invasive CL1-5 cells showed a 50% decrease in the hFTSJ2 mRNA expression than the less invasive CL1-0 cells (Figures 5B and 5C). .0090818.g005 Figure 5 Comparison of the hFTSJ2 mRNA expression levels in two lung cancer sublines (CL1-0 and CL1-5). (A) Morphology of CL1-0 and CL1-5 cells. (B) Determination of the hFTSJ2 mRNA expression levels in the CL1-0 and CL1-5 cells in triplicate. (C) Relative quantification of the hFTSJ2 mRNA expression. GAPDH mRNA was used as an internal control. The values are equal to?=?the means±SE; n?=?3; **P<0.01 vs. the non-heat shock group. In addition to the down-regulation FTSJ2 increased cell invasion in the CL1-5 cells. To further evaluate the abilities of FTSJ2 to influence cell migration and metastasis the hFTSJ2-overexpressed cell line (TE671-hFTSJ2) previously mentioned was used in the cell migration and invasion assay and was compared with the non-transfected TE671 cells. The results of our wound healing assay showed that at 12 hours after wounding the migration area of the TE671-hFTSJ2 cells was significantly decreased (P<0.01) compared with the non-transfected TE671 cells (Figures 6A and 6B). The same results were also observed in our invasion assay in which the quantity of invaded TE671-hFTSJ2 cells per Trans-well was significantly lower than that of the non-transfected TE671 cells (Figures 6C and 6D)."

Lung_Cancer

"In addition how differential TS genotypes may impact on the outcome of patients depending on their smoking status or with Epidermal Growth Factor Receptor (EGFR) activating mutations tumors is to be determined. Finally although the toxicity profile described in most patients receiving pemetrexed in combination or as a single agent is usually favorable there are several reported cases of fundamentally dermatological hematological and potentially serious renal toxicities even when the recommended vitamin prophylaxis guidelines have been followed [13-15]. Nonetheless the tumor TS levels or its polymorphisms in each patient could explain these cases of severe toxicity as it has been suggested in other neoplasms treated with other antifolate drugs [9]. The potential association between different TS genotypes and the toxicity experienced by a European population of patients with NSCLC receiving pemetrexed is also to be studied. Three different types of polymorphisms have been described in the TS gene. In the gene promoter there is a variable number of tandem repeats (VNTR) of 28 pb in the 5?- region. Thus cases of two or three repetitions of this tandem TS gene promoter enhancer region (TSER) have been described [16]. A second type of polymorphism consists in a change in a single nucleotide (G >?C) in one of the sequences of the repetition comprising a single nucleotide polymorphism (SNP) [16]. A third modality of polymorphisms consists in the deletion or insertion of 6 pair of bases (bp) in the 3?-UTR region (untranslated region) [16]. In summary the potential usefulness of TS genotype as an independent prognostic factor or predictor of response to pemetrexed-based regimens in a European NSCLC population has not been studied. Similarly no clear evidence is available about the potential correlation between the different TS genotypes and the toxicity experienced by those patients. Therefore we decided to investigate the three known polymorphisms of TS gene and their correlation with objective response rate (ORR) progression-free survival (PFS) and overall survival (OS) as well as toxicity in European patients with advanced NSCLC treated with pemetrexed-based regimens. Methods Patients and samples Overall 25 consecutive stage III-IV NSCLC patients treated at a single institution from which peripheral blood samples were available were analyzed. All of them received pemetrexed-based regimens in the first second or third line settings according to our institutional therapeutic protocols. After the informed consent was obtained from all patients 10 ml of peripheral blood samples were collected before the administration of the first cycle of a pemetrexed-containing regimen. Blood samples were stored at the Biobank of the University of Navarra and were processed following standard operating procedures approved by the Ethical and Scientific Committees. Tumor ORR to the treatment was assessed using computerized tomography (CT) scans every two pemetrexed-based chemotherapy cycles and categorized according to the Response Evaluation Criteria In Solid Tumors (RECIST) v1.1 as per institutional protocol. The toxicities recorded during pemetrexed-based treatment were graded according to the Common Terminology Criteria for Adverse Events (CTCAE) version 4.0. TS enhancer region genotyping analysis The genomic DNA was extracted from the peripheral leucocytes. The genotypes of the TSER (VNTR) and SNP were determined by polymerase chain reaction (PCR). The variable number tandem repeat (VNTR) of 28 bp polymorphism and the G???C SNP in the first and second repeat were analyzed. A DNA fragment was amplified using previously described PCR conditions and primers [17] and directly sequenced using an ABI PRISM 3100 Genetic Analyzer (Applied Biosystems Foster City CA USA). The forward primer 5?-CGTGGCTCCTGCGTTTCC-3? and the reverse primer 3?-GAGCCGGCCACAGGCAT-5? were used. A modification of conventional conditions was necessary. PCR was performed in a reaction mixture with dNTP: 0.35 ?l Buffer: 0.25 ?l MgCl2: 17.5 ?l Tap polymerase: 0.5 ?l H2O: 18 ?l primers 0.1?+?0.1 ?l DMSO: 1.25 ?l and DNA: 2 ?l. The cycling conditions were denaturation 95°C for 10 minutes and 30 cycles at 95°C for one minute then at 64°C for one minute and 72°C one minute and finally seven minutes at 72?ºC. Aliquots of amplified fragments were separated on a 3% agarose gel and the TS VNTR genotype was determined staining 2R (210 base pairs; bp) and 3R (238 bp) alleles. After that we performed a PCR-restriction fragment length polymorphisms (RFLP) by Hae III digestion. The mixture was PCR product: 10 ?l H2O: 7 ?l Buffer 2 ?l and Hae III: 1 ?l. After that we incubated the mixture at 37°C overnight. Aliquots of digested fragments were separated on 12% acrylamide gel and the SNP genotype was determined. The digestion of fragments showed the different genotypes 2RGC: 664746 44 and 7 bp 2RCC: 11346 44 and 7 bp 3RGGCC (3RG): 66474644 28 and 7 bp 3RGCC (3RC): 944746 44 and 7 bp. TS 3?UTR region genotyping analysis The 3?UTR polymorphisms were analyzed by Restriction Fragment Length Polymorphism (RFLP). A fragment containing the 6 bp deletion/insertion was amplified using the reverse primer 5?-CAGATAAGTGGCAGTACAGA-3?and the forward primer 3?-CAAATCTGAGGGAGCTGAGT-5? in 10 ul of reaction mixture with dNTP: 4 ?l Buffer: 5 ?l MgCl2: 4 ?l Tap polymerase: 0.5 ?l H2O: 26.5 ?l primers 4?+?4 ?l and DNA: 2 ?l. The cycling conditions were denaturation 95°C for 10 minutes and 35 cycles at 95°C for 30 minutes then at 57°C for 30 minutes and 72°C one minute and finally seven minutes at 72°C. The fragments were amplified on 2% agarose gel. Afterwards the products were digested with Dra I and the mixture of PCR product: 20 ?l BSA 10%: 0.5 ?l Buffer: 5 ?l H2O: 23.5 ?l and Dra I: 1 ?l. Posteriorly the product was incubated one hour at 37°C. The final digested product was separated in a 3% agarose gel. The different genotypes were deletion 6 bp/insertion 6 bp insertion 6 bp/insertion 6 bp and deletion 6 bp/deletion 6 bp. The expected fragment sizes by genotyping were deletion 6 bp/insertion 6 bp: 148142 88 and 60 bp insertion 6 bp/insertion 6 bp: 88 and 60 bp and deletion 6 bp/deletion 6 bp: 142 bp. We repeated the PCR three times to ensure final results. EGFR mutations analysis As per institutional protocol all patients with advanced NSCLC were tested for EGFR activating mutations before treatment initiation. In brief after having the samples fixed in alcohol and stained by Papanicolau stain DNA was extracted and amplified by PCR technique using EGFR gene exons 1819 20 and 21 specific primers. ABI PRISM® 310 Genetic Analyzer equipment was used for the analysis of the sequencing reactions with both forward and reverse primers. Statistical analysis Fisher™s exact test was used to investigate the correlation between each genotype and the response to the treatment and the toxicity presented. Kaplan-Meier curves and log-rank test or Tarone-Ware test when indicated were calculated to correlate each genotype with the survival outcomes (PFS and OS). For the subgroup analysis EGFR mutation status and smoking history were considered in order to analyze potential differences in clinical outcome measures (ORR PFS and OS). The SPSS 15.0 software (SPSS Inc. Chicago IL) was employed to perform the statistical analysis. Results Patients™ characteristics and treatment The clinical and pathological characteristics of the patients included are summarized in . In brief our cohort was mainly composed by males with a median age of 59 years and a past smoking history showing good performance status. Most of the patients showed adenocarcinoma histology (88%) and showed distant metastasis (M1) at onset (72%). Most of the patients received a pemetrexed-based regimen in first line (84%). After a median follow up of 21 months 80% of patients have already progressed and 52% of them have died due to disease progression (). Patients™ characteristics N pts % Gender ??Female 11 44 ??Male 14 56 Age ??<60 13 52 ??> r =60 12 48 ECOG ??0 9 36 ??1 15 60 ??2 1 4 Tobacco ??Current smoker 4 16 ??Never smoker 7 28 ??Former smoker 14 56 Histology ??Adenocarcinoma 22 88 ??Adenocarcinoma poorly differentiated 2 8 ??Adeno-squamous 1 4 T ??T1-2 12 48 ??T3-4 13 52 N ??N0 6 24 ??N+ 19 76 M ??M0 7 28 ??M1 18 72 Lung metastases ??Presence 7 28 ??Absence 18 72 Liver metastases ??Presence 2 8 ??Absence 23 92 Bone metastases ??Presence 10 40 ??Absence 15 60 Brain metastases ??Presence 8 32 ??Absence 17 68 EGFR ??Wild type 23 92 ??Mutant 1 4 ??Unknown 1 4 Line of treatment ??First/Induction (stage III) 2 8 ??First 21 84 ??Second 1 4 ??Third 1 4 Response ??Response 18 72 ??Progression?+?Stabilization 7 28 Maintenance ??No maintenance 18 72 ??Maintenance 7 28 Progression ??Not progressed 6 24 ??Progressed 19 76 Clinical status ??Alive 12 48 ??Dead 13 52 Eastern Cooperative Oncology Group (ECOG). Epidermal Growth Factor Receptor (EGFR). In addition in 8 out of the 18 subjects showing multiple brain metastases at onset conventional whole-brain radiotherapy (300 cGy) was administered between first and second chemotherapy cycles following our institutional treatment guidelines. Finally 4 out of the 7 patients showing no distant metastases at onset responded to the pemetrexed-based induction chemotherapy. As per institutional protocol all four subjects underwent a 3-D conformal radiotherapy program with concurrent chemotherapy as previously published [18]. Correlation between ORR to the treatment and polymorphisms We studied the potential correlation between the different polymorphisms observed and the response to the treatment obtained (Table 2). For this purpose any kind of radiological response (complete or partial response) was compared to no response to the treatment (disease stabilization or progression). The presence of 3R/3R polymorphism seemed to predict a higher ORR (100%) compared to the rest of the genotypes with a trend toward statistical significance (p =?0.055). In the subgroup analysis a significantly higher ORR to pemetrexed for wild-type EGFR patients showing a 3R/3R genotype (100%) compared to the 2R/2R (77.8%) 2R/3R (33.3%) and 3R/4R (0%) was observed (p =?0.017). Table 2 Overall response rate to the treatment and polymorphisms observed Global distribution of polymorphisms (Pol) Response N (%) Stabilization or progression N (%) p value VNTR 2R/2R 7 (77.8) 2 (22.2) 0.055 3R/3R 7 (100) 0 (0) 2R/3R 4 (50) 4 (50) 3R/4R 0 (0) 1 (100) Pol VNTR (Subanalysis by EGFR status; group of native EGFR-patients) 2R/2R 7 (77.8) 2 (22.2) 0.017 3R/3R 7 (100) 0 (0) 2R/3R 2 (33.3) 4 (66.7) 3R/4R 0 (0) 1 (100) Global distribution of SNP Absence 6 (85.7) 1 (14.3) 0.626 Presence 12 (66.7) 6 (33.3) Global distribution of polymorphisms in 3?-UTR +6/+6 10 (83.3) 2 (16.7) 0.234 +6/-6 6 (54.5) 5 (45.5) -6/-6 2 (100) 0 (0) Pol 3?-UTR (Subanalysis by smoking habit stratification; group of active and former smokers) +6/+6 8 (100) 0 (0) 0.085 +6/-6 4 (50) 4 (50) -6/-6 2 (100) 0 (0) No statistically significant differences were observed comparing the presence and the absence of a SNP G >?C as shown in Table 2. Overall a non-significant correlation between the different 3?-UTR polymorphisms and the ORR was observed. However the genotype +6/+6 seemed to predict a higher ORR among active/former smokers (A/FS) compared to +6/-6 (100% vs. 50%; p =?0.085). Correlation between PFS and polymorphisms Regarding TSER polymorphisms we found a trend toward statistical significance (p =?0.089) in the differences in PFS observed among the different genotypes in favor of the 3R/3R genotype (Figure 1A). Figure 1 Kaplan-Meier curves for progression-free survival (PFS) in months (mo) associated with the different TS polymorphisms. A: TSER genotypes. B: Presence or absence of SNP. C: 3´UTR genotypes. In the case of the absence or presence of a SNP at the third repetition (3R allele) we observed a non-significant increased PFS in the subgroup of patients showing an absence of SNP (Figure 1B). Finally no significant correlations regarding the 3?UTR genotypes and PFS were observed (Figure 1C). Correlation between OS and polymorphisms In this cohort we found a significant correlation between TSER polymorphisms and OS (Figure 2A). The median OS was not reached for 3R/3R genotype patients whereas 2R/3R genotype subjects showed a 70 m OS followed by 3R/4R and 2R/2R genotypes with a median OS of 15 m and 13 m respectively (p =?0.019) (Figure 2A). Figure 2 Kaplan-Meier curves for overall survival (OS) in months (mo) associated with the different TS polymorphisms. A: TSER genotypes. B: Presence or absence of SNP. C: 3´UTR genotypes. No significant differences in OS were observed with regards to the presence/absence of SNP (Figure 2B) or regarding the 3?-UTR polymorphisms (Figure 2C). Correlation between toxicity and polymorphisms The most frequent toxicity was grade (G)1 anemia (28%) and nausea (20%) and G2 leucopenia (40%). The most commom G3-4 toxicities were leucopenia (16%) asthenia (8%) anemia (4%) neutropenia (4%) and dyspnea (4%). Overall we found no significant correlations between the toxicity profiles experienced by the patients and the different TS genotypes (Table 3). Table 3 Correlation between grades of toxicity and different genotypes Global distribution polymorphisms (Pol) No toxicity Grade 1-2 Grade 3-4 p value VNTR polymorphisms 2R/2R 2 (22.2) 4 (44.2) 3 (33.4) 0.545 3R/3R 2 (25) 5 (75) 0 (0) 2R/3R 2 (25) 4 (50) 2 (25) 3R/4R 1 (100) 0 (0) 0 (0) SNP polymorphisms Absence 3 (42.9) 4 (57.1) 0 (0) 0.3 Presence 4 (22.2) 9 (50) 5 (27.8) 3?-UTR polymorphisms +6/+6 3 (25) 6 (50) 3 (25) > 0.05 +6/-6 3 (27.3) 6 (54.5) 2 (18.2) -6/-6 1 (50) 1 (50) 0 (0) Discussion Pemetrexed a multitargeted antifolate drug is essential for the first and second-line as well as maintenance treatment of NSCLC patients with non-squamous histology [6]. TS is the main biological target of pemetrexed. Some studies have suggested that TS expression could be a predictive factor of response in NSCLC [19]. Moreover some VNTR genotypes have been associated with TS expression and activity in other tumor types such as colorectal cancer [17]. In NSCLC patients a correlation between different genotypes and the TS protein expression has been shown [20]. Shintani et al. [20] also confirmed that the TS mRNA levels were significantly higher in lung cancer tissues with the 3R/3R genotype as compared to those with the 2R/2R genotype. Nonetheless definitive studies addressing the correlation of the different genotypes of TS in circulating genomic DNA with response to the treatment PFS or OS in pemetrexed-treated NSCLC European patients are lacking. The potential influence of the EGFR status on those polymorphisms and their correlation with clinical outcome after pemetrexed-based treatment is also unexplored. A recent study by Hu et al. [21] investigated the different TS polymorphisms in genomic DNA of 90 Asian NSCLC patients. In contrast with our findings no specific genotype regarding the TSER or 3?-UTR polymorphisms studied seemed to correlate with a significant difference in ORR PFS or OS. This could be explained by substantial clinical differences between both populations. Our cohort was constituted by Caucasian patients compared to the Asian population studied by Hu et al. In addition our patients were mostly current or former smokers (72%) compared to the Asian population that showed 62% of never smokers. Also in our cohort the subjects mainly received pemetrexed-based chemotherapy as a first line regimen (92%) whereas the cohort studied by Hu et al. [21] was treated with pemetrexed as a second or further line in 62.2% of the cases. These remarkable differences in basic clinical characteristics and in particular the ethnicity between both cohorts are probably also explaining the differences observed in the 3?-UTR genotype frequency between our population and the one studied by Hu et al. In our cohort +6 bp/+6 bp +6 bp/-6 bp and -6 bp/-6 bp genotypes were found in 48% 44% and 8% of the cases respectively. In contrast0.078 47.8% and 44.4% were respectively found in the population studied by Hu et al. [21]. In a previous analysis performed on another Caucasian NSCLC population evaluated at the M.D. Anderson Cancer Center [22] a similar proportion of 3?-UTR genotypes according to our findings was observed (49.2% of +6 bp/+6 bp 42.4% of +6 bp/-6 bp and 8.4% of -6 bp/-6 bp). Additionally the low prevalence of the +6 bp/+6 bp genotype in an Asian population compared to our cohort may be confirmed by a recent study in which from 106 Asian NSCLC patients investigated none of them showed a +6 bp/+6 bp genotype in genomic circulating DNA [23]. Nontheless in this latter study [23] a significantly higher ORR was observed among patients showing a -6 bp/-6 bp 3?-UTR genotype compared to the ORR reported for patients presenting a -6 bp/+6 bp polymorphism (32.2% vs 12.7%; p =?0.008). Accordingly in our cohort a higher ORR in patients showing a -6 bp/-6 bp genotype compared to those presenting a -6 bp/+6 bp polymorphism was also observed (100% vs. 54.5%). However the statistical significance was not reached probably due to the relatively low number of patients included in our analysis. Interestingly enough in the subgroup analysis of our data the +6 bp/+6 bp genotype seemed to predict a higher ORR only among active/former smokers compared to +6 bp/-6 bp (100% vs. 50%; p =?0.085). This novel observation if validated in future studies could be relevant for selecting specific drugs for each patient in a second or third line setting. With regards to the TSER polymorphisms the presence of a 3R/3R polymorphism seemed to predict a higher ORR with a clear trend toward statistical significance (p =?0.055). Moreover that difference was even greater and statistically significant benefiting the subpopulation of wild-type EGFR patients. To our knowledge this is the first time that such observation has been made. An interesting preclinical study by Giovannetti et al. [24] investigated the activity profile of a combination therapy against NSCLC cell lines with different genotypes with erlotinib and pemetrexed. Remarkably pemetrexed increased EGFR phosphorylation and reduced Akt phosphorylation. Additionally erlotinib significantly reduced TS expression and activity. Thus when erlotinib and pemetrexed were combined a strong synergism in all NSCLC cells regardless of their genetic signature was observed. This potential crosstalk between the EGFR signaling pathway and the TS expression and activity could in part explain our novel findings showing a significantly higher ORR to pemetrexed in those wild-type EGFR patients harboring a 3R/3R polymorphism. However none of the previous studies have described the EGFR status of the patients analyzed and how that status impacted on the ORR to pemetrexed for certain TS polymorphisms. In terms of survival in the present series after a median follow-up of 21 months PFS was superior for those patients showing a 3R/3R genotype with a trend toward statistical significance as expected considering the higher ORR observed for patients with the same TSER genotype. The relatively low statistical power of our clinical cohort may be accounting for the lack of a full statistical significance observed. Regarding OS the advantage in PFS observed in patients showing the 3R/3R genotype translated into a significantly higher median OS in patients with the same polymorphism compared to the rest. Conversely in the study by Hu et al. [21] no specific genotype was significantly correlated with a superior PFS or OS. As aforementioned the dramatic differences in the population™s characteristics between both series might possibly explain this discordance. In our study conversely to the observations made by Wang et al. [23] a significantly superior PFS and OS in patients with the -6 bp/-6 bp 3?-UTR genotype has not been confirmed. Most probably this is also due to the differences in the genotype distribution among populations with markedly different ethnicity and epidemiological characteristics. Finally in accordance with Wang et al. [23] the toxicity profile was not significantly correlated with any TS genotype in our series. As aforementioned this study has some limitations due to its retrospective nature and the low number of patients investigated. Both could be responsible for a low statistical power that may impair our ability to find significant differences between subgroups of patients. Conclusions For the first time in a European population of NSCLC patients receiving pemetrexed the presence of the TSER 3R/3R polymorphism significantly correlated with a superior OS. Moreover this same polymorphism when associated to wild-type EGFR was correlated with a higher ORR to pemetrexed. The presence of the +6/-6 bp 3?-UTR genotype among active or former smokers was correlated to a higher ORR showing a trend toward statistical significance. Finally pemetrexed-induced toxicity was not significantly correlated with a specific TS genotype. These novel data warrant further investigation in larger prospective series and may help to patient™s selection if finally validated. Abbreviations NSCLC: Non-small cell lung cancer; TS: Thymidylate synthase; EGFR: Epidermal Growth Factor Receptor; VNTR: Variable number of tandem repeats; TSER: Thymidylate Synthase gene promoter enhancer region; SNP: Single nucleotide polymorphism; ORR: Overall response rate; PFS: Progression-free survival; OS: Overall survival; CT: Computerized tomography; RECIST: Response Evaluation Criteria in Solid Tumors; CTCAE: Common Terminology Criteria for Adverse Events; PCR: Polymerase chain reaction; RFLP: Restriction fragment length polymorphism; A/FS: Active/former smokers. Competing interests The authors declare that they have no competing interests. Authors™ contributions EA participated in the design of the study contributed to the patients™ identification and medical history charts revision and performed samples™ processing and statistical analyses as well as manuscript™s drafting. EC participated in the design of the study contributed to the patients™ identification and medical history charts revision and performed samples™ processing and statistical analyses as well as manuscript™s drafting. IL carried out samples™ processing and laboratory analysis. JS participated in the design of the study and contributed to the laboratory analysis. VC contributed to samples™ processing laboratory analysis and paper drafting. MS contributed to results´ interpretation and manuscript´s drafting. MRR contributed to drafting the manuscript and revising it critically for important intellectual content. PM aided to conceive the study and participated in its design and helped to draft the manuscript. LZ contributed to drafting the manuscript and revising it critically for important intellectual content. APG participated in the design of the study and contributed to the laboratory analysis. CR contributed to drafting the manuscript and revising it critically for important intellectual content. IGB conceived the study and its design contributed to patients™ selection drafted the manuscript and gave final approval. All authors read and approved the final version of the manuscript. Acknowledgements Blood samples from patients included in the study were kindly provided by the Biobank of the University of Navarra and processed following standard operating procedures approved by the Ethical and Scientific Committees. Funding This work has been funded by UTE project CIMA and by a grant (RD12/0036/0040) from Red Temática de Investigación Cooperativa en Cáncer Instituto de Salud Carlos III Spanish Ministry of Economy and Competitiveness & European Regional Development Fund œUna manera de hacer Europa. Siegel R Naishadham D Jemal A Cancer statistics 2012 CA Cancer J Clin 2012 62 10 29 10.3322/caac.20138 22237781 Sánchez MJ Payer T de Angelis R Larrañaga N Capocaccia R Martinez C CIBERESP Working Group Cancer incidence and mortality in Spain: estimates and projections for the period 1981“2012 Ann Oncol 2010 21 Suppl 3 iii30 iii36 20427358 Brambilla E Travis WD Colby TV Corrin B Shimosato Y The new World Health Organization classification of lung tumours Eur Respir J 2001 18 1059 1068 10.1183/09031936.01.00275301 11829087 Goffin J Lacchetti C Ellis PM Ung YC Evans WK Lung cancer disease site group of cancer care Ontario™s program in evidence-based care. First-line systemic chemotherapy in the treatment of advanced non-small cell lung cancer: a systematic review J Thorac Oncol 2010 5 260 274 10.1097/JTO.0b013e3181c6f035 20101151 Cohen MH Johnson JR Wang YC Sridhara R Pazdur R FDA drug approval summary: pemetrexed for injection (Alimta) for the treatment of non-small cell lung cancer Oncologist 2005 10 363 368 10.1634/theoncologist.10-6-363 15967829 Scagliotti GV Parikh P von Pawel J Biesma B Vansteenkiste J Manegold C Serwatowski P Gatzemeier U Digumarti R Zukin M Lee JS Mellemgaard A Park K Patil S Rolski J Goksel T de Marinis F Simms L Sugarman KP Gandara D Phase III study comparing cisplatin plus gemcitabine with cisplatin plus pemetrexed in chemotherapy-naive patients with advanced-stage non-small-cell lung cancer J Clin Oncol 2008 26 3543 3551 10.1200/JCO.2007.15.0375 18506025 Hanna N Shepherd FA Fossella FV Pereira JR De Marinis F von Pawel J Gatzemeier U Tsao TC Pless M Muller T Lim HL Desch C Szondy K Gervais R Shaharyar Manegold C Paul S Paoletti P Einhorn L Bunn PA Jr Randomized phase III trial of pemetrexed versus docetaxel in patients with non-small-cell lung cancer previously treated with chemotherapy J Clin Oncol 2004 22 1589 1597 10.1200/JCO.2004.08.163 15117980 Cohen MH Cortazar P Justice R Pazdur R Approval summary: pemetrexed maintenance therapy of advanced/metastatic nonsquamous non-small cell lung cancer (NSCLC) Oncologist 2010 15 1352 1358 10.1634/theoncologist.2010-0224 21148615 Lecomte T Ferraz JM Zinzindohoué F Loriot MA Tregouet DA Landi B Berger A Cugnenc PH Jian R Beaune P Laurent-Puig P Thymidylate synthase gene polymorphism predicts toxicity in colorectal cancer patients receiving 5-fluorouracil-based chemotherapy Clin Cancer Res 2004 10 5880 5888 10.1158/1078-0432.CCR-04-0169 15355920 Vignoli M Nobili S Napoli C Putignano AL Morganti M Papi L Valanzano R Cianchi F Tonelli F Mazzei T Mini E Genuardi M Thymidylate synthase expression and genotype have no major impact on the clinical outcome of colorectal cancer patients treated with 5-fluorouracil Pharmacol Res 2011 64 242 248 10.1016/j.phrs.2011.04.006 21536130 Zucali PA Giovannetti E Destro A Mencoboni M Ceresoli GL Gianoncelli L Lorenzi E De Vincenzo F Simonelli M Perrino M Bruzzone A Thunnissen E Tunesi G Giordano L Roncalli M Peters GJ Santoro A Thymidylate synthase and excision repair-cross-complementing group-1 as predictors of responsiveness in mesothelioma patients treated with pemetrexed-carboplatin Clin Cancer Res 2011 17 2581 2590 10.1158/1078-0432.CCR-10-2873 21262916 Tanaka F Wada H Fukui Y Fukushima M Thymidylate synthase (TS) gene expression in primary lung cancer patients: a large-scale study in Japanese population Ann Oncol 2011 22 1791 1797 10.1093/annonc/mdq730 21321092 Bosch-Barrera J Gaztañaga M Ceballos J Pérez-Gracia JL López-Picazo JM García-Foncillas J Ferrer M Sanz ML Pretel M Idoate MA Gil-Bazo I Toxic epidermal necrolysis related to pemetrexed and carboplatin with vitamin B12 and folic acid supplementation for advanced non-small cell lung cancer Onkologie 2009 32 580 584 10.1159/000232315 19816075 Bosch-Barrera J Montero A López-Picazo JM García-Foncillas J Ferrer M Yuste JR Gil-Bazo I Adult onset Still's disease after first cycle of pemetrexed and gemcitabine for non-small cell lung cancer Lung Cancer 2009 64 124 126 10.1016/j.lungcan.2008.09.013 19008012 Michels J Spano JP Brocheriou I Deray G Khayat D Izzedine H Acute tubular necrosis and interstitial nephritis during Pemetrexed therapy Case Rep Oncol 2009 2 53 56 10.1159/000208377 20740145 Lurje G Manegold PC Ning Y Pohl A Zhang W Lenz HJ Thymidylate synthase gene variations: predictive and prognostic markers Mol Cancer Ther 2009 8 1000 1007 19383851 Salgado J Zabalegui N Gil C Monreal I Rodríguez J García-Foncillas J Polymorphisms in the thymidylate synthase and dihydropyrimidine dehydrogenase genes predict response and toxicity to capecitabine-raltitrexed in colorectal cancer Oncol Rep 2007 17 325 328 17203168 Bosch-Barrera J García-Franco C Guillén-Grima F Moreno-Jiménez M López-Picazo JM Gúrpide A Pérez-Gracia JL Aristu J Torre W García-Foncillas J Gil-Bazo I The multimodal management of locally advanced N2 non-small cell lung cancer: is there a role for surgical resection? A single institution's experience Clin Transl Oncol 2012 14 835 841 10.1007/s12094-012-0874-3 22855163 Takezawa K Okamoto I Okamoto W Takeda M Sakai K Tsukioka S Kuwata K Yamaguchi H Nishio K Nakagawa K Thymidylate synthase as a determinant of pemetrexed sensitivity in non-small cell lung cancer Br J Cancer 2011 104 1594 1601 10.1038/bjc.2011.129 21487406 Shintani Y Ohta M Hirabayashi H Tanaka H Iuchi K Nakagawa K Maeda H Kido T Miyoshi S Matsuda H New prognostic indicator for non-small-cell lung cancer quantitation of thymidylate synthase by real-time reverse transcription polymerase chain reaction Int J Cancer 2003 104 790 795 10.1002/ijc.11014 12640689 Hu Q Li X Su C Chen X Gao G Zhang J Zhao Y Li J Zhou C Correlation between thymidylate synthase gene"

Lung_Cancer

"In the case of HCRT only one series was applied with 26 — 1.75 Gy?=?45.5 Gy delivered to the hemithorax with a simultaneous integrated boost of 26 — 2.15 Gy?=?55.9 Gy delivered to the R1/R2 region. Planning and dose calculation was performed on the Eclipse planning system (Varian Medical Systems Palo Alto CA) for a linear accelerator (Clinac 6EX or Trilogy Varian Medical Systems). The treatment technique and dose-volume constraints have been previously published [71011]. Follow-Up and recurrence analysis Patients were followed up every three to four months with clinical examinations and CT or PET/CT scans. Local tumor progression or recurrence was defined as an increasing radiographic abnormality within or partially within the irradiation field. Recurrence adjacent to the field border but not in-field was defined as marginal miss recurrence. Regional recurrence was defined as recurrence in close proximity but not within the irradiated field. Tumor recurrence in the contralateral hemithorax or abdominal cavity was classified as a distant recurrence [12]. All in-field recurrences were carefully analyzed by 2 of the authors (JK PD) in order to assess if they occurred in previously underdosed areas by comparing the respective diagnostic image with the radiation therapy treatment plan. Statistics All survival endpoints as well as tumor recurrence were measured from the date of treatment start (neoadjuvant chemotherapy) and were evaluated using the Kaplan Meier Method. In a subset of the cohort a matched pair analysis was performed in order to compare outcome after 3DCRT and HCRT. For this analysis the patients were matched for age preoperative TNM R and histology and sex (except one pair). Results Between 1999 and 2011 39 patients were treated with neoadjuvant chemotherapy and EPP followed by RT. All follow up patients were deceased at the time of this study. Matched pair analysis In the matched pair analysis 11 HCRT and 11 3DCRT patients were matched based on tumor staging resection status tumor histology age and gender (except one pair were the gender was not matched). In each group 3 patients had a tumor stage T1N0M0 with resection R0 and 8 patients tumor stage T2N0M0 with resection R1. Tumor histology was epithelioid for 6 patients and biphasic for 5 patients in each group. The mean age was 59.6 years and 59.8 years for patient™s in the HCRT and 3DCRT group. The median time to local relapse was increased by 49% with HCRT in comparison to 3DCRT from 10.9?±?5.4 months to 16.2?±?3.1 months (p?=?0.06) as displayed in . Three (27.3%) and eight patients (72.7%) had a local relapse after HCRT and 3DCRT respectively. Nine HCRT (81.8%) and nine 3DCRT (81.8%) patients developed metastases within a median time of 18.4?±?10.7 months and 10.9?±?8.6 months (p?=?0.21). The difference in disease free survival between HCRT and 3DCRT was not significant (p?=?0.72). The median overall survivals were 22.3?±?15.3 months for HCRT and 21.2?±?9.2 months for 3DCRT and are displayed in (p?=?0.57). Local control for 11 matched modulated radiotherapy (HCRT) patients and 11 3-dimensional conformal radiotherapy (3DCRT) patients. Overall survival for 11 matched modulated radiotherapy (HCRT) patients and 11 3-dimensional conformal radiotherapy (3DCRT) patients. Outcome of the entire cohort Fourteen HCRT and 25 3DCRT patients were treated and reviewed. Patient™s sex age tumor characteristics and resection are displayed on . Patient demographics and tumor characteristics of 39 patients who underwent neoadjuvant chemotherapy extrapleural pneumonectomy and radiotherapy Characteristic HCRT 3D-CRT n?=?14 n?=?25 Sex ??¢ Male 13 22 ??¢ Female 1 3 Mean age (years) 61 61 Side ??¢ Right 9 15 ??¢ Left 5 10 Tumor histology ??¢ Epithelioid 8 17 ??¢ Biphasic 6 8 Initial Tumor stage ??¢ T1 3 15 ??¢ T2 10 10 ??¢ T3 1 0 Initial Nodal stage ??¢ N0 14 22 ??¢ N1 0 1 ??¢ N2 0 2 Resection ??¢ R0 4 8 ??¢ R1 9 15 ??¢ R2 1 2 Abbreviation: HCRT: Highly conformal modulated radiotherapy 3DCRT: 3-dimensional conformal radiotherapy. The median overall survival was 20.8?±?14.4 months for the HCRT group and 26.9 ± 11.8 months for the 3DCRT group (p?=?0.48). In the HCRT group 10 patients (71%) died of progressive disease and 4 patients (29%) due to intercurrent disease: one patient died of septic shock one of acute myocardial infarction one of progressive biventricular heart failure and another patient who was well and without evidence of disease at two days before his sudden death most likely also died due to a cardiac event. In the 3DCRT group 24 patients (96%) died of progressive disease and one of septic shock (4%). The local control rates were improved after HCRT (p?=?0.30). Four HCRT patients (28.6%) suffered from locoregional relapse in comparison to 15 patients (60%) treated with 3DCRT. Analysis of tumor recurrence For patients treated with HCRT local relapse occurred in-field in 3 patients (21.4%) all within areas that had been treated with doses between 43 Gy to 59 Gy (according to our treatment planning protocol 95% of the prescribed 45 Gy (=43 Gy) should enclose the target volume which in this case is the tumor bed of the hemithorax ) and none in a clearly underdosed region. One patient (7.1%) had a marginal miss recurrence at the field border (13 Gy). In the 3DCRT group twelve patients (48%) had in-field recurrences in regions treated with doses between 30 Gy and 56 Gy (). Notably in 16% of patients treated with 3DCRT (4/25) in-field recurrences occurred in regions that were covered with doses of only 30 to 43 Gy instead of the prescribed ?45 Gy. One patient (4.0%) had a marginal miss recurrence (18 Gy). In one patient with a regional recurrence (4.0%) the delivered dose was not possible to define because no diagnostic CT was available. In one patient (4.0%) the site of recurrence could not be determined because of missing radiographs during follow-up. Locoregional recurrences in patients who underwent highly conformal modulated radiotherapy Localization Age/sex Histology Time to recurrence Dose in recurrence region (Months) (Gray) In-field recurrence 67/m Epithelioid 10 54 In-field recurrence 62/m Biphasic 15 56“59 In-field recurrence 64/m Epithelioid 10 43“50 Marginal miss 65/m Biphasic 17 13 Recurrence Locoregional recurrences in patients who underwent 3D-conformal radiotherapy Localization Age/sex Histology Time to recurrence Dose in recurrence region (Months) (Gray) In-field recurrence 61/m Epithelioid 21 50 In-field recurrence 68/m Biphasic 16 36 In-field recurrence 68/m Epithelioid 13 30 In-field recurrence 65/m Biphasic 19 56 In-field recurrence 65/m Biphasic 16 50 In-field recurrence 50/m Epithelioid 29 48 In-field recurrence 55/m Biphasic 8 50 In-field recurrence 66/m Biphasic 20 36 501 In-field recurrence 68/m Epithelioid 11 32“43 46“501 In-field recurrence 58/m Epithelioid 9 50 In-field recurrence 58/m Epithelioid 11 50 In-field recurrence 65/m Biphasic 19 30 Marginal miss recurrence 55/m Epithelioid 19 18 Regional recurrence 62/m Epithelioid 13 Not available Unknown 56/m Epithelioid 13 Not available 1The recurrence occurred in two separate regions. Distant recurrences occurred in ten patients (71.4%) treated with HCRT and in twenty 3DCRT patients (80%). "

Lung_Cancer

"11-years of experience. Surg Endosc23: 55“6118437482 7 CerfolioRJ BryantAS McCartyTP MinnichDJ (2011) A prospective study to determine the incidence of non-imaged malignant pulmonary nodules in patients who undergo metastasectomy by thoracotomy with lung palpation. Ann Thorac Surg91: 1696“1700 discussion 1700“1691.21619965 8 DownsSH BlackN (1998) The feasibility of creating a checklist for the assessment of the methodological quality both of randomised and non-randomised studies of health care interventions. J Epidemiol Community Health52: 377“3849764259 9 KondoH OkumuraT OhdeY NakagawaK (2005) Surgical treatment for metastatic malignancies. Pulmonary metastasis: indications and outcomes. Int J Clin Oncol10: 81“8515864692 10 PorterGA CantorSB WalshGL RuschVW LeungDH et al (2004) Cost-effectiveness of pulmonary resection and systemic chemotherapy in the management of metastatic soft tissue sarcoma: a combined analysis from the University of Texas M. D. Anderson and Memorial Sloan-Kettering Cancer Centers. J Thorac Cardiovasc Surg127: 1366“137215115994 11 PetersenRP PhamD BurfeindWR HanishSI TolozaEM et al (2007) Thoracoscopic lobectomy facilitates the delivery of chemotherapy after resection for lung cancer. Ann Thorac Surg83: 1245“1249 discussion 1250.17383320 12 PaulS AltorkiNK ShengS LeePC HarpoleDH et al (2010) Thoracoscopic lobectomy is associated with lower morbidity than open lobectomy: a propensity-matched analysis from the STS database. J Thorac Cardiovasc Surg139: 366“37820106398 13 WhitsonBA GrothSS DuvalSJ SwansonSJ MaddausMA (2008) Surgery for early-stage non-small cell lung cancer: a systematic review of the video-assisted thoracoscopic surgery versus thoracotomy approaches to lobectomy. Ann Thorac Surg86: 2008“2016 discussion 2016“2008.19022040 14 EckardtJ LichtPB (2012) Thoracoscopic versus open pulmonary metastasectomy: a prospective sequentially controlled study. Chest142: 1598“160222677347 15 AmbrogiV PaciM PompeoE MineoTC (2000) Transxiphoid video-assisted pulmonary metastasectomy: relevance of helical computed tomography occult lesions. Ann Thorac Surg70: 1847“185211156082 16 MargaritoraS PorziellaV D'AndrilliA CesarioA GalettaD et al (2002) Pulmonary metastases: can accurate radiological evaluation avoid thoracotomic approach? Eur J Cardiothorac Surg21: 1111“111412048094 17 ParsonsAM DetterbeckFC ParkerLA (2004) Accuracy of helical CT in the detection of pulmonary metastases: is intraoperative palpation still necessary? Ann Thorac Surg78: 1910“1916 discussion 1916“1918.15561000 18 KaytonML HuvosAG CasherJ AbramsonSJ RosenNS et al (2006) Computed tomographic scan of the chest underestimates the number of metastatic lesions in osteosarcoma. J Pediatr Surg41: 200“206 discussion 200“206.16410133 19 Long-term results of lung metastasectomy: prognostic analyses based on 5206 cases. The International Registry of Lung Metastases. J Thorac Cardiovasc Surg113: 37“499011700 20 MutsaertsEL ZoetmulderFA RutgersEJ (2001) Port site metastasis as a complication of thoracoscopic metastatectomy. Eur J Surg Oncol27: 327“32811373113 21 JohnstonePA RohdeDC SwartzSE FetterJE WexnerSD (1996) Port site recurrences after laparoscopic and thoracoscopic procedures in malignancy. J Clin Oncol14: 1950“19568656265 22 TreasureT (2007) Pulmonary metastasectomy: a common practice based on weak evidence. Ann R Coll Surg Engl89: 744“74817999813 23 RothJA PassHI WesleyMN WhiteD PutnamJB et al (1986) Comparison of median sternotomy and thoracotomy for resection of pulmonary metastases in patients with adult soft-tissue sarcomas. Ann Thorac Surg42: 134“1383741009 24 FloresRM IhekweazuUN RizkN DycocoJ BainsMS et al (2011) Patterns of recurrence and incidence of second primary tumors after lobectomy by means of video-assisted thoracoscopic surgery (VATS) versus thoracotomy for lung cancer. J Thorac Cardiovasc Surg141: 59“6421055770 25 SchaeffB PaolucciV ThomopoulosJ (1998) Port site recurrences after laparoscopic surgery. A review. Dig Surg15: 124“1349845574 26 ChenYR YeowKM LeeJY SuIH ChuSY et al (2007) CT-guided hook wire localization of subpleural lung lesions for video-assisted thoracoscopic surgery (VATS). J Formos Med Assoc106: 911“91818063512 27 MolnarTF GebitekinC TurnaA (2010) What are the considerations in the surgical approach in pulmonary metastasectomy? J Thorac Oncol5: S140“14420502249 28 NakajimaJ TakamotoS TanakaM TakeuchiE MurakawaT et al (2001) Thoracoscopic surgery and conventional open thoracotomy in metastatic lung cancer. Surg Endosc15: 849“85311443456 29 MutsaertsEL ZoetmulderFA MeijerS BaasP HartAA et al (2002) Long term survival of thoracoscopic metastasectomy vs metastasectomy by thoracotomy in patients with a solitary pulmonary lesion. Eur J Surg Oncol28: 864“86812477479 30 NakasA KlimatsidasMN EntwisleJ Martin-UcarAE WallerDA (2009) Video-assisted versus open pulmonary metastasectomy: the surgeon's finger or the radiologist's eye? Eur J Cardiothorac Surg36: 469“47419464921 31 CarballoM MaishMS JaroszewskiDE HolmesCE (2009) Video-assisted thoracic surgery (VATS) as a safe alternative for the resection of pulmonary metastases: a retrospective cohort study. J Cardiothorac Surg4: 1319239710 32 GossotD RaduC GirardP Le CesneA BonvalotS et al (2009) Resection of pulmonary metastases from sarcoma: can some patients benefit from a less invasive approach? Ann Thorac Surg87: 238“24319101304 33 ChaoYK ChangHC WuYC LiuYH HsiehMJ et al (2012) Management of lung metastases from colorectal cancer: video-assisted thoracoscopic surgery versus thoracotomy”a case-matched study. Thorac Cardiovasc Surg60: 398“40422228090 101150042 30118 Mol Cancer Res Mol. Cancer Res. Molecular cancer research : MCR 1541-7786 1557-3125 24202705 3946989 10.1158/1541-7786.MCR-13-0300 NIHMS538386 œNEDD9 Depletion Leads to MMP14 Inactivation by TIMP2 and Prevents Invasion and Metastasis. McLaughlin Sarah L. 5 * Ice Ryan J. 5 * Rajulapati Anuradha 5 Kozyulina Polina Y. 1 Livengood Ryan H. 4 Kozyreva Varvara K. 5 Loskutov Yuriy V. 5 Culp Mark V. 3 Weed Scott A. 2 5 Ivanov Alexey V. 1 5 Pugacheva Elena N. 1 5 # 1Department of Biochemistry West Virginia University School of Medicine Mantown WV 26506 2Department of Neurobiology and Anatomy West Virginia University School of Medicine Mantown WV 26506 3Department of Statistics West Virginia University School of Medicine Mantown WV 26506 4Department of Pathology West Virginia University School of Medicine Mantown WV 26506 5Mary Babb Randolph Cancer Center West Virginia University School of Medicine Mantown WV 26506 #Corresponding author: Elena N. Pugacheva Mailing address: Department of Biochemistry and Mary Babb Randolph Cancer Center PO Box 9142 1 Medical Center Drive West Virginia University School of Medicine Mantown WV 26506. Phone: (304) 293-5295; Fax: (304) 293-4667; epugachevahsc.wvu.edu S.L. McLaughlin* and R. J. Ice* contributed equally to this work. 17 12 2013 07 11 2013 1 2014 01 1 2015 12 1 69 81 The scaffolding protein NEDD9 is an established pro-metastatic marker in several cancers. Nevertheless the molecular mechanisms of NEDD9 driven metastasis in cancers remain ill defined. Here using a comprehensive breast cancer (BCa) tissue microarray it was show that increased levels of NEDD9 protein significantly correlated with the transition from carcinoma in situ to invasive carcinoma. Similarly it was shown that NEDD9 overexpression is a hallmark of highly invasive BCa cells. Moreover NEDD9 expression is crucial for the protease-dependent mesenchymal invasion of cancer cells at the primary site but not at the metastatic site. Depletion of NEDD9 is sufficient to suppress invasion of tumor cells in vitro and in vivo leading to decreased circulating tumor cells (CTCs) and lung metastases"

Lung_Cancer

"This represents a 160-fold preference for ?v?6. As a reference point the maximum concentration of the imaging probe in the blood of a mouse is ~5 nM; this is substantially below the Kd of the H2009.1-10mer dimeric peptide for ?v?3 and ?v?5 and no binding of the peptide to these purified integrins was detected at this concentration. In the same assay the well characterized ?v?3-binding peptide cRGDyK was determined to have a Kd of 4.9 ± 2.1 nM for ?v?3 but no detectable binding to ?v?6 was observed up to 1 µM. We further evaluated the specific ?v?3 integrin expression in H2009 and H460 tumors using our previously reported peptide-RGD based dimeric probe (64Cu-CB-TE2A-(c(RGDyK))2) ( and ). Unlike 64Cu-M10 64Cu-(M10)2 64Cu-D10 and 64Cu-AcD10 64Cu-CB-TE2A-(c(RGDyK))2 clearly visualized both tumors and showed nearly identical tumor uptake at all three time points (1 h: 1.58 ± 0.13 %ID/g in H2009 vs 1.64 ± 0.20 %ID/g in H460; 4 h: 1.07 ± 0.21 %ID/g in H2009 vs 1.09 ± 0.24 %ID/g in H460; 24 h: 0.70 ± 0.29 %ID/g in H2009 vs. 0.72 ± 0.10 %ID/g in H460). In sum our data confirms that four probes built upon the H2009.1-10mer peptide do not recognize ?v?3 but specifically bind to ?v?6 in NSCLCs. Of note 64Cu-CB-TE2A-(c(RGDyK))2 exhibited significantly lower kidney uptake in both tumor models than 64Cu-(M10)2 64Cu-D10 or 64Cu-AcD10 (p < 0.0001) which indicates that the CB-TE2A chelator scaffold has a negligible role in the high kidney accumulation. Discussion The role of molecular tumor profiling is ever-increasing in clinical practice for diagnosis treatment planning and monitoring of disease. There is an increasing demand to diagnose tumors based on prognostic biomarkers in order to select the therapy that is most likely to successfully treat an individual patient's cancer. The ?v?6-integrin is an emerging prognostic biomarker for NSCLC as well as other epithelial based cancer. Expression of ?v?6 in NSCLC patients is associated with poor survival. The up-regulation of ?v?6-integrin in early stage NSCLC as well as its association with a pro-invasive NSCLC phenotype makes it highly desirable target for diagnostic and therapeutic application 11 12. To date a few ?v?6-targeted probes have been reported. Of which most efforts are based on a 20 amino acid peptide derived from the coat protein of foot and mouth disease virus (A20FMDV2 Sequence: NAVPNLRGDLQVLAQKVART). This peptide sequence binds to ?v?6 with low nanomolar affinity. When modified and labeled with 18F the peptidic PET probe ([18F]FBA-A20FMDV2) was able to show a reasonable tumor uptake (0.66 %ID/g at 1 h) in an ?v?6+ tumor model although the tumor uptake retention needs to be further improved 37 38. Recently a ?v?6-binding cysteine knot was engineered to improve in vivo stability 39 40. This ligand displays similar affinity and specificity for ?v?6 as the A20FMDV peptide. When modified and labeled with 64Cu the cysteine knot showed good tumor uptake and retention (1.8 ± 0.50% 1 h and 1.46 ± 0.43% 24 h). However the modest tumor to lung ratio (1.89 ±0.81% 1 h and 1.25 ± 0.28% 24 h) may hamper the use of this probe for detection of NSCLC tumors. Additionally this probe requires biosynthesis and may invoke an immunological response upon repeat injections. Success of a ?v?6-specific PET imaging probe depends upon the choice of a ligand with high binding affinity and selectivity towards ?v?6-integrin. The H2009.1 peptide was selected by biopanning a phage displayed-peptide library on intact H2009 NSCLC cells. Subsequently we determined that the H2009.1 peptide binds with high binding affinity and selectivity to ?v?6+ 8 20. Not surprisingly the selected peptide sequence contains an Arginine-Glycine-Aspartate (RGD) tripeptide sequence a well-known ligand for many integrins 41 42. However the peptide is specific for ?v?6 and does not bind other RGD-binding integrins 8. Importantly this peptide does not bind cells that express other RGD binding integrins including ?v?5 ?v?3 and ?5?1 but lack ?v?6. Furthermore we have shown here that the H2009.1-10mer dimeric peptide has a >160-fold preference for purified ?v?6 for compared to ?v?5 and ?v?3. The specificity of the H2009.1 peptide for ?v?6-integrin arises from the peptide sequence LATL directly to the carboxy-terminal side of the RGD. The sequence LXXL has been shown to impart ?v?6-specificity when it flanks the RGD domain 18 43-46. Notably the binding of H2009.1 peptide showed a linear correlation with the ?v?6-integrin expression on the cell surface which enables the H2009.1 peptide as an ideal ligand for ?v?6+ tumor detection as well as quantification 8 20. However like other peptides selected from phage displayed libraries the corresponding synthetic monomer peptide was not ideal for molecular imaging especially at the later time points primarily due to suboptimal binding affinity 47. The phage-displayed library from which the H2009.1 peptide was selected presents the peptide at the N-terminus of the phage pIII coat protein. As such the peptide is displayed at one end of the filamentous phage in 3 - 5 copies. Thus target-specific binding of the phage is likely driven by both the peptide sequence and multimeric presentation of peptides. Multimeric presentation of the H2009.1-10mer peptide was sought to increase the receptor-ligand binding affinity while maintaining the specificity of the peptide for tumor detection with the aim to enhance the specific PET imaging signal 2226 29. Given that juxtaposition positioning of H2009.1-10mer peptide in the three dimensional space might play a key role in ligand-receptor interaction on the cell surface we employed two complimentary multimerization approaches to evaluate the anticipated multivalent effect. First simultaneous presentation of two monomeric peptides on a divalent BFC scaffold (CB-TE2A(tBu)2-(Mal)2) gave a scaffold-based divalent conjugate H2(M10)2. Second the isolated H2009.1-10mer peptide was dimerized and subsequently presented on a monovalent BFC scaffold (CB-TE2A(tBu)2-Mal) to provide peptide-based divalent conjugates H2D10 and H2(Ac)D10. In all cases a polyethylene glycol (PEG) linker was included in the peptide design in order to increase the solubility of the resulted peptide conjugates in aqueous solution and to act as a spacer between the chelating scaffold and the peptide moiety for optimal in vivo kinetics and high tumor uptake. Indeed it was reported that attaching a defined length 28-PEG spacer to A20FMDV2 could provide a 3-fold tumor uptake increase although higher uptake was also observed in non-target ans 37. The multivalent effect on binding affinity of isolated peptides was evaluated in a cell-based assay using H2009 human NSCLC cell line. As expected divalent conjugates of H2009.1-10mer peptide (H2-(M10)2 H2-D10 and H2-AcD10) showed a 4 - 6 fold enhancement in their binding affinity over the monovalent one (H2-M10)."

Lung_Cancer

" Based on the above analysis we speculated that there may be some interaction between p120ctn isoform 3A and snail which plays a role in suppressing EMT in lung cancer cells expressing cytoplasmic E-cadherin but this hypothesis requires further study. Importantly we also found that knockdown of p120ctn-1A in SPC cells with cytoplasmic E-cadherin resulted in decreased twist expression (B). Meanwhile transfection of LK2 cells which also showed cytoplasmic localization of E-cadherin with the p120ctn isoform 1A plasmid resulted in increased twist expression (B). However no changes in twist expression were observed in the rest of the experiments (A 4A). As a transcription factor and master gene regulator of EMT [39] [40] twist can downregulate E-cadherin expression [41] and upregulate N-cadherin and other mesenchymal biomarkers [42]. Increased twist expression in LK2 cells transfected with the p120ctn isoform 1A plasmid indicated that transcriptional activation took place and further suggested that the p120ctn isoform 1A may have translocated into the nucleus upon binding of E-cad/CTF2 in the cytoplasm consequently activating the Wnt signaling pathway to promote EMT. Decreased twist expression in SPC cells transfected with p120ctn-1A-siRNA indicated that transcriptional activity was downregulated and suggested that ablation of p120ctn isoform 1A resulted in the inhibtion of EMT by removing the stimulatory effect of the Wnt signaling activity by p120ctn isoform 1A. In the H460 and H1299 cells with E-cadherin localized in the membrane the unchanged twist expression confirmed that p120ctn isoforms 1A and 3A could bind to E-cadherin and maintain effective cell-cell adhesion in order to suppress EMT instead of affecting the Wnt/twist pathway. Intriguingly overexpression of p120ctn isoform 3A did not change twist expression in LK2 cells expressing cytoplasmic E-cadherin indicating that p120ctn isoform 3A did not activate transcription. Therefore we firmly believe in the above hypothesis that p120ctn isoform 3A may interact with snail in some manner to influence E-cadherin expression and suppress EMT in lung cancer cells carrying cytoplasmic E-cadherin. Previous studies have observed that p120ctn-1A restored the cytoplasmic expression of E-cadherin whereas p120ctn-3A could not [20] which seems to be contradictory with the results of this study. However the method in previous studies of knocking down p120ctn expression and then transfecting p120ctn isoforms 1A and 3A plasmids into cells is different from that in the current study in which cells were only transiently transfected with p120ctn isoforms 1A and 3A plasmids. Therefore the different research methods may have led to different effects on E-cadherin. We also noted that in previous studies decreased and almost undetectable levels of E-cadherin by ablation of p120ctn resulted in the failure of exogenous p120ctn-1A to translocate into the nucleus to activate the Wnt/b-catenin pathway and decrease E-cadherin expression due to the deletion of the binding partner E-cad/CTF2. However the LK2 and H1299 cell lines used in these experiments expressed E-cadherin in the present study. E-cadherin binds primarily to unphosphorylated p120ctn isoform 3A whereas tyrosine-phosphorylated p120ctn isoform 1A interacts exclusively with N-cadherin [23]. In the previous studies exogenous p120ctn isoform 3A was prevented from binding and stabilizing E-cadherin after its ablation while in the present study the exogenous p120ctn isoform 3A could stabilize E-cadherin expression directly on the membrane or indirectly by increasing its cytoplasmic expression via regulation of snail expression. Of course all of these findings will need to be further investigated. In we for the first time found that p120ctn isoforms 1A and 3A to have different functions in EMT of lung cancer cells with E-cadherin expressed in different subcellular locations. When E-cadherin was localized on the cell membrane p120ctn isoforms 1A and 3A both could inhibit EMT and reduce the cell invasiveness phenotype. When E-cadherin was localized in the cytoplasm p120ctn isoform 1A promoted EMT and enhanced cell invasion while p120ctn isoform 3A inhibited EMT and reduced cell invasiveness. We thank Dr. Albert B. Reynolds (Department of Cancer Biology Vanderbilt University School of Medicine TN USA) for kindly providing p120ctn isoforms 1A and 3A cDNA plasmids. References 1 ThieryJP SleemanJP (2006) Complex networks orchestrate epithelial-mesenchymal transitions. Nat Rev Mol Cell Biol7: 131“14216493418 2 ShookD KellerR (2003) Mechanisms mechanics and function of epithelial-mesenchymal transitions in early development. Mech Dev120: 1351“138314623443 3 StockingerA EgerA WolfJ BeugH FoisnerR (2001) E-cadherin regulates cell growth by modulating proliferation-dependent beta-catenin transcriptional activity. J Cell Biol154: 1185“119611564756 4 ValdesF AlvarezAM LocascioA VegaS HerreraB et al (2002) The epithelial mesenchymal transition confers resistance to the apoptotic effects of transforming growth factor Beta in fetal rat hepatocytes. Mol Cancer Res1: 68“7812496370 5 HuberMA KrautN BeugH (2005) Molecular requirements for epithelial-mesenchymal transition during tumor progression. Curr Opin Cell Biol17: 548“55816098727 6 WheelockMJ ShintaniY MaedaM FukumotoY JohnsonKR (2008) Cadherin switching. J Cell Sci121: 727“73518322269 7 PeinadoH OlmedaD CanoA (2007) Snail Zeb and bHLH factors in tumour progression: an alliance against the epithelial phenotype?Nat Rev Cancer7: 415“42817508028 8 PeinadoH PortilloF CanoA (2004) Transcriptional regulation of cadherins during development and carcinogenesis. Int J Dev Biol48: 365“37515349812 9 VandewalleC ComijnJ De CraeneB VermassenP BruyneelE et al (2005) SIP1/ZEB2 induces EMT by repressing genes of different epithelial cell-cell junctions. Nucleic Acids Res33: 6566“657816314317 10 WarzechaCC SatoTK NabetB HogeneschJB CarstensRP (2009) ESRP1 and ESRP2 are epithelial cell-type-specific regulators of FGFR2 splicing. Mol Cell33: 591“60119285943 11 SlorachEM ChouJ WerbZ (2011) Zeppo1 is a novel metastasis promoter that represses E-cadherin expression and regulates p120-catenin isoform expression and localization. Genes Dev25: 471“48421317240 12 IshiyamaN LeeSH LiuS LiGY SmithMJ et al (2010) Dynamic and static interactions between p120 catenin and E-cadherin regulate the stability of cell-cell adhesion. Cell141: 117“12820371349 13 WangEH LiuY XuHT DaiSD LiuN et al (2006) Abnormal expression and clinicopathologic significance of p120-catenin in lung cancer. Histol Histopathol21: 841“84716691536 14 BellovinDI BatesRC MuzikanskyA RimmDL MercurioAM (2005) Altered localization of p120 catenin during epithelial to mesenchymal transition of colon carcinoma is prognostic for aggressive disease. Cancer Res65: 10938“1094516322241 15 JiangG WangY DaiS LiuY StoeckerM et al (2012) P120-catenin isoforms 1 and 3 regulate proliferation and cell cycle of lung cancer cells via beta-catenin and Kaiso respectively. PLoS One7: e3030322276175 16 LiuY DongQZ ZhaoY DongXJ MiaoY et al (2009) P120-catenin isoforms 1A and 3A differently affect invasion and proliferation of lung cancer cells. Exp Cell Res315: 890“89819150613 17 AhoS LevansuoL MontonenO KariC RodeckU et al (2002) Specific sequences in p120ctn determine subcellular distribution of its multiple isoforms involved in cellular adhesion of normal and malignant epithelial cells. J Cell Sci115: 1391“140211896187 18 SotoE YanagisawaM MarlowLA CoplandJA PerezEA et al (2008) p120 catenin induces opposing effects on tumor cell growth depending on E-cadherin expression. J Cell Biol183: 737“74919015320 19 YanagisawaM AnastasiadisPZ (2006) p120 catenin is essential for mesenchymal cadherin-mediated regulation of cell motility and invasiveness. J Cell Biol174: 1087“109616982802 20 YuJ MiaoY XuH LiuY JiangG et al (2012) N-terminal 1-54 amino acid sequence and Armadillo repeat domain are indispensable for P120-catenin isoform 1A in regulating E-cadherin. PLoS One7: e3700822615871 21 Travis WD Brambilla E Muller-Hermelink HK (2004) Pathology and Genetics: Tumours of the Lung Pleura Thymus and Heart. Lyon: IARC. 22 GoldstrawP (2011) Updated staging system for lung cancer. Surg Oncol Clin N Am20: 655“66621986263 23 SeidelB BraegS AdlerG WedlichD MenkeA (2004) E- and N-cadherin differ with respect to their associated p120ctn isoforms and their ability to suppress invasive growth in pancreatic cancer cells. Oncogene23: 5532“554215107817 24 KeirsebilckA BonneS StaesK van HengelJ NolletF et al (1998) Molecular cloning of the human p120ctn catenin gene (CTNND1): expression of multiple alternatively spliced isoforms. Genomics50: 129“1469653641 25 AhoS RothenbergerK UittoJ (1999) Human p120ctn catenin: tissue-specific expression of isoforms and molecular interactions with BP180/type XVII collagen. J Cell Biochem73: 390“39910321838 26 ReynoldsAB CarnahanRH (2004) Regulation of cadherin stability and turnover by p120ctn: implications in disease and cancer. Semin Cell Dev Biol15: 657“66315561585 27 CheungLW LeungPC WongAS (2010) Cadherin switching and activation of p120 catenin signaling are mediators of gonadotropin-releasing hormone to promote tumor cell migration and invasion in ovarian cancer. Oncogene29: 2427“244020118984 28 ThoresonMA AnastasiadisPZ DanielJM IretonRC WheelockMJ et al (2000) Selective uncoupling of p120(ctn) from E-cadherin disrupts strong adhesion. J Cell Biol148: 189“20210629228 29 BukholmIK NeslandJM Borresen-DaleAL (2000) Re-expression of E-cadherin alpha-catenin and beta-catenin but not of gamma-catenin in metastatic tissue from breast cancer patients [seecomments]. J Pathol190: 15“1910640987 30 PeiferM YapAS (2003) Traffic control: p120-catenin acts as a gatekeeper to control the fate of classical cadherins in mammalian cells. J Cell Biol163: 437“44014610049 31 DavisMA IretonRC ReynoldsAB (2003) A core function for p120-catenin in cadherin turnover. J Cell Biol163: 525“53414610055 32 MirandaKC JosephSR YapAS TeasdaleRD StowJL (2003) Contextual binding of p120ctn to E-cadherin at the basolateral plasma membrane in polarized epithelia. J Biol Chem278: 43480“4348812923199 33 teinhusenU WeiskeJ BadockV TauberR BommertK et al (2001) Cleavage and shedding of E-cadherin after induction of apoptosis. J Biol Chem276: 4972“498011076937 34 SpringCM KellyKF O'KellyI GrahamM CrawfordHC et al (2005) The catenin p120ctn inhibits Kaiso-mediated transcriptional repression of the beta-catenin/TCF target gene matrilysin. Exp Cell Res305: 253“26515817151 35 FerberEC KajitaM WadlowA TobianskyL NiessenC et al (2008) A role for the cleaved cytoplasmic domain of E-cadherin in the nucleus. J Biol Chem283: 12691“1270018356166 36 DiMeoTA AndersonK PhadkeP FanC PerouCM et al (2009) A novel lung metastasis signature links Wnt signaling with cancer cell self-renewal and epithelial-mesenchymal transition in basal-like breast cancer. Cancer Res69: 5364“537319549913 37 MiaoY LiuN ZhangY LiuY YuJH et al (2010) p120ctn isoform 1 expression significantly correlates with abnormal expression of E-cadherin and poor survival of lung cancer patients. Med Oncol27: 880“88619763914 38 YangJ ManiSA DonaherJL RamaswamyS ItzyksonRA et al (2004) Twist a master regulator of morphogenesis plays an essential role in tumor metastasis. Cell117: 927“93915210113 39 BerxG RaspeE ChristoforiG ThieryJP SleemanJP (2007) Pre-EMTing metastasis? Recapitulation of morphogenetic processes in cancer. Clin Exp Metastasis24: 587“59717978854 40 VernonAE LaBonneC (2004) Tumor metastasis: a new twist on epithelial-mesenchymal transitions. Curr Biol14: R719“72115341765 41 VesunaF van DiestP ChenJH RamanV (2008) Twist is a transcriptional repressor of E-cadherin gene expression in breast cancer. Biochem Biophys Res Commun367: 235“24118062917 42 AlexanderNR TranNL RekapallyH SummersCE GlackinC et al (2006) N-cadherin gene expression in prostate carcinoma is modulated by integrin-dependent nuclear translocation of Twist1. Cancer Res66: 3365“336916585154 43 AndreolasC KalogeropoulouM VoulgariA PintzasA (2008) Fra-1 regulates vimentin during Ha-RAS-induced epithelial mesenchymal transition in human colon carcinoma cells. Int J Cancer122: 1745“175618098284 44 KnirshR Ben-DrorI SpanglerB MatthewsGD KuphalS et al (2009) Loss of E-cadherin-mediated cell-cell contacts activates a novel mechanism for up-regulation of the proto-oncogene c-Jun. Mol Biol Cell20: 2121“212919193763 Stat Med Stat Med sim Statistics in Medicine 0277-6715 1097-0258 BlackWell Publishing Ltd Oxford UK 24027094 4098103 10.1002/sim.5963 Research Articles Modeling exposure“lag“response associations with distributed lag non-linear models Gasparrini Antonio *   Medical Statistics Department London School of Hygiene and Tropical Medicine London U.K. *Correspondence to: Antonio Gasparrini London School of Hygiene and Tropical Medicine Keppel Street London WC1E 7HT U.K.  E-mail: antonio.gasparrini@lshtm.ac.uk 28 2 2014 12 9 2013 33 5 881 899 29 3 2012 10 8 2013 © 2013 The Authors. Statistics in Medicine published by John Wiley & Sons Ltd. 2013 This is an open access article under the terms of the Creative Commons Attribution License which permits use distribution and reproduction in any medium provided the original work is properly cited. In biomedical research a health effect is frequently associated with protracted exposures of varying intensity sustained in the past. The main complexity of modeling and interpreting such phenomena lies in the additional temporal dimension needed to express the association as the risk depends on both intensity and timing of past exposures. This type of dependency is defined here as exposure“lag“response association. In this contribution I illustrate a general statistical framework for such associations established through the extension of distributed lag non-linear models originally developed in time series analysis. This modeling class is based on the definition of a cross-basis obtained by the combination of two functions to flexibly model linear or nonlinear exposure-responses and the lag structure of the relationship respectively. The methodology is illustrated with an example application to cohort data and validated through a simulation study. This modeling framework generalizes to various study designs and regression models and can be applied to study the health effects of protracted exposures to environmental factors drugs or carcinogenic agents among others. © 2013 The Authors. Statistics in Medicine published by John Wiley & Sons Ltd. latency distributed lag models exposure“lag“response delayed effects splines 1. Introduction In biomedical research it is commonly appreciated that an exposure event produces effects lasting well beyond the exposure period with an increase in risk occurring from few hours to many years later depending on the physiological processes linking the exposure and the health outcome. The problem is made even more complicated in the presence of protracted time-varying exposures when the health effect measured at a given time can be described as the result of multiple exposure events of different intensities sustained in the past. This phenomenon common to various research fields has been associated for example with peak 1 or chronic exposures 2 to environmental stressors drug intake 34 or occupational exposures to carcinogenic substances 5. The main complexity of modeling and interpreting such dependencies lies in the additional temporal dimension needed to express the association beyond the usual exposure“response relationship as the risk depends on both intensity and timing of past exposures. Nonetheless the appropriate representation of the temporal pattern of risks may provide further insights on the association of interest in particular regarding the underlying pathophysiological mechanisms and prevent biases in estimates and predictions. Revising previous terminology 6 I define these dependencies as exposure“lag“response associations. In particular this issue has been debated in cancer epidemiology 7“9. Analytical approaches extend simple indices such as cumulative exposure in order to accommodate the temporal variation in risk because of protracted exposures. In particular the pioneering work by Thomas 106 helped develop sophisticated statistical methods on the basis of weighting past exposures through specific functions whose parameters are estimated by the data. Vacek 11 Langholz and colleagues 12 and Richardson 13 provided interesting applications in case-control studies with weights represented through simple parametric functions. The methodology was improved by Hauptmann and colleagues in a series of papers 14“16 by using flexible and smooth spline functions. Sylvestre and Abrahamowicz 17 and Abrahamowicz and colleagues 18 extended the spline methods to the analysis of time-to-event data with a cohort design and presented their applications in pharmaco-epidemiology. The main limitation of the statistical techniques described in these papers is the assumption of a linear exposure“response relationship. Models for nonlinear dependencies introduce further nontrivial complexities from both statistical and interpretational perspectives as the problem becomes inherently bidimensional. Abrahamowicz and Mackenzie 19 proposed a model for analyzing the nonlinear time-dependent effects of fixed exposures while Vacek 11 and Berhane and colleagues 20 extended this scheme to the case of protracted time-varying exposures. However the modeling techniques illustrated in these other papers still face some limitations as they are based on complex estimation routines with convergence issues and problems in producing uncertainty measures such as standard errors and confidence intervals. Interestingly equivalent approaches were previously established in time series analysis on the basis of distributed lag models (DLMs) a methodology originally formulated in econometrics 21 then applied in epidemiological research 22. These models involve the definition of a distributed lag function analogous to the weighting function described before. In particular Armstrong 23 generalized the method to distributed lag non-linear models (DLNMs) a class of models with different options for the functions applied to model nonlinearity and distributed lag effects. The theory of DLMs and DLNMs have been recently re-evaluated 24 offering a well-grounded statistical tool and a comprehensive scheme for interpretation. In this paper I aim to establish a general conceptual and statistical framework for modeling exposure“lag“response associations built upon the paradigm of DLMs and DLNMs. This modeling class extended beyond time series analysis provides a unified methodology applicable in different study designs data structures and regression models including most of the previous methods as specific cases. Also the statistical framework is defined by completely parametric functions and fitted through standard regression methods with measures of uncertainty and fit statistics easily available. The R package dlnm originally developed for time series data 25 is extended in parallel offering a easy-to-use implementation of the modeling approach. The manuscript is structured as follows. The development and algebraic definition of the modeling framework is described in Section 2. As an illustrative example in I apply the method for investigating the relationship between occupational exposure to radon and lung cancer mortality by using the data from the Colorado Plateau miners cohort. The modeling framework is then validated in a simulation study n. A final discussion is provided in. Information on data and software implementation is included in. The R code and data are included in the supporting information together with additional details making the results of the illustrative example and of the simulation study entirely reproducible. 2. Modeling framework The modeling skeleton is derived by extending the class of DLNMs beyond the time series context. This extension provides a neat algebraic representation and a comprehensive statistical definition. The focus is on a function here defined s(xt) which describes the dependency in terms of the exposure history to x evaluated at time t. The function s(xt) is commonly included in regression models in order to estimate the association while controlling for potential confounders. Although the regression model varies depending on the study design and the type of data the definition of s(xt) provided later and the related modeling framework generally apply. 2.1. Models for linear exposure“response relationships Previous studies on the topic have defined the function s(xt) by using slightly different algebraic formulae 1026111417. Assuming a linear exposure“response relationship a general notation can be given by (1a) (1b) (1c) In (1a) the increase in risk at time t is defined as the integral of the instantaneous exposure intensity xu over the period ?t = [t0t1] with t0 and t1 representing the times of the first and last relevant exposures. Here w(t ? u) is the weighting function previously described in which assigns weights to past exposures experienced at time t ? u on the basis of their contribution to the risk at time t. The model can be reparameterized as in (1b) where the risk is now expressed along the lag with ? ? [?0L]. Here L ? ?0 = t1 ? t0 is interpreted as the lag period over which an exposure to x is assumed to affect the risk at time t usually with ?0 = 0. This parameterization offers the advantage that the function w is now directly defined in the new dimension of lag ? and it is independent of the time axis chosen for t which may represent different time scales depending on the study design. The function w(?) termed from here on as the lag“response function models the lag“response curve associated with exposure x. Finally for computational purposes the integral is approximated in (1c) by a sum of terms derived by partitioning the lag interval in equally spaced discrete units and assuming the protracted exposure as a sequence of exposure events xt ? ? at lags ? = ?0 ¦ L. A statistical model for (1) can be defined by expressing the lag“response function w(?) as a linear combination of terms obtained through basis transformation with related parameters. By using matrix notation let the vector qxt of exposure history be defined by (2) Such exposure history changes along time depending on the time t at which the vector qxt is computed. Given (2) the cumulative function s(xt) in (1) can be written using a compact and general matrix notation as (3) The (L ? ?0 + 1) × v? matrix C is obtained from the transformation of the lag vector ? = [?0 ¦ ? ¦ L]T by choosing a specific basis with dimension v? for w(?) which defines the related basis functions. In this parameterization the function s(xt) representing the integral of x · w(?) over the interval [?0L] is defined as a lag“basis function with parameters ?. Interestingly the equation in (3) is almost identical to that defining DLMs 24 Eq. (4). The different indexing in the original version reflects the specific application in time series where the data are perfectly ordered in time and the matrix Q has a structure such that qt? ? qt + 1? + 1. However this is a specific case of the general representation in (2)“(3). The theory and software already developed for DLMs can be therefore extended in parallel. Alternative lag“basis functions for representing s(xt) are derived through different lag“response functions w(?) in (1). In particular the traditional index of unweighted cumulative exposure is a specific case of (3) where reduces to with w(?) equal to a constant c. This is obtained by specifying C as an (L ? ?0 + 1)-dimensional vector of 1's with v? = 1."

Lung_Cancer

"Tumor tissue nonmalignant lung tissue and peripheral blood samples were obtained from III-4. The proband™s mother (II-4) also had multiple lung adenocarcinomas and tumor and nonmalignant lung tissue samples were available. The proband™s father (II-5) and sister (III-5) were both unaffected and peripheral blood samples were obtained from these individuals. Some family members who were not considered as critical for this study were excluded from the pedigree chart to preserve confidentiality. Whole-exome sequencing was performed for individuals II-4 II-5 III-4 and III-5. After obtaining permission from the Institutional Review Board at Okayama University Hospital and informed consent from the patients and other family members we performed a whole-exome sequencing study. Tumor DNA samples from II-4 tumor and peripheral blood DNA samples from III-4 and peripheral blood DNA samples from two unaffected family members (II-5 and III-5) were used for the analysis. The candidate germline alterations were restricted to 29 variants by comparing the whole-exome sequencing results between the patients and the unaffected family members. Among them we focused on a point mutation in the human epidermal growth factor receptor 2 (HER2/neu) gene (NM_004448 G660D GGC to GAC) which was located in exon 17 encoding the transmembrane domain of HER2 (Supplementary Tables 1“3). This alteration was confirmed by direct sequencing (A). We also confirmed that there was no copy number gain of HER2 in the examined tumors based on the degree of read-depth in the whole-exome sequencing results. Of note no mutations in genes known to cause lung cancers were detected for tumors from III-4 and II-4. . DNA and amino acid sequences in the transmembrane domain of HER2. A) Direct Sanger sequencing of the proband (III-4) her affected mother (II-4) and her unaffected sister (III-5). The results indicated that G660D was a germline mutation. B) Direct sequencing of a sporadic lung adenocarcinoma with a HER2 V659E mutation. V659E was found to be of somatic origin based on the sequencing results of the peritumoral lung tissue from the same specimen. All the sequence variants were confirmed by independent polymerase chain reaction amplifications and were sequenced in both directions. C) Interspecies conservation of the transmembrane domain of HER2 (UCSC Genome Browser http://genome.ucsc.edu accessed September 12 2013). The yellow highlight indicates the N-terminal glycine zipper motif Thr652-X3-Ser656-X3-Gly660 a tandem variant of a GG4-like motif of human HER2. Codons 659 and 660 in human HER2 are highly conserved among the listed vertebrate species (shown in red). X. tropicalis = Xenopus tropicalis. We considered that somatic mutations in the HER2 transmembrane domain might act as driver mutations in lung cancer. Hence we sequenced exon 17 of the HER2 in the tumor samples of 315 sporadic non“small cell lung cancer patients of which 253 were adenocarcinomas. Although the HER2 G660D mutation was not detected a novel nonsynonymous mutation V659E (GTT to GAA) next to codon 660 was identified in one of these patients. This patient was histologically diagnosed as nonmucinous adenocarcinoma in situ and the patient had neither smoking history nor apparent family history of lung cancer. This V659E mutation was certainly a somatic mutation because it was not identified in the peritumoral lung tissue of the same patient (B). The alignment of HER2 amino acid sequences showed high conservation of valine 659 and glycine 660 among vertebrates (C). HER2 somatic mutations have been reported in 2% to 4% of lung adenocarcinomas (5“7). However all reported mutations were restricted to its tyrosine kinase domain (67). According to the cBioPortal for Cancer Genomics (http://www.cbioportal./public-portal/ accessed September 12 2013) the same genetic mutation in the HER2 has not been reported in any type of cancer. Interestingly a previous study reported that a mutation in the transmembrane domain (V664E) of the rat neu gene which corresponds to V659E in its human homolog HER2 induced oncogenic transformation (8). In addition in vivo experiments showed that the HER2 V659E mutation contributed to the stability of HER2 dimers resulting in the dysregulated receptor activation and subsequent cell transformation (910). Furthermore the novel mutations were located within the glycine zipper motif Thr652-X3-Ser656-X3-Gly660 a tandem variant of the GG4-like motif at the N-terminal portion of the transmembrane domain which was critically related to the dimerization of HER2 (C) (911). Accordingly we performed a functional analysis of the mutant HER2 proteins. We found that the degradation of HER2 protein after the administration of cycloheximide was slower in G660D and V659E mutants as compared with wild-type (Supplementary A) indicating the higher stability of the mutant proteins than wild-type protein. In addition results of a phospho-mitogen“activated protein kinase array indicated the activation of Akt and p38? (data not shown). Indeed Akt is known to be activated by HER2 by phosphatidylinositol 3-kinase and leads to increased cell growth and survival (1213). Also the activation of p38 was shown to contribute to the viability of lung adenocarcinoma cells derived from never or light smokers (1415). A western blot analysis for Akt and p38 successfully confirmed the upregulation of both phospho-Akt and phospho-p38 expression in the mutant HER2 transfectants (Supplementary B). Because the G660D alteration in HER2 might have been the cause of the lung cancer in the pedigree studied we investigated whether familial aggregation of cancer in other ans could be seen in this pedigree. We found that II-1 and II-6 developed renal and gastric cancers respectively; however both of them also had lung cancer. The reason why other types of clinically apparent malignances were rarely found in this pedigree is unclear. The G660D germline mutation may be tolerated in ans other than the lung. This study had some limitations. First the carcinogenic potential of the HER2 mutation at the transmembrane domain should be confirmed in other models such as transgenic mice. Second the rarity of these mutations in sporadic lung cancers may be the limitation for generalizability to other cases even if targeting therapies for similar types of HER2 mutation were developed. In we identified a novel germline mutation in the transmembrane domain of the HER2 in familial lung adenocarcinomas. Somatic mutation in the HER2 transmembrane domain may be a possible cause of sporadic lung adenocarcinomas. Funding This study was supported by a Grant-in Aid for Scientific Research from the Ministry of Education Culture Sports Science and Technology of Japan (25293302 to ST). H. Yamamoto J. Soh S. Miyoshi and S. Toyooka conceived the project. K. Higasa M. Sakaguchi K. Shien and K. Ichimura performed the experiments. H. Yamamoto J. Soh M. Furukawa S. Hashida N. Takigawa K. Kiura K. Tsukuda and S. Toyooka collected the samples and assisted with the experiments. H. Yamamoto K. Higasa K. Shien and K. Matsuo analyzed the data. H. Yamamoto K. Higasa M. Sakaguchi F. Matsuda and S. Toyooka prepared the manuscript with input from the other authors. S. Miyoshi F. Matsuda and S. Toyooka supervised the project. The authors declared no conflicts of interest. References 1. BellDWGoreIOkimotoRA Inherited susceptibility to lung cancer may be associated with the T790M drug resistance mutation in EGFR. Nat Genet. 2005;37(12):1315“131616258541 2. IkedaKNomoriHMoriTSasakiJKobayashiT Novel germline mutation: EGFR V843I in patient with multiple lung adenocarcinomas and family members with lung cancer. Ann Thorac Surg. 2008;85(4):1430“143218355544 3. OhtsukaKOhnishiHKuraiD Familial lung adenocarcinoma caused by the EGFR V843I germ-line mutation. J Clin Oncol."

Lung_Cancer

"Chinese women. International Journal of Cancer40: 604“609 37 Wu-WilliamsAH DaiXD BlotW XuZY SunXW et al (1990) Lung cancer among women in north-east China. Br J Cancer62: 982“9872257230 38 ZhongL GoldbergMS GaoYT JinF (1999) Lung cancer and indoor air pollution arising from Chinese-style cooking among nonsmoking women living in Shanghai China. Epidemiology (Cambridge Mass)10: 488“494 PLoS One one 1932-6203 Public Library of Science San Francisco USA 24586842 3934888 PONE-D-13-30257 .0089518 Research Biology Genetics Genetic mutation Mutation types Cancer genetics Medicine Clinical research design Retrospective studies Diagnostic medicine Pathology Clinical pathology Test evaluation Oncology Cancer detection and diagnosis Cancer screening Cancer treatment Chemotherapy and drug treatment Clinical trials (cancer treatment) Cancers and neoplasms Lung and intrathoracic tumors Non-small cell lung cancer Oncology agents Clinical Validation of a PCR Assay for the Detection of EGFR Mutations in Non“Small-Cell Lung Cancer: Retrospective Testing of Specimens from the EURTAC Trial EGFR Mutation Testing in NSCLC in EURTAC Trial Benlloch Susana 1 * Botero Maria Luisa 1 Beltran-Alamillo Jordi 1 Mayo Clara 1 Gimenez-Capit¡n Ana 1 de Aguirre Itziar 2 Queralt Cristina 2 Ramirez Jose Luis 2 Cajal Santiago Ramn y. 1 6 Klughammer Barbara 3 Schlegel Mariette 3 Bordogna Walter 3 Chen David 4 Zhang Guili 5 Kovach Barbara 5 7 Shieh Felice 5 7 Palma John F. 5 Wu Lin 5 Lawrence H. Jeffrey 5 7 Taron Miquel 1 2 1 Pangaea Biotech SL Barcelona Spain 2 Medical Oncology Service-ICO Hospital Germans Trias i Pujol Badalona Spain 3 F. Hoffmann-La Roche Basel Switzerland 4 Genentech South San Francisco California United States of America 5 Roche Molecular Systems Pleasanton California United States of America 6 Pathology Department Vall d'Hebron University Hospital Universidad Autnoma de Barcelona Barcelona Spain 7 Roche Molecular Systems Pleasanton California United States of America Minna John D. Editor Univesity of Texas Southwestern Medical Center at Dallas United States of America * E-mail: sbenllochpangaeabiotech.com Competing Interests: BK MS WB DC GZ JFP LW are all current employees of Roche. BK DC JFP and LW have stock holdings in Roche. BK and HJL are former Roche employees and HJL has stock in Roche and has served as a paid consultant. FS was a paid consultant to Roche. SB JBA CM AGC are current employees of Pangaea Biotech. MLB is a former Pangaea employee. MT and SRyC have stock holdings in Pangaea Biotech. IdA CQ JLR are current employees of Medical Oncology Service-ICO Hospital Germans Trias i Pujol. This does not alter the authors' adherence to all the PLOS ONE policies on sharing data and materials. Conceived and designed the experiments: MT HJL. Performed the experiments: CM AGC JBA IdA CQ JLR. Analyzed the data: SB DC GZ CM AGC JBA IdA CQ JLR FS LW JFP HJL MT. Contributed reagents/materials/analysis tools: SB MLB JBA CM AGC IdA CQ JLR SRyC BK MS WB DC GZ BK FS LW JFP HJL MT. Wrote the paper: SB MLB JBA CM AGC IdA CQ JLR SRyC BK MS WB DC GZ BK FS LW JFP HJL MT. 2014 25 2 2014 9 2 e89518 23 7 2013 21 1 2014 2014 Benlloch et al This is an open-access distributed under the terms of the Creative Commons Attribution License which permits unrestricted use distribution and reproduction in any medium provided the original author and source are credited. The EURTAC trial demonstrated that the tyrosine kinase inhibitor (TKI) erlotinib was superior to chemotherapy as first-line therapy for advanced non-small cell lung cancers (NSCLC) that harbor EGFR activating mutations in a predominantly Caucasian population. Based on EURTAC and several Asian trials anti-EGFR TKIs are standard of care for EGFR mutation-positive NSCLC. We sought to validate a rapid multiplex EGFR mutation assay as a companion diagnostic assay to select patients for this therapy. Samples from the EURTAC trial were prospectively screened for EGFR mutations using a combination of laboratory-developed tests (LDTs) and tested retrospectively with the cobas EGFR mutation test (EGFR PCR test). The EGFR PCR test results were compared to the original LDT results and to Sanger sequencing using a subset of specimens from patients screened for the trial. Residual tissue was available from 487 (47%) of the 1044 patients screened for the trial. The EGFR PCR test showed high concordance with LDT results with a 96.3% overall agreement. The clinical outcome of patients who were EGFR-mutation detected by the EGFR PCR test was very similar to the entire EURTAC cohort. The concordance between the EGFR PCR test and Sanger sequencing was 90.6%. In 78.9% of the discordant samples the EGFR PCR test result was confirmed by a sensitive deep sequencing assay. This retrospective study demonstrates the clinical utility of the EGFR PCR test in the accurate selection of patients for anti-EGFR TKI therapy. The EGFR PCR test demonstrated improved performance relative to Sanger sequencing. This study was funded by Roche. The funders contributed to the study design data collection analysis decision to publish and preparation of the manuscript. Introduction The efficacy of many novel targeted cancer therapies can be predicted by the detection of specific biomarkers in the tumor. The FDA has indicated that if the identification of a specific biomarker is required for the safe and efficacious administration of a drug a well-validated FDA approved companion diagnostic assay is required for that drug. The optimal approval path for a new targeted therapy and its companion diagnostic is a parallel clinical development process that involves clinical trials for the investigational agent where the investigational diagnostic test is used to either select patients for the trials or to predict response to treatment and ends ideally with simultaneous health authority approval of the drug and the companion diagnostic. Successful examples of this include the co-development (and co-approval) of the BRAF inhibitor vemurafenib and its companion diagnostic BRAF V600E mutation assay for BRAF-mutant metastatic melanoma[1] and the ALK inhibitor crizotinib and its companion diagnostic ALK fusion gene test in advanced ALK-fusion positive non-small cell lung cancer (NSCLC) patients.[2] [3] [4] However in some cases predictive biomarkers for a targeted therapy are not recognized until after the drug is first approved. As an example the anti-EGFR antibody cetuximab was first approved in the US for the treatment of metastatic colorectal cancer in 2004. Numerous retrospective and prospective trials subsequently revealed that tumors harboring KRAS mutations were very unlikely to respond to cetuximab. In July 2009 FDA required labeling changes for cetuximab and another anti-EGFR antibody panitumumab requiring that the indications and usage state there was no treatment benefit with the drugs for patients whose tumors had KRAS mutations in codon 12 or 13 at a time when there were no FDA-approved diagnostic assays for KRAS mutations.[5] Only later in July 2012 did a KRAS mutation assay receive FDA approval based on the results of a prospective randomized trial highlighting the challenges of retrospectively validating a companion diagnostic assay after the pivotal drug trials have been completed.[6] The anti-EGFR TKI erlotinib was initially approved for all patients with advanced NSCLC who had progressed on first-line chemotherapy. A number of subsequent studies determined that patients with EGFR-mutant NSCLC had a high likelihood of responding to these TKI leading to trials in the first-line setting for EGFR-mutant cancer.[7] [8] [9] [10] [11] [12] [13] Four prospective randomized clinical trials studied in Asian populations demonstrated that erlotinib and gefitinib resulted in improved progression-free survival compared to chemotherapy for first line therapy in NSCLC patients with EGFR mutations.[7] [8] [9] [13] Other clinical studies in mixed ethnicity cohorts have concluded with similar results.[10][12] The EURTAC trial was a randomized phase 3 trial to assess the safety and efficacy of erlotinib compared with standard platinum-based chemotherapy for first-line treatment of a patient population with advanced EGFR-mutation detected NSCLC in a largely Caucasian population of European patients. Erlotinib-treated patients experienced significant improvements in median PFS (9.7 months vs. 5.2 months) compared to chemotherapy. Patients on the erlotinib arm also had a considerably higher percentage of responses (58% vs. 15%) in the intent-to-treat population.[11] This trial has been submitted for first line indication of erlotinib in EGFR mutated NSCLC patients. The majority of activating EGFR mutations are located in exons 19 (45%) and 21 (40“45%).[14] [15] [16] [17] [18] [19] [20] Guidelines from organizations such as ASCO CAP/AMP and NCCN recommend the use of anti-EGFR TKIs as first-line therapy in patients with EGFR-mutant advanced NSCLC based on the results of these pivotal clinical trials. [21] [22] [23] Recent recommendations by CAP/IASLC/AMP advise the identification of EGFR mutations present at >1% of which exon 19 deletions and an exon 21 mutation (L858R) account for greater than 90% of all mutations.[24] None of the guidelines specify the testing method to be used however the cobas EGFR Mutation test is CE-IVD approved and is recently FDA approved.[25] Here we present the retrospective analysis of a clinical validation study of the EGFR PCR test on a subset of lung cancer specimens from patients screened for the EURTAC trial. The EGFR PCR test demonstrated improved sample workflow relative to the LDTs used in the EURTAC trial enabling EGFR mutation screening in a single assay with a one-day turn-around time. The EGFR PCR test showed superior sensitivity and specificity compared with conventional Sanger sequencing. Methods The major study objectives were 1) to correlate the clinical outcomes (PFS BORR) from the subgroup of available samples tested by the EGFR PCR test to the results from the entire EURTAC population and 2) to compare the analytic performance of the EGFR PCR test to that of the original LDT and Sanger sequencing using massively parallel pyrosequencing (MPP) to resolve discrepancies observed between the other 3 testing methods. In the EURTAC trial1044 patients from hospitals in France Italy and Spain were screened using the LDT. For this study all samples were retrospectively analyzed under IRB approval from Copernicus IRB (00001313). Site specific IRB approval from each clinical site and written consent from all patients was obtained prior to the study conduct phase of NCT00446225.[11] [26] In 487 cases residual specimens were available for retesting with the EGFR PCR test (Figure 1). A single 5 µm section with at least 10% tumor content from each of the 487 specimens was used for the EGFR PCR test. Genomic DNA from existing eluate or extracted from additional sections was tested on Sanger sequencing and MPP. Table 1 lists the demographics of the patients screened for the EURTAC trial by the LDT sub-categorized by patients tested or not tested by the EGFR PCR test. Patients enrolled in the EURTAC trial were selected using a laboratory-developed test validated by the Laboratory of Oncology (ICO-Hospital Germans Trias i Pujol Badalona Spain) consisting of three methodologies.[26] In this study a single PCR-based assay for detecting EGFR mutations was used. Details of the analytical performance of this assay have been described previously.[27] .0089518.g001 Figure 1 Flow of samples through the study."

Lung_Cancer

"To understand the functional consequences of GWAS loci is challenging and multiple principles for post-GWAS™ functional characterization of genetic loci have been proposed including the exploration of epigenetic mechanisms46. In our study the top GWAS lung cancer loci were strongly associated with methylation levels of CpG sites in nearby gene bodies through cis-regulation and adjusting for smoking status or intensity did not change the results. Furthermore SNPs affecting the DNA methylation of gene bodies (which are typically methylated) were also collectively associated with risk for squamous cell carcinoma after excluding the established GWAS loci and were enriched for genes in cancer pathways. In contrast no enrichment was observed for SNPs affecting the methylation of gene promoters or CGI regions which are typically not methylated in normal tissues. This suggests a potential novel mechanism for genetic effects on cancer risk. In fact gene body-enriched cis-meQTLs outside CGI regions may increase the risk for germline and somatic mutations due to their increased propensity to become mutated1112. Upon spontaneous hydrolytic deamination methylated cytosine residues turn into thymine which are less likely to be efficiently repaired than the uracils that result from deamination of unmethylated cytosine residues. For example about 25% of mutations in TP53 in cancers are thought to be due to epigenetic effects47. Indeed analyses of comprehensive human catalogues of lung tumors have identified frequent G>T mutations enriched for CpG dinucleotides outside CGI regions suggesting a role for methylated cytosine since CGI as we confirmed are usually unmethylated48. A similar signature was recently observed in other tumors14. Thus inherited genetic variation may have a profound impact on carcinogenesis by regulating the human methylome. We observed a high similarity of genetic control on DNA methylation across tissues. Since tissue of origin determines cancer-associated CpG island promoter hypermethylation patterns49 a natural question is whether the genetic regulation of methylation is tissue specific. While the tissue-specificity of eQTLs has been investigated for a few tissues50 for cis-meQTL only a recent investigation was conducted6 showing that 35.7% of 88751 cis meQTLs detected in 662 adipose samples were replicated in ~200 whole blood samples. We found that a large proportion of meQTLs in EAGLE lung samples particularly those with large effect sizes were robustly replicated in breast and kidney tissue samples from TCGA suggesting a high similarity of genetic regulation of methylation across these tissues and related impact on somatic mutation rates1448. The lower replication rate of adipose meQTLs in whole-blood samples6 might be explained by the heterogeneity of different cell types in whole blood and by their more liberal P-value threshold (8.6—10?4) which led to the identification of a large number of weak cis-meQTLs. Compared with cis-regulation trans-eQTL regulation is typically considered to be more complex has smaller effect sizes and is more difficult to be replicated even in the same tissue. However in our study the lung trans-meQTLs are highly reproducible in TCGA lung breast and kidney tissues. Notably this similarity allows mapping meQTLs with substantially improved power by borrowing strength across tissues51. meQTL SNPs are strongly associated with multiple epigenetic marks. Chromatin regulators play a role in maintaining genomic integrity and anization52. We found that meQTL SNPs were strongly enriched for DNase hypersensitive sites and sequences bound by CTCF or modified histones. SNPs could affect these epigenetic marks by several mechanisms such as by affecting the core recognition sequences (exemplified for rs2816057 on chromosome 1 for CTCF) causing loss or gain of a CpG within a binding region which when methylated could affect binding27 or altering the binding sequence for interacting factors53. CTCF could cause changes in epigenetic marks through its multiple key roles including genome anization through mediating intra- and inter-chromosomal contacts5455 the regulation of transcription by binding between enhancers and promoters5456 and the regulation of splicing which may impact tissue specificity during tissue development39. These changes can impact regulation of distant genes and not the genes proximal to the SNPs that would be typically investigated in eQTL studies. This may be one reason for the previously observed lack of correlation between eQTLs and meQTLs347. Future large studies integrating SNP profiles the DNA methylome and transcriptome data through tissue developmental stages will hopefully shed light on this possibility. There may be a myriad of other DNA-binding factors whose binding is directly or indirectly affected by SNPs. For example among the histone marks the strongest enrichment of meQTLs in our study was for H3K4me3 in both SAEC and hAEC cell types. As H3K4me3 is the chromatin mark primarily associated with regulatory elements at promoters and enhancers this suggests a strong influence of meQTLs on regulating gene activity. Unfortunately transcription factor binding data in SAEC or hAEC are not available so we could not test whether SNPs in their core sequence could affect the deposition of epigenetic marks e.g. by recruiting DNA methyltransferases57. It will be important to obtain ChIP data from relevant primary cells for numerous DNA-binding regulatory factors to further elucidate the mechanisms whereby meQTLs and other SNP-affected epigenetic marks arise. In we show here that genetic variation has a profound impact on the DNA methylome with implications for cancer risk tissue specificity and chromatin structure and anization. The meQTL data (Supplementary Data) attached to this manuscript provides an important resource for studying genetic-DNA methylation interactions in lung tissue. Methods Sample collection We assayed 244 fresh frozen paired tumor and non-involved lung tissue samples from Stage I to IIIA non-small cell lung cancer (NSCLC) cases from the Environment And Genetics in Lung cancer Etiology (EAGLE) study18. EAGLE includes 2100 incident lung cancer cases and 2120 population controls enrolled in 2002“2005 within 216 municipalities of the Lombardy region of Italy. Cases were newly diagnosed primary cancers of lung trachea and bronchus verified by tissue pathology (67.0%) cytology (28.0%) or review of clinical records (5.0%). They were 35?79 years of age at diagnosis and were recruited from 13 hospitals which cover over 80% of the lung cancer cases from the study area. The study was approved by local and NCI Institutional Review Boards and all participants signed an informed consent form. Lung tissue samples were snap-frozen in liquid nitrogen within 20 minutes of surgical resection. Surgeons and pathologists were together in the surgery room at the time of resection and sample collection to ensure correct sampling of tissue from the tumor the area adjacent to the tumor and an additional area distant from the tumor (1“5 cm). The precise site of tissue sampling was indicated on a lung drawing and the pathologists classified the samples as tumor adjacent lung tissue and distant non-involved lung tissue. For the current study we used lung tissue sampled from an area distant from the tumor to reduce the potential effects of field cancerization. DNA methylation profiling and data quality control Fresh frozen lung tissue samples remained frozen while approximately 30 mg was subsampled for DNA extraction into pre-chilled 2.0 ml microcentrifuge tubes. Lysates for DNA extraction were generated by incubating 30 mg of tissue in 1 ml of 0.2 mg/ml Proteinase K (Ambion) in DNA Lysis Buffer (10 mM Tris-Cl (pH 8.0) 0.1 M EDTA (pH 8.0) and 0.5% (w/v) SDS) for 24 hrs at 56°C with shaking at 850 rpm in Thermomixer R (Eppendorf). DNA was extracted from the generated lysate using the QIAamp DNA Blood Maxi Kit (Qiagen) according to the manufacturer™s protocol. Bisulfite treatment and Illumina Infinium HumanMethylation450 BeadChip assays were performed by the Southern California Genotyping Consortium at the University of California Los Angeles (UCLA) following Illumina™s protocols. This assay generates DNA methylation data for 485512 cytosine targets (482421 CpG and 3091 CpH) and 65 SNP probes for the purpose of data quality control. Raw methylated and unmethylated intensities were background corrected and dye-bias equalized to correct for technical variation in signal between arrays. For background correction we applied a normal-exponential convolution using the intensity of the Infinium I probes in the channel opposite their design to measure non-specific signal58. Dye-bias equalization used a global scaling factor computed from the ratio of the average red and green fluorescing normalization control probes. Both methods were conducted using the methylumi package in Bioconductor version 2.11. For each probe DNA methylation level is summarized as a ?-value estimated as the fraction of signal intensity obtained from the methylated beads over the total signal intensity. Probes with detection P-values of >0.05 were considered not significantly different from background noise and were labeled as missing. Methylation probes were excluded from meQTL analysis if any of the following criteria was met: on X/Y chromosome annotated in repetitive genomic regions annotated to harbor SNPs missing rate>5%. Because the ?-values for the 65 SNP probes are expected to be similar in matched pair of normal and tumor tissues we performed principal component analysis (PCA) using these 65 SNP probes to confirm the labeled pairs. We then performed PCA using the 5000 most variable methylation probes with var>0.02 and found that the normal tissues were clustered together and well separated from the tumor tissues. We further excluded 5 normal tissues that were relatively close to the tumor cluster. From the remaining 239 normal tissue samples we analyzed 210 with genotype data from a previous GWAS of lung cancer20. Genotype data and genetic association analysis The blood samples were genotyped using the Illumina HumanHap550K SNP arrays in EAGLE GWAS20. The SNPs with call rate >99% minor allele frequency (MAF) >3% and Hardy-Weinberg Equilibrium (HWE) P-value >10?5 were included for analysis. Prior to meQTL analysis each methylation trait was regressed against sex age batches and PCA scores based on methylation profiles. The regression residues were then quantile-normalized to the standard normal distribution N(01) as traits. The genetic association testing was performed using PLINK and R adjusted for the top three PCA scores based on GWAS SNPs to control for potential population stratification. Identification of cis-meQTLs For each CpG methylation probe the cis region was defined as being less than 500kb upstream and downstream from the target CpG-site (1Mb total). A methylation trait was detected to harbor a cis-meQTL if any SNP in the cis region had a SNP-CpG nominal association P-value less than P0 where P0 was chosen to control FDR at 5% by permutations. Here we describe a permutation procedure to choose P0 to control FDR at 5%. For a given P0 let N(P0) be the total number of CpG probes with detected cis-meQTLs and N0(P0) the expected number of CpG probes falsely determined to have cis-meQTLs. FDR is defined as N0(P0)/N(P0). The key is to estimate N0(P0) under the global null hypothesis that no CpG probe has cis-meQTLs. We randomly permuted the genotypes across subjects for 100 times keeping the correlation structure of the 338456 methylation traits in each permutation. Then N0(P0) was estimated as the average number of methylation traits that were detected to harbor cis-meQTL SNPs with nominal P<P0. Control FDR at 5% requires P0=4.0—10?5. The same procedure was applied to detect secondary independently associated cis-meQTL SNPs. With our sample size h2>0.12 is required to detect cis-meQTLs with power greater than 0.8. We note that although we excluded all CpG probes annotated with SNPs there is still the possibility that rare not annotated variants could be associated with the cis-meQTL SNPs. However since common variants and rare variants are known to be poorly correlated and rare variants are uncommon by definition we do not expect this event to be frequent. Identification of trans-meQTLs For each CpG probe the trans region was defined as being more than 500kb from the target CpG-site in the same chromosome or on different chromosomes. For the kth methylation trait with m SNPs in the trans region let (qk1?qkm) be the P-values for testing the marginal association between the trait and the m SNPs. Let pk=min(qk1?qkm) be the minimum P-value for m SNPs and converted pk into genome-wide P-value Pk by performing one million permutations for SNPs in the trans region. Because a cis region is very short (~1M) compared to the whole genome (~3000M) Pk computed based on SNPs in trans regions is very close to that based on permutations using genome-wide SNPs. Thus we use the genome-wide p-value computed based on all SNPs to approximate Pk. Furthermore all quantile-normalized traits follow the same standard normal distribution N(01); thus the permutation-based null distributions are the same for all traits. We then applied the Benjamini-Hochberg procedure to (P1?PN) to identify trans-meQTLs by controlling FDR at 5%. With our sample size h2 >0.24 is required to detect trans-meQTLs with power greater than 0.8. Replication of meQTLs in TCGA samples The replication was performed in TCGA histologically normal tissue samples that had genome-wide genotype (Affymetrix Genome-Wide Human SNP Array 6.0) and methylation profiling (Illumina Infinium HumanMethylation450 BeadChip). We downloaded genotype (level 2) and methylation data (level 3) from the TCGA website22. We also downloaded methylation data for tumor tissue samples and performed PCA analysis to confirm that normal tissue samples were separated from tumor tissue samples. Autosomal SNPs with MAF >3% calling rate >0.99 and HWE P-value > 10?5 were included for imputation using IMPUTE259 and reference haplotypes in the 1000 Genome Project60 (version 2012/03). We only included samples of European ancestry based on EIGENSTRAT analysis. The replication set had 65 lung 87 breast and 142 kidney histologically normal tissue samples after QC. Again each methylation trait was regressed against sex age batches and PCA scores based on methylation profiles. The regression residues were then quantile-normalized to the standard normal distribution N(01) as traits for meQTL analysis. The associations were tested between the quantile-normalized methylation traits and imputed genotypic dosages adjusting for sex age and PCA scores based on SNPs. A genetic association detected in EAGLE lung data was considered replicated if the association had the same direction and FDR<0.05 based on single-sided P-values. Testing genetic associations with methylation and gene expression traits We downloaded gene expression data (level 3) from RNA-seq analysis of 59 histologically normal tissue samples from NSCL patients from TCGA. All samples also had genome-wide genotype data and 28 samples had additional methylation data from Illumina Infinium HumanMethylation450 BeadChips. Regression analysis was performed to test the association of gene expression with methylation levels in the CHRNA5 gene and with methylation levels in PABPC4 STARD3 and SLC35A3 genes. We tested the association between lung cancer GWAS risk SNPs and gene expression using regression analysis under an additive model adjusting for age sex and PCA scores based on genome-wide SNPs. Testing for enrichment of cis-meQTLs in lung cancer GWAS We tested for enrichment in NCI lung cancer GWAS of European ancestry which included three main histologic subtypes of lung cancer (adenocarcinoma (AD) squamous cell carcinoma (SQ) small cell carcinoma (SC)) and a small number of other lung cancer subtypes. We investigated whether the identified cis-meQTL SNPs were collectively associated with lung cancer risk which was tested by examining whether the GWAS P-values for these SNPs deviated from the uniform distribution (i.e. no enrichment). Because the high linkage disequilibrium (LD) in SNPs increased variability of the enrichment statistic and caused a loss of power we first performed LD-pruning using PLINK so that no pair of remaining SNPs had a r2 ?0.8. The enrichment significance was evaluated by 10000 random permutations. The genomic control ?-values61 based on genome-wide SNPs were 1.010.995 0.977 and 1.00 for overall lung cancer AD SC and SQ respectively. Thus the type-I error rates of our enrichment tests were not inflated. The detailed procedure for testing a set of cis-meQTL SNPs is described as follows: Firstly we performed LD-pruning using PLINK so that no pair of remaining SNPs had an r2 ?0.8. Secondly we tested the association for the LD-pruned SNPs (assuming K SNPs left) in a GWAS and computed the P-values (p1?pK). We then tested whether (p1?pK) followed a uniform distribution i.e. no enrichment. Thirdly we transformed P-values into ?12 quantitles qk = F?1(1 ? pk) with F(·) being the cumulative distribution function (CDF) of ?12. We defined a statistic for testing enrichment as Q=?k=1Klog(1?f+fexp(qk/2))3562 where f is a pre-specified constant reflecting the expected proportion of SNPs associated with the disease. Because only a small proportion of SNPs may be associated with the disease we set f=0.05 for this paper. The statistical power was insensitive to the choice of f in the range of [0.01 0.1]62. Finally the significance of the test Q was evaluated by 10000 random permutations. meQTL mediation analysis We investigated whether trans associations were mediated by the methylation levels of CpG probes nearby the trans-acting SNPs. Note that this analysis was only for trans associations with cis effects i.e. the SNP was associated with at least one proximal CpG probes with p<4—10?5. See Fig. 2c. Suppose a SNP G cis-regulates K proximal (<500kb) CpG sites A1?AK with P<4—10?5 and trans-regulates a distal CpG site B. We performed a linear regression: B~?+?G +?kAk. We also computed marginal correlation coefficient cor(GB) and partial correlation coefficient cor(GB|Ak) using an R package œppcor63. A full mediation was detected if G and B were not significantly correlated after conditioning on Ak or equivalently G was not significant (p>0.01) in regression analysis B~?+?G +?kAk for any k. A partial mediation was detected if any Ak had a P<0.05/K (Bonferroni correction) in the regression analysis and |cor(GB)|?| cor(GB|A) |>0.1. An independent effect model (i.e. no mediation) was detected otherwise. Testing enrichment of meQTL SNPs in regulatory regions We obtained peak data for CTCF DNaseI H3K27me3 H3K4me3 and H3K36me of small airway epithelial cells (SAEC) from the ENCODE project and for H3K27me3 H3K4me3 and H3K9-14Ac from human alveolar epithelial cells (hAEC) from our own laboratory. A SNP is determined to be functionally related to a given mark or CTCF binding site if the SNP or any of its LD SNPs (r2 ?0.8 with LD computed using the genotype data of European population in The 1000 Genome Project) resided in any of the mark regions or CTCF binding sites. We explain our enrichment testing using CTCF as an example. We classified genome-wide SNPs into four categories: SNPs not associated with CpG probes in trans or cis (defined as control SNP set) SNPs only associated with proximal CpG probes via cis-regulation (cis-only21119 SNPs) SNPs only associated with distal CpG probes via trans-regulation (trans-only 192 SNPs) and SNPs detected with both trans and cis effects (cis+trans 277 SNPs). For SNPs in the category of cis-only trans-only and cis+trans we computed the proportion of SNPs functionally related to CTCF. To compute the enrichment of cis-meQTLs in CTCF binding sites we defined a control set of SNPs that are not associated with CpG probes via cis- or trans regulation. The selection of the control set was further complicated by the following two observations. (1) cis-meQTL SNPs tended to be more common (data now shown). (2) The probability of a SNP detected as a cis-meQTL SNP positively depended on the density of the CpG probes in the nearby region. Choosing a control set while ignoring these two factors could underestimate the proportion of functionally related SNPs in the control set and thus overestimate the enrichment for cis-meQTLs. Therefore we created 1000 sets of control SNPs with CpG probe density (measured as the number of CpG probes in the cis region of each SNP) and MAF matched with the meQTL SNP set and then averaged the proportions on the 1000 sets. The enrichment was calculated as the fold change with the proportion in the control SNP set as baseline. Next we investigated whether the enrichment was stronger for SNPs more significantly associated with CpG sites. Because we detected only a few hundred trans-meQTLs we focused this analysis on the set of cis-meQTLs. We classified cis-meQTL SNPs into five categories according to the cis-association P-values: P >10?7 (the weakest) 10?10< P ?10?7 10?15 < P ? 10?10 10?20 < P ? 10?15 and P ? 10?20 (the strongest). For each category we computed the proportion of SNPs functionally related to CTCF binding sites. meQTL SNPs affect CTCF binding We found that meQTL SNPs are strongly enriched in CTCF consensus sequences. We used SAEC data from ENCODE to test whether meQTL heterozygous SNPs directly affect CTCF binding by disrupting the CTCF recognition sites. P-values were calculated based on a binomial distribution Binom(N 0.5). Here N is the total number reads covering the SNPs. Raw sequencing data (.fasstq format) from SAEC cells were generated at the University of Washington as part of the ENCODE project and downloaded from the UCSC genome browser. Raw data was aligned to the hg19 genome using CLC genomics workbench (v 5.5.1) parsing out data with less than 80% contiguous alignment to the genome and duplicate reads in excess of 10 copies. We used the CTCFBSDB 2.0 program64 to predict whether the meQTL SNPs or their LD SNPs (r2 ? 0.8) were within CTCF peaks and then examined in SAEC whether CTCF exhibited allele-specific binding. Because common SNPs are more likely to be heterozygous we only looked for SNPs with MAF ?0.4. Here we present two such examples. Systematic investigation of all meQTL SNPs that are heterozygous in SAEC is warranted once more samples with genotypic data are available. Supplementary Material 1 Acknowledgements This study utilized the high-performance computational capabilities of the Biowulf Linux cluster at the NIH Bethesda MD (http://biowulf.nih.gov). We are grateful to the EAGLE participants and the large number of EAGLE collaborators (listed in http://dceg.cancer.gov/eagle) The Cancer Genome Atlas project for the genotype and methylation data and the ENCODE project for the regulatory region data. This work was supported by the Intramural Research Program of NIH NCI Division of Cancer Epidemiology and Genetics and in part by the Norris Comprehensive Cancer Center core grant (P30CA014089) from NCI the Trandisciplinary Research in Cancer of the Lung (TRICL) and the Genetic Associations and Mechanisms in Oncology (GAME-ON) Network (U19CA148127). AW ZW WZ and AH were also funded by the NCI NIH (HSN261200800001E). IALO and ZB were also funded by NIH grants (1 R01 HL114094 1 P30 H101258 and R37HL062569-13) Whittier Foundation and Hastings Foundation. ZB was also funded by the Ralph Edgington Chair in Medicine. CNM was funded by ACS/Canary postdoctoral fellowship (FTED-10-207-01-SIED). Author contributions M.T.L conceived the study. I.A.L.O. supervised DNA methylome analysis. J.S. performed EAGLE TCGA and ENCODE genetic analyses. C.M. performed allele-specific binding analyses. J.D. contributed to genetic analyses and performed GO analyses. J.S. P.L. I.A.L.O. and M.T.L. performed quality control analyses. A.C.P D.C. P.A.B A.W.B N.E.C. and M.T.L. conducted the EAGLE study and provided tissue samples. AW and AH prepared the tissue samples for the analyses. BZ and ZB isolated and cultured alveolar epithelial cells. T.T. and K.D.S. performed methylation normalization. Z.W. and W.W. performed LD analyses. J.S. C.M. J.D. P.L.H. M.C. D.S.L J.H. P-H.C B.S.I.C.W.Z. L.A. M.F. B.P.B. N.C M.A.T. S.J. C. I.A.L.O. M.T.L. contributed to the data interpretation. J.S. and M.T.L. wrote the manuscript. All authors participated in the discussion and reviewed the manuscript."

Lung_Cancer

"The proband™s father (II-5) and sister (III-5) were both unaffected and peripheral blood samples were obtained from these individuals. Some family members who were not considered as critical for this study were excluded from the pedigree chart to preserve confidentiality. Whole-exome sequencing was performed for individuals II-4 II-5 III-4 and III-5. After obtaining permission from the Institutional Review Board at Okayama University Hospital and informed consent from the patients and other family members we performed a whole-exome sequencing study. Tumor DNA samples from II-4 tumor and peripheral blood DNA samples from III-4 and peripheral blood DNA samples from two unaffected family members (II-5 and III-5) were used for the analysis. The candidate germline alterations were restricted to 29 variants by comparing the whole-exome sequencing results between the patients and the unaffected family members. Among them we focused on a point mutation in the human epidermal growth factor receptor 2 (HER2/neu) gene (NM_004448 G660D GGC to GAC) which was located in exon 17 encoding the transmembrane domain of HER2 (Supplementary Tables 1“3). This alteration was confirmed by direct sequencing (A). We also confirmed that there was no copy number gain of HER2 in the examined tumors based on the degree of read-depth in the whole-exome sequencing results. Of note no mutations in genes known to cause lung cancers were detected for tumors from III-4 and II-4. . DNA and amino acid sequences in the transmembrane domain of HER2. A) Direct Sanger sequencing of the proband (III-4) her affected mother (II-4) and her unaffected sister (III-5). The results indicated that G660D was a germline mutation. B) Direct sequencing of a sporadic lung adenocarcinoma with a HER2 V659E mutation. V659E was found to be of somatic origin based on the sequencing results of the peritumoral lung tissue from the same specimen. All the sequence variants were confirmed by independent polymerase chain reaction amplifications and were sequenced in both directions. C) Interspecies conservation of the transmembrane domain of HER2 (UCSC Genome Browser http://genome.ucsc.edu accessed September 12 2013). The yellow highlight indicates the N-terminal glycine zipper motif Thr652-X3-Ser656-X3-Gly660 a tandem variant of a GG4-like motif of human HER2. Codons 659 and 660 in human HER2 are highly conserved among the listed vertebrate species (shown in red). X. tropicalis = Xenopus tropicalis. We considered that somatic mutations in the HER2 transmembrane domain might act as driver mutations in lung cancer. Hence we sequenced exon 17 of the HER2 in the tumor samples of 315 sporadic non“small cell lung cancer patients of which 253 were adenocarcinomas. Although the HER2 G660D mutation was not detected a novel nonsynonymous mutation V659E (GTT to GAA) next to codon 660 was identified in one of these patients. This patient was histologically diagnosed as nonmucinous adenocarcinoma in situ and the patient had neither smoking history nor apparent family history of lung cancer. This V659E mutation was certainly a somatic mutation because it was not identified in the peritumoral lung tissue of the same patient (B). The alignment of HER2 amino acid sequences showed high conservation of valine 659 and glycine 660 among vertebrates (C). HER2 somatic mutations have been reported in 2% to 4% of lung adenocarcinomas (5“7). However all reported mutations were restricted to its tyrosine kinase domain (67). According to the cBioPortal for Cancer Genomics (http://www.cbioportal./public-portal/ accessed September 12 2013) the same genetic mutation in the HER2 has not been reported in any type of cancer. Interestingly a previous study reported that a mutation in the transmembrane domain (V664E) of the rat neu gene which corresponds to V659E in its human homolog HER2 induced oncogenic transformation (8). In addition in vivo experiments showed that the HER2 V659E mutation contributed to the stability of HER2 dimers resulting in the dysregulated receptor activation and subsequent cell transformation (910). Furthermore the novel mutations were located within the glycine zipper motif Thr652-X3-Ser656-X3-Gly660 a tandem variant of the GG4-like motif at the N-terminal portion of the transmembrane domain which was critically related to the dimerization of HER2 (C) (911). Accordingly we performed a functional analysis of the mutant HER2 proteins. We found that the degradation of HER2 protein after the administration of cycloheximide was slower in G660D and V659E mutants as compared with wild-type (Supplementary A) indicating the higher stability of the mutant proteins than wild-type protein. In addition results of a phospho-mitogen“activated protein kinase array indicated the activation of Akt and p38? (data not shown). Indeed Akt is known to be activated by HER2 by phosphatidylinositol 3-kinase and leads to increased cell growth and survival (1213). Also the activation of p38 was shown to contribute to the viability of lung adenocarcinoma cells derived from never or light smokers (1415). A western blot analysis for Akt and p38 successfully confirmed the upregulation of both phospho-Akt and phospho-p38 expression in the mutant HER2 transfectants (Supplementary B). Because the G660D alteration in HER2 might have been the cause of the lung cancer in the pedigree studied we investigated whether familial aggregation of cancer in other ans could be seen in this pedigree. We found that II-1 and II-6 developed renal and gastric cancers respectively; however both of them also had lung cancer. The reason why other types of clinically apparent malignances were rarely found in this pedigree is unclear. The G660D germline mutation may be tolerated in ans other than the lung. This study had some limitations. First the carcinogenic potential of the HER2 mutation at the transmembrane domain should be confirmed in other models such as transgenic mice. Second the rarity of these mutations in sporadic lung cancers may be the limitation for generalizability to other cases even if targeting therapies for similar types of HER2 mutation were developed. In we identified a novel germline mutation in the transmembrane domain of the HER2 in familial lung adenocarcinomas. Somatic mutation in the HER2 transmembrane domain may be a possible cause of sporadic lung adenocarcinomas. Funding This study was supported by a Grant-in Aid for Scientific Research from the Ministry of Education Culture Sports Science and Technology of Japan (25293302 to ST). H. Yamamoto J. Soh S. Miyoshi and S. Toyooka conceived the project. K. Higasa M. Sakaguchi K. Shien and K. Ichimura performed the experiments. H. Yamamoto J. Soh M. Furukawa S. Hashida N. Takigawa K. Kiura K. Tsukuda and S. Toyooka collected the samples and assisted with the experiments. H. Yamamoto K. Higasa K. Shien and K. Matsuo analyzed the data. H. Yamamoto K. Higasa M. Sakaguchi F. Matsuda and S. Toyooka prepared the manuscript with input from the other authors. S. Miyoshi F. Matsuda and S. Toyooka supervised the project. The authors declared no conflicts of interest. References 1. BellDWGoreIOkimotoRA Inherited susceptibility to lung cancer may be associated with the T790M drug resistance mutation in EGFR. Nat Genet. 2005;37(12):1315“131616258541 2. IkedaKNomoriHMoriTSasakiJKobayashiT Novel germline mutation: EGFR V843I in patient with multiple lung adenocarcinomas and family members with lung cancer. Ann Thorac Surg. 2008;85(4):1430“143218355544 3. OhtsukaKOhnishiHKuraiD Familial lung adenocarcinoma caused by the EGFR V843I germ-line mutation. J Clin Oncol. 2011;29(8):e191“e19221172876 4. van NoeselJvan der VenWHvan OsTA Activating germline R776H mutation in the epidermal growth factor receptor associated with lung cancer with squamous differentiation. J Clin Oncol. 2013;31(10):e161“e16423358982 5. PaoWGirardN New driver mutations in non-small-cell lung cancer. Lancet Oncol. 2011;12(2):175“18021277552 6. ShigematsuHTakahashiTNomuraM Somatic mutations of the HER2 kinase domain in lung adenocarcinomas. Cancer Res. 2005;65(5):1642“164615753357 7. StephensPHunterCBignellG Lung cancer: intragenic ERBB2 kinase mutations in tumours. Nature. 2004;431(7008):525“52615457249 8. BargmannCIHungMCWeinbergRA Multiple independent activations of the neu oncogene by a point mutation altering the transmembrane domain of p185. Cell. 1986;45(5):649“6572871941 9. BocharovEVMineevKSVolynskyPE Spatial structure of the dimeric transmembrane domain of the growth factor receptor ErbB2 presumably corresponding to the receptor active state. J Biol Chem. 2008;283(11):6950“695618178548 10. FleishmanSJSchlessingerJBen-TalN A putative molecular-activation switch in the transmembrane domain of erbB2. Proc Natl Acad Sci U S A. 2002;99(25):15937“1594012461170 11. MineevKSBocharovEVPustovalovaYEBocharovaOVChupinVVArsenievAS Spatial structure of the transmembrane domain heterodimer of ErbB1 and ErbB2 receptor tyrosine kinases. J Mol Biol. 2010;400(2):231“24320471394 12. BaselgaJSwainSM Novel anticancer targets: revisiting ERBB2 and discovering ERBB3. Nat Rev Cancer. 2009;9(7):463“47519536107 13. EngelmanJA Targeting PI3K signalling in cancer: opportunities challenges and limitations. Nat Rev Cancer. 2009;9(8):550“56219629070 14. MountziosGPlanchardDBesseB Mitogen-activated protein kinase activation in lung adenocarcinoma: a comparative study between ever smokers and never smokers. Clin Cancer Res. 2008;14(13):4096“410218593986 15. PlanchardDCamara-ClayetteVDorvaultNSoriaJCFouretP p38 Mitogen-activated protein kinase signaling ERCC1 expression and viability of lung cancer cells from never or light smoker patients. Cancer. 2012;118(20):5015“502522415779 Oncotarget Oncotarget ImpactJ Oncotarget 1949-2553 Impact Journals LLC 24519909 3996653 Research Paper Sp1-mediated microRNA-182 expression regulates lung cancer progression Yang Wen-Bin 1 Chen Ping-Hsin 2 Hsu Tsung-I 3 Fu Tzu-Fun 4 Su Wu-Chou 5 Liaw Hungjiun 6 Chang Wen-Chang 7 Hung Jan-Jong 1 2 3 7 1 Institute of Bioinformatics and Biosignal Transduction College of Bioscience in Biotechnology National Cheng Kung University Tainan 701 Taiwan 2 Department of Pharmacology College of Medicine National Cheng Kung University Tainan 701 Taiwan 3 Center for Infectious Disease and Signal Transduction Research National Cheng Kung University Tainan 701 Taiwan 4 Department of Medical Laboratory Science and Biotechnology College of Medicine National Cheng Kung University Tainan 701 Taiwan 5 Department of Internal Medicine College of Medicine and Hospital National Cheng Kung University Tainan 701 Taiwan 6 Department of Life Sciences College of Bioscience in Biotechnology National Cheng Kung University Tainan 701 Taiwan 7 Graduate Institute of Medical Sciences College of Medicine and Center for Neurotrauma and Neuroregeneration Taipei Medical University Taipei 110 Taiwan Correspondence to:petehung petehung@mail.ncku.edu.tw 2 2014 25 1 2014 5 3 740 753 18 11 2013 24 11 2014 Copyright: © 2014 Yang et al. 2014 This is an open-access article distributed under the terms of the Creative Commons Attribution License which permits unrestricted use distribution and reproduction in any medium provided the original author and source are credited. Our recent study indicated that overexpression of Sp1 enhances the proliferation of lung cancer cells while represses metastasis. In this study we found that the transcriptional activity of FOXO3 was increased but its protein levels decreased following Sp1 expression. Sp1 increased expression of miR-182 which was then recruited to the 3'-untranslated region of FOXO3 mRNA to silence its translational activity. Knockdown of miR-182 inhibited lung cancer cells growth but enhanced the invasive and migratory abilities of these cells through increased N-cadherin expression. Repression of FOXO3 expression in the miR-182 knockdown cells partially reversed this effect suggesting that miR-182 promotes cancer cell growth and inhibits cancer metastatic activity by regulating the expression of FOXO3. The expression of several cancer metastasis-related genes such as ADAM9 CDH9 and CD44 was increased following miR-182 knockdown. In in the early stages of lung cancer progression Sp1 stimulates miR-182 expression which in turn decreases FOXO3 expression. This stimulates proliferation and tumor growth. In the late stages Sp1 and miR-182 decline thus increasing FOXO3 expression which leads to lung metastasis. Sp1 miR-182 FOXO3 Lung cancer INTRODUCTION Post-transcriptional regulation plays an important role in diverse cellular processes such as development neurogenesis and cancer progression [1-3]. MicroRNAs (miRNAs) have emerged as important post-transcriptional regulators that inhibit mRNA translation or induce mRNA cleavage by base pairing with a seed region in the 3'-untranslated region (3'-UTR) of target genes [4 5]. Recent studies have shown that dysregulation of miRNAs contributes to the initiation progression metastasis and drug resistance of cancer [6 7]. For example miR-200c targets Kras to regulate Kras expression during tumorigenesis [8]. Furthermore several upregulated and downregulated miRNAs have been identified in lung cancer the most frequently diagnosed cancer and the most common cause of cancer-related death worldwide [9-11]. Identification of early-detection biomarkers and precise diagnosis are necessary if lung cancer patients are to receive efficacious therapeutic treatment quickly. Several factors such as USP17 have been identified as potential biomarkers for lung cancer [12 13]. Circulating miRNAs could also serve as useful clinical biomarkers for the screening of high-risk populations and the detection solid tumors in the early stages of cancer progression [14 15]. miRNAs offer new targets for cancer therapy [16 17]. Therefore a detailed understanding of the mechanisms underlying miRNA production and function is important. Identification of miRNA target genes and the use of gene set enrichment analysis have clarified the function role of miRNAs. However the molecular mechanisms that regulate of miRNA biogenesis are still largely unknown. Recent studies have shown that transcription factors (TFs) regulate not only the expression of protein-encoding genes but also miRNA biogenesis through RNA polymerase II-dependent transcription [18]. Several TFs including p53 c-myc and HIF1? that directly recognize miRNA promoters and regulate miRNA transcription have been reported [19-21]. Specificity protein 1 (Sp1) which belongs to the specificity protein/ Krüppel-like family was the first TF identified in mammalian cells. Sp1 contains three Cys2His2-type zinc finger DNA binding motifs that recognize GC-rich promoter sequences [22]. Sp1 regulates thousands of coding genes such as those encoding cyclin A2 p21cip1/waf1 E-cadherin and Sp1 itself. These genes are involved in a variety of physiological processes including cell cycle progression and cell migration [23-26]. Sp1 also regulates the expression of noncoding genes. Sp1 forms a complex with NF-?B to downregulate miR-29b expression through the recruitment of histone deacetylase (HDAC) 1 and HDAC3 in leukemia and thereby contributes to the growth of leukemia cells [27]. Sp1 also forms a complex with HDAC4 to downregulate miR-200a expression in hepatocellular carcinoma and contributes to cell proliferation and migration [28]. In addition Sp1 is an activator of miR-34c miR-132 and miR-365 expression [29-31]. However no studies have assessed whether Sp1 regulates the expression of miRNAs involved in lung tumorigenesis. Because the accumulation of Sp1 is required for lung tumor growth further investigation of Sp1-mediated miRNA regulation is needed. In this study we showed that Sp1 suppressed FOXO3 expression via post-transcriptional regulation. To elucidate whether miRNAs were involved in this process we used a systematic screening approach to identify Sp1-regulated miRNAs. We identified a novel Sp1-regulated miRNA miR-182 in lung cancer cells and demonstrated that Sp1 downregulated FOXO3 expression by upregulating miR-182 expression. Our results show that miR-182 functions as an oncomiR to enhance cancer cell proliferation and acts as a tumor suppressor to inhibit cancer metastasis. RESULTS Sp1 regulates miR-182 expression Our previous studies demonstrated that Sp1 is involved in KrasG12D-induced lung tumorigenesis [23 32]. Using cDNA microarray analysis we found that Sp1 increased oncogene expression and decreased tumor suppressor gene expression. In the present study we initially used software to analyze the promoters of all identified miRNAs. According to the miRBase database the human genome contains 1600 miRNA genes. We investigated whether Sp1 participates in the regulation of intergenic miRNAs. First we screened the upstream (-1 kb) flanking sequences of intergenic miRNAs. Using the TFSEARCH program we identified 205 intergenic miRNAs that contained potential binding sites for Sp1. Because Sp1 is upregulated in lung cancer and the expression of its target genes is altered we next examined the expression of these miRNAs in lung cancer. According to previous studies the expression patterns of 22 miRNAs differed significantly in lung cancer tissue and normal lung tissue (Supplementary Table S1). In most of these studies miR-182 which contains two putative Sp1 binding sites within its upstream region was upregulated in lung cancer. When we examined miR-182 expression we found that miR-182 was decreased in Sp1-knockdown cells but increased in IMR-90 cells that overexpressed GFP-Sp1 (Figure 1A and 1B) suggesting that Sp1 positively regulates miR-182 expression."

Lung_Cancer

"ne 78-diol 910-epoxide (BPDE) which involved in inducing DNA adducts and thus made a predisposition to lung adenocarcinoma [32]“[34]. Besides the method of cooking and throat or eyes irritation the interviewers also asked each woman the information on cooking oil fumes exposure such as the types of cooking oils she used the frequency she used stir frying or deep frying to prepare food ventilation conditions and the use of a fume extractor. Increasing epidemiological studies have reported cooking method and types of cooking oils on lung cancer susceptibility among Chinese females. Seow et al.[35]found that women who reported that they stir fried daily had a significantly increased risk of lung cancer (OR?=?2.0 95%CI 1.0“3.8) and risk was enhanced for those who stir fried meat daily (OR?=?2.7 95%CI 1.3“5.5). The elevated lung cancer risk might be attributed to heterocyclic amines generated during frying of meats. In addition the frequency of stir frying seemed to be related with lung cancer susceptibility. Gao et al. [36]investigated the association between the frequency of stir frying and lung cancer risk in Chinese females they observed that stir frying more than 30 dishes per week was associated with high risk of lung cancer (OR?=?2.6 95%CI 1.3“5.0). In a case-control study in northeast China Wu-Williams et al.[37] found that women who deep fried twice per month had a 2.1-fold increased risk of developing lung cancer than those who never used deep frying method. And there was a significant trend in risk with increasing number of meals cooked by deep frying. Also this kind of correlation was found in both non-smokers and lung adenocarcinoma population. For types of cooking oils Zhong et al.[38] reported that soybean oil was most commonly used in Shanghai and the use of rapeseed oil was associated with a higher risk of lung cancer (OR?=?1.84 95%CI 1.12“3.03). In this study we observed that ATM rs189037 AA genotype carriers were more susceptible to lung adenocarcinoma than GA or GG genotype carriers in a recessive model. This might not give direct support for AA genotype as a risk factor for lung adenocarcinoma. But the results reflected that G allele might be a protective factor for lung adenocarcinoma. So we compared AA genotype with GA genotype and our data showed that women who were AA genotype carriers had an elevated risk of lung adenocarcinoma (OR?=?1.74 95%CI 1.10“2.74 P?=?0.018). In other words GA genotype might be protective for developing lung adenocarcinoma. In the stratified analysis of cooking oil fumes exposure we also found that AA genotype carriers had a predisposition to lung adenocarcinoma in women who had no exposure of cooking oil fumes (OR?=?1.89 95%CI 1.03“3.49). Considering that G allele might be a protective factor for lung adenocarcinoma we then compared AA genotype with GA genotype to further validate our previous results. And it turned out that in the non-exposed group women who were AA genotype carriers had a higher risk of lung adenocarcinoma than those GA genotype carriers (OR?=?1.98 95%CI 1.15“3.40 P?=?0.014) which was in accordance with our previous data that G allele might be a protective factor for lung adenocarcinoma. But in the combined analysis of interaction of cooking oil fumes exposure and rs189037 polymorphism no significant association was found. We have described the distribution of any possible factors such as age passive smoking status fuel smoke exposure family history of cancer between cooking oil fumes exposed group and non-exposed group that might affect the association but none of these seemed to be different between exposed group and non-exposed group (). As tumor is a multifactorial disease we could infer that there might be other risk factors playing a role in the development of lung adenocarcinoma. We tended to believe that there might be other host genetic susceptibility or unknown risk factors caused the results. .0096911.t005 Comparisons of distribution of risk factors between cooking oil fumes exposed group and non-exposed group. Variable Exposed(%) Non-exposed(%) P value Mean age (±S.D.) 56.3±11.7 56.1±11.1 0.871a Fuel smoke exposure 44(28.2%) 98(27.0%) 0.777b Passive smoking exposure 96(61.5%) 203(55.9%) 0.235b Family history of cancer 19(12.2%) 37(10.2%) 0.504b a Student's t-test was used to compare the frequency distribution of demographic variables between the exposed group and non-exposed group. b Peason's chi square was used to compare the frequency distribution of demographic variables fuel smoke exposure family history of cancer passive smoking between the exposed group and non-exposed group. There are several limitations in the current study. First hospital-based studies are likely to include some controls with non-malignant lung diseases especially those associated with chronic inflammatory processes are suspected to have predisposing factors for lung cancer. The ORs we found may be underestimated. Second the statistical power of the study may be limited by the relatively small sample size of subjects. In addition other SNPs in ATM gene and in this pathway may be involved in the risk of lung adenocarcinoma gene-gene interaction and haplotypes may offer more clues to clarity the association between host genetic susceptibility and lung adenocarcinoma risk. But it is noteworthy that our study investigated the association between ATM rs189037 polymorphism and lung adenocarcinoma risk in a non-smoking females population for the first time. Meanwhile we explored the combined effects of cooking oil fumes exposure and ATM rs189037 polymorphism on lung adenocarcinoma risk. As our small sample size and only one SNP genotyped large-scale studies with gene-gene and gene-environment interactions in different races and population are required to validate our findings. Conclusions In summary this hospital-based case-control study showed that ATM rs189037 might be associated with the risk of lung adenocarcinoma in Chinese non-smoking females. Furthermore ATM rs189037 AA genotype might be a risk factor affecting lung adenocarcinoma among females without cooking oil fume exposure. References 1 MattsonME PollackES CullenJW (1987) What are the odds that smoking will kill you?American journal of public health77: 425“4313826460 2 WeiQ ChengL HongWK SpitzMR (1996) Reduced DNA repair capacity in lung cancer patients. Cancer Res56: 4103“41078797573 3 SpitzMR WeiQ DongQ AmosCI WuX (2003) Genetic susceptibility to lung cancer: the role of DNA damage and repair. Cancer Epidemiol Biomarkers Prev12: 689“69812917198 4 KurzEU Lees-MillerSP (2004) DNA damage-induced activation of ATM and ATM-dependent signaling pathways. DNA Repair (Amst)3: 889“90015279774 5 PetriniJH StrackerTH (2003) The cellular response to DNA double-strand breaks: defining the sensors and mediators. Trends Cell Biol13: 458“46212946624 6 LavinMF KozlovS (2007) ATM activation and DNA damage response. Cell Cycle6: 931“94217457059 7 SavitskyK Bar-ShiraA GiladS RotmanG ZivY et al (1995) A single ataxia telangiectasia gene with a product similar to PI-3 kinase. Science268: 1749“17537792600 8 KastanMB LimDS (2000) The many substrates and functions of ATM. Nat Rev Mol Cell Biol1: 179“18611252893 9 KastanMB BartekJ (2004) Cell-cycle checkpoints and cancer. Nature432: 316“32315549093 10 TaulanM LopezE GuittardC ReneC BauxD et al (2007) First functional polymorphism in CFTR promoter that results in decreased transcriptional activity and Sp1/USF binding. Biochem Biophys Res Commun361: 775“78117678620 11 SchultzJ LorenzP IbrahimSM KundtG GrossG et al (2009) The functional -443T/C osteopontin promoter polymorphism influences osteopontin gene expression in melanoma cells via binding of c-Myb transcription factor. Mol Carcinog48: 14“2318459127 12 MenzaghiC ParoniG De BonisC SoccioT MarucciA et al (2006) The -318 C>G single-nucleotide polymorphism in GNAI2 gene promoter region impairs transcriptional activity through specific binding of Sp1 transcription factor and is associated with high blood pressure in Caucasians from Italy. J Am Soc Nephrol17: S115“11916565233 13 FreyUH HaunerH JockelKH MantheyI BrockmeyerN et al (2008) A novel promoter polymorphism in the human gene GNAS affects binding of transcription factor upstream stimulatory factor 1 Galphas protein expression and body weight regulation. Pharmacogenet Genomics18: 141“15118192900 14 GiladS ChessaL KhosraviR RussellP GalantyY et al (1998) Genotype-phenotype relationships in ataxia-telangiectasia and variants. Am J Hum Genet62: 551“5619497252 15 TeraokaSN TelatarM Becker-CataniaS LiangT OnengutS et al (1999) Splicing defects in the ataxia-telangiectasia gene ATM: underlying mutations and consequences. Am J Hum Genet64: 1617“163110330348 16 ZhangL YangM BiN FangM SunT et al (2010) ATM polymorphisms are associated with risk of radiation-induced pneumonitis. Int J Radiat Oncol Biol Phys77: 1360“136820171797 17 XuL MorariEC WeiQ SturgisEM WardLS (2012) Functional variations in the ATM gene and susceptibility to differentiated thyroid carcinoma. J Clin Endocrinol Metab97: 1913“192122438227 18 BauD-T ChangC-H TsaiM-H ChiuC-F TsouY-A et al (2010) Association Between DNA Repair Gene ATM Polymorphisms and Oral Cancer Susceptibility. Laryngoscope120: 2417“242221108427 19 WangH-C ChangW-S TsaiR-Y TsaiC-W LiuL-C et al (2010) Association between Ataxia Telangiectasia Mutated Gene Polymorphisms and Breast Cancer in Taiwanese Females. Anticancer Research30: 5217“522121187516 20 WangC-H WuK-H YangY-L PengC-T TsaiF-J et al (2011) Association between Ataxia Telangiectasia Mutated Gene Polymorphisms and Childhood Leukemia in Taiwan. Chinese Journal of Physiology54: 413“41822229509 21 WangHM ShiYS LiQS LiuY ZhengXK (2011) [Association between single nucleotide polymorphism locus rs189037 in the promoter of ATM gene and nasopharyngeal carcinoma susceptibility in Cantonese]. Nan Fang Yi Ke Da Xue Xue Bao31: 1863“186622126766 22 ZhaoP ZouP ZhaoL YanW KangC et al (2013) Genetic polymorphisms of DNA double-strand break repair pathway genes and glioma susceptibility. BMC Cancer13: 23423663450 23 LoYL HsiaoCF JouYS ChangGC TsaiYH et al (2010) ATM polymorphisms and risk of lung cancer among never smokers. Lung Cancer69: 148“15420004998 24 HsiaTC TsaiCW LiangSJ ChangWS LinLY et al (2013) Effects of ataxia telangiectasia mutated (ATM) genotypes and smoking habits on lung cancer risk in Taiwan. Anticancer Res33: 4067“407124023351 25 KimJH KimH LeeKY ChoeKH RyuJS et al (2006) Genetic polymorphisms of ataxia telangiectasia mutated affect lung cancer risk. Hum Mol Genet15: 1181“118616497724 26 BelaniCP MartsS SchillerJ SocinskiMA (2007) Women and lung cancer: epidemiology tumor biology and emerging trends in clinical research. Lung Cancer55: 15“2317084482 27 ThomasL DoyleLA EdelmanMJ (2005) Lung cancer in women: emerging differences in epidemiology biology and therapy. Chest128: 370“38116002959 28 ZangEA WynderEL (1996) Differences in lung cancer risk between men and women: examination of the evidence. J Natl Cancer Inst88: 183“1928632492 29 ShiH HeQ DaiX ZhouB (2005) [Study on risk factors of lung cancer in non-smoking women]. Zhongguo Fei Ai Za Zhi8: 279“28221108882 30 KoYC ChengLS LeeCH HuangJJ HuangMS et al (2000) Chinese food cooking and lung cancer in women nonsmokers. Am J Epidemiol151: 140“14710645816 31 ChenT DongB LuZ TianB ZhangJ et al (2010) A functional single nucleotide polymorphism in promoter of ATM is associated with longevity. Mech Ageing Dev131: 636“64020816691 32 ChiangTA WuPF KoYC (1999) Identification of carcinogens in cooking oil fumes. Environ Res81: 18“2210361022 33 ChenH YangM YeS (1992) A study on genotoxicity of cooking fumes from rapeseed oil. Biomed Environ Sci5: 229“2351449658 34 YangSC JenqSN KangZC LeeH (2000) Identification of benzo[a]pyrene 78-diol 910-epoxide N2-deoxyguanosine in human lung adenocarcinoma cells exposed to cooking oil fumes from frying fish under domestic conditions. Chem Res Toxicol13: 1046“105011080053 35 SeowA PohWT TehM EngP WangYT et al (2000) Fumes from meat cooking and lung cancer risk in Chinese women. Cancer Epidemiol Biomarkers Prev9: 1215“122111097230 36 GaoYT BlotWJ ZhengW ErshowAG HsuCW et al (1987) Lung cancer among Chinese women. International Journal of Cancer40: 604“609 37 Wu-WilliamsAH DaiXD BlotW XuZY SunXW et al (1990) Lung cancer among women in north-east China. Br J Cancer62: 982“9872257230 38 ZhongL GoldbergMS GaoYT JinF (1999) Lung cancer and indoor air pollution arising from Chinese-style cooking among nonsmoking women living in Shanghai China. Epidemiology (Cambridge Mass)10: 488“494 PLoS One PLoS ONE plos plosone PLoS ONE 1932-6203 Public Library of Science San Francisco USA 24586842 3934888 PONE-D-13-30257 .0089518 Research Article Biology Genetics Genetic mutation Mutation types Cancer genetics Medicine Clinical research design Retrospective studies Diagnostic medicine Pathology Clinical pathology Test evaluation Oncology Cancer detection and diagnosis Cancer screening Cancer treatment Chemotherapy and drug treatment Clinical trials (cancer treatment) Cancers and neoplasms Lung and intrathoracic tumors Non-small cell lung cancer Oncology agents Clinical Validation of a PCR Assay for the Detection of EGFR Mutations in Non“Small-Cell Lung Cancer: Retrospective Testing of Specimens from the EURTAC Trial EGFR Mutation Testing in NSCLC in EURTAC Trial Benlloch Susana 1 * Botero Maria Luisa 1 Beltran-Alamillo Jordi 1 Mayo Clara 1 Gimenez-Capitán Ana 1 de Aguirre Itziar 2 Queralt Cristina 2 Ramirez Jose Luis 2 Cajal Santiago Ramón y. 1 6 Klughammer Barbara 3 Schlegel Mariette 3 Bordogna Walter 3 Chen David 4 Zhang Guili 5 Kovach Barbara 5 7 Shieh Felice 5 7 Palma John F. 5 Wu Lin 5 Lawrence H. Jeffrey 5 7 Taron Miquel 1 2 1 Pangaea Biotech SL Barcelona Spain 2 Medical Oncology Service-ICO Hospital Germans Trias i Pujol Badalona Spain 3 F. Hoffmann-La Roche Basel Switzerland 4 Genentech South San Francisco California United States of America 5 Roche Molecular Systems Pleasanton California United States of America 6 Pathology Department Vall d'Hebron University Hospital Universidad Autónoma de Barcelona Barcelona Spain 7 Roche Molecular Systems Pleasanton California United States of America Minna John D. Editor Univesity of Texas Southwestern Medical Center at Dallas United States of America * E-mail: sbenlloch@pangaeabiotech.com Competing Interests: BK MS WB DC GZ JFP LW are all current employees of Roche. BK DC JFP and LW have stock holdings in Roche. BK and HJL are former Roche employees and HJL has stock in Roche and has served as a paid consultant. FS was a paid consultant to Roche. SB JBA CM AGC are current employees of Pangaea Biotech. MLB is a former Pangaea employee. MT and SRyC have stock holdings in Pangaea Biotech. IdA CQ JLR are current employees of Medical Oncology Service-ICO Hospital Germans Trias i Pujol. This does not alter the authors' adherence to all the PLOS ONE policies on sharing data and materials. Conceived and designed the experiments: MT HJL. Performed the experiments: CM AGC JBA IdA CQ JLR. Analyzed the data: SB DC GZ CM AGC JBA IdA CQ JLR FS LW JFP HJL MT. Contributed reagents/materials/analysis tools: SB MLB JBA CM AGC IdA CQ JLR SRyC BK MS WB DC GZ BK FS LW JFP HJL MT. Wrote the paper: SB MLB JBA CM AGC IdA CQ JLR SRyC BK MS WB DC GZ BK FS LW JFP HJL MT. 2014 25 2 2014 9 2 e89518 23 7 2013 21 1 2014 2014 Benlloch et al This is an open-access article distributed under the terms of the Creative Commons Attribution License which permits unrestricted use distribution and reproduction in any medium provided the original author and source are credited. The EURTAC trial demonstrated that the tyrosine kinase inhibitor (TKI) erlotinib was superior to chemotherapy as first-line therapy for advanc"

Lung_Cancer

"A Splenocytes harvested from mice treated with scFvMTBHsp70 fusion protein equimolar mixture of MTBHsp70 plus P4 scFv or saline (n = 10 per group) were re-stimulated with Her2/neu peptide or MSLN Ld1 peptide. Results are reported as the difference between nonstimulated (media alone) and stimulated cells and expressed as the frequency of parent CD3+CD8+ cells. P values were determined using One-Way ANOVA followed by Dunnett™s multiple comparison tests. B Representative flow data are presented. C In vivo CD8+ T-cell depletion study. FVB/NJ mice were injected i.p. with anti-CD8 mAb or an isotype-matched irrelevant rat IgG2a and were treated with scFvMTBHsp70 or saline as described in the methods. CD8+ T-cell depletion significantly and negatively impacted ascites-free survival in the scFvMTBHsp70 treated BR5FVB1 tumor-bearing animals compared to non depleted actively treated (n = 10 per group representative of two independent experiments; Med. sur. = 32.5 days vs. 48 days) animals. After CD8+ T cells depletion scFvMTBHsp70 treatment did not delay onset of disease (clinically evident ascites) compared with saline (Med. sur. = 32.5 days vs. 31.5 days; p = 0.5938). P values were determined using log-rank test. *p< 0.05; **p < 0.01 ***p < 0.001. scFvMTBHsp70 is able to prime an adaptive tumor-specific immune response that has an absolute requirement for tumor-specific CD8+ T cells To determine whether CD8+ T cells play a major role in the protective anti-tumor effects observed in mice treated with scFvMTBHsp70 we conducted in vivo CD8+ T-cell depletion experiments using monoclonal antibodies. The absence of circulating CD8+ cells in peripheral blood following depletion was confirmed by flow cytometry (Additional file 4: Figure S4A and B). As shown in Figure 3C CD8+ T-cell depletion significantly and negatively impacted ascites-free survival in the scFvMTBHsp70-treated BR5FVB1 tumor-bearing animals compared to non-depleted actively-treated animals. Following CD8+ T-cell depletion scFvMTBHsp70 treatment did not delay onset of disease (clinically evident ascites) compared to saline treatment. Therefore our data suggest that the priming of an adaptive tumor-specific immune response by scFvMTBHsp70 treatment is chiefly mediated by tumor-specific CD8+ T cells. scFvMTBHsp70 stimulates maturation of murine bone marrow-derived dendritic cells In order to investigate immunological mechanisms involved in the scFvMTBHsp70-enhanced anti-tumor immune response we first examined if the scFvMTBHsp70 or MTBHsp70 proteins used in our study could stimulate maturation of bone marrow-derived dendritic cells (BMDCs) as shown in previous studies [1617]. We stimulated CD11c+ BMDCs with 2 ?g/ml of scFvMTBHsp70 or an equimolar amount of MTBHsp70 (1.3 ?g/ml). 1 ?g/ml lipopolysaccharide (LPS) was used as positive control. To determine whether the BMDC maturation was attributable to LPS contamination of the recombinant proteins used in this study we also incubated BMDCs with 0.1 ng/ml LPS which was the equivalent amount of endotoxin found in 2 ?g/ml scFvMTBHsp70. After a 24 h-incubation both scFvMTBHsp70 and MTBHsp70 induced DC maturation indicated by an increase in the expression of CD40 CD80 CD86 and MHC class II molecules in comparison to the control cultures in medium. The increased expression of these DC maturation markers were comparable to those on cells stimulated with 1 ?g/ml LPS. The contamination control showed that addition of 0.1 ng/ml LPS did not replicate the effects of scFvMTBHsp70 or MTBHsp70 allowing us to discriminate the scFvMTBHsp70- or MTBHsp70-specific effects from effects of LPS (Figure 4A and B). scFvMTBHsp70 induces DC maturation and promotes antigen presentation and cross-presentation. A CD11c+ BMDCs isolated form FVB/NJ mice were incubated for 24 h with 2 ?g/ml scFvMTBHsp70 1.3 ?g/ml MTBHsp70 1 ?g/ml LPS as positive control or 0.1 ng/ml LPS as contamination control (thick lines) or medium only (solid) stained for CD11c CD40 CD80 CD86 and MHC II and analyzed by flow cytometry. Histograms were gated on CD11c+ DCs. Data are representative of three independent experiments in duplicate wells. B Median fluorescence intensity (MFI) of LPS- or protein-stimulated BMDCs normalized to MFI of BMDCs maintained in medium. Data are expressed as means?±?SEM in arbitrary units. P values were determined using One-Way ANOVA followed by Dunnett™s multiple comparison tests. C BMDCs cultured from FVB/NJ mice were pulsed with BR5FVB1 cells alone (Column a) or BR5FVB1 cells pre-complexed with MTBHsp70 (Column b) or scFvMTBHsp70 (Column c) and then incubated with BR5FVB1 tumor cell-primed T cells. Intracellular granzyme B and IFN? expressions in CD3+CD4+ and CD3+CD8+ T cells were analyzed by flow cytometry. Data from three independent experiments in duplicate wells are pooled and analyzed using One-Way ANOVA followed by Turkey™s multiple comparison tests. Data are presented as mean?±?SEM. D Representative flow data are presented. E scFvMTBHsp70 enhanced tumor cell immunogenicity in vivo. Results are reported as the difference between nonstimulated (media alone) and stimulated cells and expressed as the frequency of parent CD3+CD4+ or CD3+CD8+ cells. P values were determined using One-Way ANOVA followed by Turkey™s multiple comparison tests. *p?<?0.05; **p?<?0.01; ***p?<?0.001; ****p?<?0.0001. "

Lung_Cancer

"In we identify EGFR as a molecular target to overcome a novel mechanism of radioresistance in KRAS-mutant tumor cells which stands in contrast to the unresponsiveness of KRAS-mutant cancers to EGFR-directed agents in monotherapy. Our findings may reposition EGFR-targeted agents for combination with DSB-inducing therapies in KRAS-mutant NSCLC. KRAS EGFR Lung Cancer Radiation Med Phys Med Phys Medical Physics 0094-2405 0094-2405 American Association of Physicists in Medicine 24694124 3978354 020404MPH 10.1118/1.4867860 Radiation Therapy Physics A block matching-based registration algorithm for localization of locally advanced lung tumors Robertson Scott P. Weiss Elisabeth Hugo Geoffrey D. a) Department of Radiation Oncology Virginia Commonwealth University Richmond Virginia 23298 a) Author to whom correspondence should be addressed. Electronic mail: gdhugovcu.edu; Telephone: 804-628-3457; Fax: 804-628-0271. 4 2014 13 3 2014 41 4 041704 24 6 2013 17 2 2014 20 2 2014 Copyright 2014 American Association of Physicists in Medicine 2014 American Association of Physicists in Medicine Purpose: To implement and evaluate a block matching-based registration (BMR) algorithm for locally advanced lung tumor localization during image-guided radiotherapy. Methods: Small (1 cm3) nonoverlapping image subvolumes (œblocks) were automatically identified on the planning image to cover the tumor surface using a measure of the local intensity gradient. Blocks were independently and automatically registered to the on-treatment image using a rigid transform. To improve speed and robustness registrations were performed iteratively from coarse to fine image resolution. At each resolution all block displacements having a near-maximum similarity score were stored. From this list a single displacement vector for each block was iteratively selected which maximized the consistency of displacement vectors across immediately neighboring blocks. These selected displacements were regularized using a median filter before proceeding to registrations at finer image resolutions. After evaluating all image resolutions the global rigid transform of the on-treatment image was computed using a Procrustes analysis providing the couch shift for patient setup correction. This algorithm was evaluated for 18 locally advanced lung cancer patients each with 4“7 weekly on-treatment computed tomography scans having physician-delineated gross tumor volumes. Volume overlap (VO) and border displacement errors (BDE) were calculated relative to the nominal physician-identified targets to establish residual error after registration. Results: Implementation of multiresolution registration improved block matching accuracy by 39% compared to registration using only the full resolution images. By also considering multiple potential displacements per block initial errors were reduced by 65%. Using the final implementation of the BMR algorithm VO was significantly improved from 77% ± 21% (range: 0%“100%) in the initial bony alignment to 91% ± 8% (range: 56%“100%; p < 0.001). Left-right anterior-posterior and superior-inferior systematic BDE were 3.22.4 and 4.4 mm respectively with random BDE of 2.42.1 and 2.7 mm. Margins required to include both localization and delineation uncertainties ranged from 5.0 to 11.7 mm an average of 40% less than required for bony alignment. Conclusions: BMR is a promising approach for automatic lung tumor localization. Further evaluation is warranted to assess the accuracy and robustness of BMR against other potential localization strategies. nonsmall-cell lung cancer image registration image-guided radiation therapy CCC information 0094-2405/2014/41(4)/041704/11/$30.00 sisac 0094-2405()41:4L.041704;1 edcode 13-932R2 aipkey 1.4867860 spin KART 2012 8757Q- 8757nj 8757cf 8719xj 8753Jw US 10 cancer computerised tomography image matching image registration image resolution lung median filters medical image processing radiation therapy tumours ipc-code A61B6/03 Computerised tomographs ipc-code A61N5/00 Radiation therapy ipc-code G01N33/48 Biological material e.g. blood urine; Haemocytometers ipc-code G06F19/00 Digital computing or data processing equipment or methods specially adapted for specific applications ipc-code G06T Image data processing or generation in general PLoS One one 1932-6203 Public Library of Science San Francisco USA 24587153 3935965 PONE-D-13-45372 .0089961 Research Biology Developmental biology Morphogenesis Cell migration Model anisms Animal models Mouse Molecular cell biology Cell growth Medicine Oncology Basic cancer research Metastasis Cancers and neoplasms Gastrointestinal tumors Hepatocellular carcinoma Luteoloside Suppresses Proliferation and Metastasis of Hepatocellular Carcinoma Cells by Inhibition of NLRP3 Inflammasome Luteoloside Suppresses HCC Carcinogenesis Fan Shao-hua 1 Wang Yan-yan 2 Lu Jun 1 Zheng Yuan-lin 1 * Wu Dong-mei 1 Li Meng-qiu 1 Hu Bin 1 Zhang Zi-feng 1 Cheng Wei 3 Shan Qun 1 1 Key Laboratory for Biotechnology on Medicinal Plants of Jiangsu Province School of Life Science Jiangsu Normal University Xuzhou Jiangsu China 2 Department of Function Examination The First People's Hospital of Xuzhou Jiangsu China 3 School of Environment and Spatial Informatics China University of Mining and Technology Xuzhou Jiangsu China Sarkar Devanand Editor Virginia Commonwealth University United States of America * E-mail: ylzhengjsnu.edu.cn Competing Interests: The authors have declared that no competing interests exist. Conceived and designed the experiments: SF JL YZ. Performed the experiments: SF YW DW ML WC. Analyzed the data: SF YW JL. Contributed reagents/materials/analysis tools: YZ BH ZZ QS. Wrote the paper: SF YW JL YZ. 2014 26 2 2014 9 2 e89961 13 10 2013 25 1 2014 2014 Fan et al This is an open-access distributed under the terms of the Creative Commons Attribution License which permits unrestricted use distribution and reproduction in any medium provided the original author and source are credited. The inflammasome is a multi-protein complex which when activated regulates caspase-1 activation and IL-1? secretion. Inflammasome activation is mediated by NLR proteins that respond to stimuli. Among NLRs NLRP3 senses the widest array of stimuli. NLRP3 inflammasome plays an important role in the development of many cancer types. However Whether NLRP3 inflammasome plays an important role in the process of hepatocellular carcinoma (HCC) is still unknown. Here the anticancer effect of luteoloside a naturally occurring flavonoid isolated from the medicinal plant Gentiana macrophylla against HCC cells and the underlying mechanisms were investigated. Luteoloside significantly inhibited the proliferation of HCC cells in vitro and in vivo. Live-cell imaging and transwell assays showed that the migration and invasive capacities of HCC cells which were treated with luteoloside were significantly inhibited compared with the control cells. The inhibitory effect of luteoloside on metastasis was also observed in vivo in male BALB/c-nu/nu mouse lung metastasis model. Further studies showed that luteoloside could significantly reduce the intracellular reactive oxygen species (ROS) accumulation. The decreased levels of ROS induced by luteoloside was accompanied by decrease in expression of NLRP3 inflammasome resulting in decrease in proteolytic cleavage of caspase-1. Inactivation of caspase-1 by luteoloside resulted in inhibition of IL-1?. "

Lung_Cancer

"Background A gene-based estimate of lung cancer risk in smokers has been shown to act as a smoking cessation motivator in hospital recruited subjects. The objective of this trial is to determine if this motivator is as effective in subjects recruited from an NHS primary care unit. Method/Design Subjects will be recruited by mailings using smoking entries on the GP electronic data-base (total practice population?=?32048) to identify smokers who may want to quit. Smoking cessation clinics based on medical centre premises will run for eight weeks. Clinics will be randomised to have the gene-based test for estimation of lung cancer risk or to act as controls groups. The primary endpoint will be smoking cessation at eight weeks and six months. Secondary outcomes will include ranking of the gene-based test with other smoking cessation motivators. Discussion The results will inform as to whether the gene-based test is both effective as motivator and acceptable to subjects recruited from primary care. Trial registration Registered with Clinical Trials.gov Registration number: NCT01176383. Smoking cessation Genetic test Lung cancer Background Gene testing in primary care is no longer limited by their exorbitant cost. The prices of genetic tests are dropping faster than Moore™s law for computing costs [1]. This leads the focus to shift from cost of genetic testing to the clinical value of individual gene tests. The recent development of gene-based tests that predicts the risk of lung cancer in smokers is an important example [2]. Despite the well accepted 10-15% probability of lung cancer in smokers 50% of smokers do not believe they are at significantly increased risk [3]. However over 80% of smokers would like to know their personal risk of lung cancer [4]. There is a plausible three way link between biomarkers for chronic obstructive pulmonary disease (COPD) a set of 20 single nucleotide polymorphisms (SNPs) associated with cancer risk and lung cancer [5-8] (). Research has shown a strong association between a high lung cancer susceptibility score derived from family history of cancer the 20 SNPs COPD history (Auckland formula) and the development of lung cancers whereas healthy smokers matched for age gender and lifetime smoking habits had a relatively low score (n?=?446 lung cancer subjects 484 healthy current smokers). The odds ratio for lung cancer risk varied from 0.2-3.2 depending on the genetic risk (p?<?0.001) [910]. The accuracy of the Auckland formula in estimating lung cancer risk for a score of >4 was: sensitivity 90% specificity 45% ( which also includes scores for 52 subjects who developed cancer from a six year prospective study of 1212 smokers and ex-smokers). The score for prediction of non-cancer was conducted with a follow up of just six years. It means that 45% of non-cancer subjects have a low cancer score and 55% have some degree of increased score. The 55% with increased scores have simply not been followed up long enough for lung cancers to develop yet. Notwithstanding this limitation there is now a 20 SNP gene test for prediction of lung cancer in smokers under the trade name Respiragene. Research that established the respiragene test. Distribution of the Respiragene score in a cross-sectional study of 484 control smokers (blue) and 446 with lung cancer (red) (Total?=?930) and from the prospective study of 52 lung cancer cases (green). Reference [8]. Two case-control studies showed a 5-10% increase in cessation with a single gene test of small effect [1112]. A small smoking cessation pilot study using spirometry results and explanations using the Fletcher-Peto diagram to explain risk demonstrated that patients find this is an acceptable method and the quit rate at 12 months was 27% [13]. In a randomised control trial patients were given either a full explanation of the results of spirometry testing including an estimation of lung age or just their forced expiratory volume in the first second (FEV1) without explanation (control group). The group of patients who were given the full explanation had a 7.2% higher quit rate than the control group [14]. Data from a hospital outpatient cohort in Auckland suggest a larger increase in quit rate with Respiragene test and the Auckland formula (). Subjects who were current smokers in the pre-contemplative and contemplative stage were randomised into either the test group or control group and only the test group had the Respiragene test. Counselling and follow-up was done by telephone. Using Auckland formula to incorporate the results of the Respiragene test clinical data and family history a score ranging 1-12 with associated risk level (moderate risk high risk very high risk) was calculated and explained to test subjects. Neither group were involved in any formal smoking cessation programme. Indeed of the 13 subjects that had managed to stop smoking (28% of the gene-tested group) 48% quit without any medical assistance and only 52% had nicotine replacement therapy [1516]. When compared with previous studies using telephone counselling alone [17] () there is a 20-25% improvement in smoking cessation with the Respiragene test (). The improvement in intention to quit increases from 56% before testing to 67% in smokers with an average smokers risk of lung cancer or 89% in smokers with a high risk of lung cancer [18]. Respiragene study in Auckland NZ (n?=?43) Cancer susceptibility scale (compared with normal lifetime risk) Cancer susceptibility score Estimated lifetime risk of lung cancer Initial intention to quit Proportion that stopped smoking at 2-4 weeks Proportion still not smoking at 6 months Expected result for telephone counselling () - - 15% 41% 10-20% 9-12% Telephone counselling?+?Respiragene test 1-2.3 (10-35% risk) 2.3-6.7 (35-65% risk) 6.7-8 (65%-80% risk) 27 had average risk score 15% 67% 8/27 (30%) 8 (30%) 16 had high or very high risk score 30-50% (4-10 times average risk) 89% 10/16 (63%) 6 (37.5%) Smoking cessation after Respiragene testing and estimation of lung cancer risk with telephone counselling in a small pilot study in Auckland NZ (n?=?43) compared with expected quit rate. Efficacy of the variety of smoking cessation strategies. Percent increase of success for six months over unaided attempts for each type of quitting (chart from West & Shiffman based on Cochrane review data). Totally unaided smoking cessation has a 3-6% success rate. Therefore telephone support () increases success rate by 6% = 9-12% quit rate. A large hospital trial using Respiragene for calculating lung cancer susceptibility is currently underway in the USA [19] but there are no planned UK investigations. This study fills that gap and uses the NHS framework for smoking cessation. Other studies have taken place looking at how lung functioning testing in COPD might motivate smokers to quit suggesting that it is feasible to conduct this sort of study [131420]. This protocol describes a trial to evaluate a gene-based risk test (using genetic and clinical data) as a smoking cessation motivator in smokers wishing to participate in an NHS primary care smoking cessation clinic (in the action stage of change) alongside the usual counselling and prescribing protocol. It will differ from previous studies using gene testing as a motivator however in that the NHS primary care counselling and prescribing protocol will include several other motivators (CO breath testing saliva cotinine testing and intensive counselling) whereas the Auckland trial using the same gene test had none of these. Also the method of recruitment will differ in that primary care subjects will of necessity be different from the Auckland hospital outpatient cohort [1516]. Research question Can the Respiragene test combined with an estimation of lung cancer susceptibility be used to increase the uptake adherence to and success rate in an established smoking cessation programme in subjects who want to quit in a National Health Service United Kingdom (NHS UK) setting? Hypothesis Genetic testing and estimation of lung cancer susceptibility should increase œsmoking cessation outcomes at six months to >30% (or 1.5-2 fold greater than usual care) irrespective of the risk scores assigned to subjects [11]. Method/Design This protocol has been approved by Surrey Research Ethics Committee at the Royal Surrey County Hospital Guildford Surrey UK. 1/Recruitment Focus groups A number of focus groups of different aged smokers will be held to enable them to contribute to the design of the study 2/ Recruitment Subjects will be recruited from a large general practice in Surrey (practice population=?>?30000). Smokers aged 20-70 years will be identified from the practice records and contacted by post by their GP. Patients who reply stating that they wish to stop smoking will be randomised (stratified randomisation to ensure equivalent age and gender mix) to two clinics (Figure 3) only one of which will include the gene-based test. Previous trials of genetic testing in association with smoking cessation achieved 83-100% of participants opting for the test depending on the method of recruitment [821]. There will be two mailings with SAEs for recruitment with the aim of recruiting at least 30 subjects per clinic (see Power calculations under heading œstatistics). In the first letter the patient™s GP asks the patient to give permission for the researcher to contact him/her to ask about taking part in smoking cessation research (with possible genetic risk testing) and encloses fact sheet 1 and a stamped addressed envelope (SAE) for reply. Figure 3 Consort 2010 flow diagram for GeTTS recruitment. Mailing 2. The principal investigator mails patient with Letter 2 to ask him/her if they would like to attend an 8-week smoking cessation clinic and asks if they would be willing to have a test for genetic susceptibility to development of lung cancer and encloses SAE for reply. Mailing 3. The principal investigator mails Group B subjects and Group A test-concordant subjects to confirm dates of the smoking cessation sessions and full patient information leaflet and consent form enclosed. The information sheet will be slightly different for group A and B. Non-test concordant subjects within group A will be invited to attend the practice nurse for smoking cessation. 3/Inclusion and exclusion criteria i. Inclusion criteria: Aged 20-70 years smoking more than 10 cigarettes daily. ii. Exclusion criteria: Aged under 20 years or over 70 years smoking less than 10 cigarettes daily history of major depression and other psychiatric conditions dementias and serious or terminal illness (cancers etc.). Patients on warfarin would be excluded due to interactions between warfarin and varenicline as varenicline will be used as the modern treatment of choice for smoking cessation. Patients who smoke less than 10 cigarettes/day and patients who did not wish to have a genetic test or do not wish to take part in a research study will be referred to the practice nurse for smoking cessation. 4/Smoking cessation clinics For group A subjects only subjects who have expressed an interest in having a genetic test and gene-based estimation of susceptibility to lung cancer in mailing 2 will be invited to participate (see referral for decliners above). For group B subjects all subjects willing to participate are invited to do so. Uptake into smoking cessation programme (i.e. proportion of invitees who accept invitation and attend clinic of those mailed invitation) will be recorded. All subjects who attend the first session of the research clinic will be asked by the principal investigator JN to sign a consent form and will be invited to raise any concerns about the protocol (as explained in the full information sheet). The consent form will then be countersigned by JN. Group A clinics and Group B clinics will be held on different weekdays at the same health centre premises. Test Subjects who attend Clinic A will be offered a fact sheet on the health risks of smoking (including lung cancer) and the option of the gene-based test for calculation of lung cancer susceptibility whilst subjects who attend Clinic B will be given the same fact sheet on the health risks of smoking (including lung cancer) but without any reference to the gene-based test. The principal investigator will be responsible for handing out the fact sheets and administering the gene-based test in Clinic A and for handing out and explaining the fact sheet in Clinic B. NHS Surrey™s Smoking Cessation Practitioners will lead in-house smoking cessation clinics A and B using the NHS smoking cessation guidelines [22] under the supervision of the principal investigator at the medical centre. There will be: ¢Introductory session which includes a new near patient test for salivary cotinine (nicotine metabolite) “ trade name SmokeScreen [23]. ¢At session 2 patients will be given advice on therapies for smoking cessation. We expect that most patients will opt for a course of varenicline and they will be advised to contact their GP for a prescription. ¢This is followed by seven more weekly sessions and a follow-up session at six months (Figure 4). Uptake and adherence to smoking cessation will be monitored by weekly carbon monoxide exhalation measurements (breath test). The principal investigator will be involved in clinic A administering the gene-based test and determining if subjects have COPD from practice records and history in session 1. Participants who are heavy smokers have a smokers cough and use a salbutamol inhaler can be judged to have COPD even if this is not entered in their GP records (all Group A & B subjects will have spirometry at their 6-month follow-up)."

Lung_Cancer

"This study utilized the high-performance computational capabilities of the Biowulf Linux cluster at the NIH Bethesda MD (http://biowulf.nih.gov). We are grateful to the EAGLE participants and the large number of EAGLE collaborators (listed in http://dceg.cancer.gov/eagle) The Cancer Genome Atlas project for the genotype and methylation data and the ENCODE project for the regulatory region data. This work was supported by the Intramural Research Program of NIH NCI Division of Cancer Epidemiology and Genetics and in part by the Norris Comprehensive Cancer Center core grant (P30CA014089) from NCI the Trandisciplinary Research in Cancer of the Lung (TRICL) and the Genetic Associations and Mechanisms in Oncology (GAME-ON) Network (U19CA148127). AW ZW WZ and AH were also funded by the NCI NIH (HSN261200800001E). IALO and ZB were also funded by NIH grants (1 R01 HL114094 1 P30 H101258 and R37HL062569-13) Whittier Foundation and Hastings Foundation. ZB was also funded by the Ralph Edgington Chair in Medicine. CNM was funded by ACS/Canary postdoctoral fellowship (FTED-10-207-01-SIED). Author contributions M.T.L conceived the study. I.A.L.O. supervised DNA methylome analysis. J.S. performed EAGLE TCGA and ENCODE genetic analyses. C.M. performed allele-specific binding analyses. J.D. contributed to genetic analyses and performed GO analyses. J.S. P.L. I.A.L.O. and M.T.L. performed quality control analyses. A.C.P D.C. P.A.B A.W.B N.E.C. and M.T.L. conducted the EAGLE study and provided tissue samples. AW and AH prepared the tissue samples for the analyses. BZ and ZB isolated and cultured alveolar epithelial cells. T.T. and K.D.S. performed methylation normalization. Z.W. and W.W. performed LD analyses. J.S. C.M. J.D. P.L.H. M.C. D.S.L J.H. P-H.C B.S.I.C.W.Z. L.A. M.F. B.P.B. N.C M.A.T. S.J. C. I.A.L.O. M.T.L. contributed to the data interpretation. J.S. and M.T.L. wrote the manuscript. All authors participated in the discussion and reviewed the manuscript. Supplementary Information accompanies this paper at tttp://www.nature.com/Naturecommunications. Competing financial interests: The authors declare no competing financial interests. Accession codes: Genotype data have been deposited in dbGAP under accession code phs000093.v2.p2. Methylation data have been deposited in dbGAP under accession code GSE52401. REFERENCES 1 Kaminsky ZA DNA methylation profiles in monozygotic and dizygotic twins Nat Genet 2009 41 240 245 19151718 2 Heijmans BT Kremer D Tobi EW Boomsma DI Slagboom PE Heritable rather than age-related environmental and stochastic factors dominate variation in DNA methylation of the human IGF2/H19 locus Hum Mol Genet 2007 16 547 554 17339271 3 Gibbs JR Abundant Quantitative Trait Loci Exist for DNA Methylation and Gene Expression in Human Brain Plos Genetics 2010 6 4 Zhang D Genetic control of individual differences in gene-specific methylation in human brain Am J Hum Genet 2010 86 411 419 20215007 5 Drong AW The presence of methylation quantitative trait loci indicates a direct genetic influence on the level of DNA methylation in adipose tissue PLoS One 2013 8 e55923 23431366 6 Grundberg E Global analysis of DNA methylation variation in adipose tissue from twins reveals links to disease-associated variants in distal regulatory elements Am J Hum Genet 2013 93 876 890 24183450 7 Bell JT DNA methylation patterns associate with genetic and gene expression variation in HapMap cell lines (vol 12 pg R10 2011) Genome Biology 2011 12 8 Laurent L Dynamic changes in the human methylome during differentiation Genome Research 2010 20 320 331 20133333 9 Maunakea AK Conserved role of intragenic DNA methylation in regulating alternative promoters Nature 2010 466 253 257 20613842 10 Yoder JA Walsh CP Bestor TH Cytosine methylation and the ecology of intragenomic parasites Trends Genet 1997 13 335 340 9260521 11 Rideout WM Coetzee GA Olumi AF Jones PA 5-Methylcytosine as an Endogenous Mutagen in the Human Ldl Receptor and P53 Genes Science 1990 249 1288 1290 1697983 12 Shen H Laird PW Interplay between the Cancer Genome and Epigenome Cell 2013 153 13 Irizarry RA The human colon cancer methylome shows similar hypo- and hypermethylation at conserved tissue-specific CpG island shores Nat Genet 2009 41 178 186 19151715 14 Alexandrov LB Signatures of mutational processes in human cancer Nature 2013 500 415 421 23945592 15 Montgomery SB Dermitzakis ET From expression QTLs to personalized transcriptomics Nat Rev Genet 2011 12 277 282 21386863 16 Schiller JS Lucas JW Ward BW Peregoy JA Summary health statistics for U.S. adults: National Health Interview Survey 2010 Vital Health Stat 2012 10 1 207 17 American Cancer Society Cancer Facts & Figures 2013 Atlanta: American Cancer Society 2013 18 Jones PA Functions of DNA methylation: islands start sites gene bodies and beyond Nature Reviews Genetics 2012 13 484 492 19 Landi MT Environment And Genetics in Lung cancer Etiology (EAGLE) study: an integrative population-based case-control study of lung cancer BMC Public Health 2008 8 203 18538025 20 Landi MT A genome-wide association study of lung cancer identifies a region of chromosome 5p15 associated with risk for adenocarcinoma Am J Hum Genet 2009 85 679 691 19836008 21 Jones PA Functions of DNA methylation: islands start sites gene bodies and beyond Nat Rev Genet 2012 13 484 492 22641018 22 Cancer Genome Atlas Research N Comprehensive genomic characterization defines human glioblastoma genes and core pathways Nature 2008 455 1061 1068 18772890 23 Dennis G Jr DAVID: Database for Annotation Visualization and Integrated Discovery Genome Biol 2003 4 P3 12734009 24 Maurano MT Systematic localization of common disease-associated variation in regulatory DNA Science 2012 337 1190 1195 22955828 25 Gaffney DJ Dissecting the regulatory architecture of gene expression QTLs Genome Biol 2012 13 R7 22293038 26 The ENCODE Project Consortium A user's guide to the encyclopedia of DNA elements (ENCODE) PLoS Biol 2011 9 27 Wang H Widespread plasticity in CTCF occupancy linked to DNA methylation Genome Res 2012 22 1680 1688 22955980 28 Thurman RE The accessible chromatin landscape of the human genome Nature 2012 489 75 82 22955617 29 Marconett C Zhou B Rieger M Selamat S Mickael Dubourd XF Sean K Lynch Kimberly D Siegmund Benjamin P Berman Zea Borok Ite A Laird-Offringa. Integrated transcriptomic and epigenomic analysis reveals novel pathways regulating distal lung epithelial cell differentiation Plos Genet 2013 30 Amos CI Genome-wide association scan of tag SNPs identifies a susceptibility locus for lung cancer at 15q25.1 Nat Genet 2008 40 616 622 18385676 31 Hung RJ A susceptibility locus for lung cancer maps to nicotinic acetylcholine receptor subunit genes on 15q25 Nature 2008 452 633 637 18385738 32 Theirsson TE A variant associated with nicotine dependence lung cancer and peripheral arterial disease Nature 2008 452 638 642 18385739 33 Wang Y Common 5p15.33 and 6p21.33 variants influence lung cancer risk Nat Genet 2008 40 1407 1409 18978787 34 McKay JD Lung cancer susceptibility locus at 5p15.33 Nat Genet 2008 40 1404 1406 18978790 35 Shi J Inherited variation at chromosome 12p13.33 including RAD52 influences the risk of squamous cell lung carcinoma Cancer Discov 2012 2 131 139 22585858 36 Timofeeva MN Influence of common genetic variation on lung cancer risk: meta-analysis of 14 900 cases and 29 485 controls Hum Mol Genet 2012 21 4980 4995 22899653 37 Tekpli X Functional effect of polymorphisms in 15q25 locus on CHRNA5 mRNA bulky DNA adducts and TP53 mutations Int J Cancer 2013 132 1811 1820 23011884 38 Falvella FS Multiple isoforms and differential allelic expression of CHRNA5 in lung tissue and lung adenocarcinoma Carcinogenesis 2013 39 Shukla S CTCF-promoted RNA polymerase II pausing links DNA methylation to splicing Nature 2011 479 74 79 21964334 40 Fairfax BP Genetics of gene expression in primary immune cells identifies cell type-specific master regulators and roles of HLA alleles Nat Genet 2012 44 502 510 22446964 41 Small KS Identification of an imprinted master trans regulator at the KLF14 locus related to multiple metabolic phenotypes Nat Genet 2011 43 561 564 21572415 42 Heinig M A trans-acting locus regulates an anti-viral expression network and type 1 diabetes risk Nature 2010 467 460 464 20827270 43 Wu Y Interplay between menin and K-Ras in regulating lung adenocarcinoma J Biol Chem 2012 287 40003 40011 23027861 44 Korostowski L Sedlak N Engel N The Kcnq1ot1 long non-coding RNA affects chromatin conformation and expression of Kcnq1 but does not regulate its imprinting in the developing heart PLoS Genet 2012 8 e1002956 23028363 45 Sabin LR Delas MJ Hannon GJ Dogma derailed: the many influences of RNA on the genome Mol Cell 2013 49 783 794 23473599 46 Freedman ML Principles for the post-GWAS functional characterization of cancer risk loci Nat Genet 2011 43 513 518 21614091 47 Olivier M Hollstein M Hainaut P TP53 mutations in human cancers: origins consequences and clinical use Cold Spring Harb Perspect Biol 2010 2 a001008 20182602 48 Pleasance ED A small-cell lung cancer genome with complex signatures of tobacco exposure Nature 2010 463 184 190 20016488 49 Sproul D Tissue of origin determines cancer-associated CpG island promoter hypermethylation patterns Genome Biol 2012 13 R84 23034185 50 Grundberg E Mapping cis- and trans-regulatory effects across multiple tissues in twins Nat Genet 2012 44 1084 1089 22941192 51 Flutre T Wen X Pritchard J Stephens M A statistical framework for joint eQTL analysis in multiple tissues PLoS Genet 2013 9 e1003486 23671422 52 Papamichos-Chronakis M Peterson CL Chromatin and the genome integrity network Nat Rev Genet 2013 14 62 75 23247436 53 Chernukhin IV Physical and functional interaction between two pluripotent proteins the Y-box DNA/RNA-binding factor YB-1 and the multivalent zinc finger factor CTCF J Biol Chem 2000 275 29915 29921 10906122 54 Handoko L CTCF-mediated functional chromatin interactome in pluripotent cells Nat Genet 2011 43 630 638 21685913 55 Phillips JE Corces VG CTCF: master weaver of the genome Cell 2009 137 1194 1211 19563753 56 Bell AC West AG Felsenfeld G The protein CTCF is required for the enhancer blocking activity of vertebrate insulators Cell 1999 98 387 396 10458613 57 Brenner C Myc represses transcription through recruitment of DNA methyltransferase corepressor EMBO J 2005 24 336 346 15616584 58 Triche TJ Jr Weisenberger DJ Van Den Berg D Laird PW Siegmund KD Low-level processing of Illumina Infinium DNA Methylation BeadArrays Nucleic Acids Res 2013 59 Howie BN Donnelly P Marchini J A flexible and accurate genotype imputation method for the next generation of genome-wide association studies PLoS Genet 2009 5 e1000529 19543373 60 Genomes Project C A map of human genome variation from population-scale sequencing Nature 2010 467 1061 1073 20981092 61 Devlin B Roeder K Genomic control for association studies Biometrics 1999 55 997 1004 11315092 62 Siegmund D Yakir B Zhang N Detecting simultaneous variant intervals in aligned sequences Annals of applied statistics 2011 5 24 63 Kim SH Yi SV Correlated asymmetry of sequence and functional divergence between duplicate proteins of saccharomyces cerevisiae Molecular Biology and Evolution 2006 23 1068 1075 16510556 64 Bao L Zhou M Cui Y CTCFBSDB: a CTCF-binding site database for characterization of vertebrate genomic insulators Nucleic Acids Res 2008 36 D83 D87 17981843 Figure 1 cis-meQTL structural characteristics (a) Distribution of CpG probes and corresponding cis-meQTL numbers and proportions in gene and non-gene regions. meQTLs were detected based on EAGLE lung normal tissue samples (n=210). (b) Distribution of CpG probes and corresponding cis-meQTL numbers and proportions in CpG islands (CGIs) shores (< 2kb from the boundary of CGI) shelves (2–4kb from the boundary of CGI) and the remaining region or “open sea”. The box plots show the distribution of the methylation levels in each genotype category with error bars representing the 25% and 75% quantiles. (c) The strongest cis-association is between SNP rs10090179 and CpG probe cg19504605. P=1.5×10?73 t-test. The SNP explains 79.8% of the phenotypic variance. (d e): The x-coordinate is the average standard deviation (SD) of methylation levels for CpG probes in each category. The y-coordinate is the proportion of CpG probes detected with cis-meQTLs. The proportion of methylation probes detected with cis-meQTLs varied across categories ranging from 4.0% for CGIs in 1st Exons to 15.7% for south shores in non-gene regions. Figure 2 trans-meQTL structural characteristics (a) Circos plot for trans-meQTLs. The outer rim shows the log10 P-values Manhattan plots of trans-meQTL associations. The innermost network depicts spokes between all trans-meQTL SNPs and their target CpG sites. The red spikes show a master regulatory SNP rs1293229 located at 16p11.2 associated with methylation of CpG sites located in CGIs annotated to five genes. (b) Proportion of CpG probes detected with cis-meQTLs and trans-meQTLs across gene regions. The asterisks “******” indicate t-test P<0.050.01 and 0.0001 for the comparison between CGI and non-CGI regions. CGI regions are strongly enriched with trans-meQTLs while non-CGI regions are enriched with cis-meQTLs. CpG-sites in 3’UTR regions show an opposite trend. (c) The association between a SNP denoted as G and a distal CpG-site B may be mediated through a proximal CpG-site A. (d) For each trans-association (G B) pair the dots show their marginal v.s. partial correlation coefficients upon conditioning on the proximal A CpG probes. Analysis was based on 210 samples. Reduction of correlation coefficients by conditioning on A suggests the magnitude of the mediation effect. Figure 3 Chromatin marks are increasingly enriched on meQTL SNPs with larger effect sizes (a) We split cis-meQTL SNPs into five categories according to the meQTL association strength "

Lung_Cancer

"Materials and Methods Patient selection A total of 181 advanced CRC patients with synchronous or metachronous metastases who were treated at Seoul National University Bundang Hospital (Seongnam-si South Korea) between 2003 and 2009 were enrolled in this study. Synchronous metastases were defined as distant metastases occurring within six months of the primary diagnosis of CRC and metachronous metastases were those occurring after that time point [29]. The cancer tissue used in this study was received from patients that had surgical resection of both the primary tumor and related metastases. None of the patients had received chemo- or radiotherapy before the resection of the primary tumor. Medical charts and pathology reports were reviewed to record clinical and pathological data. Glass slides were reviewed to determine the histological type according to the WHO classification [30]. Follow-up information including the patient outcome and the time interval between the date of surgical resection and death was collected. The cases lost to follow-up and deaths from causes other than CRC were considered censored data for the survival analysis. The median follow-up period was 37.9 months (range 0.8“104.6 months). Ethical statement All human specimens were obtained from the files of surgically resected cases examined at the Department of Pathology Seoul National University Bundang Hospital for the pathologic diagnosis. The retrospective study was performed using the stored samples after the pathologic diagnosis and all of the samples were anonymized before the study. The participants did not provide written informed consent in this study. The study was approved by the Institutional Review Board of Seoul National University Bundang Hospital under the condition of anonymization (reference: B-1109/136-302). Tissue array methods To evaluate the regional stromal differences samples were taken from each patient from four areas: the center and periphery of the primary cancer distant metastases and lymph node metastases. The distant metastatic sites for the tissue arrays were as follows: liver in 83 cases (45.9%) lung in 38 cases (21.0%) seedings in 38 cases (21.0%) distant lymph nodes in 6 cases (3.3%) and ovary in 16 cases (8.3%). The representative core tissue specimens (2 mm in diameter) were taken from individual paraffin blocks and rearranged in new tissue array blocks using a trephine apparatus (Superbiochips Laboratories Seoul South Korea) [31]. Immunohistochemistry Array slides were labelled by immunohistochemistry using antibodies for CD31 (1?100 DAKO Glostrup Denmark) D2-40 (1?100 DAKO) SMA (1?1000 Neomarkers Fremont CA USA) desmin (1?300 DAKO) and PTEN (1?80 Epitomics Burlingame CA USA) after a microwave antigen retrieval procedure except SMA. Non-reactive sites were blocked using 1% horse serum in Tris-buffered saline (pH 6.0) for 3 min. Primary antibodies were applied and antibody binding was detected with diaminobenzidine (DAB). Sections were counterstained with hematoxylin. The reactivity of PTEN in each tissue section was scored as negative faint or strong and the percentage of PTEN-positive fibroblasts was quantified. For the statistical analysis the sample was deemed PTEN-positive if 5% or more CAFs were scored as strong positives. Calculation of LVD MVD and CAFs using digital pathology Slides were concurrently evaluated by two pathologists (H.E.L and H.S.L) using light microscopy to improve the accuracy of the results (Fig. 1). CRC cells were considered as internal negative controls. Medium- to large-sized vessels were considered as internal positive controls for CD31 and D2-40. Intestinal muscular layer or medium- to large-sized vessels were considered as internal positive controls for desmin and SMA. Samples showing inappropriate staining in internal negative or positive controls were considered non-informative and were excluded from the analysis. Slides were scanned using an Aperio ScanScope® CS instrument (Aperio Technologies Inc. Vista CA) at 20— magnification. Subsequently they were analyzed in ImageScope„¢ using the Microvessel Analysis v1 algorithm (Aperio Technologies) and MVD and LVD were calculated. Because desmin-positive muscularis mucosa and propria are positive for SMA immunostaining the area of CAFs (mm2) was calculated by subtracting the areas of desmin staining from that of SMA staining (SMA - desmin). .0091811.g001 Representative sections from four tumor locations stained with CD31 D2-40 SMA or desmin antibodies (—100). Statistical analysis A chi-squared test or Fisher's exact test (2-sided) for non-continuous variables and Mann-Whitney or Kruskal-Wallis analysis for continuous variables were used to compare each parameter with respect to the CRC site and according to its clinicopathologic features. The correlation between continuous variables was analyzed using the Pearson correlation coefficient. To determine the best cut-offs of continuous variables for predicting patient survival the maximal chi-squared method was performed using R program (http://cran.r-project./). The overall survival curves were plotted using the Kaplan-Meier product-limit method and the significance of the differences between these curves was determined using the log-rank test. A univariate and multivariate regression analysis was performed using the Cox's proportional hazards model to determine hazard ratios (HRs). P-values of less than 0.05 were considered statistically significant. All statistical analysis excluding the maximal chi-squared test was performed with the IBM SPSS statistics 20 (Armonk NY USA). Results 1. Heterogeneity of cancer-associated stroma according to examined tumor locations The clinicopathological characteristics of the advanced CRC patients are described in . The CRC patients with synchronous metastases had aggressive features including larger tumor size more advanced pT and pN stage and the presence of perineural and venous invasion than the patients with metachronous metastasis (p<0.05). .0091811.t001 Clinicopathologic characteristics of advanced colorectal cancers. Parameters Total Metachronous Synchronous P value (n?=?181) (n?=?57) (n?=?124) Age (median range) 60.00 (28“93) 62.00 (36“79) 60.00 (28“93) 0.241 Sex 0.007 Male 97 39 (68.4%) 58 (46.8%) Female 84 18 (31.6%) 66 (53.2%) Location 0.055 Right colon 37 6 (10.5%) 31 (25.0%) Left colon 75 29 (50.9%) 46 (37.1%) Rectum 69 22 (38.6%) 47 (37.9%) Size of primary tumor 5.30 (2.0“13.0) 4.20 (2“9) 5.50 (2.5“13) <0.001 Histologic grade 0.227 Low grade 157 52 (91.2%) 105 (84.7%) High grade 24 5 (8.8%) 19 (15.3%) T stage <0.001 T1 0 0 0 T2 5 3 (5.3%) 2 (1.6%) T3 107 45 (78.9%) 62 (50.0%) T4 69 9 (15.8%) 60 (48.4%) N stage <0.001 N0 35 23 (40.4%) 12 (9.7%) N1 58 23 (40.4%) 35 (28.2%) N2 88 11 (19.3%) 77 (62.1%) Perineural invasion 0.011 Absent 89 36 (63.2%) 53 (42.7%) Present 92 21 (36.8%) 71 (57.3%) Venous invasion 0.028 Absent 126 46 (80.7%) 80 (64.5%) Present 55 11 (19.3%) 44 (35.5%) The heterogeneous values for LVD MVD and CAF area are shown in Fig 2. LVD was the highest in center of the primary cancers (median interquartile range (IQR); 37.00 10.50“81.00) than any other site (5.00 1.00“23.75 at the periphery; 2.50 1.00“15.00 in lymph node metastases; 3.00 1.00“20.00 in distant metastases). MVD was lower in distant metastases (median IQR; 641.50 428.00“1006.75) than at the periphery of the primary cancer (731.00 508.25“1049.75) and lymph node metastases (893.50 520.25“1275.25). The area occupied by CAFs was the lowest in the distant metastases (median IQR; 0.91 0.68“1.18) than any other site (1.12 0.88“1.41 in the center; 1.22 0.96“1.54 in the periphery1.4 1.00“1.71 in lymph node metastases). In addition the stromal characteristics varied in relation to the metastatic an examined. MVD and LVD were the higher in lung metastases than those in the liver peritoneum or lymph nodes (p<0.001; Fig. 3). However the amounts of CAFs were consistent among the different metastatic ans (p?=?0.180)."

Lung_Cancer

"As one of the DNA repair genes ataxia-telangiectasia mutated (ATM) gene which is responsible for the multisystem autoxomal recessive disorder ataxia-telangiectasia (A“T) plays a crucial role in the recognition signaling and repair of DNA damage especially DNA double-strand breaks (DSBs) [4] [5]. The ATM protein is a member of phosphoinositide 3-kinase (PI-3 kinases) and can be activated by DSBs caused by ionizing radiation or reactive oxygen intermediates [6] [7]. Once activated ATM can phosphorylate various downstream substates that function in cell cycle arrest apoptosis and DNA repair such as p53 NBS1 BRCA1 and Chk2 [8] [9]. Therefore genetic variants in ATM gene may lead to the structure and function change of the protein and act as important factors indicating individual susceptibility to cancer. ATM -111G>A (rs189037) resides in the promoter of ATM gene. Increasing studies have shown that variations in the DNA promoter sequence may potentially alter the affinities of multiple regulatory proteins-DNA interactions or the specificity of the transcriptional process [10]“[13]. Although this polymorphism makes no amino acid change the alleles may have different binding affinity to the transcription factor and exhibit different levels of mRNA expression [14] [15]. Zhang et al. [16]declared that ATM rs189037 AA genotype was associated with a lower ATM mRNA levels than GG genotype in lung tissue samples. Their results showed that the G-to-A change might create a transcriptional inhibitor-binding site for ATM rs189037 A allele promoter and subsequently reduce the ATM mRNA expression. Consequently lower expression of ATM might cause elevated sensitivity to ionizing radiation defects in the activation of cell cycle checkpoints a reduced capacity for DNA repair and abnormal apoptosis. All of these features would contribute to increased individual cancer susceptibility. In recent years a number of studies have evaluated the association between this polymorphism and cancer risk such as thyroid carcinoma [17] oral cancer [18] breast cancer [19] leukemia [20] nasopharyngeal carcinoma [21] glioma [22] and lung caner [23]“[25]. Previous studies of ATM rs189037 have included cigarette smokers as cases and controls that made it difficult to judge whether this polymorphism were associated with lung cancer or tobacco use. Considering the facts in China the incidence and death rate of lung cancer in women continues to increase and this phenomenon is frequently occurring in those who have never smoked. In order to have a better control of confounding of gender or smoking we performed a case-control study to identify the association between the polymorphism of ATM rs189037 and the risk of lung cancer in the non-smoking females in Chinese Han population. We also investigated the interaction between genetic polymorphism and environmental exposure in lung cancer. Methods Subjects This hospital-based case-control study included 487 lung cancer patients and 516 cancer-free hospital controls. All subjects were female non-smokers and they were from unrelated ethic Han Chinese. The cases were recruited during January 2002 to November 2012 at Liaoning Cancer Hospital & Institute. All patients were histologically confirmed to have lung cancer before any radiotherapy and chemotherapy. During the same time controls were selected from patients with other lung diseases but free of cancer history and symptom. Controls suffered mainly from bronchitis pneumonias fibrosis sarcoidosis chronic obstructive pulmonary disease and emphysema. Controls were all non-smoking females and frequency-matched to case subjects for age (±5 years). This study was approved by the institutional review board of China Medical University and written informed consent was obtained from each participant or each participant's representatives if direct consent could not be obtained. Data Collection A total of 10 ml of venous blood was collected from each patient. Patients were interviewed to collect information for demographics and environmental exposure at the time they were admitted to hospital. Information concerning demographic characteristics passive smoking cooking oil fume exposure fuel smoke exposure family history of cancer occupational exposure and dietary habit was obtained for each case and control by trained interviewers. An individual was defined as a smoker if she had consumed a total of 100 cigarettes in her lifetime; otherwise she was considered as a non-smoker. About fuel smoke exposure participants who used coal-fuel-burning stoves without chimneys were regarded as fuel smoke exposure. For exposure to cooking oil fumes participants were mainly asked about the method of cooking and eyes or throat irritation. For cooking methods participants were asked whether they cooked food in a stir-frying way and how many times a week; for eyes or throat irritation participants were asked how often they felt eyes or throat irritated by the oily smoke. There were four possible responses ranging from œnever œseldom œsometimes and œfrequently. Subjects were considered as cooking oil fume exposure if they met criteria as follows: (1) have cooked for over 15 years; (2) cooked food in a stir-frying way for more than twice a week; (3) felt eyes or throat irritated by oily smoke. Exposure for cooking oil fume was categorized as an indicator variable equal to 1 if participants reported frequently or sometimes and equal to 0 otherwise. Genotype Analysis Genomic DNA was extracted from peripheral blood samples by the conventional phenol-chloroform extraction method. SNP was genotyped by investigators blinded to case-control status in order to avoid any genotyping bias using TaqMan methodology and read with the Sequence Detection Software on an Applied Biosystems 7500 FAST Real-Time PCR System according to the manufacturer's instructions (Applied Biosystems Foster City CA). Amplification was done under the following conditions: 95°C for 10 min followed by 47 cycles of 92°C for 30 s and 60°C for 1 min. In this study 487 lung cancer patients and 516 controls were all genotyped successfully and 5% duplicated samples were randomly selected to assess the reproducibility for quality control with a concordance rate of 100%. Statistical Analysis The x2 test and t test were applied to estimate differences in demographic variables and distributions of genotypes between cases and controls. The association of genotypes of ATM rs189037 with risk of lung cancer was estimated by computing the odds ratios (ORs) and 95% confidence intervals (CIs) in unconditional logistic regression analysis. The Hardy-Weinberg equilibrium (HWE) was tested using goodness-fit x2 test to compare the genotype frequencies in the control subjects from those expected. A logistic regression model was used to evaluate gene-environment interactions. All data were analyzed with Statistical Product and Service Solutions (SPSS) v13.0 for Windows if not otherwise specified. All statistical analysis were two-sided and the significance level was set at P<0.05. Results Population characteristics A total of 487 lung cancer and 516 age-matched cancer-free controls were enrolled in this study. As shown in the mean ages of cases and controls (mean ±S.D.) were almost identical (56.5±11.7 and 56.3±12.5 respectively). All cases were female non-smoking lung cancer patients. No statistically significant difference was found between cases and controls in terms of age (P?=?0.248) and monthly income (P?=?0.084). Cases included 434 non-small cell lung cancer (NSCLC) patients and 53 small cell carcinoma patients. In the NSCLC cases there were 320 adenocarcinomas 73 squamous cell carcinomas and 41 other tumors with a variety of different pathologies (such as large cell carcinomas mixed cell carcinomas or undifferentiated carcinomas). .0096911.t001 Characteristics of lung cancer cases and controls. Variables Cases(%) Controls(%) P value Female 487 516 Mean age (years) 56.5±11.7 56.3±12.5 0.248a Income (yuan/month) 628.9±419.3 563.5±387.6 0.084a Never smoker 487 516 Histological type NSCLC 434(89.1) Adenocarcinoma 320(65.7) Squamous cell carcinoma 73(15.0) Small cell carcinoma 53(10.9) Other 41(8.4) a Student's t-test was used to compare the frequency distributions of demographic variables between the cases and controls. Association analysis The observed genotype frequencies among the control subjects was in agreement with that expected under the Hardy-Weinberg equilibrium (P?=?0.119). The distribution of ATM rs189037 genotypes among subjects were displayed in Table 2. Using subjects with the ATM rs189037 GG genotype as the reference group we calculated the ORs and 95%CIs for heterozygous carriers of GA genotype and homozygous carriers of AA genotype. No significant difference was observed between lung cancer cases and controls in each test (P>0.05). In order to increase the statistical power we combined the GA genotype with the AA genotype to compare with GG genotype as a dominant model and combined the GA genotype with the GG genotype to compare with AA genotype as a recessive model. The results indicated that individuals with AA genotype had a significantly elevated risk of lung adenocarcinoma compared with those carrying the GG or GA genotype (OR?=?1.44 95%CI 1.02“2.02 P?=?0.039). .0096911.t002 Table 2 Distribution of ATM rs189037 genotypes and ORs for lung cancer cases and controls. Genotype Cases(%) Controls(%) ORc 95%CI P overall (n?=?487) GG 148(30.4) 152(29.5) ref GA 240(49.3) 272(52.7) 0.91 0.68“1.20 0.494 AA 99(20.3) 92(17.8) 1.11 0.77“1.59 0.590 dominant modela 0.96 0.73“1.25 0.742 recessive modelb 1.18 0.86“1.61 0.313 NSCLC (n?=?434) GG 129(29.7) 152(29.5) ref GA 213(49.1) 272(52.7) 0.92 0.68“1.24 0.573 AA 92(21.2) 92(17.8) 1.18 0.81“1.71 0.397 dominant model 0.98 0.74“1.30 0.906 recessive model 1.24 0.90“1.71 0.192 Adenocarcinoma (n?=?320) GG 94(29.4) 152(29.5) ref GA 150(46.9) 272(52.7) 0.89 0.64“1.23 0.485 AA 76(23.7) 92(17.8) 1.33 0.90“1.99 0.156 dominant model 1.00 0.74“1.36 0.987 recessive model 1.44 1.02“2.02 0.039* Squamous cell carcinoma (n?=?73) GG 24(32.9) 152(29.5) ref GA 39(53.4) 272(52.7) 0.90 0.52“1.56 0.706 AA 10(13.7) 92(17.8) 0.69 0.32“1.51 0.355 dominant model 0.85 0.50“1.43 0.537 recessive model 0.74 0.37“1.50 0.400 *P<0.05. a GA+AA vs GG. b AA vs GA+GG. c adjusted for age and data were calculated by unconditional logistic regression. According to the results above we assumed that ATM rs189037 AA genotype might affect lung adenocarcinoma risk among non-smoking Chinese females. To test this hypothesis and explore the gene-environment interaction we adopted all the lung adenocarcinoma patients and cancer-free controls whose information about environmental risk factors were completely obtained such as fuel smoke exposure cooking oil fume exposure passive smoking and family history of cancer. Cases and controls were not included in the association analysis if any item of their environmental risk factors data was incomplete. After screening we had 242 lung adenocarcinoma cases and 277 cancer-free controls that were eligible. Selected demographic variables and environmental risk factors for the cases and controls were listed in Table 3. .0096911.t003 Table 3 Basic demographic data and environmental risk factor in lung adenocarcinoma cases and controls. Variable Cases(%) Controls(%) P value Female 242 277 Mean age (±S.D.) 55.7±11.6 56.6±11.0 0.346a Income(yuan/month) 626.5±384.0 558.1±391.4 0.066a Education Never 26(10.7) 26(9.4) 0.305 Elementary school 111(45.9) 141(50.9) Junior school 76(31.4) 69(24.9) Senior school and upwards 29(12.0) 41(14.8) Fuel smoke exposure 66(27.3) 76(27.4) 0.967b Cooking oil fume exposure 86(35.5) 70(25.3) 0.011b* Family history of cancer 26(10.7) 30(10.8) 0.975b Passive smoking exposure 141(58.3) 158(57.0) 0.778b *P<0.05. a Student's t-test was used to compare the frequency distribution of demographic variables between the cases and controls. b Peason's chi square was used to compare the frequency distribution of demographic variables fuel smoke exposure cooking oil fume exposure family history of cancer passive smoking between the cases and controls. As shown in Table 3 the mean ages of lung adenocarcinoma cases and controls (mean±S.D.) were similar (P>0.05). All cases were female non-smokers. There was no significant difference in the distribution of education fuel smoke exposure family history of cancer and passive smoking status between cases and controls. However the cases were more likely than the controls to report cooking oil fume exposure (P?=?0.011). Table 4 summarized the relationship between ATM rs189037 genotypes and lung adenocarcinoma risk with the stratification analysis of cooking oil fume exposure. The results indicated that in the recessive model (AA vs GA/GG) individuals carrying AA genotype had a 1.69-fold risk of lung adenocarcinoma compared with those carrying GA or AA genotype (95%CI 1.09“2.61 P?=?0.019). Considering the difference in the distribution of cooking oil fume exposure between cases and controls we conducted the stratification analysis. Our data revealed that AA homozygous carriers had an increased risk of lung adenocarcinoma among women who were never or seldom exposed to cooking oil fume (OR?=?1.89 95%CI 1.03“3.49 P?=?0.040). To well-understood the possible interaction between rs189037 polymorphism and cooking oil fumes exposure next we conducted a combined analysis. But there was no significant correlation found between this SNP and cooking oil fumes exposure. .0096911.t004 Table 4 Overall association stratification analysis and combined analysis between ATM rs189037 polymorphism and lung adenocarcinoma risk. Comparison model Genotype ORc 95%CI P value Overall GG ref GA 0.89 0.59“1.35 0.592 AA 1.57 0.93“2.62 0.089 dominant modela 1.05 0.70“1.55 0.825 recessive modelb 1.69 1.09“2.61 0.019* Stratified by cooking oil fuel exposure Yes GG ref GA 0.72 0.34“1.54 0.395 AA 1.19 0.43“3.24 0.740 dominant modela 0.81 0.39“1.68 0.573 recessive modelb 1.48 0.62“3.52 0.381 No GG ref GA 0.94 0.57“1.56 0.811 AA 1.89 1.03“3.49 0.040* dominant modela 1.16 0.72“1.87 0.542 recessive modelb 1.97 1.18“3.29 0.009* Cooking oil fumes exposure-genotype combined analysis non-exposed GG ref non-exposed GA 0.91 0.55“1.50 0.714 non-exposed AA 1.71 0.94“3.09 0.078 exposed GG 1.99 0.96“4.12 0.063 exposed GA 1.58 0.88“2.82 0.127 exposed AA 2.07 0.87“4.93 0.099 *P<0.05. a GA+AA vs GG. b AA vs GA+GG. c the overall test was adjusted for age fuel smoke exposure cooking oil fume exposure family history of cancer and passive smoking and the stratified analysis was adjusted for age fuel smoke exposure family history of cancer and passive smoking. Discussion It is well known that smoking is the most important risk factor for lung cancer but in the past 30years the incidence and death rate of lung cancer continues to increase in women who have a low rate of smoking [26]“[28]. Adenocarcinoma accounts for about 40% of all lung cancer with a higher incidence in women especially in those who have never smoked. Undoubtedly female non-smokers are the ideal subjects to examine unknown yet important environmental and genetic factors of lung adenocarcinoma. Exposure to cooking oil fume fuel smoke passive smoking and occupational exposures have been implicated as possible risk factors among Chinese women mainly based on Chinese people's traditional diet habits lifestyle and social environment [29] [30]. So we designed this study to evaluate the association between genetic variant and environmental risk factors and lung adenocarcinoma in female non-smokers. To date the association between ATM rs189037 and host susceptibility to lung adenocarcinoma in Chinese female non-smokers has not been well addressed. ATM rs189037 was a common polymorphism in the promoter of ATM gene. Studies have shown that this site possibly may regulate ATM protein activity due to regulation function of promoter as shown in most genes. And specific genotypes or haplotypes of ATM may play an important role in carcinogenesis through expression regulation or alternative splicing of the ATM gene [31]. We searched through NCBI (National Center for Biotechnology Information) dbSNP database to get the allele frequency of this polymorphism. The data indicated that the frequency of wild-type allele G was 61.1% and the frequency of variant allele A was 38.9% in Chinese Han population (http://www.ncbi.nlm.nih.gov/SNP/snp_ref.cgi?rs=rs189037). In this study our results was in accordance with the data from NCBI. In 2006 Kim et al.[25] evaluated the role of ATM rs189037 in lung cancer development In Korean population for the first time. No significant association was found between this polymorphism and lung cancer risk (P>0.05). They recruited 616 lung cancer patients in which 78.4% were male and 79.6% were cigarette smokers. As cigarette smoking might modulate the risk of lung cancer in turn it could be a confounder in the association between ATM rs189037 and lung cancer risk. Besides there was no gene-environment interactions be considered in their research. In 2010 Lo et al.[23] suggested that ATM rs189037 was associated with lung cancer risk among never smokers (AA vs GG: OR?=?1.61 95%CI 1.10“2.35) and this association might be modified by passive smoking. Although they have eliminated the cofounding effect of cigarette smoking by conducting their study in non-smokers the risk of lung cancer among different histological types still needed to be clarified. Recently Hsia et al.[24] put their attention on the association of ATM rs189037 with lung cancer susceptibility among ever smokers. No genotype frequency difference was found between lung cancer cases and controls among ever smokers (P>0.05). After summing up the omissions of their studies and combining with the current situation that Chinese non-smoking female lung adenocarcinoma incidence and fatality rate was increasingly rising up we performed this case-control study to elucidate the association between ATM rs189037 and lung adenocarcinoma risk. To the best of our knowledge this is the first study that has investigated whether ATM rs189037 was associated with lung adenocarcinoma risk in non-smoking Han-Chinese females. Our results have shown that individuals with exposure to cooking oil fume had a 1.63-fold increased risk of developing lung adenocarcinoma (P?=?0.011). Similar significant associations were observed in our previous studies of Chinese non-smoking females. Experimental studies have presented that fumes from cooking oils could be genotoxic because of the potential carcinogenic components such as polycyclic aromatic hydrocarbons (PAHs) and benzo[a]pyrene 78-diol 910-epoxide (BPDE) which involved in inducing DNA adducts and thus made a predisposition to lung adenocarcinoma [32]“[34]. Besides the method of cooking and throat or eyes irritation the interviewers also asked each woman the information on cooking oil fumes exposure such as the types of cooking oils she used the frequency she used stir frying or deep frying to prepare food ventilation conditions and the use of a fume extractor. Increasing epidemiological studies have reported cooking method and types of cooking oils on lung cancer susceptibility among Chinese females. Seow et al.[35]found that women who reported that they stir fried daily had a significantly increased risk of lung cancer (OR?=?2.0 95%CI 1.0“3.8) and risk was enhanced for those who stir fried meat daily (OR?=?2.7 95%CI 1.3“5.5). The elevated lung cancer risk might be attributed to heterocyclic amines generated during frying of meats. In addition the frequency of stir frying seemed to be related with lung cancer susceptibility. Gao et al. [36]investigated the association between the frequency of stir frying and lung cancer risk in Chinese females they observed that stir frying more than 30 dishes per week was associated with high risk of lung cancer (OR?=?2.6 95%CI 1.3“5.0). In a case-control study in northeast China Wu-Williams et al.[37] found that women who deep fried twice per month had a 2.1-fold increased risk of developing lung cancer than those who never used deep frying method. And there was a significant trend in risk with increasing number of meals cooked by deep frying. Also this kind of correlation was found in both non-smokers and lung adenocarcinoma population. For types of cooking oils Zhong et al.[38] reported that soybean oil was most commonly used in Shanghai and the use of rapeseed oil was associated with a higher risk of lung cancer (OR?=?1.84 95%CI 1.12“3.03). In this study we observed that ATM rs189037 AA genotype carriers were more susceptible to lung adenocarcinoma than GA or GG genotype carriers in a recessive model. This might not give direct support for AA genotype as a risk factor for lung adenocarcinoma. But the results reflected that G allele might be a protective factor for lung adenocarcinoma. So we compared AA genotype with GA genotype and our data showed that women who were AA genotype carriers had an elevated risk of lung adenocarcinoma (OR?=?1.74 95%CI 1.10“2.74 P?=?0.018). In other words GA genotype might be protective for developing lung adenocarcinoma. In the stratified analysis of cooking oil fumes exposure we also found that AA genotype carriers had a predisposition to lung adenocarcinoma in women who had no exposure of cooking oil fumes (OR?=?1.89 95%CI 1.03“3.49). Considering that G allele might be a protective factor for lung adenocarcinoma we then compared AA genotype with GA genotype to further validate our previous results. And it turned out that in the non-exposed group women who were AA genotype carriers had a higher risk of lung adenocarcinoma than those GA genotype carriers (OR?=?1.98 95%CI 1.15“3.40 P?=?0.014) which was in accordance with our previous data that G allele might be a protective factor for lung adenocarcinoma. But in the combined analysis of interaction of cooking oil fumes exposure and rs189037 polymorphism no significant association was found. We have described the distribution of any possible factors such as age passive smoking status fuel smoke exposure family history of cancer between cooking oil fumes exposed group and non-exposed group that might affect the association but none of these seemed to be different between exposed group and non-exposed group (Table 5). As tumor is a multifactorial disease we could infer that there might be other risk factors playing a role in the development of lung adenocarcinoma. We tended to believe that there might be other host genetic susceptibility or unknown risk factors caused the results. .0096911.t005 Table 5 Comparisons of distribution of risk factors between cooking oil fumes exposed group and non-exposed group. Variable Exposed(%) Non-exposed(%) P value Mean age (±S.D.) 56.3±11.7 56.1±11.1 0.871a Fuel smoke exposure 44(28.2%) 98(27.0%) 0.777b Passive smoking exposure 96(61.5%) 203(55.9%) 0.235b Family history of cancer 19(12.2%) 37(10.2%) 0.504b a Student's t-test was used to compare the frequency distribution of demographic variables between the exposed group and non-exposed group. b Peason's chi square was used to compare the frequency distribution of demographic variables fuel smoke exposure family history of cancer passive smoking between the exposed group and non-exposed group. There are several limitations in the current study. First hospital-based studies are likely to include some controls with non-malignant lung diseases especially those associated with chronic inflammatory processes are suspected to have predisposing factors for lung cancer. "

Lung_Cancer

"Nucleosome positioning: multiple mechanisms toward a unifying goal Molecular cell 2012 48 1 2 23062951 24. Hughes A.L. Jin Y. Rando O.J. Struhl K. A functional evolutionary approach to identify determinants of nucleosome positioning: a unifying model for establishing the genome-wide pattern Molecular cell 2012 48 5 15 22885008 25. Nelson J.D. Denisenko O. Bomsztyk K. Protocol for the fast chromatin immunoprecipitation (ChIP) method Nat. Protoc. 2006 1 179 185 17406230 26. Li H. Ruan J. Durbin R. Mapping short DNA sequencing reads and calling variants using mapping quality scores Genome Res. 2008 18 1851 1858 18714091 27. Hartsough M.T. Steeg P.S. Nm23/nucleoside diphosphate kinase in human cancers J. Bioenerg. Biomembr. 2000 32 301 308 11768314 28. Ouatas T. Salerno M. Palmieri D. Steeg P.S. Basic and translational advances in cancer metastasis: Nm23 J. Bioenerg. Biomembr. 2003 35 73 79 12848344 29. Vogelstein B. Kinzler K.W. Cancer genes and the pathways they control Nat. Med. 2004 10 789 799 15286780 30. Thompson W.A. Newberg L.A. Conlan S. McCue L.A. Lawrence C.E. The Gibbs Centroid Sampler Nucleic Acids Res. 2007 35 W232 W237 17483517 31. Postel E.H. Berberich S.J. Rooney J.W. Kaetzel D.M. Human NM23/nucleoside diphosphate kinase regulates gene expression through DNA binding to nuclease-hypersensitive transcriptional elements J. Bioenerg. Biomembr. 2000 32 277 284 11768311 32. Ozanne B.W. McGarry L. Spence H.J. Johnston I. Winnie J. Meagher L. Stapleton G. Transcriptional regulation of cell invasion: AP-1 regulation of a multigenic invasion programme Eur. J. Cancer 2000 36 1640 1648 10959050 33. Weiner A. Hughes A. Yassour M. Rando O.J. Friedman N. High-resolution nucleosome mapping reveals transcription-dependent promoter packaging Genome Res. 2010 20 90 100 19846608 34. Chorley B.N. Campbell M.R. Wang X. Karaca M. Sambandan D. Bangura F. Xue P. Pi J. Kleeberger S.R. Bell D.A. Identification of novel NRF2-regulated genes by ChIP-Seq: influence on retinoid X receptor alpha NucleicAcids Res. 2012 40 7416 7429 35. Lin B. Wang J. Hong X. Yan X. Hwang D. Cho J.H. Yi D. Utleg A.G. Fang X. Schones D.E. Integrated expression profiling and ChIP-seq analyses of the growth inhibition response program of the androgen receptor PLoS One. 2009 4 e6589 19668381 36. Kaplan N. Moore I.K. Fondufe-Mittendorf Y. Gossett A.J. Tillo D. Field Y. LeProust E.M. Hughes T.R. Lieb J.D. Widom J. The DNA-encoded nucleosome anization of a eukaryotic genome Nature 2009 458 362 366 19092803 37. Zawadzki K.A. Morozov A.V. Broach J.R. Chromatin-dependent transcription factor accessibility rather than nucleosome remodeling predominates during global transcriptional restructuring in Saccharomyces cerevisiae Mol. Biol. Cell 2009 20 3503 3513 19494041 38. Casadio F. Lu X. Pollock S.B. Leroy G. Garcia B.A. Muir T.W. Roeder R.G. Allis C.D. H3R42me2a is a histone modification with positive transcriptional effects Proc.Natl. Acad. Sci. U.S.A. 2013 110 14894 14899 23980157 39. Smolle M. Workman J.L. Transcription-associated histone modifications and cryptic transcription Biochim. Biophys. Acta 2013 1829 84 97 22982198 40. Suganuma T. Workman J.L. Chromatin and signaling Curr. Opin. Cell Biol. 2013 25 322 326 23498660 41. Dou Y. Milne T.A. Tackett A.J. Smith E.R. Fukuda A. Wysocka J. Allis C.D. Chait B.T. Hess J.L. Roeder R.G. Physical association and coordinate function of the H3 K4 methyltransferase MLL1 and the H4 K16 acetyltransferase MOF Cell 2005 121 873 885 15960975 42. Cheadle C. Vawter M.P. Freed W.J. Becker K.G. Analysis of microarray data using Z score transformation J. Mol. Diagn. 2003 5 73 81 12707371 43. Fang F. Chang R. Yang L. Heat shock factor 1 promotes invasion and metastasis of hepatocellular carcinoma in vitro and in vivo Cancer 2012 118 1782 1794 22009757 44. Goodarzi H. Elemento O. Tavazoie S. Revealing global regulatory perturbations across human cancers Mol. Cell 2009 36 900 911 20005852 45. Katiyar P. Aplin A.E. FOXD3 regulates migration properties and Rnd3 expression in melanoma cells Mol. Cancer Res. 2011 9 545 552 21478267 46. Milde-Langosch K. Janke S. Wagner I. Schroder C. Streichert T. Bamberger A.M. Janicke F. Loning T. Role of Fra-2 in breast cancer: influence on tumor cell invasion and motility Breast Cancer Res. Treat. 2008 107 337 347 17393299 47. Subramanian A. Tamayo P. Mootha V.K. Mukherjee S. Ebert B.L. Gillette M.A. Paulovich A. Pomeroy S.L. Golub T.R. Lander E.S. Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles Proc. Natl. Acad. Sci. U.S.A. 2005 102 15545 15550 16199517 BMC Cancer BMC Cancer BMC Cancer 1471-2407 BioMed Central 24575749 3996062 1471-2407-14-138 10.1186/1471-2407-14-138 Research Stage and tissue-specific prognostic impact of miR-182 in NSCLC Stenvold Helge 1 2 Helge.Stenvolduit.no Donnem Tom 1 2 Tom.Donnemuit.no Andersen Sigve 1 2 Sigve.Andersenuit.no Al-Saad Samer 3 4 Samer.Al-Saadunn.no Busund Lill-Tove 3 4 Lill-Tove.Busundunn.no Bremnes Roy M 1 2 Roy.Bremnesunn.no 1Institute of Clinical Medicine University of Tromso Tromso Norway 2Department of Oncology University Hospital of North Norway Tromso 9038 Norway 3Institute of Medical Biology University of Tromso Tromso Norway 4Department of Clinical Pathology University Hospital of North Norway Tromso Norway 2014 27 2 2014 14 138 138 25 4 2013 12 2 2014 Copyright 2014 Stenvold et al.; licensee BioMed Central Ltd. 2014 Stenvold et al.; licensee BioMed Central Ltd. This is an Open Access distributed under the terms of the Creative Commons Attribution License (http://creativecommons./licenses/by/2.0) which permits unrestricted use distribution and reproduction in any medium provided the original work is properly credited. Background MicroRNA (miR)-182 is frequently upregulated in cancers has generally been viewed as an oncogene and is possibly connected to angiogenesis. We aimed to explore what impact miR-182 has in non-small cell lung cancer (NSCLC) and more explicitly its correlation with angiogenic markers. Methods From 335 unselected stage I to IIIA NSCLC carcinomas duplicate tumor and tumor-associated stromal cores were collected in tissue microarray blocks (TMAs). In situ hybridization (ISH) was used to detect the expression of miR-182 in tumor cells and immunohistochemistry (IHC) was used to detect the expression of angiogenesis related protein markers. Results In univariate analyses high tumor cell expression of miR-182 was a positive prognostic factor for patients with squamous cell carcinoma (SCC P?=?0.042) and stage II patients (P?=?0.003). Also in the multivariate analysis high tumor cell miR-182 expression was associated with a good prognosis in the same groups (SCC: HR 0.57 CI 95% 0.33-0.99 P?=?0.048; stage II: HR 0.50 CI 95% 0.28-0.90 P?=?0.020). We found significant correlations between miR-182 and the angiogenesis related markers FGF2 HIF2? and MMP-7. Conclusion In patients with SCC and in stage II patients high tumor cell miR-182 expression is an independent positive prognostic factor. NSCLC Stage I-IIIA Survival Prognostic impact miR-182 miRNA Background Lung cancer is despite a small decline in mortality recent years still the number one killer among cancers [1]. Non-small cell lung cancer (NSCLC) accounts for 80“85% of all lung cancers. Optimization of treatment with better surgery cytotoxic agents and radiation therapy has not altered the prognosis much. We are now in an era where personalized medicine and targeted therapies may give new hope for this patient group [23]. Identification of novel molecular markers which can improve diagnosis and prognostic stratification and serve as possible therapeutic targets will be of great importance in the near future. MicroRNAs (miRNAs) are small non-coding nucleotides. They post-transcriptionally control the stability and translation of mRNAs. Today we know more than 1500 different miRNAs and each miRNA can regulate several genes [4]. Many miRNAs are located at sites of the genome known to be altered in cancers and are frequently up- or down regulated [5]. The differences in miRNA expression between cancers make it possible to develop specific miRNA profiles for different cancer types [6]. miR-182 is one of the miRNAs often seen up-regulated in cancers. Also in NSCLC several studies have reported miR-182 to be up-regulated and it is generally regarded as an oncogene [7-11]. However results are conflicting concerning its role as an oncogene or tumor suppressor. In NSCLC and other malignancies high miR-182 expression has been associated with cell migration metastatic properties of cancer cells and poor survival [11-13]. Recent studies have however found miR-182 to suppress lung cancer cell proliferation and growth of melanoma cells [14-16]. In a recent study we screened tumor tissues from 10 worst and 10 best prognosis NSCLC cases as well as 10 normal lungs for the expression of several angiogenesis-related miRNAs [17]. miR-182 was the only miRNA among 281 tested to be up-regulated in all three comparisons: worst prognosis versus normal lung best prognosis versus normal lung and worst prognosis versus best prognosis [17]. Besides miR-182 appeared to be connected to angiogenesis according to the Gene Set Enrichment Analyses (GSEA) [17]. Based on these pilot data we have explored the impact of miR-182 in our large unselected cohort of 335 NSCLC cases. In situ hybridization was performed on tissue micro array slides for high-throughput exploration of miR-182™s prognostic impact. Since it is known that miRNAs are highly tissue- and stage specific and miR-182 in particular possibly connected to angiogenesis according to the GSEA we aimed to explore 1) the prognostic impact of miR-182 also in the NSCLC subgroups and 2) its association with relevant angiogenic and hypoxia molecular markers. Methods Patients and clinical samples Between 1990 and 2004 371 patients with pathological stage I to IIIA non-small cell lung cancer were diagnosed at the University Hospital of North Norway and Nordland Central Hospital and treated with curative intent. Resected tissues from the primary tumors in these patients were used in our retrospective study. Out of 371 patients 36 were excluded from the study due to radiotherapy or chemotherapy prior to surgery (n?=?10) other malignancy within 5 years before NSCLC diagnosis (n?=?13) or inadequate paraffin-embedded fixed tissue blocks (n?=?13). Adjuvant chemotherapy was not introduced in Norway during this period (1990 “ 2004). Thus 335 patients with complete demographic and clinicopathological data were eligible for this study. Of these postoperative radiotherapy was offered to 55 patients with non-radical surgical margins or mediastinal lymph node disease (N2). This report includes follow-up data as of January 10 2011. The median follow-up time of survivors was 105 months (range 73“234). Formalin-fixed paraffin-embedded tumor specimens were obtained from the archives of the Departments of Clinical Pathology at the University Hospital of North Norway and Nordland Central Hospital. The pathological data were revised according to the 7th edition of UICC TNM classification of lung cancer [18]. If the morphological characteristics for adeno- and squamous cell carcinomas were easily recognizable it was not always necessary to do further examinations (IHC) of the tumor samples. If the tumors were not well differentiated IHC was necessary. CK7 TTF1 p63 and CK5/6 was the markers most frequently used. The National Data Inspection Board and the Regional Ethics Committee North (REC North) approved this study. Microarray construction We used a 0.6 mm-diameter stylet to sample two cores with neoplastic tissue and two cores with tumor stroma from different areas of the primary tumors from each patient. Normal lung tissue localized distant from the tumor and lung tissue sample from 20 patients without cancer diagnosis were used as controls. The TMAs were assembled using a tissue-arraying instrument (Beecher Instruments Silver Springs Md). Eight tissue microarray blocks were made to include all the tissue samples. Multiple 4-?m-sections were cut with a Micron microtome (HM355S) and stained by specific antibodies for immunohistochemical analyses or stained by in situ hybridization. The detailed methodology has been previously reported [19]. In situ hybridization (ISH) In situ hybridization was performed following the protocol developed by Exiqon Vedbaek Denmark [20]. Digoxigenin (DIG) labelled locked nucleic acid (LNA) modified probes from Exiqon for miR-182 (hsa-miR-182) positive control (U6 hsa/mmu/rno) and negative control (scramble-miR) were used in this study. Some adjustments were done to get a specific and sensitive detection of miRNA in our sections from formalin-fixed paraffin-embedded (FFPE) TMA blocks. We placed 4 ?m sections of the TMA blocks in a heater at 59?C over night to attach cores to Super Frost Plus slides. Sections were deparaffinised with xylene (3 × 5 min) and then rehydrated with ethanol solutions (99.9% - 96% - 70%) ending up in PBS pH 7.4. Proteinase-K (20 ?g/ml) (Exiqon Vedbaek Denmark) treatment was done in PK-buffer (5 mM Tris“HCl pH 7.5 1 mM EDTA 1 mM NaCl autoclaved) at 37?C for 20 min in a HYBrite automated hybridizer (Abbot laboratories IL US). After a PBS wash the sections were dehydrated through increasing gradient of ethanol solutions and air-dried. The LNA-probes were denatured by heating to 90?C for 4 min. Hybridization of the LNA-probe miR-182 (100nM) and scramble miR (50nM) control was carried out in the HYBrite automated hybridizer at 50?C for 60 min. The positive control U6 (1nM) was hybridized at 55?C for 60 min. Stringent washes was performed in pre-heated SSC buffers 1 × 5 min in 5x SSC 2 × 5 min in 1× SSC and 02× SSC. Sections were blocked against unspecific binding in blocking solution from DIG wash and Block Buffer set (Roche Mannheim Germany) for 15 min at room temperature (RT). Alkaline phosphatase (AP)-conjugated anti-DIG (Roche) 1:800 was incubated for 60 min at RT for immunologic detection. After PBS-T wash the substrate enzymatic reaction was carried out with NBT/BCIP (Roche) at 30?C in the hybridizer for 120 min. The reaction was stopped with a 2 × 5 min wash in KTBT buffer (50 mM Tris“HCl 150 mM NaCl 10 mM KCl). Sections were counter stained with nuclear fast red (WALDECK ZE-012-250) at RT for 1 min and then rinsed in tap water. Dehydration followed through increasing gradient of ethanol solutions and finally mounting with Histokitt mounting medium (Assistant-Histokitt 1025/250). Immunohistochemistry (IHC) We used data from previous publications with the following antibodies for correlation analyses: VEGF (?A “C -D R-1 R-2 R-3) PDGF (?A -B “C -D R-? R-?) FGF (?2 R-1) Notch (?1 -2) Jagged1 DLL4 Hif (?1? -2?) GLUT-1 LDH5 CAIX PHD (?1-2 -3) FIH Ang (?1-2 -4) Tie-2 and MMP (?2-7 -9). Detailed IHC procedures for the antibodies which correlated significantly with miR-182 (FGF2 Hif2? and MMP-7) have been previously published [21-23]. Scoring of ISH Representative viable tissue sections were scored semi-quantitatively by light microscopy. The dominant staining intensity in tumor cells was scored as 0?=?negative 1?=?weak 2?=?intermediate or 3?=?strong (Figure 1). The TMA cores were scored anonymously and independently by one experienced pathologist and one oncologist. In case of disagreement the slides were reexamined and consensus was reached by the observers. Figure 1 In situ hybridization (ISH) analysis of non-small-cell lung cancer. Scoring intensities based on blue cytoplasmatic staining graded from 0“3 in tumor cells. A: score 0; B: score 1; C: score 2; D; score 3. Mean score for duplicate cores from each individual was calculated in tumor epithelial cells. We then categorized the staining into high and low expression. High expression in tumor cells was defined as score >0. Statistical methods All statistical analyses were performed using the statistical package SPSS (Chicago IL) version 19.0. The chi-square test and the Fisher exact test were used to examine the association between molecular marker expression and the clinicopathological markers. Correlations between markers were assessed using Spearman™s rank correlation. Univariate analyses were done using the Kaplan-Meier method and statistical significance between survival curves was assessed by the log-rank test. Disease-specific survival (DSS) was defined as time from surgery to lung cancer death. Variables of significant value from the univariate analyses were entered into multivariate analysis using the backward stepwise Cox regression analysis. A P?<?0.05 was considered statistically significant. Ethics The National Data Inspection Board and the Regional Ethics Committee North (REC North) approved this study. Information and subsequent written consent from patients was considered but as this was a retrospective study with more than half of patients deceased the rest of the patients having to be reminded about the death rate of the disease and the possible raising of unrealistic hope for the individual The Norwegian Data Inspection Board and REC North specifically waived the need for consent. All the patient data were anonymized after collecting the clinicopathological variables for each patient and before doing the statistical analyses. Results Patient characteristics Demographic"

Lung_Cancer

"The remaining 24 (25.3%) were not differentiated beyond NSCLC NOS. The median tumor size was 2.15 cm (range: 0.8-5.0 cm). Tumor T-stage distribution was according to the AJCC 7th edition as follows: T1a: 46 (48.4%) T1b: 30 (31.6%) and T2a: 19 (20%) (). The median pretreatment SUVmax was 6.6 (range: 1.2-26.1). Among the 95 patients 90 had follow-up imaging available (median number of scans: 2) for review with a median follow-up time of 16 months (range: 1-63 months). Imaging was performed to assess changes in tumor size to identify development of additional tumors and to evaluate effects on normal tissues. Of the patients who had follow-up imaging 82 had at least one PET-CT scan. Imaging and tumor characteristics with percentage distribution per SUV max category N (%) Pretreatment PET SUV max SUV max ?<?5 SUV max ???5 p All patients 95 40 55 ns Histology Squamous 38 (40%) 8 (20%) 30 (54.5%) .046 Adenocarcinoma 33 (34.7%) 21 (52.5%) 12 (21.8%) NSCLC NOS 24 (25.3%) 11 (27.5%) 13 (23.7%) Tumor Size [median (range)] 2.15 (0.8-5.0) cm 1.95 (0.9-5.0) cm 2.4 (0.8-4.8) cm .022 T Stage 1a 46 (48.4%) 27 (67.5%) 19 (34.5%) .013 1b 30 (31.6%) 7 (17.5%) 23 (41.8%) 2a 19 (20%) 6 (15%) 13 (23.7%) Tumor demographics and SUVmax distributions showing tendency for squamous cell histology and larger size to be of increasing SUVmax. PET response Of the 82 who had at least one PET scan in follow-up at first PET-CT scan 6 achieved complete responses 56 a partial response 24 stable disease and 2 progressive disease. During interval follow-up the best response observed was: 21 complete responders 49 partial responders 19 with stable disease and none with progressive disease. Toxicity In the 95 patients treated with SBRT three acute Grade 3 toxicities were observed. The Grade 3 toxicities were comprised of radiation pneumonitis pneumonia and pleural effusion. Additionally there was one Grade 2 dyspnea and two Grade 2 chest pains. Late toxicities included one Grade 3 dyspnea and one Grade 2 dyspnea. Clinical outcomes Median overall survival (OS) and progression-free survival (PFS) were 25.3 and 40.3 months respectively. The 2-year actuarial rates of events following treatment are shown in . Two-year overall and cause-specific survivals were 64.2% and 94.5% respectively. Overall PFS at two years was 93.7%. Two-year local control was 93.7% regional control was 90.5% and distant control was 86.3%. For dichotomous variable analyses an SUV of 5 was utilized as a cutoff as stated above. In univariate Kaplan-Meier analysis OS was predicted by TNM T-stage (p?=?.007). There was no difference in survival between operable and non-operable patients (p?=?.313) or tumor histology (p?=?.292). SUVmax predicted for OS and PFS (p?=?.024 for each Figures 1A B) but did not achieve significance for local control (LC) (p?=?0.256) regional control (RC) (p?=?0.131) or distant control (DC) (p?=?0.371) (Figures 2A B C). On Cox univariate regression analysis SUVmax as a dichotomous variable predicted for both OS (p?=?.027 HR?=?0.478) and PFS (p?=?.030 HR?=?0.359). OS was also predicted by Karnofsky Performance Status (p?<?.0001) and TNM T-stage (p?=?.005). Defined as a continuous variable SUVmax continued to predict for OS (p?=?.032 HR?=?1.061) and PFS (p?=?.003 HR?=?1.098) but also achieved significance for LC (p?=?.045 HR?=?1.124) and trended toward significance for DC (p?=?.059) (). On ANOVA test tumor T-stage and histology were both significantly correlated to SUVmax (p?=?.046 and p?=?.013 respectively). Overall outcomes from treatment with 2-year event rates showing differences between SUV max categories SUV max ?<?5 SUV max ???5 2-year freedom from event (%) Total events n (%) 2-year freedom (%) 2-year freedom (%) K-M p Local failure 93.7 8 (8.4) 97 86 .256 Regional failure 90.5 10 (10.5) 94 82 .131 Distant failure 86.3 15 (15.8) 91 78 .371 Any progression 93.7 25 (26.3) 88 62 .024 Death 64.2 48 (50.5) 72 49 .024 Comparison of SUVmax categories shows a statistically significant difference in progression-free and overall survivals. Overall and progression-free survivals as differentiated by SUVmax. A: Overall survival differences between SUVmax categories p= 0.024; B: Progression-free survival differences between SUVmax categories p= 0.024. Local regional and distant control rates as differentiated by SUVmax. A: Local control differences between SUVmax categories p= 0.256; B: Regional control differences between SUVmax categories p= 0.131; C: Distant control differences between SUVmax categories p= 0.371. Univariate and multivariate Cox proportional hazards regression analysis with SUV max as a dichotomous and continuous variable Univariate Cox proportional hazards regression analysis PET SUV max (<5 vs ?5) PET SUV max (Continuous) HR (95% CI) p HR (95% CI) p Local control -- NS 1.124 (1.002 “ 1.260) .045 Distant control -- NS -- .059 Progression-free survival 0.359 (0.143 “ 0.905) .030 1.098 (1.033 “ 1.168) .003 Overall survival 0.478 (0.249 “ 0.920) .027 1.061 (1.005 “ 1.119) .032 Multivariate Cox proportional hazards regression analysis Local control -- NS -- .057 Distant control -- NS -- .092 Progression-free survival -- .105 1.111 (1.027 “ 1.201) .008 Univariate Cox hazards regression analysis of SUVmax as a dichotomous variable shows significance for progression-free and overall survivals. As a continuous variable SUVmax significantly predicts for local control progression-free and overall survivals. In multivariate Cox analysis SUVmax remains a significant predictor of progression-free survival. In multivariate analysis SUVmax did not predict for OS as a dichotomous or continuous variable and only KPS and T-stage remained significant (p?<?.0001 and p?=?.013 respectively). It did however predict for PFS as a continuous variable (p?=?.008 HR?=?1.111) though not as a dichotomous variable (). SUVmax also trended toward significance for LC and DC as a continuous variable (p?=?.057 and p?=?.092 respectively). Discussion Previous reports indicate that tumor aggressiveness defined by an increased Ki-67 is correlated with SUVmax and tumor differentiation but not with TNM stage [1617]. Lung tumors with high Ki-67 are associated with decreased survival [18] as well as shortened progression-free survival in surgical series [1920]. This would indicate that tumors with higher SUVmax values have an increased likelihood of having a more aggressive biology regardless of size which in our study manifests in decreased progression-free survival. Our study of patients with primary peripheral biopsy-proven stage I NSCLC treated with a homogenous SBRT regimen found that SUVmax predicts for progression-free survival. OS was predicted by tumor stage a finding that is expected. When analyzing SUV cutoffs for significance a range of SUV values showed significant results for different endpoints. A meta-analysis of surgical studies utilizing differing SUV cutoffs by Paesmans et al also found that SUVmax is a significant prognosticator for overall survival [3]. To date similar studies on patients treated with either conventionally fractionated radiation therapy or SBRT have been unable to come to consensus on the utility of SUVmax as a prognosticator [6-101521]. Ikushima et al™s study of definitive external beam radiation found SUVmax to be related to tumor size/stage but not outcomes and hypothesized that the result was due to partial volume effect (PVE) as outlined by Soret et al [2122]. In this study we also found SUVmax to be related to tumor size (p?=?.013) but tumor size did not predict for the same outcomes as SUVmax. The results from Ikushima et al™s study are in contrast to the results from the Sasaki group which showed an SUV cutoff of 5 to be significant for OS and PFS in patients treated with conventional RT [15]. In the two studies which investigated SUVmax as a prognostic factor for the treatment of early-stage NSCLC with SBRT and failed to achieve significance both cite sample size as a possible contributor to the lack of findings [910]. The studies that did find significance in SUVmax as a predictor of outcomes also suffer from problems such as heterogeneous treatment dosing tumor staging and location and sample size [6-8]. With a reduction in confounding variables by evaluating patients with a uniformity in stage treatment dose and fractionation and confirmation that all patients do indeed have non-small cell lung cancer this study is able to provide a more focused insight into the prognostic value of SUVmax. An additional study by Abelson et al. infers that the amount of metabolically active tumor may be equally important to outcomes as the peak metabolic activity of the tumor and warrants further investigation to elucidate the relationship between the two [23]. To better determine the external validity of the results of this study the most appropriate SUVmax cutoff needs to be generated from pooled data from multiple high-volume centers. To determine the applicability of this information to the general stage 1 SBRT lung population this data needs to include patients without pathological confirmation of disease as well as those who were treated under alternative fractionation schedules. Additionally studies that include medically operable patients will provide longer-term data than current studies which rely on inoperable patients most of whom succumb to intercurrent disease. At the time of analysis in this study the cause of death in at least 56% of the patients who had perished was attributable to intercurrent disease. Armed with the upfront knowledge that some patients have more aggressive disease than others as well as the emerging evidence that early post-treatment FDG-PET scanning may allow further differentiation of at-risk patients [6] clinical trials may emerge to offer treatment-intensification. There are several limitations to this study including size limited follow-up its retrospective nature and the inherent variability of FDG-PET scans and SUVmax measurements from machine to machine and interobserver variability. A multi-institutional prospective study which utilizes a standardized protocol for administering and reading FDG-PET scans as well as biopsy information to correlate tumor biology to scan information and outcomes is likely necessary to confirm the findings found herein. SUVmax appears to be a useful prognosticator for progression-free survival and overall survival in the therapy of early-stage NSCLC treated with SBRT. As a predictor in both dichotomous and continuous forms SUVmax seems to be correlated with the propensity of tumors to metastasize. Larger studies may reveal a more appropriate cutoff value for identifying patients with more aggressive disease which may then provide the basis for clinical trials to identify the benefit of more vigorous therapy. Competing interest The authors™ declare that they have no competing interest. Authors™ contributions ZDH DAC JAV DEH drafted the manuscript. SS SB SAB AEQ MJS RJL NAC JDL gathered data and edited the manuscript. All authors read and approved the final manuscript. Kligerman S Digumarthy S Staging of non-small cell lung cancer using integrated PET/CT AJR Am J Roentgenol 2009 193 5 1203 1211 10.2214/AJR.09.3193 19843732 Mac Manus MP Hicks RJ The role of positron emission tomography/computed tomography in radiation therapy planning for patients with lung cancer Semin Nucl Med 2012 42 5 308 319 10.1053/j.semnuclmed.2012.04.003 22840596 Paesmans M Berghmans T Dusart M Primary tumor standardized uptake value measured on fluorodeoxyglucose positron emission tomography is of prognostic value for survival in non-small cell lung cancer: update of a systematic review and meta-analysis by the European Lung Cancer Working Party for the International Association for the Study of Lung Cancer Staging Project J Thorac Oncol: Offic Publ Int Assoc Stud Lung Canc 2010 5 5 612 619 Onishi H Shirato H Nagata Y Hypofractionated stereotactic radiotherapy"

Lung_Cancer

"are associated with erythrocyte sedimentation rate Am J Hum Genet 2011 89 131 138 10.1016/j.ajhg.2011.05.019 21700265 Teeranaipong P Ohashi J Patarapotikul J Kimura R Nuchnoi P Hananantachai H Naka I Putaporntip C Jongwutiwes S Tokunaga K A functional single-nucleotide polymorphism in the CR1 promoter region contributes to protection against cerebral malaria J Infect Dis 2008 198 1880 1891 10.1086/593338 18954261 Chen GB Xu Y Xu HM Li MD Zhu J Lou XY Practical and theoretical considerations in study design for detecting gene-gene interactions using MDR and GMDR approaches PLoS One 2011 6 e16981 .0016981 21386969 Lou XY Chen GB Yan L Ma JZ Zhu J Elston RC Li MD A generalized combinatorial approach for detecting gene-by-gene and gene-by-environment interactions with application to nicotine dependence Am J Hum Genet 2007 80 1125 1137 10.1086/518312 17503330 PLoS One one 1932-6203 Public Library of Science San Francisco USA 24416392 3887046 PONE-D-13-33822 .0085329 Research Mathematics Statistics Biostatistics Statistical Methods Medicine Clinical Research Design Meta-Analyses Oncology Basic Cancer Research Metastasis Cancers and Neoplasms Lung and Intrathoracic Tumors Pulmonology Surgery Thoracic Surgery Evaluation of Video-Assisted Thoracoscopic Surgery for Pulmonary Metastases: A Meta-Analysis VATS for Pulmonary Metastases Dong Siyuan Zhang Lin * Li Wenya Du Jiang Liu Xiangli Chen Xitao Department of Thoracic Surgery First Hospital of China Medical University Shenyang Liaoning Province People's Republic of China Arnold Paul Editor University of Kansas United States of America * E-mail: zhanglincmu163.com Competing Interests: The authors have declared that no competing interests exist. Conceived and designed the experiments: SYD LZ. Performed the experiments: SYD LZ WYL JD XLL XTC. Analyzed the data: SYD LZ WYL JD XLL XTC. Contributed reagents/materials/analysis tools: SYD LZ WYL JD XLL XTC. Wrote the paper: SYD LZ. 2014 9 1 2014 9 1 e85329 16 8 2013 25 11 2013 2014 Dong et al This is an open-access distributed under the terms of the Creative Commons Attribution License which permits unrestricted use distribution and reproduction in any medium provided the original author and source are credited. Background To evaluate the evidence comparing video-assisted thoracic surgery (VATS) and open thoracotomy in the treatment of metastatic lung cancer using meta-analytical techniques. Methods A literature search was undertaken until July 2013 to identify the comparative studies evaluating disease-free survival rates and survival rates. The pooled odds ratios (OR) and the 95% confidence intervals (95% CI) were calculated with the fixed or random effect models. Results Six retrospective studies were included in our meta-analysis. These studies included a total of 546 patients: 235 patients were treated with VATS and 311 patients were treated with open thoracotomy. The VATS and the thoracotomy did not demonstrate a significant difference in the 1-3-5-year survival rates and the 1-year disease-free survival rate. There were significant statistical differences between the 3-year disease free survival rate (p?=?0.04) which favored open thoracotomy. Conclusions The VATS approach is a safe and feasible treatment in terms of the survival rate for metastatic lung cancer compared with the thoracotomy. The 3-year disease-free survival rate in the VATS group is inferior to that of open thoracotomy. The VATS approach could not completely replace open thoracotomy. The authors have no support or funding to report. Introduction Metastasectomy is considered a beneficial treatment for a patient with metastatic lung cancer whose primary tumor has been well controlled[1].After surgery 5-year survival rates of 30% to 50% could be achieved depending on the underlying primary cancer[2]“[4].In practice the surgical approaches to pulmonary metastases are variable. Video-assisted thoracoscopic surgery (VATS) is an emerging technique; many procedures that had previously required a thoracotomy have been performed with the minimally invasive VATS. VATS has been used for the treatment of pulmonary metastases. The routine use of VATS for the treatment of respectable metastatic lung cancer remains controversial. Critics of the VATS approach have argued that it might not be an equivalent oncological operation[5] [6]. A prospective study by Cerfolio[7]found that 22% of the nodules that could be detected by thoracotomy were missing by VATS.Whether the VATS approach can provide a satisfactory outcome is unknown. An evidenced-based investigation of the VATS approach is needed we undertook this meta-analysis to achieve a more objective assessment of the published studies and to provide a more accurate comparison between VATS and thoracotomy for metastatic lung cancer. Methods Search Strategy Electronic searches were of the MEDLINECochrane Controlled Trial Register (CENTRAL) Ovid MEDILINE PubMed and Embase databases were performed until July 2013.The following MeSH search headings were used: œmetastatic lung cancer œpulmonary metastases œvideo-assisted thoracic surgery œthoracotomy and œcomparative study.We searched the reference lists of relevant studies reviews editorials lettersand meeting s. We used the Science Citation Index to cross-reference for further studies that met our criteria. Study Selection The studies included in this meta-analysis were based on our predetermined criteria as follows: (1) clinical trials that include the full text of the paper published in peer-reviewed English journals or reports of presentations at major thoracic surgery meetings; (2) comparison of the efficacy of VATS to that of thoracotomy in patients with metastatic lung cancer; and (3) similarity in the patients' baseline characteristics. Data extraction and quality assessment Two independent reviewers (Siyuan and Wenya) assessed the quality and the risk of bias of the included trials as follows: (1) the studies that did not include a comparative group with surgery as a form of intervention were excluded; (2) the trials focusing on patients undergoing surgery for primary lung cancer were excluded; (3) the studies on robotic video-assisted thoracic surgery were excluded; (4) if there was an overlap between authors centers or patient cohorts evaluated in the published literature only the most recent report was included; (5) studies published more than 20 years ago were excluded because of the significant technological changes that has occurred. The s were evaluated with the Downs and Black quality assessment method[8]. Discrepancies between the two investigators were resolved by discussion and consensus with a senior investigator. The final results were reviewed by two senior investigators (Lin and Jiang).The disease-free survival was defined as the date of the initial metastasectomy until the date of a recurrence. Statistical and sensitivity analyses The meta-analysis was performed using the RevMan 5.1.0. software package. The odds ratio (OR) or the mean difference with 95% confidence intervals (95% CI) was calculated for the dichotomous outcomes and the continuous outcomes respectively. A P value<0.05 was considered a significant difference in the value between the two groups. We used the I2 statistic to investigate the heterogeneity among the studies.The heterogeneity was explored by X2 and I2; I2<25% and I2>50% reflect a small and large inconsistency respectively. P<0.05 was considered significant. If there were a statistical difference in terms of the heterogeneity (P?0.05) a random-effect model was selected to pool the data. Otherwise a fixed-effect model was used. Taking into account the presence of different sample sizes of the included studies a sensitivity analysis was performed to compare the of 1-year survival rate and the 3-year disease free survival rate between VATS and open thoracotomy. Publication bias A funnel plot was used to explore bias. Asymmetry in the funnel plot of trial size against treatment effect was used to assess the risk of bias. Results Description of the studies Six retrospective cohort studies the met our criteria were included in this meta-analysis. A total of 546 patients were included in the six studies;235 patients were allocated to the VATS group whereas 311 were allocated to the open thoracotomy group to evaluate their survival rate.The search algorithm results of the search strategies and selection criteria are shown in Fig 1. The patient characteristics and evaluation index are shown in Table 1. .0085329.g001 Figure 1 Identification of studies for inclusion. .0085329.t001 Table 1 Study Design Country NO(V/O) Gender (M/F) Mean age (years) Assessment score Nakajima2001[28] OC Japan 45/55 V59/41 O34/21 V55±15 O55±14 13 Mutsaerts2002[29] OC Netherlands 8/12 NR NR 19 Nakas2009[30] OC UK 25/27 V16/9 O 19/8 V69 O66 16 Carballo2009[31] OC USA 36/135 V18/18 O82/53 V58.5 O49 15 Gossot2009[32] OC France 31/29 V21/10 O13/16 V43 O40 18 Chao2012[33] OC Taiwan 90/53 V49/41 O35/18 NR 13 V VATS; O Open thoracotomy; NR Not reported; OC observational cohort. Assessment of Recurrence and Survival Six studies documented the 1-year survival rateand there was no significant heterogeneity among the six studies (x2?=?3.79 P?=?0.58I2?=?0%).A fixed effect model was used.The combined result is shown in Fig 2(OR?=?1.15; 95%CI 0.72“1.84; p?=?0.58). Because of the heterogeneity in sample size the sensitivity analyses were conducted using larger sample sizes. There was no difference between the two surgical methods with an OR of 1.00(95%CI 0.55“1.79) and with heterogeneity(?2?=?3.23P?=?0.07 I2?=?69%). Five studies reported the 3-year survival rate and heterogeneity was identified through the five studies (x2?=?11.32P?=?0.02I2?=?65%); and a random effect model was adopted (OR?=?1.07; 95%CI 0.50“2.27; p?=?0.86) (Fig 3). Three studies compared the 5-year survival rate (OR?=?0.96; 95%CI 0.34“2.71; p?=?0.93) with certain heterogeneity(x2?=?8.86P?=?0.01I2?=?77%) (Fig 4). .0085329.g002 Figure 2 1-year survival rate. Forest plot of the Odds Ratio(OR) of the 1-year survival rate following VATS versus open thoracotomy for metastatic lung cancer.The estimate of the OR of each individual trial corresponds to the middle of the squares and horizontal line gives the 95% CI.On each linethe numbers of events as a fraction of the total number randomized are shown for both treatment groups.For each subgroupthe sum of the statistics along with the summary OR is represented by the middle of the solid diamonds.A test of heterogeneity between the trials within a subgroup is given below the summary statistics. .0085329.g003 Figure 3 3-year survival rate. Forest plot of the Odds Ratio(OR) of the 3-year survival rate following VATS versus open thoracotomy for metastatic lung cancer.The estimate of the OR of each individual trial corresponds to the middle of the squares and horizontal line gives the 95% CI.On each linethe numbers of events as a fraction of the total number randomized are shown for both treatment groups.For each subgroupthe sum of the statistics along with the summary OR is represented by the middle of the solid diamonds.A test of heterogeneity between the trials within a subgroup is given below the summary statistics. .0085329.g004 Figure 4 5-year survival rate. Forest plot of the Odds Ratio(OR) of the 5-year survival rate following VATS versus open thoracotomy for metastatic lung cancer."

Lung_Cancer

"and vimentin was positive in p120ctn cytoplasmic-positive lung cancer cells. .0088064.t001 Correlation between E-cadherin vimentin and lymph node metastasis and p120ctn. p120ctn N membrane cytolymph/nucleolus X2 p E-cadherin negative 56 9 47 30.166 <0.01 positive 22 18 4 Vimentin negative 53 23 30 5.633 0.022 positive 25 4 21 Lymph node metastasis No 41 19 22 5.251 0.032 Yes 37 8 29 Localization of p120ctn is consistent with E-cadherin in lung cancer cells We examined the protein expression levels of p120ctn and E-cadherin in normal HBE cells and nine lung cancer cell lines by Western blot and found that they all expressed mainly isoforms 1A (120 kDa) and 3A (100 kDa) of p120ctn (A). Although the protein expression levels of p120ctn were not related to E-cadherin the localization (membrane or cytoplasm) of p120ctn was always consistent with that of E-cadherin. We then screened cells expressing high levels of p120ctn and E-cadherin in the membrane (H460 cells) or cytoplasm (SPC cells) as well as those expressing low levels of p120ctn and E-cadherin in the membrane (H4299 cells) or cytoplasm (LK2 cells) for further study (B). .0088064.g002 Expression and localization of p120ctn and E-cadherin in H460 SPC H1299 and LK2 cells. (A) Western blot analyses showed expression of p120ctn and E-cadherin in nine lung cancer cell lines and HBE. (B) By immunofluorescence analysis the expression of E-cadherin and p120ctn were observed restricted to the cell membrane at cell-cell adherens junctions in H460 and H1299 cells whereas they both were confined to the cytoplasm in SPC and LK2 cells. Different functions of p120ctn isoform 1A in EMT are dependent on E-cadherin subcellular localization Knockdown of endogenous p120ctn isoform 1A by siRNA-p120ctn-1A resulted in decreased E-cadherin expression and increased N-cadherin snail and vimentin expression in H460 cells (A). However knockdown of endogenous p120ctn-1A by siRNA-p120ctn-1A showed opposite results in SPC cells where we found increased E-cadherin expression and decreased N-cadherin snail and vimentin expression (B). In comparison with the control the ablation of p120ctn isoform 1A also enhanced the H460 cells invasiveness (17.33±1.25 vs. 36.33±1.70 P<0.01) (C) whereas reduced the SPC cells invasiveness (23.0±0.82 vs. 13.0±0.82 P<0.01) (D). These results revealed that the p120ctn isoform 1A plays a different role in EMT and cell invasiveness in different E-cadherin subcellular locations. .0088064.g003 p120ctn isoform 1A plays a different role in regulating EMT in H460 and SPC cells. (A) Ablation of p120ctn isoform 1A decreased E-cadherin expression and increased N-cadherin snail and vimentin expression in H460 cells. (B) SPC cells were treated as in (A) and the opposite results were obtained. (C) Ablation of p120ctn isoform 1A enhanced the invasiveness of H460 cells (**P<0.01). (D) Ablation of p120ctn isoform 1A decreased the invasiveness of SPC cells (**P<0.01). Inhibitory function of p120ctn isoform 3A on EMT is not affected by differences in E-cadherin subcellular localization To verify whether p120ctn isoforms 1A and 3A play different roles in regulating EMT their expression plasmids were transiently transfected into lung cancer cells with low expression of p120ctn (H1299 with membrane E-cadherin expression and LK2 with cytoplasmic E-cadherin expression). The western-blot analysis demonstrated that overexpression of the p120ctn isoform 1A led to increased E-cadherin expression and decreased N-cadherin vimentin and snail expression (A); on the contrary the decreased E-cadherin expression and increased N-cadherin vimentin and snail expression were observed in LK2 cells (B). Overexpression of the p120ctn isoform 1A also reduced the H1299 cell invasiveness (52.0±2.65 vs. 33.33±2.64 P<0.01) (C) while enhanced the LK2 cell invasiveness (18.0±0.82 vs. 39.66±2.05 P<0.01) (D).. Overexpression of p120ctn isoform 3A led to increased E-cadherin expression decreased N-cadherin vimentin and snail expression (A 4B) and reduced cell invasiveness (52.0±2.65 vs. 29.66±1.53 P<0.01; 18.0±0.82 vs. 8.33±expression 0.47 P<0.01) (C 4D) in both of these cell lines. These results further confirmed that the p120ctn isoform 1A had a different effect on EMT depending on the subcellular localization of E-cadherin. They also revealed that the p120ctn isoform 3A maintained an inhibitory role in the EMT of lung cancer cells whether E-cadherin was localized to the membrane or the cytoplasm. .0088064.g004 p120ctn isoform 3A maintains the role of inhibitiing EMT independently of E-cadherin localization. (A B) Both H1299 (E-cadherin membrane localization) and LK2 cells (E-cadherin cytoplasmic localization) transiently transfected with the p120ctn isoform 3A plasmid showed increased E-cadherin expression and decreased N-cadherin vimentin and snail expression. (C D) Transient transfection of p120ctn isoform 3A plasmids into H1299 and LK2 cells resulted in decreased cell invasiveness (**P<0.01). (E) E-cadherin remained localized on the membrane in H1299 cells and in the cytoplasm of LK2 cells after transfection of the p120ctn isoform 3A plasmid. Discussion The phenomenon of EMT in tumor cells often leads to decreased cell adhesion and increased mobility and this transition is accompanied by decreased E-cadherin expression and increased expression of N-cadherin vimentin and other mesenchymal biomarkers [3] [4] [5] [6] [7]. As an important factor for stabilizing E-cadherin p120ctn plays a role in inhibiting or promoting tumor cell proliferation and invasion that is dependent on whether E-cadherin is expressed or not [16] [17]. Furthermore p120ctn isoforms 1A and 3A have shown different effects on E-cadherin expression and tumor cell invasiveness which are based on differences in the localization of E-cadherin [18]. These results strongly suggest that p120ctn most likely regulates the EMT of tumor cells by affecting E-cadherin expression and that p120ctn isoforms 1A and 3A play different roles in EMT expressing E-cadherin in different subcellular locations. We first found that the p120ctn membrane expression was positively correlated with E-cadherin expression and negatively correlated with vimentin expression and lymph node metastasis while the cytoplasmic expression of p120ctn was negatively correlated with E-cadherin expression and positively correlated with vimentin expression and lymph node metastasis by immunohistochemistry. Although these results were consistent with previous studies [13] [14] they further suggested that p120ctn likely affects the EMT by influencing the expression of E-cadherin and vimentin and thereby the cell invasion and metastasis in non-small cell lung cancer (NSCLC). To confirm the different impacts of p120ctn isoforms 1A and 3A on EMT in cells expressing E-cadherin in different locations we selected H460 and H1299 cells with E-cadherin membrane expression and SPC and LK2 cells with E-cadherin cytoplasmic expression for further analysis. Plasmids expressing the p120ctn isoforms 1A and 3A were constructed and the full-length p120ctn siRNA was synthesized for these experiments. Since the sequence beyond amino acids 1“101 of p120ctn isoform 1A is similar to that of p120ctn isoform 3A [24] [25] we could not design an interference sequence specifically for p120ctn isoform 3A. Therefore we had to further study the impact of the two isoforms on EMT and cell invasiveness in lung cancer cells with different E-cadherin locations specifically by knocking down p120ctn isoform 1A in H460 and SPC cells with high p120ctn expression and transfecting cDNA plasmids for exogenous p120ctn isoforms 1A and 3A into H1299 and LK2 cells with low expression of p120ctn. Knockdown of p120ctn isoform 1A in H460 cells destroyed the epithelial cell adhesion complexes. E-cadherin expression was also downregulated due to the loss of its important stabilizing factor p120ctn isoform 1A which was consistent with previous studies [20] [26]. Decreased E-cadherin expression and disrupted cell-cell adhesion may induce EMT [27] [28] [43] [44] which results in increased N-cadherin vimentin and snail expression and enhanced cell invasiveness. On the other hand overexpressed p120ctn isoforms 1A and 3A was shown to bind E-cadherin located on the membrane proactively in tumor cells [29] and then inhibit the degradation of E-cadherin and stabilize its expression contributing to the formation of effective epithelial cell adhesion complexes [30] [31] [32]. As these series of processes maintained the normal cell-cell adhesion connection and inhibited EMT there was increased E-cadherin expression and decreased N-cadherin vimentin and snail expression as well as inhibited cell invasiveness in H1299 cells. Previous studies have shown that although p120ctn isoform 1A could bind E-cadherin in the cytoplasm they could not form effective adhesion complexes on the membrane between epithelial cells [33]. Furthermore the cytoplasmic E-cadherin is likely not to be the full-length E-cadherin but instead cleaved E-cadherin fragments such as E-cad/sE-cad (80 kDa) and E-cad/CTF2 (33 kDa) [34]. The E-cad/CTF2 fragment can bind to p120 in the cytoplasm and then translocate into the nucleus and bind the transcriptional repressor of Kaiso to activate the Wnt/b-catenin pathway [35] [36] finally promoting the EMT of tumor cells and enhancing cell invasion and metastasis [37]. Moreover others have shown that p120ctn-1A is related to abnormal expression of E-cadherin and poor prognosis [38]. These studies illustrated that the cytoplasmic p120ctn isoform 1A can play a role in promoting tumor cell EMT invasion and metastasis. Based on the above we observed on the one hand that the effect of p120ctn isoform 1A to promote tumor cell EMT invasion and metastasis would be lifted by its ablation resulting in increased E-cadherin expression decreased N-cadherin vimentin and snail expression and inhibited invasiveness in SPC cells. On the other hand transfection of the p120ctn isoform 1A plasmid into LK2 cells expressing cytoplasmic E-cadherin resulted in decreased E-cadherin expression increased N-cadherin vimentin and snail expression and enhanced cell invasiveness. Although the precise role of p120ctn during EMT induction is still unclarified previous studies suggested that knockdown of all isoforms of p120ctn could induce EMT indirectly [27] [28] [43] [44]. All inductions were based on decreased E-cadherin expression and intercellular adhesion in previous studies which were also confirmed by our study in H460 cells with E-cadherin membrane localization. Unlike the H460 cells knockdown of the p120ctn isoform 1A in SPC cells with E-cadherin cytoplasmic expression could not decrease E-cadherin expression and intercellular adhesion. Instead we found increased E-cadherin expression and decreased cell invasiveness indicating that the EMT could not be induced by this pathway in SPC cells. It was worth noting that the same result was observed in LK2 and H1299 cells transfected with the p120ctn isoform 3A plasmid both showing increased E-cadherin expression decreased N-cadherin vimentin and snail expression and inhibited cell invasiveness. These results suggested that p120ctn isoform 3A has the function of inhibiting EMT of lung cancer cells and this function is independent of the cellular E-cadherin localization. Past research had also confirmed a shift from p120ctn isoform 3A to p120ctn isoform 1A expression after the induction of EMT [9] [10] [11] which indirectly indicates that p120ctn isoform 3A may inhibit EMT while p120ctn isoform 1A promotes EMT. In addition we also noticed that p120ctn and E-cadherin protein expression levels were significantly increased after transfection of the p120ctn-3A plasmid into LK2 and H1299 cells but p120ctn and E-cadherin were still mainly restricted to the cell membrane at cell-cell adherens junctions in H1299 cells. By contrast E-cadherin and p120ctn were almost exclusively located in the cytoplasm in LK2 cells (E). As a cell adhesion molecule E-cadherin is known to be only located on the cell membrane with the potential to inhibit EMT while in the cytoplasm it is often cleaved into fragments and therefore functions differently from the molecules located on the cell membrane [34]. Thus the cytoplasmic E-cadherin would theoretically not play a role in inhibiting EMT. Based on the above analysis we speculated that there may be some interaction between p120ctn isoform 3A and snail which plays a role in suppressing EMT in lung cancer cells expressing cytoplasmic E-cadherin but this hypothesis requires further study. Importantly we also found that knockdown of p120ctn-1A in SPC cells with cytoplasmic E-cadherin resulted in decreased twist expression (B). Meanwhile transfection of LK2 cells which also showed cytoplasmic localization of E-cadherin with the p120ctn isoform 1A plasmid resulted in increased twist expression (B). However no changes in twist expression were observed in the rest of the experiments (A 4A). As a transcription factor and master gene regulator of EMT [39] [40] twist can downregulate E-cadherin expression [41] and upregulate N-cadherin and other mesenchymal biomarkers [42]. Increased twist expression in LK2 cells transfected with the p120ctn isoform 1A plasmid indicated that transcriptional activation took place and further suggested that the p120ctn isoform 1A may have translocated into the nucleus upon binding of E-cad/CTF2 in the cytoplasm consequently activating the Wnt signaling pathway to promote EMT. Decreased twist expression in SPC cells transfected with p120ctn-1A-siRNA indicated that transcriptional activity was downregulated and suggested that ablation of p120ctn isoform 1A resulted in the inhibtion of EMT by removing the stimulatory effect of the Wnt signaling activity by p120ctn isoform 1A. In the H460 and H1299 cells with E-cadherin localized in the membrane the unchanged twist expression confirmed that p120ctn isoforms 1A and 3A could bind to E-cadherin and maintain effective cell-cell adhesion in order to suppress EMT instead of affecting the Wnt/twist pathway. Intriguingly overexpression of p120ctn isoform 3A did not change twist expression in LK2 cells expressing cytoplasmic E-cadherin indicating that p120ctn isoform 3A did not activate transcription. Therefore we firmly believe in the above hypothesis that p120ctn isoform 3A may interact with snail in some manner to influence E-cadherin expression and suppress EMT in lung cancer cells carrying cytoplasmic E-cadherin. Previous studies have observed that p120ctn-1A restored the cytoplasmic expression of E-cadherin whereas p120ctn-3A could not [20] which seems to be contradictory with the results of this study. However the method in previous studies of knocking down p120ctn expression and then transfecting p120ctn isoforms 1A and 3A plasmids into cells is different from that in the current study in which cells were only transiently transfected with p120ctn isoforms 1A and 3A plasmids. Therefore the different research methods may have led to different effects on E-cadherin. We also noted that in previous studies decreased and almost undetectable levels of E-cadherin by ablation of p120ctn resulted in the failure of exogenous p120ctn-1A to translocate into the nucleus to activate the Wnt/b-catenin pathway and decrease E-cadherin expression due to the deletion of the binding partner E-cad/CTF2. However the LK2 and H1299 cell lines used in these experiments expressed E-cadherin in the present study. E-cadherin binds primarily to unphosphorylated p120ctn isoform 3A whereas tyrosine-phosphorylated p120ctn isoform 1A interacts exclusively with N-cadherin [23]. In the previous studies exogenous p120ctn isoform 3A was prevented from binding and stabilizing E-cadherin after its ablation while in the present study the exogenous p120ctn isoform 3A could stabilize E-cadherin expression directly on the membrane or indirectly by increasing its cytoplasmic expression via regulation of snail expression. Of course all of these findings will need to be further investigated. In conclusion we for the first time found that p120ctn isoforms 1A and 3A to have different functions in EMT of lung cancer cells with E-cadherin expressed in different subcellular locations. When E-cadherin was localized on the cell membrane p120ctn isoforms 1A and 3A both could inhibit EMT and reduce the cell invasiveness phenotype."

Lung_Cancer

"Pathway-level statistics and significance testWe introduce five methods as candidates for iPAS. Each method is a modification of existing pathway analysis techniques enabling us to test an individual tumor sample™s pathway aberrance by using the nRef. A summary is provided in . .Modification of existing pathway analysis methods for iPASNote. Significance can be obtained against the null distribution generated from normal samples. All the collected normal samples for the nRef are one by one compared with the nRef to yield statistics of the null distribution. A statistic from a single cancer case is compared with this null distribution to yield P-value.Average ZStandardizing the gene expression by mean and standard deviation from datasets is often used in microarray analysis. A vector Z = (z1 z2 ¦ zn) denotes the expression status of a pathway where zi symbolizes the standardized expression value of i-th gene where the number of genes belonging to the pathway is n. In typical settings standardization is performed using the mean and SD of a given dataset mostly the cancer-only cohort data thus y¯/n indicates how much the given sample™s overall pathway gene expression deviates from the center of the cancer samples. We made the simple modification Z™ = (z1™ z2™ ¦ zn) where zi™ is derived from mean and SD of the nRef. In this case y'¯/n gives the samples deviation from the nRef. We believe this modification is biologically valid because every cancer starts its malignancy from normal cell. Thus the clinical characteristics of a single cancer can be captured by measuring the difference of it against common characteristic of normal cells which is represented by the nRef in our study.Fisher exact testWe generated a 2 — 2 contingency table for a given pathway (S) and DEGs (D) for the test. For individualized interpretation we define D by the ranking of z-value which is standardized gene expression for the mean and SD of the nRef. For each individual sample 5% (highest 2.5% and lowest 2.5%) of the total genes are defined as D. We applied a two-tailed test to detect alteration of pathways due to enrichment or depletion of differential genes. The result of this statistic can be interpreted as how many DEGs are enriched in the given pathway where the expression difference refers to how much a patient™s gene expression deviates from the nRef.Gene set enrichment analysisWe adopted the original version of gene set enrichment analysis (GSEA) proposed by Subramanian et al. (2005). Typically inputs for GSEA are generated by testing whole cohort samples using phenotype label; t-statistic correlation coefficients and fold changes are usually used. In the personalized analysis setting we use the z-value as an input for the GSEA algorithm which is standardized gene expression by mean and SD of the nRef. The GSEA output enrichment score reflects the degree to which a gene set in the pathway is overrepresented at the extremes (low or high) of the entire ranked list of z-values from a single patient.Non-parametric quadratic testGene expression in a pathway of a tumor sample is represented by vector Z = (z1 z2 ¦ zn) where zi is standardized expression level of i-th gene by mean and SD of the nRef where n is the number of genes belonged to the pathway. A pathway characteristic of an individual patient™s pathway can be represented by the averaged Euclidean distance (ZTZ/n). This gives the distance of a single patient from the center of the nRef due to the square of standardized expression difference and thus does not reflect increased or decreased expression only the extent of the expression difference. Genes in the pathway are usually functionally correlated; therefore use of the correlation structure of the normal samples may increase sensitivity enough to capture the aberrance of a single cancer case. We also consider the averaged Mahalanobis (ZTSZ/n) distance which uses the covariance matrix calculated from the nRef. This value describes the statistical distance from the center of normal samples taking into account correlation among normal samples. The covariance matrix S is calculated for each pathway from the nRef.3 RESULTS3.1 Pathway-based identification and validation of cancer survivalTo assess whether our method can sensitively detect pathway aberrances that are associated with a patient™s clinical outcome a known survival pathway that showed strong association with patient survival from Beer™s data was tested. Bryant et al. (2010) reported that the ˜cell cycle stimulatory™ pathway of 51 genes is significantly associated with patient survival (Cox proportional hazards model P = 0.000113). In that study pathway gene expression was represented as an average of z-values where the z-value indicates the standardized expression level by the mean and SD of all cancer samples. The high-risk group was defined as those in which pathway expressions were >0 and the pathway showed poor prognostic outcome. The association was significant with or without adjusted clinical covariates and thus the pathway alone is a strong indicator of cancer prognosis. This finding was also validated in the Japanese LUAD cohort (n = 87 survival data are not provided to public) in Bryant™s study. As studies have shown a clear association between the cell cycle pathway and cancer in terms of driving cancer proliferation we considered this pathway as a pathway that should be detected. All of the methods proposed as candidates for iPAS showed significant associations of the ˜cell cycle stimulatory™ pathway from Beer™s data (). The same pathway analyzed using GSE8894 (n = 61) data yielded significant associations in all proposed methods with the marginal exception of Mahalanobis (P = 0.0549). .Survival analysis of ˜cell cycle stimulatory™ pathway reported by Bryant et al. (2010)DatasetPathway statisticsCoefficientP-valueBeer (N = 432)"

Lung_Cancer

"This result may have been caused by direct exposure of the lung tissue to the increased temperature through inhalation of the hot air. .0090818.g004 FTSJ2 mRNA expression after in vivo and in vitro heat shock treatments. Porcine Ftsj2 (A) and Hsp70.2 (B) mRNA expressions in piglets which were raised at 25°C 30°C or 35°C for 1 week. Human FTSJ2 (C) and HSP70.2 (D) mRNA expressions in A549 lung cells after 1 hour of heat shock at 42°C or 45°C followed by 0 3 or 6 hours of recovery at 37°C. Porcine Hsp70.2 or human HSP70.2 mRNA expression was used as the heat shock response control. The values are equal to?=?the means±SE; n?=?4. The bars with different letters represent a significant difference (P<0.05). The Level of Human FTSJ2 mRNA Expression Increases after Heat Shock in A549 Cells Our results showed that Ftsj2 mRNA was overexpressed in the porcine lung after heat shock; therefore a human lung adenocarcinoma epithelial cell line (A549) was used to further confirm the heat shock response in vitro to eliminate the systematic effects observed in the piglets. A549 cells were first grown at 37°C and 5% CO2. For the heat shock treatment the cells were grown at 42°C or 45°C 5% CO2 for 1 hour and then returned to 37°C for 03 or 6 hours respectively. Human FTSJ2 mRNA was detected by real-time RT-PCR. The results revealed that after both the 42°C and 45°C heat shock treatments the hFTSJ2 mRNA expression increased by more than 50% (50.6% and 52.6% at 3 hours and 0 hours respectively) (P<0.05) (C) compared with the non-heat shock control. The up-regulation of the HSP70.2 mRNA indicated a positive heat shock response after the 42°C and 45°C treatments in the A549 cells (D). FTSJ2 Inhibits Cancer Cell Migration and Invasion In a recent study in clinical samples of NSCLC the human FTSJ2 gene was located in a novel oncogenic locus of NSCLC. These results indicate that FTSJ2 may also be involved in the growth of cancer cells. To evaluate the roles of FTSJ2 in cancer the gene expressions in the NSCLC cell lines were detected. A human lung adenocarcinoma cell line (CL1) which was isolated from an adenocarcinoma from the lung of a 64-year-old man has been cloned and passed on for more than 60 generations. Using the Transwell invasion chamber the CL1 cell line was separated into six sublines according to their metastatic ability (CL1-0 to CL1-5 from lowest to highest invasiveness) [41]. The hFTSJ2 mRNA expression was detected in two of these sublines (CL1-0 and CL1-5). Surprisingly the more invasive CL1-5 cells showed a 50% decrease in the hFTSJ2 mRNA expression than the less invasive CL1-0 cells (Figures 5B and 5C). .0090818.g005 Comparison of the hFTSJ2 mRNA expression levels in two lung cancer sublines (CL1-0 and CL1-5). (A) Morphology of CL1-0 and CL1-5 cells. (B) Determination of the hFTSJ2 mRNA expression levels in the CL1-0 and CL1-5 cells in triplicate. (C) Relative quantification of the hFTSJ2 mRNA expression. GAPDH mRNA was used as an internal control. The values are equal to?=?the means±SE; n?=?3; **P<0.01 vs. the non-heat shock group. In addition to the down-regulation FTSJ2 increased cell invasion in the CL1-5 cells. To further evaluate the abilities of FTSJ2 to influence cell migration and metastasis the hFTSJ2-overexpressed cell line (TE671-hFTSJ2) previously mentioned was used in the cell migration and invasion assay and was compared with the non-transfected TE671 cells. The results of our wound healing assay showed that at 12 hours after wounding the migration area of the TE671-hFTSJ2 cells was significantly decreased (P<0.01) compared with the non-transfected TE671 cells (Figures 6A and 6B). The same results were also observed in our invasion assay in which the quantity of invaded TE671-hFTSJ2 cells per Trans-well was significantly lower than that of the non-transfected TE671 cells (Figures 6C and 6D). These results indicate that FTSJ2 is involved in the inhibition of cancer cell migration and invasion. .0090818.g006 Inhibition of cell migration and invasion upon the over-expression of hFTSJ2 in TE671 cancer cells. (A) The wound healing assay showing that the TE671-hFTSJ2 cells had a reduced migration compared with the untransfected TE671 cells at 12 hours after wounding. (B) Cell migration area at 12 hours after wounding ([healing area/wounding area]—100%). (C) Invasion assay showing that the TE671-hFTSJ2 cells had a reduced invasion compared with the untransfected TE671 cells. The cells that penetrated the Trans-well membrane are shown in purple. (D) Quantity of the cells that invaded the Trans-well membrane ([Giemsa positive area/total area]—100%). The values are equal to?=?the means±SE; n?=?3; *P<0.05 vs. untransfected TE671 cells. Discussion In this study we characterized the mammalian FTSJ2 protein which we presumed to be an ortholog of E. coli RrmJ. RrmJ is known as a 2?-O-ribose MTase which methylates U2552 in the A-loop of the peptidyl transferase center in the 23S rRNA [5]. Um2552 is one of the four 2?-O-methylated nucleotides in rRNA [6]. In a previous study a lack of U2552 methylation has been found to influence the tertiary interactions of U2552 U2555 and C2556; to reduce the conformational dynamics of the A-loop [8]; and to subsequently decrease the ribosome stability and translation efficiency [7] [9] [37]. "

Lung_Cancer

"This is obtained by specifying C as an (L ? ?0 + 1)-dimensional vector of 1's with v? = 1. More sophisticated models with splines or other functions such as those illustrated in publications cited in only require the application of different bases for deriving C but are nevertheless represented by 3). 2.2. Extension to nonlinear exposure“response relationships The extension to the nonlinear case presents further complexities as anticipated earlier. The model in (1) can be extended by defining an additional exposure“response function f(x) to express the potentially nonlinear exposure“response curve along the dimension of the predictor. An intuitive generalization of (1) is: (4) with f(x) as the standard exposure“response function. However the function f(x) · w(?) in 4) previously proposed 1119 is not easily represented as a linear combination of basis variables and generates models that are not linear in their parameters and thus require ad hoc optimization routines. More importantly this representation is based on the strong assumption of independency between f(x) and w(?) namely that the exposure“response shape is the same at each lag ? and vice versa that the lag structure is the same at each value of x. This assumption can be relaxed by expressing s(xt) as a truly bivariate function with the more flexible representation: (5) Here the bidimensional function f · w(x?) is defined as the exposure“lag“response function and models simultaneously the exposure“response curve along x and lag“response curve along ? namely an exposure“lag“response surface. Differently from 4) the exposure“lag“response function in 5) can be expressed as a linear combination of basis variables and related parameters through a special tensor product. As anticipated earlier Armstrong 23 proposed the same approach for time series data within the DLNM framework generalizing this tensor product parameterization through the concept of cross-basis. Specifically two sets of basis functions are independently chosen to represent f(x) and w(?) respectively. The cross-basis is the bidimensional space of functions obtained by the combination of the two sets integrated over the lag dimension and represents the core of DLNMs. The algebraic representation has been previously presented 24 and a revised version is proposed here. Briefly the simpler lag-basis for DLMs in 3) can be extended by choosing an additional basis with dimension vx for representing f(x). The application of the related basis functions to the vector of exposure history qxt obtained by 2) generates a (L ? ?0 + 1) — vx matrix Rxt. Let Axt be: (6) with 1v as a v-dimensional vector of 1's and C defined in 3). The cross-basis function s(xt;?) can be defined as (7) In this case the dimension of the cross-basis is determined by the product of the dimensions of the bases for the two spaces and the association is expressed through vx · v? values W and related parameters ?. The cross-basis function s(xt) represents the integral of f · w(x?) over the interval [?0L] cumulating the contributions of events representing the exposure history. In spite of the relatively complex algebraic form the definition of cross-basis and the specification of DLNMs only amount to the choice of the bases for the functions f(x) and w(?). These can be independently selected between several options such as splines linear threshold or piecewise constant (step) functions. The DLNM modeling class comprises the simpler DLMs from Section 2.1. For example the bidimensional exposure“lag“response function f · w(x?) in 5) reduces to a non-linear function for un-weighted cumulative exposure f(x) · c when w(?) is a constant function c and to the lag“response function x · w(?) in (1) when f(x) is simply an linear function of the untransformed x. The model proposed by Berhane and colleagues 20 can be written in the form of 6)“7) when both f(x) and w(?) are cubic B-splines. 2.3. Estimation and prediction Although the lag-basis and cross-basis functions in (1)“(3) and (5)“(7) involve a nonstandard parameterization in terms of exposure histories DLMs and DLNMs do not require specialized estimation procedures. The association is entirely expressed by the vx — v? parameters ? of the cross-basis values W. The computation of the exposure history in (2) can be extended to all N observations with x measured at time t producing an N — (L ? ?0 + 1) matrix of exposure histories Q. The matrix of transformed variables W in (3) and (7) is consequently derived. This matrix can be included in the design matrix of standard regression models to estimate the parameters ?. In the completely parametric development proposed here the number of coefficients vx — v? represents the degrees of freedom (df) used to model the association. Inference on the parameters ? and interpretation of the estimated association is aided by the prediction of specific risk measures. For simpler DLMs that assume a linear exposure“response relationship this step reduces to the computation of a series of estimated risk contributions at lag ?p with ?0 ? ?p ? L and the associated (co)variance matrix . The series of risk contributions is provided by (8) with Cp obtained from the vector of lag ?p used for prediction by applying the same basis functions for w(?) used for estimation. These estimated risk contributions compose the lag“response curve and can be interpreted using either a forward or backward perspective. Namely represents the risk contribution at time t + ?p in the future from a unit increase in exposure x at time t or the contribution from a unit increase in exposure x occurring at time t ? ?p in the past to a given risk measured at time t. The estimated risk contributions associated with different exposure increases are easily derived. The equations in (8) only apply to DLMs with lag-bases as defined in (3). For DLNMs the association is allowed to vary nonlinearly in the space of x. Moreover the specification in (5)“(7) allows the lag-response curve to change depending on the level of the exposure. The prediction of risk contributions corresponding to a specific exposure intensity xp at lag ?p involves a more complex procedure. First let be the (L ? ?0 + 1)-dimensional vector of exposure history with constant exposure xp. The related matrices and are derived from (6) substituting qxt and C with and Cp by applying the same two sets of basis functions for f · w(x?) chosen for estimation. The exposure-specific risk contributions and associated (co)variance matrix are provided by (9) The estimated risk contributions may be interpreted as a lag-response curve similar to in (8) but this time associated with a specific exposure level xp instead of a unit increase. These measures may be used to define a grid of predicted risk contributions defined within the ranges of the exposure x and the lag ? thus obtaining a bi-dimensional representation of the association. From this grid besides above it is also possible to derive the vector of lag-specific risk contributions expressing the exposure-response curve for lag ?p. As noted in Section 2.2 the truly bivariate definition of (7) allows both the lag-response curve and exposure-response curve defined by and respectively to change depending on the specific exposure and lag values xp and ?p. The grid is interpreted as a risk surface along x and ? representing the exposure“lag“response. In addition predictions in (8)“(9) may be extended to a generic exposure history qh. Substituting it into in (9) provides the vector of lag-specific risk contributions for each exposure that occurred within the lag period. The overall cumulative effect of such exposure history with associated (co)variance matrix may be computed with: (10) The Equation (10) can be used to estimate the predicted cumulative risk for a given pattern of exposure qh. This method can also be applied to investigate how the risk progressively evolves along an exposure profile computing the cumulative risk at each time associated with the time-varying exposure history qh. 2.4. "

Lung_Cancer

"Pten occurred in the majority of murine SCLC studied and engineered Pten deletion accelerated murine SCLC and abrogated loss of Chr19 in Trp53; Rb1; Pten compound mutant tumors. Finally we found evidence for polyclonal and sequential metastatic spread of murine SCLC by comparative sequencing of families of related primary tumors and metastases. We propose a temporal model of SCLC tumorigenesis with implications for human SCLC therapeutics and the nature of cancer-genome evolution in GEMMs. J Natl Cancer Inst J. Natl. Cancer Inst jnci jnci.j JNCI Journal of the National Cancer Institute 0027-8874 1460-2105 Oxford University Press US 24317180 3906987 10.1093/jnci/djt338 Brief Communication Novel Germline Mutation in the Transmembrane Domain of HER2 in Familial Lung Adenocarcinomas Yamamoto Hiromasa Higasa Koichiro Sakaguchi Masakiyo Shien Kazuhiko Soh Junichi Ichimura Koichi Furukawa Masashi Hashida Shinsuke Tsukuda Kazunori Takigawa Nagio Matsuo Keitaro Kiura Katsuyuki Miyoshi Shinichiro Matsuda Fumihiko Toyooka Shinichi Affiliations of authors:Department of Thoracic Breast and Endocrinological Surgery (HY KS JS MF SH KT SM ST) Department of Clinical Genomic Medicine (KS ST) Department of Cell Biology (MS) Department of Pathology (KI) and Department of Hematology Oncology and Respiratory Medicine (KK) Okayama University Graduate School of Medicine Dentistry and Pharmaceutical Sciences Okayama Japan; Center for Genomic Medicine Kyoto University School of Medicine Kyoto Japan (KH FM); Department of General Internal Medicine 4 Kawasaki Medical School Okayama Japan (NT); Department of Preventive Medicine Kyushu University Faculty of Medical Sciences Fukuoka Japan (KM). Correspondence to: Shinichi Toyooka MD PhD Okayama University Graduate School of Medicine Dentistry and Pharmaceutical Sciences Clinical Genomic Medicine/Thoracic Breast and Endocrinological Surgery 2-5-1 Shikata-cho Kita-ku Okayama Okayama 700“8558 Japan (e-mail: toyookamd.okayama-u.ac.jp). 1 2014 7 12 2013 7 12 2013 106 1 djt338 7 7 2013 14 10 2013 16 10 2013 The Author 2013. Published by Oxford University Press. 2013 This is an Open Access distributed under the terms of the Creative Commons Attribution-NonCommercial-NoDerivs licence (http://creativecommons./licenses/by-nc-nd/3.0/) which permits non-commercial reproduction and distribution of the work in any medium provided the original work is not altered or transformed in any way and that the work is properly cited. For commercial re-use please contact journals.permissionsoup.com We encountered a family of Japanese descent in which multiple members developed lung cancer. Using whole-exome sequencing we identified a novel germline mutation in the transmembrane domain of the human epidermal growth factor receptor 2 (HER2) gene (G660D). A novel somatic mutation (V659E) was also detected in the transmembrane domain of HER2 in one of 253 sporadic lung adenocarcinomas. Because the transmembrane domain of HER2 is considered to be responsible for the dimerization and subsequent activation of the HER family and downstream signaling pathways we performed functional analyses of these HER2 mutants. Mutant HER2 G660D and V659E proteins were more stable than wild-type protein. Both the G660D and V659E mutants activated Akt. In addition they activated p38 which is thought to promote cell proliferation in lung adenocarcinoma. Our findings strongly suggest that mutations in the transmembrane domain of HER2 may be oncogenic causing hereditary and sporadic lung adenocarcinomas. Familial lung cancers are rare among human malignancies. Recent studies have reported that germline mutations in the epidermal growth factor receptor (EGFR) gene predispose the development of lung cancer. Reported familial lung adenocarcinomas with a germline EGFR mutation such as T790M carry secondary somatic EGFR mutations including exon 19 deletion and exon 21 L858R mutation (1“4). We encountered a family of Japanese descent in which multiple members developed lung cancer (). The proband (III-4) was a 53-year-old woman with multiple lung adenocarcinomas in bilateral lungs. She was a light smoker with a 1.2-pack-year history of smoking. She had undergone a left lower lobectomy for multiple lung adenocarcinomas at the age of 44 years. Her mother (II-4) a never smoker also had multiple lung adenocarcinomas. Partial pulmonary resections of two tumors were performed for II-4 for the purpose of diagnosis after pleural dissemination was found during surgery and multiple lesions were removed in a lobectomy or partial resections in III-4. A histological examination of the resected tumors in II-4 revealed nonmucinous adenocarcinoma in situ and nonmucinous minimally invasive adenocarcinoma whereas the histological findings of pleural dissemination indicated mucus-containing adenocarcinoma. Those of III-4 contained various subtypes of adenocarcinoma including nonmucinous and mucinous adenocarcinoma in situ and invasive mucinous adenocarcinoma. In addition normal-appearing lung parenchyma obtained from a lobectomy in III-4 revealed innumerable small preinvasive lesions implying the presence of precancerous changes throughout the lung (Supplementary available online). Sequencing analyses of EGFR exons 18 to 21 and KRAS as well as an immunohistochemical staining for ALK protein in the resected tumors indicated no genetic alterations in these genes. The pedigree chart suggested that lung cancer was inherited in an autosomal dominant manner. . Pedigree chart of a Japanese family in which multiple members developed lung cancer. The boxes and circles indicate men and women respectively. The numbers at the bottom of each member indicate the age at the time of death or the time of the analysis. An oblique line shows deceased family members. The proband (III-4) had multiple lung adenocarcinomas (arrow). Tumor tissue nonmalignant lung tissue and peripheral blood samples were obtained from III-4. The proband™s mother (II-4) also had multiple lung adenocarcinomas and tumor and nonmalignant lung tissue samples were available. The proband™s father (II-5) and sister (III-5) were both unaffected and peripheral blood samples were obtained from these individuals. Some family members who were not considered as critical for this study were excluded from the pedigree chart to preserve confidentiality. Whole-exome sequencing was performed for individuals II-4 II-5 III-4 and III-5. After obtaining permission from the Institutional Review Board at Okayama University Hospital and informed consent from the patients and other family members we performed a whole-exome sequencing study. Tumor DNA samples from II-4 tumor and peripheral blood DNA samples from III-4 and peripheral blood DNA samples from two unaffected family members (II-5 and III-5) were used for the analysis. The candidate germline alterations were restricted to 29 variants by comparing the whole-exome sequencing results between the patients and the unaffected family members. Among them we focused on a point mutation in the human epidermal growth factor receptor 2 (HER2/neu) gene (NM_004448 G660D GGC to GAC) which was located in exon 17 encoding the transmembrane domain of HER2 (Supplementary Tables 1“3). This alteration was confirmed by direct sequencing (A). We also confirmed that there was no copy number gain of HER2 in the examined tumors based on the degree of read-depth in the whole-exome sequencing results. Of note no mutations in genes known to cause lung cancers were detected for tumors from III-4 and II-4. . DNA and amino acid sequences in the transmembrane domain of HER2. A) Direct Sanger sequencing of the proband (III-4) her affected mother (II-4) and her unaffected sister (III-5). The results indicated that G660D was a germline mutation. B) Direct sequencing of a sporadic lung adenocarcinoma with a HER2 V659E mutation. V659E was found to be of somatic origin based on the sequencing results of the peritumoral lung tissue from the same specimen. All the sequence variants were confirmed by independent polymerase chain reaction amplifications and were sequenced in both directions. C) Interspecies conservation of the transmembrane domain of HER2 (UCSC Genome Browser http://genome.ucsc.edu accessed September 12 2013). The yellow highlight indicates the N-terminal glycine zipper motif Thr652-X3-Ser656-X3-Gly660 a tandem variant of a GG4-like motif of human HER2. Codons 659 and 660 in human HER2 are highly conserved among the listed vertebrate species (shown in red). X. tropicalis = Xenopus tropicalis. We considered that somatic mutations in the HER2 transmembrane domain might act as driver mutations in lung cancer. Hence we sequenced exon 17 of the HER2 in the tumor samples of 315 sporadic non“small cell lung cancer patients of which 253 were adenocarcinomas. Although the HER2 G660D mutation was not detected a novel nonsynonymous mutation V659E (GTT to GAA) next to codon 660 was identified in one of these patients. This patient was histologically diagnosed as nonmucinous adenocarcinoma in situ and the patient had neither smoking history nor apparent family history of lung cancer. This V659E mutation was certainly a somatic mutation because it was not identified in the peritumoral lung tissue of the same patient (B). The alignment of HER2 amino acid sequences showed high conservation of valine 659 and glycine 660 among vertebrates (C). HER2 somatic mutations have been reported in 2% to 4% of lung adenocarcinomas (5“7). However all reported mutations were restricted to its tyrosine kinase domain (67). According to the cBioPortal for Cancer Genomics (http://www.cbioportal./public-portal/ accessed September 12 2013) the same genetic mutation in the HER2 has not been reported in any type of cancer. Interestingly a previous study reported that a mutation in the transmembrane domain (V664E) of the rat neu gene which corresponds to V659E in its human homolog HER2 induced oncogenic transformation (8). In addition in vivo experiments showed that the HER2 V659E mutation contributed to the stability of HER2 dimers resulting in the dysregulated receptor activation and subsequent cell transformation (910). Furthermore the novel mutations were located within the glycine zipper motif Thr652-X3-Ser656-X3-Gly660 a tandem variant of the GG4-like motif at the N-terminal portion of the transmembrane domain which was critically related to the dimerization of HER2 (C) (911). Accordingly we performed a functional analysis of the mutant HER2 proteins. We found that the degradation of HER2 protein after the administration of cycloheximide was slower in G660D and V659E mutants as compared with wild-type (Supplementary A) indicating the higher stability of the mutant proteins than wild-type protein. In addition results of a phospho-mitogen“activated protein kinase array indicated the activation of Akt and p38? (data not shown). Indeed Akt is known to be activated by HER2 by phosphatidylinositol 3-kinase and leads to increased cell growth and survival (1213). Also the activation of p38 was shown to contribute to the viability of lung adenocarcinoma cells derived from never or light smokers (1415). A western blot analysis for Akt and p38 successfully confirmed the upregulation of both phospho-Akt and phospho-p38 expression in the mutant HER2 transfectants (Supplementary B). Because the G660D alteration in HER2 might have been the cause of the lung cancer in the pedigree studied we investigated whether familial aggregation of cancer in other ans could be seen in this pedigree. We found that II-1 and II-6 developed renal and gastric cancers respectively; however both of them also had lung cancer. The reason why other types of clinically apparent malignances were rarely found in this pedigree is unclear. The G660D germline mutation may be tolerated in ans other than the lung. This study had some limitations. First the carcinogenic potential of the HER2 mutation at the transmembrane domain should be confirmed in other models such as transgenic mice. Second the rarity of these mutations in sporadic lung cancers may be the limitation for generalizability to other cases even if targeting therapies for similar types of HER2 mutation were developed. In conclusion we identified a novel germline mutation in the transmembrane domain of the HER2 in familial lung adenocarcinomas. Somatic mutation in the HER2 transmembrane domain may be a possible cause of sporadic lung adenocarcinomas. Funding This study was supported by a Grant-in Aid for Scientific Research from the Ministry of Education Culture Sports Science and Technology of Japan (25293302 to ST). H. Yamamoto J. Soh S. Miyoshi and S. Toyooka conceived the project. K. Higasa M. Sakaguchi K. Shien and K. Ichimura performed the experiments. H. Yamamoto J. Soh M. Furukawa S. Hashida N. Takigawa K. Kiura K. Tsukuda and S. Toyooka collected the samples and assisted with the experiments. H. Yamamoto K. Higasa K. Shien and K. Matsuo analyzed the data. H. Yamamoto K. Higasa M. Sakaguchi F. Matsuda and S. Toyooka prepared the manuscript with input from the other authors. S. Miyoshi F. Matsuda and S. Toyooka supervised the project. The authors declared no conflicts of interest. References 1. BellDWGoreIOkimotoRA Inherited susceptibility to lung cancer may be associated with the T790M drug resistance mutation in EGFR. Nat Genet. 2005;37(12):1315“131616258541 2. IkedaKNomoriHMoriTSasakiJKobayashiT Novel germline mutation: EGFR V843I in patient with multiple lung adenocarcinomas and family members with lung cancer. Ann Thorac Surg. 2008;85(4):1430“143218355544 3. OhtsukaKOhnishiHKuraiD Familial lung adenocarcinoma caused by the EGFR V843I germ-line mutation. J Clin Oncol. 2011;29(8):e191“e19221172876 4. van NoeselJvan der VenWHvan OsTA Activating germline R776H mutation in the epidermal growth factor receptor associated with lung cancer with squamous differentiation. J Clin Oncol. 2013;31(10):e161“e16423358982 5. PaoWGirardN New driver mutations in non-small-cell lung cancer. Lancet Oncol. 2011;12(2):175“18021277552 6. ShigematsuHTakahashiTNomuraM Somatic mutations of the HER2 kinase domain in lung adenocarcinomas. Cancer Res. 2005;65(5):1642“164615753357 7. StephensPHunterCBignellG Lung cancer: intragenic ERBB2 kinase mutations in tumours. Nature. 2004;431(7008):525“52615457249 8. BargmannCIHungMCWeinbergRA Multiple independent activations of the neu oncogene by a point mutation altering the transmembrane domain of p185. Cell. 1986;45(5):649“6572871941 9. BocharovEVMineevKSVolynskyPE Spatial structure of the dimeric transmembrane domain of the growth factor receptor ErbB2 presumably corresponding to the receptor active state. J Biol Chem. 2008;283(11):6950“695618178548 10. FleishmanSJSchlessingerJBen-TalN A putative molecular-activation switch in the transmembrane domain of erbB2. Proc Natl Acad Sci U S A. 2002;99(25):15937“1594012461170 11. MineevKSBocharovEVPustovalovaYEBocharovaOVChupinVVArsenievAS Spatial structure of the transmembrane domain heterodimer of ErbB1 and ErbB2 receptor tyrosine kinases. J Mol Biol. 2010;400(2):231“24320471394 12. BaselgaJSwainSM Novel anticancer targets: revisiting ERBB2 and discovering ERBB3. Nat Rev Cancer. 2009;9(7):463“47519536107 13. EngelmanJA Targeting PI3K signalling in cancer: opportunities challenges and limitations. Nat Rev Cancer. 2009;9(8):550“56219629070 14. MountziosGPlanchardDBesseB Mitogen-activated protein kinase activation in lung adenocarcinoma: a comparative study between ever smokers and never smokers. Clin Cancer Res. 2008;14(13):4096“410218593986 15. PlanchardDCamara-ClayetteVDorvaultNSoriaJCFouretP p38 Mitogen-activated protein kinase signaling ERCC1 expression and viability of lung cancer cells from never or light smoker patients. Cancer. 2012;118(20):5015“502522415779 Oncotarget Oncotarget ImpactJ Oncotarget 1949-2553 Impact Journals LLC 24519909 3996653 Research Paper Sp1-mediated microRNA-182 expression regulates lung cancer progression Yang Wen-Bin 1 Chen Ping-Hsin 2 Hsu Tsung-I 3 Fu Tzu-Fun 4 Su Wu-Chou 5 Liaw Hungjiun 6 Chang Wen-Chang 7 Hung Jan-Jong 1 2 3 7 1 Institute of Bioinformatics and Biosignal Transduction College of Bioscience in Biotechnology National Cheng Kung University Tainan 701 Taiwan 2 Department of Pharmacology College of Medicine National Cheng Kung University Tainan 701 Taiwan 3 Center for Infectious Disease and Signal Transduction Research National Cheng Kung University Tainan 701 Taiwan 4 Department of Medical Laboratory Science and Biotechnology College of Medicine National Cheng Kung University Tainan 701 Taiwan 5 Department of Internal Medicine College of Medicine and Hospital National Cheng Kung University Tainan 701 Taiwan 6 Department of Life Sciences College of Bioscience in Biotechnology National Cheng Kung University Tainan 701 Taiwan 7 Graduate Institute of Medical Sciences College of Medicine and Center for Neurotrauma and Neuroregeneration Taipei Medical University Taipei 110 Taiwan Correspondence to:petehung petehungmail.ncku.edu.tw 2 2014 25 1 2014 5 3 740 753 18 11 2013 24 11 2014 Copyright: 2014 Yang et al. 2014 This is an open-access distributed under the terms of the Creative Commons Attribution License which permits unrestricted use distribution and reproduction in any medium provided the original author and source are credited. Our recent study indicated that overexpression of Sp1 enhances the proliferation of lung cancer cells while represses metastasis. In this study we found that the transcriptional activity of FOXO3 was increased but its protein levels decreased following Sp1 expression. Sp1 increased expression of miR-182 which was then recruited to the 3'-untranslated region of FOXO3 mRNA to silence its translational activity. Knockdown of miR-182 inhibited lung cancer cells growth but enhanced the invasive and migratory abilities of these cells through increased N-cadherin expression. Repression of FOXO3 expression in the miR-182 knockdown cells partially reversed this effect suggesting that miR-182 promotes cancer cell growth and inhibits cancer metastatic activity by regulating the expression of FOXO3. The expression of several cancer metastasis-related genes such as ADAM9 CDH9 and CD44 was increased following miR-182 knockdown. In conclusion in the early stages of lung cancer progression Sp1 stimulates miR-182 expression which in turn decreases FOXO3 expression. This stimulates proliferation and tumor growth. In the late stages Sp1 and miR-182 decline thus increasing FOXO3 expression which leads to lung metastasis. Sp1 miR-182 FOXO3 Lung cancer INTRODUCTION Post-transcriptional regulation plays an important role in diverse cellular processes such as development neurogenesis and cancer progression [1-3]. MicroRNAs (miRNAs) have emerged as important post-transcriptional regulators that inhibit mRNA translation or induce mRNA cleavage by base pairing with a seed region in the 3'-untranslated region (3'-UTR) of target genes [4 5]. Recent studies have shown that dysregulation of miRNAs contributes to the initiation progression metastasis and drug resistance of cancer [6 7]. For example miR-200c targets Kras to regulate Kras expression during tumorigenesis [8]. Furthermore several upregulated and downregulated miRNAs have been identified in lung cancer the most frequently diagnosed cancer and the most common cause of cancer-related death worldwide [9-11]. Identification of early-detection biomarkers and precise diagnosis are necessary if lung cancer patients are to receive efficacious therapeutic treatment quickly. Several factors such as USP17 have been identified as potential biomarkers for lung cancer [12 13]. Circulating miRNAs could also serve as useful clinical biomarkers for the screening of high-risk populations and the detection solid tumors in the early stages of cancer progression [14 15]. miRNAs offer new targets for cancer therapy [16 17]. Therefore a detailed understanding of the mechanisms underlying miRNA production and function is important. Identification of miRNA target genes and the use of gene set enrichment analysis have clarified the function role of miRNAs. However the molecular mechanisms that regulate of miRNA biogenesis are still largely unknown. Recent studies have shown that transcription factors (TFs) regulate not only the expression of protein-encoding genes but also miRNA biogenesis through RNA polymerase II-dependent transcription [18]. Several TFs including p53 c-myc and HIF1? that directly recognize miRNA promoters and regulate miRNA transcription have been reported [19-21]. Specificity protein 1 (Sp1) which belongs to the specificity protein/ Krüppel-like family was the first TF identified in mammalian cells. Sp1 contains three Cys2His2-type zinc finger DNA binding motifs that recognize GC-rich promoter sequences [22]. Sp1 regulates thousands of coding genes such as those encoding cyclin A2 p21cip1/waf1 E-cadherin and Sp1 itself. These genes are involved in a variety of physiological processes including cell cycle progression and cell migration [23-26]. Sp1 also regulates the expression of noncoding genes. Sp1 forms a complex with NF-?B to downregulate miR-29b expression through the recruitment of histone deacetylase (HDAC) 1 and HDAC3 in leukemia and thereby contributes to the growth of leukemia cells [27]. Sp1 also forms a complex with HDAC4 to downregulate miR-200a expression in hepatocellular carcinoma and contributes to cell proliferation and migration [28]. In addition Sp1 is an activator of miR-34c miR-132 and miR-365 expression [29-31]. However no studies have assessed whether Sp1 regulates the expression of miRNAs involved in lung tumorigenesis. Because the accumulation of Sp1 is required for lung tumor growth further investigation of Sp1-mediated miRNA regulation is needed. In this study we showed that Sp1 suppressed FOXO3 expression via post-transcriptional regulation. To elucidate whether miRNAs were involved in this process we used a systematic screening approach to identify Sp1-regulated miRNAs. We identified a novel Sp1-regulated miRNA miR-182 in lung cancer cells and demonstrated that Sp1 downregulated FOXO3 expression by upregulating miR-182 expression. Our results show that miR-182 functions as an oncomiR to enhance cancer cell proliferation and acts as a tumor suppressor to inhibit cancer metastasis. RESULTS Sp1 regulates miR-182 expression Our previous studies demonstrated that Sp1 is involved in KrasG12D-induced lung tumorigenesis [23 32]. Using cDNA microarray analysis we found that Sp1 increased oncogene expression and decreased tumor suppressor gene expression. In the present study we initially used software to analyze the promoters of all identified miRNAs. According to the miRBase database the human genome contains 1600 miRNA genes. We investigated whether Sp1 participates in the regulation of intergenic miRNAs. First we screened the upstream (-1 kb) flanking sequences of intergenic miRNAs. Using the TFSEARCH program we identified 205 intergenic miRNAs that contained potential binding sites for Sp1. Because Sp1 is upregulated in lung cancer and the expression of its target genes is altered we next examined the expression of these miRNAs in lung cancer. According to previous studies the expression patterns of 22 miRNAs differed significantly in lung cancer tissue and normal lung tissue (Supplementary Table S1). In most of these studies miR-182 which contains two putative Sp1 binding sites within its upstream region was upregulated in lung cancer. When we examined miR-182 expression we found that miR-182 was decreased in Sp1-knockdown cells but increased in IMR-90 cells that overexpressed GFP-Sp1 (A and 1B) suggesting that Sp1 positively regulates miR-182 expression. Luciferase activity driven by the miR-182 promoter increased in H1299 cells overexpressing GFP-Sp1 (C) whereas luciferase activity decrease in cells treated with an Sp1 inhibitor mithramycin A (D). These results suggested that Sp1 is involved in miR-182 transcriptional activation. Using the TFSEARCH software we analyzed the miR-182 promoter and identified two putative Sp1 binding elements. Consequently recruitment of Sp1 to the miR-182 promoter was examined (E and 1F). Acetyl-histone3 was recruited to the Sp1 binding elements indicating that the region could recruit TFs (E panel b). Sp1 was also recruited to the miR-182 promoter (E panel c and panel d and 1F). When the Sp1 binding element at site 1 was mutated luciferase activity driven by the miR-182 promoter was abolished but no change was observed when the other Sp1 binding site was mutated indicating that the Sp1 binding element at site 1 is important for the Sp1-mediated expression of miR-182 (G). Sp1 regulates miR-182 expression (A) Scramble (shScr) and different doses of Sp1 shRNAs (shSp1) were transfected into A549 for 48 h. The miR-182 level was determined by stem-loop RT-PCR. U6 served as the internal control (panel a). Data were quantified after three independent experiments (panel b). (B) Different titer of adeno-GFP-Sp1 virus was infected IMR-90 cells for 48 h. The miR-182 level was determined by stem-loop RT-PCR (panel a). Data were quantified after three independent experiments (panel b). (C) Plasmids pGL2 or pGL2-miR-182 (-1000/+50) and GFP or GFP-Sp1 were co-transfected into H1299 cells for 24h. Cells were harvested to study the luciferase activity. Data were quantified after three independent experiments. (D) The plasmids pGL2 or pGL2-miR-182 were transfected into H1299 cells with mithramycin A treatment for 24 h. Cells were harvested for luciferase activity assays. (E) Schematic diagram indicates the location of putative Sp1 binding sites on miR-182 promoter region (panel a). "

Lung_Cancer

"Blood samples were stored at the Biobank of the University of Navarra and were processed following standard operating procedures approved by the Ethical and Scientific Committees. Tumor ORR to the treatment was assessed using computerized tomography (CT) scans every two pemetrexed-based chemotherapy cycles and categorized according to the Response Evaluation Criteria In Solid Tumors (RECIST) v1.1 as per institutional protocol. The toxicities recorded during pemetrexed-based treatment were graded according to the Common Terminology Criteria for Adverse Events (CTCAE) version 4.0. TS enhancer region genotyping analysis The genomic DNA was extracted from the peripheral leucocytes. The genotypes of the TSER (VNTR) and SNP were determined by polymerase chain reaction (PCR). The variable number tandem repeat (VNTR) of 28 bp polymorphism and the G???C SNP in the first and second repeat were analyzed. A DNA fragment was amplified using previously described PCR conditions and primers [17] and directly sequenced using an ABI PRISM 3100 Genetic Analyzer (Applied Biosystems Foster City CA USA). The forward primer 5?-CGTGGCTCCTGCGTTTCC-3? and the reverse primer 3?-GAGCCGGCCACAGGCAT-5? were used. A modification of conventional conditions was necessary. PCR was performed in a reaction mixture with dNTP: 0.35 ?l Buffer: 0.25 ?l MgCl2: 17.5 ?l Tap polymerase: 0.5 ?l H2O: 18 ?l primers 0.1?+?0.1 ?l DMSO: 1.25 ?l and DNA: 2 ?l. The cycling conditions were denaturation 95°C for 10 minutes and 30 cycles at 95°C for one minute then at 64°C for one minute and 72°C one minute and finally seven minutes at 72?ºC. Aliquots of amplified fragments were separated on a 3% agarose gel and the TS VNTR genotype was determined staining 2R (210 base pairs; bp) and 3R (238 bp) alleles. After that we performed a PCR-restriction fragment length polymorphisms (RFLP) by Hae III digestion. The mixture was PCR product: 10 ?l H2O: 7 ?l Buffer 2 ?l and Hae III: 1 ?l. After that we incubated the mixture at 37°C overnight. Aliquots of digested fragments were separated on 12% acrylamide gel and the SNP genotype was determined. The digestion of fragments showed the different genotypes 2RGC: 664746 44 and 7 bp 2RCC: 11346 44 and 7 bp 3RGGCC (3RG): 66474644 28 and 7 bp 3RGCC (3RC): 944746 44 and 7 bp. TS 3?UTR region genotyping analysis The 3?UTR polymorphisms were analyzed by Restriction Fragment Length Polymorphism (RFLP). A fragment containing the 6 bp deletion/insertion was amplified using the reverse primer 5?-CAGATAAGTGGCAGTACAGA-3?and the forward primer 3?-CAAATCTGAGGGAGCTGAGT-5? in 10 ul of reaction mixture with dNTP: 4 ?l Buffer: 5 ?l MgCl2: 4 ?l Tap polymerase: 0.5 ?l H2O: 26.5 ?l primers 4?+?4 ?l and DNA: 2 ?l. The cycling conditions were denaturation 95°C for 10 minutes and 35 cycles at 95°C for 30 minutes then at 57°C for 30 minutes and 72°C one minute and finally seven minutes at 72°C. The fragments were amplified on 2% agarose gel. Afterwards the products were digested with Dra I and the mixture of PCR product: 20 ?l BSA 10%: 0.5 ?l Buffer: 5 ?l H2O: 23.5 ?l and Dra I: 1 ?l. Posteriorly the product was incubated one hour at 37°C. The final digested product was separated in a 3% agarose gel. The different genotypes were deletion 6 bp/insertion 6 bp insertion 6 bp/insertion 6 bp and deletion 6 bp/deletion 6 bp. The expected fragment sizes by genotyping were deletion 6 bp/insertion 6 bp: 148142 88 and 60 bp insertion 6 bp/insertion 6 bp: 88 and 60 bp and deletion 6 bp/deletion 6 bp: 142 bp. We repeated the PCR three times to ensure final results. EGFR mutations analysis As per institutional protocol all patients with advanced NSCLC were tested for EGFR activating mutations before treatment initiation. In brief after having the samples fixed in alcohol and stained by Papanicolau stain DNA was extracted and amplified by PCR technique using EGFR gene exons 1819 20 and 21 specific primers. ABI PRISM® 310 Genetic Analyzer equipment was used for the analysis of the sequencing reactions with both forward and reverse primers. Statistical analysis Fisher™s exact test was used to investigate the correlation between each genotype and the response to the treatment and the toxicity presented. Kaplan-Meier curves and log-rank test or Tarone-Ware test when indicated were calculated to correlate each genotype with the survival outcomes (PFS and OS). For the subgroup analysis EGFR mutation status and smoking history were considered in order to analyze potential differences in clinical outcome measures (ORR PFS and OS). The SPSS 15.0 software (SPSS Inc. Chicago IL) was employed to perform the statistical analysis. Results Patients™ characteristics and treatment The clinical and pathological characteristics of the patients included are summarized in . In brief our cohort was mainly composed by males with a median age of 59 years and a past smoking history showing good performance status. Most of the patients showed adenocarcinoma histology (88%) and showed distant metastasis (M1) at onset (72%). Most of the patients received a pemetrexed-based regimen in first line (84%). After a median follow up of 21 months 80% of patients have already progressed and 52% of them have died due to disease progression (). Patients™ characteristics N pts % Gender ??Female 11 44 ??Male 14 56 Age ??<60 13 52 ??> r =60 12 48 ECOG ??0 9 36 ??1 15 60 ??2 1 4 Tobacco ??Current smoker 4 16 ??Never smoker 7 28 ??Former smoker 14 56 Histology ??Adenocarcinoma 22 88 ??Adenocarcinoma poorly differentiated 2 8 ??Adeno-squamous 1 4 T ??T1-2 12 48 ??T3-4 13 52 N ??N0 6 24 ??N+ 19 76 M ??M0 7 28 ??M1 18 72 Lung metastases ??Presence 7 28 ??Absence 18 72 Liver metastases ??Presence 2 8 ??Absence 23 92 Bone metastases ??Presence 10 40 ??Absence 15 60 Brain metastases ??Presence 8 32 ??Absence 17 68 EGFR ??Wild type 23 92 ??Mutant 1 4 ??Unknown 1 4 Line of treatment ??First/Induction (stage III) 2 8 ??First 21 84 ??Second 1 4 ??Third 1 4 Response ??Response 18 72 ??Progression?+?Stabilization 7 28 Maintenance ??No maintenance 18 72 ??Maintenance 7 28 Progression ??Not progressed 6 24 ??Progressed 19 76 Clinical status ??Alive 12 48 ??Dead 13 52 Eastern Cooperative Oncology Group (ECOG). Epidermal Growth Factor Receptor (EGFR). In addition in 8 out of the 18 subjects showing multiple brain metastases at onset conventional whole-brain radiotherapy (300 cGy) was administered between first and second chemotherapy cycles following our institutional treatment guidelines. Finally 4 out of the 7 patients showing no distant metastases at onset responded to the pemetrexed-based induction chemotherapy. As per institutional protocol all four subjects underwent a 3-D conformal radiotherapy program with concurrent chemotherapy as previously published [18]. Correlation between ORR to the treatment and polymorphisms We studied the potential correlation between the different polymorphisms observed and the response to the treatment obtained (). For this purpose any kind of radiological response (complete or partial response) was compared to no response to the treatment (disease stabilization or progression). "

Lung_Cancer

"Biological Sciences Cell Biology Analysis of the tumor-initiating and metastatic capacity of PDX1-positive cells from the adult pancreas PDX1-positive cells from adult pancreas Ischenko Irene a Petrenko Oleksi b 1 Hayman Michael J. a 1 Departments of aMolecular Genetics and Microbiology and bPathology Stony Brook University Stony Brook NY 11794 1To whom correspondence may be addressed. E-mail: alexei.petrenkostonybrook.edu or michael.haymanstonybrook.edu. Edited by Douglas R. Lowy National Cancer Institute Bethesda MD and approved January 22 2014 (received for review October 22 2013) Author contributions: O.P. and M.J.H. designed research; I.I. and O.P. performed research; I.I. and O.P. contributed new reagents/analytic tools; O.P. and M.J.H. analyzed data; and O.P. and M.J.H. wrote the paper. 4 3 2014 18 2 2014 111 9 3466 3471 Significance Pancreatic cancer is characterized by aggressive growth and a high propensity for metastatic spread. Despite growing understanding of the genetic causes of pancreatic cancer the mechanism and timing of cancer metastasis the main cause of deaths in pancreatic cancer patients remain relatively unexplored. In this study we used experimental mouse models of pancreatic carcinogenesis to show that hyperactivation of the Ras/MAPK/ERK pathway and stabilization of the MYC protein are the two main driving forces behind the development of pancreatic cancer cells with high metastatic potential. Our results suggest that pancreatic cells bearing Kras mutation can be induced to differentiate into quasi-normal cells with suppressed tumorigenicity by selective inhibition of the MAPK/ERK/MYC signaling cascade. These findings may have important therapeutic implications. Pancreatic cancer is one of the deadliest human malignancies. A striking feature of pancreatic cancer is that activating Kras mutations are found in ?90% of cases. However apart from a restricted population of cells expressing pancreatic and duodenal homeobox 1 (PDX1) most pancreatic cells are refractory to Kras-driven transformation. In the present study we sought to determine which subsets of PDX1+ cells may be responsible for tumor growth. Using the Lox-Stop-Lox“KrasG12D genetic mouse model of pancreatic carcinogenesis we isolated a population of KrasG12D-expressing PDX1+ cells with an inherent capacity to metastasize. This population of cells bears the surface phenotype of EpCAM+CD24+CD44+CD133“SCA1? and is closer in its properties to stem-like cells than to more mature cell types. We further demonstrate that the tumorigenic capacity of PDX1+ cells is limited becoming progressively lost as the cells acquire a mature phenotype. These data are consistent with the hypothesis that the adult pancreas harbors a dormant progenitor cell population that is capable of initiating tumor growth under conditions of oncogenic stimulation. We present evidence that constitutive activation of the mitogen-activated protein kinase (MAPK/ERK) signaling and stabilization of the MYC protein are the two main driving forces behind the development of pancreatic cancer cells with stem-cell“like properties and high metastatic potential. Our results suggest that pancreatic cells bearing Kras mutation can be induced to differentiate into quasi-normal cells with suppressed tumorigenicity by selective inhibition of the MAPK/ERK/MYC signaling cascade. pancreatic ductal adenocarcinoma cell of origin Chest Chest chest Chest Chest 0012-3692 1931-3543 American College of Chest Physicians 25117058 4188148 chest.14-0477 10.1378/chest.14-0477 Original Research Critical Care Aggressiveness of Intensive Care Use Among Patients With Lung Cancer in the Surveillance Epidemiology and End Results-Medicare Registry ICU Use Among Elderly Patients With Lung Cancer Cooke Colin R. MD Feemster Laura C. MD Wiener Renda Soylemez MD O™Neil Maya E. PhD Slatore Christopher G. MD From the Division of Pulmonary and Critical Care Medicine (Dr Cooke) Center for Healthcare Outcomes and Policy Institute for Healthcare Innovation and Policy Michigan Center for Integrative Research in Critical Care University of Michigan Ann Arbor MI; the Division of Pulmonary and Critical Care Medicine (Dr Feemster) VA Puget Sound Healthcare System and University of Washington School of Medicine Seattle WA; Boston University School of Medicine (Dr Wiener) Boston MA; Edith Nourse Rogers Memorial VA Hospital (Dr Wiener) Bedford MA; Health Services Research and Development (Drs O™Neil and Slatore) and Section of Pulmonary and Critical Care Medicine (Dr Slatore) Portland VA Medical Center; and the Division of Pulmonary and Critical Care Medicine (Dr Slatore) Department of Medicine Oregon Health and Science University Portland OR. CORRESPONDENCE TO: Colin R. Cooke MD University of Michigan Center for Healthcare Outcomes and Policy 2800 Plymouth Rd Bldg 16 Room 127W Ann Arbor MI 48109; e-mail: cookecrumich.edu 10 2014 19 6 2014 1 10 2015 146 4 916 923 25 2 2014 14 5 2014 2014 AMERICAN COLLEGE OF CHEST PHYSICIANS 2014 BACKGROUND: Approximately 65% of elderly patients with lung cancer who are admitted to the ICU will die within 6 months. Efforts to improve end-of-life care for this population must first understand the patient factors that underlie admission to the ICU. METHODS: We performed a retrospective cohort study examining all fee-for-service inpatient claims in the Surveillance Epidemiology and End Results (SEER)-Medicare registry for elderly patients (aged > 65 years) who had received a diagnosis of lung cancer between 1992 and 2005 and who were hospitalized for reasons other than resection of their lung cancer. We calculated yearly rates of ICU admission per 1000 hospitalizations via room and board codes or International Classification of Diseases Ninth Revision Clinical Modification and diagnosis-related group codes for mechanical ventilation stratified the rates by receipt of mechanical ventilation and ICU type (medical/surgical/cardiac vs intermediate) and compared these rates over time. RESULTS: A total of 175756 patients with lung cancer in SEER were hospitalized for a reason other than surgical resection of their tumor during the study period49373 (28%) of whom had at least one ICU stay. The rate of ICU admissions per 1000 hospitalizations increased over the study period from 140.7 in 1992 to 201.7 in 2005 (P < .001). The majority of the increase in ICU admissions (per 1000 hospitalizations) between 1992 and 2005 occurred among patients who were not mechanically ventilated (118.2 to 173.3 P < .001) and among those who were in intermediate ICUs (20.0 to 61.9 P < .001) but increased only moderately in medical/surgical/cardiac units (120.7 to 139.9 P < .001). S: ICU admission for patients with lung cancer increased over time mostly among patients without mechanical ventilation who were largely cared for in intermediate ICUs. Cell Death Dis Cell Death Dis Cell Death & Disease 2041-4889 Nature Publishing Group 24481441 4040650 cddis2013550 10.1038/cddis.2013.550 Original Ibuprofen enhances the anticancer activity of cisplatin in lung cancer cells by inhibiting the heat shock protein 70 Ibuprofen and cisplatin-mediated apoptosis Endo H 1 2 Yano M 1 2 * Okumura Y 1 Kido H 1 1Division of Enzyme Chemistry Institute for Enzyme Research The University of Tokushima Tokushima Japan 2Department of Nutrition School of Human Cultures The University of Shiga Prefecture Shiga Japan *Department of Nutrition School of Human Cultures The University of Shiga Prefecture Hikone Shiga 522-8533 Japan. Tel: +81 749 28 8441; E-mail: yano.mshc.usp.ac.jp 01 2014 30 01 2014 1 1 2014 5 1 e1027 25 06 2013 27 11 2013 10 12 2013 Copyright 2014 Macmillan Publishers Limited 2014 Macmillan Publishers Limited This work is licensed under a Creative Commons Attribution-NonCommercial-NoDerivs 3.0 Unported License. To view a copy of this license visit http://creativecommons./licenses/by-nc-nd/3.0/ Hsp70 is often overexpressed in cancer cells and the selective cellular survival advantage that it confers may contribute to the process of tumour formation. Thus the pharmacological manipulation of Hsp70 levels in cancer cells may be an effective means of preventing the progression of tumours. We found that the downregulation of Hsp70 by ibuprofen in vitro enhances the antitumoural activity of cisplatin in lung cancer. Ibuprofen prominently suppressed the expression of Hsp70 in A549 cells derived from lung adenocarcinoma and sensitized them to cisplatin in association with an increase in the mitochondrial apoptotic cascade whereas ibuprofen alone did not induce cell death. The cisplatin-dependent events occurring up- and downstream of mitochondrial disruption were accelerated by treatment with ibuprofen. The increase in cisplatin-induced apoptosis caused by the depletion of Hsp70 by RNA interference is evidence that the increased apoptosis by ibuprofen is mediated by its effect on Hsp70. Our observations indicate that the suppression of Hsp70 by ibuprofen mediates the sensitivity to cisplatin by enhancing apoptosis at several stages of the mitochondrial cascade. Ibuprofen therefore is a potential therapeutic agent that might allow lowering the doses of cisplatin and limiting the many challenge associated with its toxicity and development of drug resistance. Hsp70 apoptosis ibuprofen The human Hsp70 family includes ?8 highly homologous members that differ from each other by their intracellular localization and expression patterns.1 Among them the major stress-inducible Hsp70 (also called Hsp72) has an essential role in cell survival under stressful conditions. Compared with its normal counterpart Hsp70 is often overexpressed in various cancer cells and is suspected to contribute to the development of tumours.2 3 Indeed the expression of Hsp70 in certain cancer types has been correlated with poor prognosis and resistance to chemotherapy.45 6 Tumour cells often express several proteins that when abnormally elevated render the tumour resistant to apoptosis.7 Previous studies have confirmed not only that Hsp70 is cytoprotective but also that it interferes effectively with cell death induced by a wide variety of stimuli including several cancer-related stresses. Hsp70 is a potent inhibitor of the stress-activated kinase pathway and apparently blocks apoptotic signals via interactions with JNK Ask1 and SEK1.8910 11 Hsp70 is also a negative regulator of the mitochondrial pathway of apoptosis. Much of the focus on the antiapoptotic function of Hsp70 has been on events that occur after the disruption of the mitochondria. Hsp70 prevents the recruitment of procaspase-9 to the apoptosome and its functional complex formation by direct interaction with apoptotic protease-activating factor 1 (Apaf-1).12 13 Furthermore Hsp70 inhibits the activation of caspase-3 and the cleavage of caspase-3 targets such as ICAD and GATA-1.14 15 On the other hand recent studies have reported that Hsp70 can prevent apoptosis upstream of the mitochondria by inhibiting events which ultimately permeabilize the mitochondrial outer membrane such as the activation of Bax.16 17 As a result of the inhibition by Hsp70 of the apoptosis induced by several anticancer drugs as well as by other stimuli we hypothesized that cancer cells would be sensitized to the induction of apoptosis by the neutralization of Hsp70. Hsp70 has been indeed targeted with pharmaceuticals such as triptolide quercetin and KNK437 which downregulate its expression.1819 20 Although they have prevented the progression of various cancer cells in vitro and in vivo21 22 the optimal clinical use of these small Hsp70 inhibitors singly or combined with other chemotherapeutics remains a challenge. Our overall objective was to pharmacologically control the levels of Hsp70 and increase the effectiveness of anticancer drugs. Several experimental and epidemiologic studies and clinical trials have observed a powerful chemopreventive activity exerted by nonsteroidal anti-inflammatory drugs (NSAIDs).23 24 The anti-carcinogenic properties of NSAID have been attributed to their inhibition of cyclooxygenase (COX) enzymes. However much higher doses of NSAID are needed to obtain an antitumoural effect than to inhibit COX25 suggesting that they also act via COX-independent mechanisms. On the other hand NSAIDs such as aspirin salicylate and sulindac sulphide inhibit the proliferation of cells and induce apoptosis in various cancer cell lines which is considered an important component of their antitumoural activity and increased sensitization of cancer cells to anticancer drugs.262728 29 There is currently interest in the ability of NSAID to directly lower the levels of antiapoptotic molecules such as the Bcl-2 family30 and 14-3-3 protein31 which inhibits the intrinsic mitochondria-dependent apoptosis in various cancer cells. Therefore the NSAID-induced dysfunction of antiapoptotic proteins prompted us to examine whether other antiapoptotic molecules including Hsp70 might also be targets in the prevention of tumour progression by NSAID. In this study we show that ibuprofen is a potent inhibitor of Hsp70 which significantly suppresses its expression by depleting heat shock factor 1 (HSF1) in lung adenocarcinoma-derived A549 cells. The downregulation of Hsp70 by ibuprofen sensitized the cells to cisplatin which was associated with the enhancement of cisplatin-induced apoptotic signalling. Ibuprofen did not only facilitate postmitochondrial events including the activation of cisplatin-induced caspase-9 but also the activation of Bax causing the release of cytochrome c. Besides the demonstration of a similar increase in the sensitivity of A549 cells to cisplatin conferred by Hsp70 knockdown and ibuprofen these observations indicate that ibuprofen accelerates cisplatin-mediated apoptosis at multiple steps of the mitochondrial apoptotic pathway via the inhibition of Hsp70. We conclude that ibuprofen is a potential chemotherapeutic agent which might enable (a) the use of lower less toxic does of cisplatin and (b) the design of a new combination treatment of lung cancer. Results Ibuprofen suppresses the expression of Hsp70 in lung adenocarcinoma cells To define the role of Hsp70 in promoting the formation of tumours we first examined its expression in human lung cancer cell lines. Compared with BEAS-2B a human non-malignant bronchial epithelial cell line the expression levels of Hsp70 in lung cancer cells such as A549 and H358 adenocarcinoma were notably higher (Figure 1a). As in previous studies which showed an increased expression of Hsp70 in various types of human cancers including breast pancreas and colon we found that Hsp70 is also dysregulated in lung cancer cells. In this study we screened conventional NSAID in search of a new pharmacologic inhibitor which neutralizes Hsp70 as they induce apoptosis in cancer cells by selectively downregulating antiapoptotic proteins. The expression of Hsp70 after the exposure of A549 cells to various NSAID in non-toxic concentrations was analyzed by immunoblot. Ibuprofen in a 400-?M concentration decreased the expression of Hsp70 by 23% in comparison with untreated cells whereas other NSAID had no effect (Table 1). Figure 1b shows the decrease in Hsp70 protein and mRNA levels in A549 cells after treatment with various concentrations of ibuprofen versus no apparent decreases in Hsc70 and Actin. Ibuprofen also decreased the expression of Hsp70 in H358 a human lung adenocarcinoma cell line in a dose-dependent manner (Figure 1c). These results suggest that ibuprofen decreases the expression of Hsp70 in various lung cancer cell lines. Ibuprofen enhances the apoptosis induced by cisplatin by suppressing Hsp70 As ibuprofen prominently inhibited the expression of Hsp70 we next examined its effect on the proliferation of cancer cells. We observed no significant change in the viability of A549 and H358 cells after the exposure to ?800??M concentrations of ibuprofen alone which downregulates Hsp70 (Figure 2a) while the exposure to 1.0?mM concentration of ibuprofen caused cell death. Combined these observations indicate that the downregulation of stress-inducible Hsp70 was insufficient to cause the death of A549 and H358 cells. There is evidence that the inhibition of anti-apoptotic molecules such as Hsp70 increases the sensitivity of tumour cells to anticancer drugs thus improving the outcomes of chemotherapy. To study the therapeutic potential of ibuprofen we examined whether its antitumoural effects are synergistic with those of cisplatin widely used in the treatment of lung adenocarcinoma. When we measured the survival of A549 (top of Figure 2b) and H358 (bottom of Figure 2b) cells exposed to increasing concentrations of cisplatin incubated in presence versus absence of ibuprofen the latter prominently magnified the apoptosis induced by cisplatin a synergistic effect confirmed by terminal deoxynucleotidyl transferase-mediated dUTP nick and labelling (TUNEL) staining (Figure 2c). To ascertain the effects conferred by the expression of Hsp70 on cell death while excluding all effects of ibuprofen unrelated to Hsp70 we weakened the expression of Hsp70 by RNA interference (RNAi) (Figure 2d) and measured its effects on the apoptosis induced by cisplatin. The inhibition of Hsp70 decreased the viability of cisplatin-treated cells by approximately 20% (Figure 2e). Transfections with scrambled siRNA serving as a control showed no increase in cell death mediated by cisplatin. Cisplatin had no effect on the expression of Hsp70 (Figure 2g). We quantified the number of apoptotic cells in ibuprofen- and/or cisplatin-treated cultures using the CF488A-annexin V methods. Although cisplatin alone induced apoptosis in 10.2% of A549 cells the co-treatment with ibuprofen increased the percentage of apoptotic cells to 34.0% (Figure 2f). These observations suggest that ibuprofen sensitizes A549 cells to cisplatin by decreasing the expression of Hsp70. Ibuprofen decreases the expression of Hsp70 via transcriptional inactivation The reverse transcriptase-polymerase chain reaction (RT-PCR) analysis described earlier revealed a decrease in RNA level following treatment with ibuprofen suggesting that the expression of Hsp70 can be downregulated at the transcriptional level. After the recently discovered inhibition by its antagonists of the transcription of Hsp70 in cancer cells by blockade of the activation of HSF118 20 (which is often upregulated and constitutively activated in tumour formation) we studied the effects of ibuprofen on HSF1 in A549 cells. We first performed a ChIP assay to explore whether the inhibitory effect of ibuprofen is at the level of HSF1 DNA binding. As expected we found an unequivocal association between HSF1 and the Hsp70 gene promoter containing the HSE site in ibuprofen-untreated cells (Figure 3a). It is noteworthy that ibuprofen eliminated this binding (Figure 3a) suggesting that it inhibits the expression of Hsp70 via the action of HSF1. This also suggests that ibuprofen blocks the binding of HSF1 chromatin or the steps which precede in several processes needed to activate HSF1. Therefore we broadened our analysis to examine the effect of ibuprofen on the expression of HSF1. Compared with unexposed control cells the HSF1 mRNA level was significantly lower in cells exposed to ibuprofen (bottom of Figure 3b). Consistent with its effect on the expression of mRNA ibuprofen also decreased the expression of HSF1 protein in a dose-dependent fashion (top of Figure 3b). To confirm the inhibition of HSF1-mediated Hsp70 by ibuprofen we lowered the amounts of HSF1 present in A549 cells by RNAi and studied its effect on the expression of Hsp70. The treatment of cells with HSF1 dsRNA decreased the Hsp70 level compared with that measured in cells untreated with dsRNA (Figure 3c). Ibuprofen decreased the expression of HSF1 by 16% in comparison with untreated cells whereas other NSAID had no effect (Table 2). Overall these observations indicate that ibuprofen inhibited the expression of Hsp70 by depleting the HSF1 in A549 cells. Ibuprofen accelerates the mitochondrial apoptotic process induced by cisplatin Several studies have found that mitochondria might be a direct and important target of cisplatin in sensitive cells.32 33 We studied the effects of ibuprofen on the depolarization of mitochondrial membranes and the cytochrome c release induced by cisplatin. A549 cells with or without cisplatin were incubated in absence or presence of ibuprofen and stained with JC-1. Treatment with cisplatin and ibuprofen lowered the mitochondrial membrane potential manifest by an attenuated red and an enhanced green mitochondrial fluorescence (Figure 4a lower right panel) compared with that observed with cisplatin alone (Figure 4a upper right panel) while control (Figure 4a upper left panel) or ibuprofen alone (Figure 4a lower left panel) produced the red-dotted staining pattern of polarized mitochondria. The intensity of green mitochondrial fluorescence in cisplatin-treated cells is significantly increased (36.56 to 55.56%) by the co-treatment with ibuprofen. Ibuprofen also promoted the release of cytochrome c from the mitochondria induced by cisplatin (Figure 4b). These findings unequivocally indicated that in A549 cells ibuprofen enhanced the mitochondria-dependent apoptosis caused by cisplatin. Ibuprofen increases the activation of Bax induced by cisplatin The translocation of the pro-apoptotic protein Bax to the mitochondria is closely associated with the apoptosis induced by cisplatin. To explore the mechanisms by which ibuprofen promotes the apoptosis mediated by mitochondria in response to cisplatin we examined whether it was due to its ability to stimulate the translocation of Bax by cisplatin. We first monitored conformational changes in Bax as indicators of its activation. Western blot analysis of the immunoprecipitates with a conformation specific anti-Bax (6A7) antibody which only recognizes the active form revealed the presence of active Bax in A549 cells treated with cisplatin (Figure 5a lane 4) although not in untreated cells (Figure 5a lanes 1 and 2). Further exposure of the cisplatin-treated cells to ibuprofen caused a 1.5-fold increase in active Bax compared with incubation with cisplatin alone (Figure 5a lane 3). When we analyzed the effects conferred by ibuprofen on the translocation of Bax to mitochondria in cisplatin-treated cells we observed an approximately 1.3-fold increase in the amount of translocated Bax (Figure 5b). To exclude an effect of ibuprofen unrelated to the inhibition of Hsp70 we performed RNAi for a selective knock-down of Hsp70 and we studied its effects on the activation of Bax. Consistent with the earlier data presented for ibuprofen the depletion of Hsp70 increased the activation of Bax in cisplatin-treated cells although its extent was greater with Hsp70 RNAi than with ibuprofen (Figure 5c). These observations confirmed that (a) ibuprofen promotes the activation of Bax dependent on cisplatin and its translocation to the mitochondria in A549 cells and (b) its mechanism of action is mediated by the inhibition of Hsp70. Ibuprofen facilitates events occurring upstream and downstream of mitochondrial disruption in cisplatin-mediated apoptosis Previous studies have shown that Hsp70 can inhibit apoptosis by acting downstream of the mitochondria.121314 15 Hsp70 interacts directly with Apaf-1 to prevent the formation of cytochrome c-mediated apoptosome and subsequent activation of caspase-9. To examine whether ibuprofen also influences the downstream mitochondrial events we measured its effects on the cleavage of procaspase-9 in the apoptosis mediated by cisplatin. With an anti-active caspase-9 antibody fully processed caspase-9 was predominantly identified in cisplatin-treated A549 cells (Figure 6a lane 3) over untreated cells (Figure 6a lanes 1 and 2). It is noteworthy that treatment with ibuprofen increased >4-fold the amount of active caspase-9 in cells treated with cisplatin compared with cells incubated with cisplatin alone (Figure 6a lane 4). As as reported earlier the highest increases in the activation of Bax and release of cytochrome c by ibuprofen were <2-fold these observations suggest that ibuprofen also facilitates the post mitochondrial process taking place between the release of cytochrome c and the activation of caspase-9. To verify that this is a specific effect we studied the effect of Hsp70 knock-down on the activation of caspase-9 mediated by cisplatin. The caspase-9 activity in cells depleted of Hsp70 with cisplatin was fourfold greater than in control (scrambled) siRNA-treated cells (Figure 6b). We obtained similar results when we measured the activity of caspase-9 in cells treated with ibuprofen (Figure 6c) or siRNA against Hsp70 (Figure 6d) by a fluorometric assay using a synthetic substrate. Overall these observations confirmed unambiguously that ibuprofen intensified the apoptosis induced by cisplatin by its effects on the events occurring downstream of the mitochondria by inhibiting Hsp70 although whether it stimulated the formation of apoptosome (essential for the recruitment of procaspase-9) remains to be determined. We conclude that ibuprofen promotes the apoptosis induced by cisplatin at multiple stages of the mitochondrial cascade by attenuating the expression of Hsp70 in A549 cells. Discussion We found that compared with non-malignant bronchial epithelial cells human lung cancer cells overexpressed Hsp70. This is an important observation as targeting the expression or function of Hsp70 has been suggested as an effective treatment strategy in several cancers based on the hypothesis that higher levels of Hsp70 protect against cell death and increase the survival rate against modalities used in chemotherapy.11 15 In fact it is well documented that the expression of Hsp70 is significantly increased in cancer tissues and/or serums obtained from patients with non-small cell lung cancer (NSCLC)34353637 38 and its overexpression correlates with poor prognosis in NSCLC.36 Several reports have indicated that functionally related small molecules that inhibit Hsp70 decrease the viability of colo-rectal or pancreatic cancer cells by promoting apoptosis via the downregulation of Hsp70 and may be a promising new class of cancer chemotherapeutics.1921 22 We showed that ibuprofen a relatively non-toxic and widely used NSAID significantly decreased the expression of Hsp70 in lung adenocarcinoma cell lines. We also clearly demonstrated that the inhibitory mechanisms of ibuprofen on Hsp70 are due to a decrease in HSF1 expression. Although the fundamental mechanism behind the reduction in HSF-1 expression is unknown a previous study has indicated that the nuclear factor 1 family member NFIX which codes for site-specific DNA-binding proteins known to have multiple roles in replication signal transduction and transcription exerts a transcriptional repressive effect on the expression of HSF1 in cancer cells.39 Whether NFIX is indeed involved in the inhibition of HSF1 expression evoked by ibuprofen is applicable in further studies. To the best of our knowledge this is the first study of the inhibitory effects of NSAID on the cellular expression of Hsp70. In addition we showed that ibuprofen does not influence the cell viability without additional stimuli unlike its maximal effect on the expression of Hsp70. The lack of inhibitory efficacy of ibuprofen against tumours is consistent with a previous study which showed that low-dose ibuprofen did not induce apoptosis in mouse and human colorectal cancer cell lines.29 Similar observations were made following RNAi of Hsp70 suggesting that the attenuation of Hsp70 per se is insufficient to cause the death of A549 and perhaps other cells. It has been shown that the knockdown of Hsp70 has no effect on the viability of several cancer cell lines although sensitized them to anticancer drugs.40 41 Therefore the therapeutic potential of ibuprofen combined with chemotherapeutic agents needs to be explored. Cisplatin is one of most effective chemotherapeutic drugs against NSCLCs.42 It is noteworthy that damage to DNA caused by cisplatin enables apoptosis involving mitochondrial pathways which is negatively regulated by Hsp70. As ibuprofen prominently suppressed the expression of Hsp70 in A549 and H358 cells we examined the possible synergistic activity of ibuprofen and cisplatin against cancer. As expected ibuprofen potentiated synergistically the anti-proliferative effect of cisplatin in A549 and H358 cells. Despite its potent antitumoural properties the therapeutic use of cisplatin in oncology is seriously limited by dose-dependent adverse effects and frequent development of drug resistance.43 Therefore our findings may make useful contributions toward the development of new and less toxic chemotherapy against NSCLCs. We also examined the molecular mechanisms of these synergistic properties of ibuprofen. Hsp70 protects cells against mitochondria-dependent apoptosis at different levels although the precise mechanism remains hypothetical because of regular contradictory descriptions of Hsp70 function. Earlier reports have shown a protective effect of Hsp70 against cellular apoptosis by inhibition of the apoptosome function a protein complex comprising Apaf-1 and cytochrome c.12 13 However recent reports have questioned this repression of apoptosis downstream of the mitochondrial membrane permeabilization. Several studies have suggested that Hsp70 functions upstream of the mitochondria by preventing the release of cytochrome c instead of inhibiting the apoptosome or other downstream points in the caspase cascade.16 17 Some of this confusion may be due to different experimental systems used to evaluate apoptosis or reflects the variability of apoptotic pathways among different cell lines. In this study we found that the inhibition of Hsp70 by ibuprofen facilitates the activation of Bax induced by cisplatin and its translocation to the mitochondria in A549 cells. This finding is consistent with the previous observation of blockade of Bax activation being one of the upstream sites of action of Hsp70. On the other hand the role played by Hsp70 in the A549 cellular mitochondrial apoptotic pathway is likely to be more complex than described earlier because in cisplatin-treated cells the "

Lung_Cancer

"Twenty-one days after cell sorting peptide specificity was assessed using the IFN-? ELISPOT assay (Fig. 3B). The established clone reacted to the T2 cells pulsed with peptide A but not to T2 cells pulsed with the irrelevant HIV-gag peptide. These results indicate that a peptide A-specific CTL clone was successfully established from PBMCs from a healthy donor. The EML4-ALK-specific CTL clone recognizes HLA-A*02:01+ lung carcinoma cells with the EML4-ALK variant 3a/b incubated with IFN-? We next evaluated the ability of the EML4-ALK-specific CTL clone to recognize the cancer cell line H2228 which expresses HLA-A*02:01 and EML4-ALK using the IFN-? ELISPOT assay. Even though the EML4-ALK-specific CTL clone failed to recognize H2228 cells it did recognize those pretreated with 100 U/ml IFN-? 48 h prior to examination (Fig. 4A). We examined the effect of IFN-? on H2228 cells. Incubating target cells with IFN-? for 48 h increased the expression of MHC class I molecules on the cell surface (Fig. 4B). This result indicates that the peptide A-specific CTL clone was able to recognize H2228 cells because of increased expression of MHC-class I on the H2228 cell surface. Specific IFN-? production by the peptide A-specific CTL clone was detectable in H2228 cells treated with IFN-?. The specificity was abolished by an anti-HLA-class I mAb but not by an isotype control suggesting that the observed production was HLA-A2 restricted (Fig. 4C). A cytotoxicity assay was also performed. The peptide A-specific CTL clone was able to specifically lyse H2228 cells pretreated with IFN-? 48 h prior to examination. This specific lysis was blocked by the anti-HLA-class I mAb but not by the isotype control. These results indicate that the peptide A-specific CTL clone showed cytotoxicity and the ability to produce IFN-? against HLA-A*02:01+ EML4-ALK+ NSCLC cell lines (Fig. 5). Discussion In the present study we identified a new tumor-associated CTL epitope (peptide A) derived from EML4-ALK which binds to HLA-A*02:01 molecules and we were able to establish a peptide-specific CTL clone from human PBMCs that specifically recognized cognate peptide-pulsed T2 cells and HLA-A*02:01 tumor cells expressing EML4-ALK that had been pretreated with IFN-?. EML4-ALK-positive lung cancers are highly sensitive to ALK inhibition. However as with trastuzumab or gefitinib (3031) patients typically gain resistance within 1 to 2 years of starting therapy (23). We aimed to overcome these difficulties with immunotherapy. We identified a glypican-3 (GPC3)-derived peptide and showed that GPC3-specific CTL frequency after vaccination correlated with OS. OS was significantly longer in patients with high GPC3-specific CTL frequencies than in those with low frequencies (32). This indicates that the ability to induce a peptide-specific CTL clone is important for effective immunotherapy. We also revealed that GPC3 is an ideal target for anticancer immunotherapy since it is specifically overexpressed in hepatocellular carcinoma (HCC) (33“35). In the present study we chose a peptide array from EML4-ALK from which we were able to induce a peptide-specific CTL clone. EML4-ALK is a strong oncogene overexpressed in cancer cells of NSCLC breast cancer kidney cancer and colon cancer (17). We performed RT-PCR and assayed the EML4 DNA levels of certain lung cancer cell lines. H2228 cells express EML4 moderately but at higher levels than other lung cancer cell lines. EML4 expression has been reported as highly expressed in CD8+ T cells. RT-PCR showed that EML4 DNA levels were high in PBMCs and CD8+ T cells. Because of a lack of suitable antibodies we could not perform western blotting. However our success at inducing a peptide A-specific CTL clone from CD8+ T cells indicated that the CTL clone had no cytotoxicity against CD8+ T cells. This CTL clone could not recognize cancer cell lines without the ability to increase the amount of HLA class I presented on cell surfaces. Further examination is needed to achieve higher tumor reactivity. Combination chemotherapy or radiation therapy plus immunotherapy was recently reported to have a synergistic effect (36). Moreover some mechanisms of synergy between radiation therapy chemotherapy and immunotherapy have been revealed (37). In one of the mechanisms these therapies upregulated tumor antigens and MHC moieties. These results suggest that combination therapy could be used to make tumor cell lines more susceptible to this peptide A-specific CTL clone-mediated cytolysis (38“41). In addition this treatment may be able to overcome resistance to ALK inhibition. Some resistance mechanisms for targeting drugs have been examined. The most commonly identified causes of resistance are point mutations such as L1196M (42“44) G1269A (22) and S1206Y (21). "

Lung_Cancer

"Acute phase reactants are plasma proteins that are synthesized by hepatocytes as a nonspesific response against tissue damage infection inflammation trauma or cancer. Acute phase reactants are frequently used in the evaluation of chronic inflammation in diseases such as inflammatory bowel disease or rheumatoid arthritis. Particularly C-reactive protein fibrinogen haptoglobin ferritin ceruloplasmin copper and ?1-antitrypsin can be mentioned among the proteins that show notable increases during acute phase response. On the other hand proteins such as albumin and transferrin demonstrate decreases during the response and are called as œnegative acute phase reactants. Different diseases associated with asbestos may present with different levels of oxidative stress or inflammation. The importance of oxidative stress and inflammation can be assessed by various markers and modalities targeting this system can be established in the treatment and follow-up. In this study we aim to evaluate oxidative markers including TOL TAC OSI and inflammatory indicators and compare their relationship with each other in patients with asbestos exposure having no disease and in patients with asbestos exposure and MM. 2. Material and Methods 2.1. Study Subjects and Area This cross-sectional study was conducted at the Pulmonology Department of Dicle University Diyarbakir Southeastern Turkey. Environmental asbestos exposure is common in the southeast region of Turkey. In this region asbestos-containing soil is used to purpose of thermal insulation and waterproofing on roof and wall (material of whitewash-wall plaster). Environmental exposure occurs through inhalation of asbestos-laden soil. Exposure with asbestos begins at birth in rural areas and the exposure is continuous. Thus patient's age was accepted exposure duration time in our study. We enrolled eighty villagers who have more than 20 years of environmental asbestos exposure were included in the study. Asbestos was detected in village in soil analysis. This village also was in an area that MM patients occure. There was not any finding for MM and other diseases in Chest X-ray in villagers. Forty-six patients with MM who were registered and followed up in our Department of Pulmonology were enrolled the study. The control group was created 50 healthy people with a mean of similar age and gender and who living in an area which not detected asbestos in soil analysis and without any disease. The patients with chronic kidney failure chronic heart failure liver failure and chronic obstructive pulmonary disease and those who have got active infection were excluded the study. The patients with malignancies other than MM were excluded from the study. The study protocol was carried out in accordance with the Helsinki Declaration as revised in 1998 and approved by the local research committee for ethics. All subjects were informed about the study protocol and written consents were obtained from all inhabitants. 2.2. MM Diagnosis Thoracentesis and closed pleural needle biopsy were performed in patients with pleural effusion for pathological and cytological examination. Ramel needle biopsy set was used in closed pleural biopsy. Surgical biopsy was performed when closed pleural biopsy is not appropriate The ultrasound-guided biopsy was performed in patients with small amount of pleural effusion. Tissue samples were immediately placed in 10% formol and sent for histopathological examination. Hematoxylin and eosin staining was used as standard in histopathological evaluation. Histochemical or immunohistochemical staining were used if necessary. The patients with confirmed MM diagnosis histopathologically were included in the study. Certain laboratory clinical and radiographic variables which measured at the time of diagnosis. were defined as potential prognostic factors. 2.3. Blood Sampling To measure TOL and TAC two 10?mL samples of blood were drawn from antecubital veins and were collected in empty tubes. Samples were separated from cells by centrifugation at 4000?rpm for 5?min and then serum was stored at ?80 C until analysis. 2.4. Measurement of TOL TOL of serum was determined using an automated measurement method (Rel assay diagnostics kits MegaTip Gaziantep Turkey) developed by Coussens and Werb [8]. Oxidants present in the sample oxidize the ferrous ion-o-dianisidine complex to ferric ion. The oxidation reaction is enhanced by glycerol molecules which are abundantly present in the reaction medium. The ferric ion makes a colored complex with xylenol orange in an acidic medium. The color intensity which can be measured spectrophotometrically is related to the total amount of oxidant molecules present in the sample. The assay was cali-brated with hydrogen peroxide and the results are expressed as micromoles of hydrogen peroxide equivalents per litre (mmol H2O2?equiv/L). 2.5. Measurement of TAC Serum TAC levels were determined using a novel automated measurement method (Rel assay diagnostics kits Mega Tip Gaziantep Turkey)"

Lung_Cancer

"Biochemistry Biomarkers Medicine and Health Sciences Diagnostic Medicine Gastroenterology and Hepatology Gastrointestinal Cancers Oncology Basic Cancer Research Metastasis Cancers and Neoplasms Carcinomas Adenocarcinomas Colon Adenocarcinoma Gastrointestinal Tumors Pathology and Laboratory Medicine Anatomical Pathology Surgical Pathology Molecular Pathology The Clinical Implication of Cancer-Associated Microvasculature and Fibroblast in Advanced Colorectal Cancer Patients with Synchronous or Metachronous Metastases Cancer-Associated Microenvironment in Advanced Colorectal Cancer Kwak Yoonjin 1 2 Lee Hee Eun 1 Kim Woo Ho 1 2 Kim Duck-Woo 3 Kang Sung-Bum 3 Lee Hye Seung 4 * 1 Department of Pathology Seoul National University Hospital Seoul South Korea 2 Department of Pathology Seoul National University College of Medicine Seoul South Korea 3 Department of Surgery Seoul National University Bundang Hospital Seongnam-si Gyeonggi-do South Korea 4 Department of Pathology Seoul National University Bundang Hospital Seongnam-si Gyeonggi-do South Korea Lo Anthony W. I. Editor The Chinese University of Hong Kong Hong Kong * E-mail: hye2snu.ac.kr. Competing Interests: The authors have declared that no competing interests exist. Conceived and designed the experiments: HEL WHK HSL. Performed the experiments: HEL WHK HSL. Analyzed the data: YK HEL HSL. Contributed reagents/materials/analysis tools: HEL WHK DWK SBK HSL. Wrote the paper: YK HEL WHK DWK SBK HSL. 2014 18 3 2014 9 3 e91811 11 1 2014 14 2 2014 2014 Kwak et al This is an open-access distributed under the terms of the Creative Commons Attribution License which permits unrestricted use distribution and reproduction in any medium provided the original author and source are credited. Background We aimed to evaluate the clinical significance of microvessel density (MVD) lymphatic vessel density (LVD) and cancer-associated fibroblasts (CAFs) in relation to tumor location in advanced colorectal cancer (CRC). Methods Using immunohistochemistry we examined 181 advanced CRC patients for CD31 and D2-40 to measure MVD and LVD respectively ?-smooth muscle actin (SMA) and desmin to identify CAFs and PTEN to examine genetic changes of CAFs. To evaluate the regional heterogeneity of these properties we examined tissue from four sites (the center and periphery of the primary cancer a distant metastasis and a lymph node metastasis) in each patient. Results MVD LVD and CAFs showed significant heterogeneity with respect to the tumor location. LVD was the greatest in the center of the primary cancers and the amount of CAFs was the lowest in distant metastases. In distant metastases those from the lung had higher LVD and MVD but fewer CAFs than those from the liver peritoneum or ovary. Patients with low MVD and LVD in the center of the primary cancer had worse outcomes and patients with few CAFs in distant metastases and in the primary tumor had a lower survival rate. PTEN expression in CAFs in distant metastases was lost in 11 of 181 CRC patients (6.1%) which was associated with a worse prognosis. Conclusions The microenvironment including cancer-associated microvasculature and fibroblasts is heterogeneous with respect to the tumor location in CRC patients. Therefore heterogeneity of microenvironments should be taken into account when managing CRC patients. This study was supported by grant number 03-2011-012 from the Seoul National University Bundang Hospital Research Fund. The funder had no role in study design data collection and analysis decision to publish or preparation of the manuscript. Introduction Although the mortality rates of colorectal cancer (CRC) patients have decreased in most western countries and in several developing countries in Asia advanced CRC patients who initially present with stage IV disease or those who develop distant metastases several months after diagnosis still have a lower five-year survival rate [1] [2]._ENREF_4 Recently the range of systemic chemotherapy has expanded and targeted therapy including epidermal growth factor receptor (EGFR) and vascular endothelial growth factor (VEGF) inhibitor therapies have been used in advanced CRC patients increasing patient survival [3]. However some CRC patients respond poorly to targeted therapy despite presenting positive results in targeted therapy-specific mutation studies [4]. One possible explanation for this therapeutic failure is tumor heterogeneity; several studies have reported that CRCs possess a heterogenic genotype or phenotype including KRAS p53 and BRAF [5]“[7]. Therefore the differing characteristics of the primary tumor site and the corresponding metastatic an need to be clarified to improve the management of CRC patients with metastatic diseases. Furthermore understanding the clinicopathological characteristics of advanced CRC is important for the development and improvement of systemic therapies. Since Paget et al. first described the cancer microenvironment by the œseed and soil theory [8] there has been growing evidence that cancer-associated stroma might affect the cancer cells themselves and contribute to cancer progression [9]. The main components of the cancer microenvironment are microvasculature (microvessels and lymphatic vessels) inflammatory cells and cancer-associated fibroblasts (CAFs) [10]“[12]. The current method of verifying angiogenetic and lymphangiogenetic activity in cancer tissue is to assess microvessel density (MVD) and lymphatic vessel density (LVD) respectively. MVD has been proposed as a surrogate marker of cancer-associated angiogenesis to identify patients with a high risk of recurrence or those with poor prognoses for various cancers including CRC [13] [14]; however the prognostic correlation of angiogenesis in CRC is still controversial [15] [16]. Similar to angiogenesis LVD has received interest as a means of lymphatic metastasis and survival [17] [18] but its role in tumor progression is still unclear [19]. The other prominent component of stroma CAFs are consistently activated and affect many aspects of tumor initiation invasion and progression [9]. While some studies have suggested that CAFs may inhibit tumor progression [20] [21] other studies have proposed that CAFs may promote progression in prostate breast and skin cancers [22]“[24]. In the context of CRC Tsujino et al. have suggested that ?-smooth muscle actin (SMA)-expressing CAFs might be a useful indicator of poor prognosis. However these results were restricted to stage II and III CRCs [25]. In addition to cancer cells genetic alterations in CAFs have demonstrated including the loss of heterozygosity microsatellite instability and genetic mutations [26] [27]. Recently genetic inactivation of PTEN in CAFs was reported in breast cancer patients [28]. Trimboli et al. identified that PTEN loss in stromal fibroblasts resulted in extensive extracellular matrix remodeling and angiogenesis which characteristic of tumor progression [28]. However expression loss of PTEN and its clinical significance have not been investigated in colorectal cancer patients. The aim of this study was to investigate the characteristics of microenvironments including microvasculatures and CAFs in advanced CRC patients. Additionally we assessed the intratumoral heterogeneity in the primary tumor and the discordance between primary tumor and distant metastasis microenvironments. "

Lung_Cancer

"MALAT1 also known as NEAT2 (nuclear-enriched abundant transcript 2) is a highly conserved nuclear lncRNA and a predictive marker for metastasis development in lung cancer [23]. In this study we found that the expression of another lncRNA BANCR was significantly downregulated in NSCLC tissues. Specifically BANCR expression was significantly lower at the later stages of tumor development and in tumors that had undergone extensive metastasis. Moreover the overall survival time of patients with lower BANCR expression levels was significantly shorter than that for patients with higher BANCR expression levels. Our results indicate that BANCR expression provided a significant independent predictive value for TNM stage (P?=?0.038). We demonstrated that upregulation of BANCR expression led to the significant inhibition of cell viability migration invasion and promotion of apoptosis. Knockdown of BANCR expression promoted cell migration and invasion. BANCR induced cell apoptosis may be partly via P53 which could contribute to the less cells in migration and invasion; however the impaired migration and invasion ability is the main reason which could be supported by wound-healing assay. Moreover increased BANCR expression levels resulted in a significant reduction in the number of metastatic nodules on the lungs in vivo. These findings suggest that BANCR plays a direct role in the modulation of cell metastasis and NSCLC progression and may be useful as a novel prognostic or progression marker for NSCLC. Tumor development and progression is precisely regulated by several subsets of genes that act by either silencing tumor suppressor genes or activating oncogenes [24]. Tumor suppressor genes can negatively regulate cell proliferation by inducing growth arrest and inhibiting cell invasion. In cancer cells tumor suppressor genes are usually silenced by genetic or epigenetic alterations [25]. Whether epigenetic regulatory factors such as histone acetylation or DNA methylation manipulate the expression of lncRNAs remains unclear. Hypermethylation of the promoter or the intergenic differentially methylated region has been found to contribute to reduced lncRNA MEG3 expression in tumors indicating that epigenetic regulation is also involved in the expression of these genes [2627]. Our findings highlight that histone acetylation is a key factor in controlling lncRNA BANCR expression. These results along with those from a recent study [28] highlight the role of epigenetics in regulating lncRNA transcription. To explore the molecular mechanism through which BANCR contributes to the invasion and metastasis of NSCLC we investigated potential target proteins involved in cell motility and matrix invasion. Hallmarks of EMT are the loss of E-cadherin expression and aberrant expression of N-cadherin and Vimentin [29-32]. Therefore we determined the protein levels of these EMT-induced markers following BANCR overexpression. Our results indicated that inhibitory effects on cell migration and invasion were associated with EMT. Matrix metalloproteases (MMPs) are also important to many aspects of biology ranging from cell proliferation differentiation and remodeling of the extracellular matrix (ECM) to vascularization and cell migration. Upregulation of BANCR expression in NSCLC cells led to a significant decrease in MMP2 protein levels. Our findings demonstrated that BANCR mediated NSCLC cell migration invasion and metastasis suppression which possibly also affected EMT. As a central differentiation process EMT allows for remodeling of tissues during the early stages of embryogenesis and is implicated in the promotion of tumor cell invasion and metastasis [733]. It has been proposed and supported by many studies that EMT could be a potent mechanism for promoting the detachment of cancer cells from primary tumors. A characteristic of cells that undergo EMT is increased expression levels of N-cadherin and Vimentin and a loss of E-cadherin expression. Importantly EMT has been reported to be associated with poor clinical outcome in NSCLC [3435]. Therefore lncRNAs as regulators of EMT might be suitable candidates for intervention in the treatment of cancer. Although only a small number of functional lncRNAs have been well characterized to date they have been shown to regulate gene expression at various levels including chromatin modification transcription and post-transcriptional processing. Hox transcript antisense intergenic RNA (HOTAIR) is one of the most studied lncRNAs involved in chromatin modification which can target PRC2 genome-wide to alter H3K27 methylation and gene expression patterns [22]. A muscle-specific lncRNA linc-MD1 may function as competing endogenous RNAs (ceRNAs) to sponge miRNAs thereby modulating the derepression of miRNA targets and impose an additional level of post-transcriptional regulation [36]. Here although we observed BANCR overexpression induced NSCLC cells apoptosis and regulate EMT phenotype the possible mechanisms that underlie such regulatory behaviors still remain to be fully understood. Further investigation of BANCR molecular and biological functions in controlling EMT will undoubtedly be important in understanding the molecular biology of NSCLC metastasis and progression. Conclusions The expression of BANCR was significantly decreased in NSCLC tissues suggesting that its downregulation may be a negative prognostic factor for NSCLC patients and indicative of poor survival rates and a higher risk for cancer metastasis. We showed that BANCR possibly regulates the invasive and metastatic ability of NSCLC cells partially through regulation of EMT. Our findings further the understanding of NSCLC pathogenesis and development and facilitate the development of lncRNA-directed diagnostics and therapeutics against cancers. However the molecular mechanisms through which BACNR regulates EMT requires further investigation."

Lung_Cancer

"The extent of lung parenchymal change depends on the time interval. Acute lung injury after the percutaneous injection of lipiodol or methylene blue was reported in animal studies (28 29); however there are no clinical results that show the adverse effect of acute lung injury in human lungs. Injection material (such as barium) can potentially complicate the pathologic diagnosis of the target lesion due to acute inflammation (29 30). To our knowledge no study has indicated that lipiodol or methylene blue hinders the histopathologic diagnosis of target lesions in human lungs. The small amount of material injection in human lungs might not create a significant parenchymal change or disrupt underlying lung disease. It is necessary to avoid directly injecting materials into the target lesion in human lungs in order to avoid the adverse effect of injection materials on underlying lung disease (especially ground glass opacity nodule or potential benign lesion). There were several limitations in our study. First we included only a small number of subjects. Second the overall localization success rate was low and the complication rate was high (compared to the results of previous studies) due to the difficulty in an accurate percutaneous injection at the desired location and depth in the small sized rabbit lung. Third we used a 1 mL syringe with manual administration to inject materials in the lung parenchyma and there were possible individual difference in the administering volume of materials. Fourth we could not evaluate complications such as intractable pain material related anaphylaxis or embolism. Fifth we could not evaluate if the histopathologic changes had any effect on underlying lung disease because the lung parenchyma of the experimental rabbits were normal. Finally we did not evaluate a successful localization for the true target lesion in lung parenchyma. The criteria for appropriate staining and radio-opacity were subjective. We expect that further clinical studies might provide an answer to if MLM can be a useful percutaneous injection material for localization in the human lung. In MLM is available for percutaneous injection for the pulmonary localization. The results of this study showed that MLM provides superior ability for appropriate localization than that of methylene blue. Further research on human lungs can clarify the availability of MLM as a CT guided percutaneous injection material. This study was supported by grant from the Seoul National University College of Medicine Research Fund 2012 (800-20120036). We have no potential conflicts of interest or commercial involvement to disclose. 1 Nakashima S Watanabe A Obama T Yamada G Takahashi H Higami T Need for preoperative computed tomography-guided localization in video-assisted thoracoscopic surgery pulmonary resections of metastatic pulmonary nodules Ann Thorac Surg 2010 89 212 218 20103238 2 Chen S Zhou J Zhang J Hu H Luo X Zhang Y Chen H Video-assisted thoracoscopic solitary pulmonary nodule resection after CT-guided hookwire localization: 43 cases report and literature review Surg Endosc 2011 25 1723 1729 21181200 3 Ciriaco P Negri G Puglisi A Nicoletti R Del Maschio A Zannini P Video-assisted thoracoscopic surgery for pulmonary nodules: rationale for preoperative computed tomography-guided hookwire localization Eur J Cardiothorac Surg 2004 25 429 433 15019673 4 Suzuki K Nagai K Yoshida J Ohmatsu H Takahashi K Nishimura M Nishiwaki Y Video-assisted thoracoscopic surgery for small indeterminate pulmonary nodules: indications for preoperative marking Chest 1999 115 563 568 10027460 5 Seo JM Lee HY Kim HK Choi YS Kim J Shim YM Lee KS Factors determining successful computed tomography-guided localization of lung nodules J Thorac Cardiovasc Surg 2012 143 809 814 22104686 6 Gossot D Miaux Y Guermazi A Celerier M Friga J The hook-wire technique for localization of pulmonary nodules during thoracoscopic resection Chest 1994 105 1467 1469 8181339 7 Pittet O Christodoulou M Pezzetta E Schmidt S Schnyder P Ris HB Video-assisted thoracoscopic resection of a small pulmonary nodule after computed tomography-guided localization with a hook-wire system: experience in 45 consecutive patients World J Surg 2007 31 575 578 17318707 8 Chen W Chen L Yang S Chen Z Qian G Zhang S Jing J A novel technique for localization of small pulmonary nodules Chest 2007 131 1526 1531 17494801 9 Bernard A Resection of pulmonary nodules using video-assisted thoracic surgery: the Thorax Group Ann Thorac Surg 1996 61 202 204 8561553 10 Martin AE Chen JY Muratore CS Mayo-Smith WW Luks FI Dual localization technique for thoracoscopic resection of lung lesions in children J Laparoendosc Adv Surg Tech A 2009 19 S161 S164 18999984 11 Kawanaka K Nomori H Mori T Ikeda K Ikeda O Tomiguchi S Yamashita Y Marking of small pulmonary nodules before thoracoscopic resection: injection of lipiodol under CT-fluoroscopic guidance Acad Radiol 2009 16 39 45 19064210 12 Yamagami T Miura H Yoshimatsu R Tanaka O Ono S Iehara T Hosoi H Nishimura T Experience of fluoroscopy-aided thoracoscopic resection of pulmonary nodule localised with Lipiodol in a child J Med Imaging Radiat Oncol 2011 55 401 403 21843175 13 Iwasaki Y Nagata K Yuba T Hosogi S Kohno K Ohsugi S Kuwahara H Takemura Y Yokomura I Fluoroscopy-guided barium marking for localizing small pulmonary lesions before video-assisted thoracic surgery Respir Med 2005 99 285 289 15733503 14 Yoshida J Nagai K Nishimura M Takahashi K Computed tomography-fluoroscopy guided injection of cyanoacrylate to mark a pulmonary nodule for thoracoscopic resection Jpn J Thorac Cardiovasc Surg 1999 47 210 213 10402768 15 Nomori H Horio H Colored collagen is a long-lasting point marker for small pulmonary nodules "

Lung_Cancer

"The DNA (1500-ng aliquots) was resolved by electrophoresis on a 1.5% agarose gel containing 0.5 µg/mL ethidium bromide and was visualized under ultraviolet light [23]. ROS Assay The generation of ROS was assessed in Huh-7 or SMMC-7721 cells with the 2?7?-dichlorofluorescein diacetate (DCFH-DA) (Invitrogen) probe which is hydrolyzed within cells to non-fluorescent 2?7?-dichlorodihydrofluorescin (DCFH). DCFH can be oxidized to the fluorescent 2?7?-dichlorofluorescein (DCF) by hydroxyl radicals peroxynitrite and nitric oxide. Briefly Huh-7 or SMMC-7721 cells were seeded in a 96-well plate. Overnight the cells were incubated with different concentration of luteoloside for 8 h then reacted with 10 µM DCFH-DA at 37°C for 20 min. Or the cells were incubated with NAC (10 mM) H2O2 (100 µM) diamide (10 mM) or BSO (100 µM) for 4 h followed by 50 µM luteoloside for 4 h [24]. DCF was determined at ?ex?=?490 and ?em?=?520 nm on a Synergy H4 microplate reader (BioTek Winooski VT). Furthermore ROS were measured with a Leica DMI4000B inverted fluorescence (Leica Wetzlar Germany). Protein Extraction and Western Blotting The proteins were separated by SDS-PAGE and transferred to nitrocellulose membrane (Bio-Rad Hercules CA). The membrane was blocked with 5% non-fat milk and incubated with rabbit anti-LC3 polyclonal antibody (pAb) (Novus Biologicals) (2 µg/ml) rabbit anti-Beclin 1 pAb (Abcam) (3 µg/ml) rabbit anti-NLRP3 pAb (Novus Biologicals) (1?1000) rabbit anti-caspase-1 (p10) pAb (Santa Cruz Biotechnology) (1?1000) rabbit anti-IL-1? pAb (Santa Cruz Biotechnology) (1?1000) or rabbit anti-?-actin pAb (Bioworld Technology) (1?5000). The proteins were detected with enhanced chemiluminescence reagents (Pierce). Cell Proliferation Assay The cell proliferation assay was conducted as previously described by us [22]. Scratch-wound Assay Scratch-wound assay was conducted as previously described by us [22]. The migration of cells into the wound was monitored in multiple wells using a CellVoyager CV1000 confocal scanner system (Yokogawa Electronic Tokyo Japan) with an Olympus UPLSApo 10—2 10—/0.4 Dry ?/0.17/26.5 WD 3.1 plan super apochromat objective lens. The images were acquired every 0.5 hour for 48 hours (or every hour for 72 hours). The images shown represent 0 and 48 hour (or 0 and 72 hour). In Vitro Migration and Invasion Assays Assays were performed as described previously by Yao et al [25]. Xenograft Model and Treatments Two different mouse models were used to observe in vivo effect of Luteoloside on HCC cells. For the subcutaneous model the mice (male BALB/c-nu/nu 6 weeks old) were anesthetized using 1% sodium pentobarbital (0.2 ml/20 g body weight Sigma Chemical) as described by us previously [22]. The SMMC-7721 cells (2—106 cells) were suspended in 200 µl serum-free DMEM and subcutaneously injected into the right upper flank of each mouse. Two weeks after the cells were injected when tumors were observable the animals were equally divided into two groups (ten per group). The first group received only 0.2 ml of vehicle material by gavage daily and served as a control group. The second group of animals received luteoloside (2 mg/kg body weight; equivalent to a dose of 6.5 mg/m2 in patients) in vehicle respectively for 4 weeks. Body weight was measured every 4 days to adjust the drug dosage. The tumors were measured using digital calipers every 3 to 4 days after they reached a volume of 100 mm3 and tumor volumes were calculated as described: V (cm3)?=?Width2 (cm2)—Length (cm)/2. At the termination of the experiment the mice were sacrificed by cervical dislocation and the tumors were weighed immediately after dissection. For lung metastasis experiments 1—106 SMMC-7721 cells were suspended in 100 µl PBS and injected into the tail veins of each mouse (male BALB/c-nu/nu 6 weeks old) [26]. Then the animals were equally divided into two groups (ten per group). The first group received only 0.2 ml of vehicle material by gavage daily and served as a control group. The second group of animals received Luteoloside (2 mg/kg body weight) in vehicle respectively for 8 weeks. Body weight was measured every 4 days to adjust the drug dosage. At the termination of the experiment the mice were sacrificed by cervical dislocation and their lungs were removed and subjected to hematoxylin & eosin (H&E) staining. This study was carried out in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. The protocol was approved by the Committee on the Ethics of Animal Experiments of the University of Jiangsu Normal University (Permit Number: 13-0221). All surgery was performed under sodium pentobarbital anesthesia and all efforts were made to minimize suffering. Statistical Analysis Data are presented as means ± SEM and comparisons were made using Student™s t test. A probability of 0.05 or less was considered statistically significant. Results Luteoloside Inhibits the Proliferation of HCC Cells in vitro We first determined whether luteoloside inhibits the proliferation of human HCC cells. We found that luteoloside significantly inhibited cell proliferation in all six-cell lines in a dose- and time-dependent manner (Fig. 1B 1C). The results suggest that luteoloside has promising antihepatoma activity. Luteoloside Inhibits the Migration and Invasion of HCC Cells in vitro Luteoloside significantly decreased the migration of Huh-7 and SMMC-7721 cells compared with the control groups (Fig. 2A“2H; Supplementary Movies 1“4). Transwell assays without Matrigel demonstrated that luteoloside could significantly inhibit migration of Huh-7 cells when compared with control groups (Fig. 2I 2J 2M). Transwell assays with Matrigel showed that the invasive capacities of Huh-7 cells which were treated with luteoloside were significantly inhibited compared with the control cells (Fig. 3K 3L 3N). These results indicate that luteoloside can significantly inhibit HCC cells migration and invasion in vitro. .0089961.g002 Luteoloside inhibits migration and invasion of HCC cells. The migration of cells into the wound was monitored in multiple wells using a CellVoyager CV1000 confocal scanner system. The images were acquired every 0.5 hour for 48 hours (Huh-7 cells) or every hour for 72 hours (SMMC-7721 cells) (see Supplemental Movies 1“4). The images shown represent 0 hour (A B E F) 48 hours (C D) and 72 hours (G H). The distance between the two edges of the scratch in the luteoloside-treated cells (D or H) was greater than that of the control (C or G). (I“N) Transwell migration and invasion assays of Huh-7 cells. For the transwell migration assay 5—104 cells were placed on the top chamber of each insert with the noncoated membrane. For the invasion assay 1—105 cells were placed on the upper chamber of each insert coated with 150 µg Matrigel (BD Biosciences MA). Cells in both assays were trypsinized and resuspended in DMEM and 700“900 µL of medium supplemented with 10% fetal bovine serum was injected into the lower chambers. Representative images are shown on the left (I J K L) and the quantification of five randomly selected fields is shown on the right (M N). The values shown are expressed as the mean ± SEM. ** P<0.01 versus non-luteoloside-treated control group. Scale bar: 100 µm. .0089961.g003 Luteoloside decreases intracellular ROS. ROS levels were measured using the ROS assay with DCFH-DA fluorescence dye. (A“B) Cells were treated with luteoloside at the indicated concentration for 8 h then reacted with 10 µM DCFH-DA for 20 min. DCF fluorescence was determined on a Synergy H4 microplate reader. Cells were incubated with NAC (C) H2O2 (D) diamide (E) or BSO (F) for 4 h followed by 50 µM luteoloside for 4 h. DCF was determined on a microplate reader. (G) DCFH-DA fluorescence (green) imaging of ROS in Huh-7 cells. Scale bar: 25 µm. Luteoloside has no Apoptotic Effects on HCC Cells Huh-7 and SMMC-7721 cells were treated with luteoloside for 24 h and caspase-3/7 was measured. The results showed that caspase-3/7 activity was not significantly different between luteoloside-treated cells and control cells when added 5102050100 150 or 200 µM luteoloside respectively (Fig. S1A S1B). Similar results were obtained by analyzing changes in nuclear fragmentation (Fig. S1C) and condensation (Fig. S1D) in cells. These results indicated that luteoloside has no apoptotic effects on Huh-7 and SMMC-7721 cells. Luteoloside does not Affect Autophagy Autophagic cell death (also known as Type II programmed cell death to distinguish it from apoptosis or Type I programmed cell death) has been described as a distinct form of cell death that differs from other death mechanism such as apoptosis and necrosis. Next we investigated whether luteoloside can induce autophagy in HCC cells. Beclin 1 and LC3 (microtubule-associated protein 1A/1B-light chain 3) play a pivotal role in mammalian autophagy. Beclin 1 is involved in both the signaling pathway activating autophagy and in the initial step of autophagosome formation [27]. LC3 comprises both a soluble LC3-I and a lapidated form called LC3-II. LC3-II correlates with autophagy being recruited into autophagosomes. Various types of stressors up-regulate LC3 and promote the conjugation of its cytosolic form LC3-I to phosphatidylethanolamine to constitute the autophagosome-specific LC3-II which is so far considered the most reliable marker of autophagy [27] [28]. Huh-7 and SMMC-7721 cells were treated with luteoloside for 48 h and the levels of LC3 and Beclin 1 proteins of different treatment groups were determined. The results showed that LC3 protein level was not significantly different between luteoloside-treated cells and control cells when added 25 µM or 50 µM luteoloside respectively. Similar results were obtained by analyzing changes in levels of Beclin 1 (Fig. S2). These results indicated that luteoloside has no autophagic effects on Huh-7 and SMMC-7721 cells. Luteoloside Reduces Intracellular ROS Accumulation ROS and cellular oxidant stress have long been associated with cancer [29]. Flavonoids are well known as ROS scavengers. As luteoloside is a kind of flavonoid isolated from Chinese herb [30] we investigated whether the intracellular ROS is part of the mechanism by which luteoloside suppress the proliferation migration and invasion potential of HCC cells. We found that luteoloside could significantly decrease the ROS level of Huh-7 and SMMC-7721 cells in a dose-dependent manner (Fig. 3A 3B). N-acetyl-cysteine (NAC) is a ROS-specific inhibitor [31]. NAC was shown to be capable of suppressing the ROS production in Huh-7 and SMMC-7721 cells (Fig. 3C). When the cells were pretreated with 10 mM NAC for 4 h then treated with 50 µM luteoloside for 4 h the ROS level was significantly lower than the cells which treated with 10 mM NAC only (Huh-7 cells P?=?0.0208; SMMC-7721 cell P?=?0.0224). H2O2 diamide and BSO are all ROS inducers [4]. Treatment with 100 µM H2O2 10 mM diamide or 100 µM BSO showed similar effects resulted in an increase in ROS levels compared with control (Fig. 3D“3F). The results showed that H2O2 diamide and BSO could significantly increase the ROS level of Huh-7 and SMMC-7721 cells compared the control group (Fig. 3D“3F). However after a prolonged time when the cells were treated with 50 µM luteoloside for 4 h the amount of ROS could significantly decrease (Fig. 3D“3F). Furthermore the ROS in Huh-7 cells were monitored using a fluorescence microscope. We also found that luteoloside could significantly decrease the ROS level of Huh-7 cells (Fig. 3G). Luteoloside Downregulates the Expression Level of NLRP3 Caspase-1 (p10) and IL-1? The NLRP3 inflammasome functions as a positive regulator of tumor cells proliferation and metastasis [17] [32]. "

Lung_Cancer

"Testing bal. acc. (%) P value Cross-validation consistency rs7525160 54.03 50.53 0.828 7/10 rs4844600 rs10494885 55.45 49.32 0.989 3/10 rs4844600 rs10494885 rs7525160 57.60 48.48 0.623 6/10 Generalized Multifactor Dimensionality Reduction (GMDR) was used to evaluate gene-gene interaction. The summary of gene-gene interaction models is listed in . The SNP rs7525160 in CR1 had the highest testing balanced accuracy among 12 SNPs. The three-way interaction model among rs4844600 rs10494885 and rs7525160 showed high testing balance accuracy and cross validation consistency but the testing balanced accuracy was lower than the two-way gene-gene interaction in NSCLC. For each model the interaction was not significant (P?>?0.05). Risk of CR1 genotypes with NSCLC by smoking status Smoking status CR1 genotype GG * OR (95% CI) § P value CG?+?CC * OR (95% CI) § P value Non-smoker 84/99 1.00 (reference) 181/182 1.15 (0.81-1.65) 0.440 Smoker 55/77 0.86 (0.54-1.38) 0.528 150/112 1.72 (1.15-2.59) 0.009 <25 pack-years 19/41 0.59 (0.31-1.10) 0.099 56/55 1.32 (0.81-2.61) 0.266 ?25 pack-years 36/36 1.18 (0.67-2.08) 0.562 94/57 2.01 (1.26-3.20) 0.003 *Number of cases/number of controls. §Data were calculated by logistic regression and adjusted for age and gender. Interaction of CR1 SNP with smoking Cigarette smoking is a well-known risk for lung cancer so stratification by smoking status was performed to investigate the association of rs7525160 G?>?C variant with the risk of NSCLC. As shown in the risk of NSCLC was associated with the rs7525160 C allele carriers in smokers with OR (95% CI) of 1.72 (1.15-2.59) but not in non-smokers with OR (95% CI) of 1.15 (0.81-1.65) suggesting that the CR1 rs7525160 G?>?C polymorphism is a smoking-modifying risk factor for susceptibility to NSCLC. When the interaction between smoking status and rs7525160 G?>?C variant was analyzed with cumulative smoking dose (pack-year) consistently GC or CC genotype carriers have increased risk of NSCLC among heavy smokers (pack-year???25) with OR (95% CI) of 2.01 (1.26-3.20) but not among light smokers (pack-year <25) with OR (95% CI) of 1.32 (0.81-2.16). The P value for heterogeneity of the stratification analysis by smoking status is 0.015. However the P value for interaction between rs7525160 polymorphism and smoking is 0.172 and the power for the interaction is 0.49. Discussion The chronic airway inflammation and dysfunctional immune system might promote pulmonary carcinogenesis. Implicated in the immune and inflammatory responses the complement cascade plays a pivotal role in the development of cancer. Thus it is likely that the genetic variants of CR1 in the complement system confer the susceptibility to lung cancer. In this study we have for the first time demonstrated that one intronic SNP (rs7525160 G?>?C) out of 13 tag SNPs of CR1 was associated with the risk of NSCLC in Chinese population. Notably the rs7525160 CC genotype was associated with an increased risk of developing NSCLC (OR?=?1.52 95% CI?=?1.02-2.28; P?=?0.028) compared with the GG genotype. MDR analysis also showed that there was no gene-gene interaction among 12 tag SNPs in CR1 gene. Moreover the risk of NSCLC was associated with the rs7525160 C allele carriers in smokers with OR (95% CI) of 1.72 (1.15-2.59) but not in non-smokers with OR (95% CI) of 1.15 (0.81-1.65) indicating this SNP is a smoking-modifying risk factor for susceptibility to NSCLC. To the best of our knowledge this study shed new insight into the interplay of genetic variation of CR1 with lung cancer risk. More importantly it highlights the potential gene-environmental interaction influences the susceptibility to lung cancer. The complement system has been proposed to get involved in innate immunity with the ability to œcomplement antibody-mediated elimination of immune complex and foreign pathogens [26]. Upon complement activation the biologically active peptides C5a and C3a elicit a lot of pro-inflammatory effects and could be closely associated with tumorigenesis [27]. Complement proteins play a dual role in the tumor microenvironment. On one hand they exert a defensive effect against tumor through complement or antibody-dependent cytotoxicity [128]. On the other hand they may escape from immunosurveillance and facilitate carcinogenesis [2]. Specifically a number of experimental evidence has suggested an association between complement activation and tumor growth [2930] which provides a strong biologically link between the abnormal expression and activity of complement cascade and carcinogenesis. Till now a few studies have been carried out to demonstrate the association of genetic variants in complement proteins with susceptibility to cancer. A significant association of CR2 SNP (rs3813946) with the development of nasopharyngeal carcinoma was indicated in Cantonese population [31] and the genetic variations of complement system genes C5 and C9 plays a potential role in susceptibility to non-Hodgkin lymphoma (NHL) [32]. Recently it has been shown that complement factor H Y402H polymorphism interact with cigarette smoking to confer the susceptibility to lung cancer [33]. Furthermore it has been indicated that CR1 A3650G (His1208Arg) polymorphism plays a critical role in conferring genetic susceptibility to gallbladder cancer in north Indian population [19]. However whether the genetic variants of CR1 are related to the risk of lung cancer remains unknown. In this case-control study we found an intronic SNP (rs7525160 G?>?C) with CC genotype was significantly associated with an increased risk of NSCLC. Consistently our results were in accordance with the study that genetic polymorphisms in innate immunity genes may play a role in the carcinogenesis of lung cancer [34]. It is likely that some genetic variations in strong link disequilibrium with this intronic SNP (rs7525160 G?>?C) are functional which provides a new insight into the hallmarks in susceptibility to lung cancer and further functional experiments are warranted to address the proposal. Functionally human CR1 exists on the surface of almost all peripheral blood cells and plays a key role in immune complex clearance and complement inhibition at the cell surface by binding to activated products C3b and C4b [435]. CR1 also possesses cofactor activity for the serum protease factor I and is thus involved in the generation of further fragments of C3/4b with the activation of complement cascade and the cellular immune response [4]. In our study the association of CR1 polymorphism with lung cancer is biologically plausible in that the intronic polymorphism could affect the density of CR1 molecules on the cell surface thereby contributing to autoimmune disorders and neoplasm. Tobacco smoking is an established risk factor for susceptibility to lung cancer. However not all people who suffer from lung cancer are smokers. Lung cancer in non-smokers can be induced by second hand smoke air pollutants and diesel exhaust [36-39]. Our present data showed significant difference of pack-year smoked but not smoking status between NSCLC cases and controls which suggested the important role of other environmental factors in the development of NSCLC. Tobacco could induce chronic and sustained inflammation in lung microenvironment contributing to pulmonary carcinogenesis in smokers [40]. Support also comes from the epidemiologic data regarding inflammation and lung cancer [41]. CR1 an important molecule implicated in immunity and inflammation could protect the host from invasion of exogenous chemicals derived from cigarette smoking. Genetic variant of CR1 could alter gene function and result in deregulation of the inflammatory and immune responses thereby modulating the susceptibility to lung cancer. More importantly we observed a potential interaction of this SNP (rs7525160 G?>?C) with smoking status suggesting the gene-environmental interaction plays a prominent role in the susceptibility to lung cancer. Our present study has its limitation. Our patients may not be representative of total NSCLC patients at large because they were recruited from only one hospital. In addition due to the relatively small sample size further case-control studies are still needed to replicate and extend our findings. Conclusion We conducted a case-control study in Chinese subjects and found an intronic SNP (rs7525160 G?>?C) of CR1 was significantly associated with lung cancer risk. To the best of our knowledge this study provides the first evidence that genetic variant of CR1 (rs7525160 G?>?C) was a smoking-modifying contributor to the development of lung cancer. Methods Study subjects This case-control study consisted of 470 patients with histopathologically confirmed NSCLC and 470 cancer-free controls. All subjects were genetic unrelated ethnic Han Chinese. Patients were recruited between January 2008 and December 2012 at Tangshan Gongren Hospital (Tangshan China). There were no age gender or stage restrictions however patients with previous malignancy or metastasized cancer from other organs were excluded. The response rate for patients was 94%. The controls were randomly selected from a pool of a cancer-free population from a nutritional survey conducted in the same region. The selection criteria for control subjects included: i) no individual history of cancer; ii) frequency matched to cases according to gender age (±5 years); iii) the residential region; and iv) the time period for blood sample collection. At recruitment informed consent was obtained from each subject and each participant was then interviewed to collect detailed information on demographic characteristics. This study was approved by the institutional review board of Hebei United University. Tag SNPs selection and genotyping Based on the Chinese population data from HapMap database we used Haploview 4.2 program to select candidate tag SNPs with an r2 threshold of 0.80 and minor allele frequency (MAF) greater than 1%. Furthermore we also added two potential functional polymorphisms rs9429942 and rs6691117 [4243]. Therefore we included 13 SNPs in our study which represents common genetic variants in Chinese population. Genotyping was performed at Bomiao Tech (Beijing China) using iPlex Gold Genotyping Asssy and Sequenom MassArray (Sequenom San Diego CA USA). Sequenom™s MassArray Designer was used to design PCR and extension primers for each SNP. Primer information for selected tag SNPs was listed in Table 5. Table 5 Primers used in this study SNP_ID Alleles 1st-PCR primer sequences 2nd-PCR primer sequences UEP sequences rs7525160 G/C ACGTTGGATGCAAAATCAAGGTTTAAAGTC ACGTTGGATGTTCTGACATGTACTGCCTGC CCCTGTTGCCTGGGTTTTTCT rs3886100 G/A ACGTTGGATGGGCCTCAGATCCTCAAAATC ACGTTGGATGTGAGCTGTTTCAGCCAAGAG GAGCCAAGAGGACACTTAG rs11118167 T/C ACGTTGGATGATGTGTGTAGTCACTTAGCC ACGTTGGATGATAATGGCAGATTTAAGGGC CAATGATAAATGAATACTGTGTTCTATC rs9429782 G/T ACGTTGGATGACACGCGGGATCCATCGGAA ACGTTGGATGAACGAGTTTCGCTGGCAGAG GGTGCAGCAGCAGAG "

Lung_Cancer

"Although PLC may be present in liver carcinoma patients these patients might die as a result of other causes such as liver failure or hemorrhage due to cancer rupture before the typical symptoms of PLC manifest. On the basis of our experience and previous reports clinicians should exclude PLC when patients develop hypoxemia and interstitial pneumonia of unknown cause. PLC may cause significant deterioration of the patient™s condition. Thus only early identification diagnosis and treatment can prolong the survival of liver carcinoma patients with PLC. Conclusions Although PLC is rare in liver carcinoma patients cancer cells can migrate into the pulmonary lymphatic system. Early identification diagnosis and treatment are crucial to improving the survival of PLC patients. Combined use of CT PET-CT and pathologic examinations may significantly increase the PLC detection rate. In our patient immunosuppressive therapy after liver transplantation caused rapid progression of PLC. Although we discontinued immunosuppressive therapy employed strategies to improve the patient™s lung edema and administered antitumor therapy the efficacy of the treatment was still very poor. Consent Written informed consent was obtained from the patient for publication of this case report and any accompanying images. A copy of the written consent is available for review by the Editor-in-Chief of this journal. Abbreviations LT: Liver transplantation; PET-CT: Positron emission tomography/computed tomography; PLC: Pulmonary lymphangitic carcinomatosis. Competing interests The authors declare that they have no competing interests. Authors™ contributions Li Zhuang carried out clinical data collection participated in the sequence alignment and drafted the manuscript. XL and CH carried out pathological analysis. Lin Zhang and GJ carried out clinical data collection JW and SZ carried out pathological analysis. All authors read and approved the final manuscript. Acknowledgements This work is supported by grants from the Zhejiang Medicines and Health Technologies Program (201350072) and the National Natural Science Foundation of China (NSFC 81000962). Grossman EJ Millis JM Liver transplantation for non-hepatocellular carcinoma malignancy: indications limitations and analysis of the current literature Liver Transpl 2010 16 930 942 10.1002/lt.22106 20677284 Bruce DM Heys SD Eremin O Lymphangitis carcinomatosa: a literature review J R Coll Surg Edinb 1996 41 7 13 8930034 Zhang K Huang Y [Clinical features and diagnosis of pulmonary lymphangitic carcinomatosis [in Chinese] Ai Zheng 2006 25 1127 1130 16965655 Otsubo K Kubo N Nakashima N Izumi M Nakamori M Koto H A juvenile case of pulmonary lymphangitic carcinomatosis caused by sigmoid colon cancer with a component of micropapillary carcinoma Intern Med 2011 50 2361 2365 10.2169/internalmedicine.50.5170 22001466 Wallach JB McGarry T Torres J Lymphangitic metastasis of recurrent renal cell carcinoma to the contralateral lung causing lymphangitic carcinomatosis and respiratory symptoms Curr Oncol 2011 18 e35 e37 21331270 Babu S Satheeshan B Geetha M Salih S A rare presentation of pulmonary lymphangitic carcinomatosis in cancer of lip: case report World J Surg Oncol 2011 9 77 10.1186/1477-7819-9-77 21756338 Katyal S Oliver JH 3rd Peterson MS Ferris JV Carr BS Baron RL Extrahepatic metastases of hepatocellular carcinoma Radiology 2000 216 698 703 10.1148/radiology.216.3.r00se24698 10966697 Molina DK Valente PT Lymphangitic spread of hepatocellular carcinoma Arch Pathol Lab Med 2003 127 e11 e13 12562285 Shin NY Hong YJ Kim AH Shim HS Nam JE Lee HJ Kim MJ Diffuse interstitial infiltrative lung metastasis of malignant melanoma: a case report Korean J Radiol 2011 12 252 255 10.3348/kjr.2011.12.2.252 21430944 Acikgoz G Kim SM Houseni M Cermik TF Intenzo CM Alavi A Pulmonary lymphangitic carcinomatosis (PLC): spectrum of FDG-PET findings Clin Nucl Med 2006 31 673 678"

Lung_Cancer

"In this model the lymphangiogenesis induced by PDGF-BB could not be restricted by blocking interaction of VEGF-C with VEGFR-3 suggesting that PDGF-BB exerts its effect via an independent pathway that may involve PDGF receptors on lymphatic vessels [34]. Another study showed that VEGF-C is an essential regulator determining PDGF-BB expression for vascular stabilization via a paracrine mode of action [22]. The stimulation of proliferation of lymphatic endothelial cells by platelets seems to be induced in a time and dose dependent manner mainly by VEGF-C and PDGF-BB which are secreted by platelets. Blocking the experiments indicate a predominant role of VEGF-C in this process [35]. All those results suggested that both factors play complicated roles in tumor lymphangiogenesis. However the overlapping biological effects of these two factors have not been clarified clearly in human cancers. In this study overexpression of both PDGF-BB and VEGF-C significantly correlated. LMVD. Those cases were also younger and had larger tumor size more likely lymph node metastasis worse histological differentiation and poorer OS. In addition a significant association between VEGF-C overexpression alone and worse histological differentiation was found. For the rest however PDGF-BB or VEGF-C alone was not linked to any other clinical feature including LMVD. The results indicated NSCLC patients who had overexpression of both PDGF-BB and VEGF-C might present with more rapid growth and higher potential for invasion due to their lymphangiogenesis. Thereby these patients had poorer OS which was consistent with the results in patients with esophageal squamous cell carcinoma those with positive expressions of PDGF-BB and VEGF-C have been shown to possess a worse prognosis compared to those with negative expressions [23]. Also those results suggested that poorly differentiated cancer cells might be more capable to secrete VEGF-C and PDGF-BB which induced lymphangiogenesis thereby promoting disease progression in NSCLC. The secretion of VEGF-C or PDGF-BB by tumor could induce the activation of their receptors on the vascular endothelium and thereby inducing the formation of new lymphatic vessels [36]. However little is currently known about the interplay among these lymphangiogenic factors. In this study a significant positive correlation between PDGF-BB and VEGF-C protein expression of tumor cells was seen in NSCLC suggesting a lymphangiogenesis pathway that one factor (PDGF-BB or VEGF-C alone) may up-regulate the other factor expression in the same cells. Therefore we suspected that PDGF-BB and VEGF-C could synergistically promote NSCLC lymphangiogenesis and enhance the tumor growth and lymph node metastasis. Combined targeting both PDGF-BB and VEGF-C may become a promising strategy for the treatment of NSCLC. Conclusions We found for the first time that compared with the overexpression of PDGF-BB or VEGF-C alone both PDGF-BB and VEGF-C overexpression in primary human NSCLC was significantly associated with lymphangiogensis and poor outcome. Furthermore our data suggested that PDGF-BB and VEGF-C expression might have a correlative dependence and interplay not only in NSCLC lymphangiogenesis but also in cancer progression. Based on the expression of PDGF-BB and VEGF-C we speculated the therapy targeting VEGF-C expression in combination with targeting PDGF-BB might be an important approach for control the cancer growth in patients with NSCLC having high expression of both PDGF-BB and VEGF-C. Competing interests All authors declare they have no actual or potential competing financial interests. Authors™ contributions All authors read and approved the final manuscript"

Lung_Cancer

"The second patient with EGFR mutation achieved the longest PFS and OS (727 and 1249 days respectively). .0087629.g007 Kaplan-Meier estimates of PFS and OS. No statistically significant difference (P?=?0.007) in PFS was observed between metabolic non-progressive (mNP) patients (median PFS 292 days ; range 190“727) and metabolic (mP) progressive patients (median PFS 64 days ; range: 37“216). Improved PFS in non-progressive patients was associated with prolonged OS (mNP; n?=?4; median OS: 1031 days ; 296 to 1249 days versus mP; n?=?8 ; 337 5 days ; 71 to 734 days) (HR 0.34; 95% CI 0.06 to 0.84; P?=?0.03). Discussion Despite the widespread use of [18F]FDG-PET/CT in NSCLC staging a large-scale study recently failed to confirm an overall survival gain in NSCLC patients.[17] This result highlights the value of [18F]FDG-PET/CT in unmet clinical needs such as prediction of residual NSCLC after surgery[18] neoadjuvant therapy[19] or antineoplastic therapy.[20] Prediction of response to antineoplastic therapies would appear to be particularly adapted to targeted therapies that do not induce rapid tumor shrinkage. NSCLC preclinical models have validated this hypothesis with both gefitinib[21] and erlotinib.[22] This original method could compensate for the weakness of RECIST criteria and has led to the proposal of evaluation of new criteria by addition metabolic evaluation by FDG-PET to CT scan.[23] The value of PET in evaluation of response to new targeted therapies emerged in the early 2000 s with the first reports on the efficacy of imatinib mesylate in Gastro Intestinal Stromal Tumor (GIST). Subsequently many studies have confirmed that PET is able to identify very early (i.e. only 24 hours after initiation of treatment) a decrease in glucose metabolism which is correlated with overall survival and progression-free survival of patients with GIST.[24] [25] In the present exploratory study a decrease in SUVmax of at least 21.6% soon after starting therapy (9±3 days) was able to discriminate progressive from non-progressive patients and was associated with improved PFS and OS. This result confirms the results of Mileshkin et al. who showed in a series of 51 patients receiving second- or third-line treatment with erlotinib that an early (14 days) [18F]FDG-PET partial metabolic response was associated with improved PFS and OS even in the absence of subsequent RECIST response.[26] Evaluation of response by [18F]FDG-PET can be performed semi-quantitatively for instance by establishing a SUV cut-off to discriminate metabolic progressive patients from non-metabolic progressive patients. This patient classification (mP/mNP) seems to be more appropriate to assess response to cytostatic therapy that is designed to stabilize disease rather than achieve complete response. The main difficulty of this approach is the overlap of SUV changes between mP and mNP patients. Furthermore different cut-off variations can be expected depending on the types of SUV measured the types of drugs used and the types of tumors which increase the difficulty of establishing a reliable SUV cut-off. However despite the absence of consensus on the most appropriate cut-off value it is generally admitted that the rationale for metabolic response or non-progression of tumor is decreased [18F]FDG tumor uptake or at least stability of tumor uptake over time respectively. Another limitation of semi-quantitative analysis of FDG-PET is that it does not take into account the development of new lesions. However PET detection of new lesions early in the course of therapy has been reported to be a strong independent predictive factor of OS in NSCLC patients treated by EGFR inhibitor.[27] Our findings are consistent with this observation as new lesions occurred in 2/8 patients correctly classified as progressive on PET2 and in 4/5 patients correctly classified as progressive on PET3. One patient (patient #7) was reclassified as mP on PET3 due to the appearance of a new lesion despite a decrease of SUVmax to below the cut-off value. As in our study previous studies failed to demonstrate any difference between SUVmax and SUVpeak.[22] [28] However SUVmax remains the standard for semi-quantitative [18F]FDG-PET assessment probably because is a parameter that can be reliably reproduced by independent operators. It is noteworthy that in our study no significant difference in mean SUV values was observed between PET1 PET2 and PET3 which can be explained by the nature of the cytostatic therapy. 11/12 patients were correctly classified (P versus NP) by PET2 and 10/10 were correctly classified by PET3 by applying the SUV cut-off determined by ROC analysis. In 9/10 patients PET3 revealed response information concordant with PET2. The only patient with discordant [18F]FDG-PET findings was classified by SUV analysis as progressive on PET2 and non-progressive on PET3. Blood glucose injected dose or uptake time were normal and/or not significantly different between PET2 and PET3 (1.16 and 1.4 g/l; 261 and 262 MBq; 60 and 75 min respectively) excluding any to methodology-related error. A flare-up phenomenon could be proposed as described on several occasions on [18F]FDG-PET during cytotoxic treatments for squamous cell carcinoma in prostate cancer patients with bone metastases[29]“[33] and particularly NSCLC patients treated with erlotinib presenting an osteoblastic bone flare-up response mimicking disease progression.[34] Benz et al also described a case of flare-up on early PET in a NSCLC patient treated by erlotinib.[27] Another explanation is that the P/NP classification probably increases mismatches of response assessments related to a discordant outcome of patients with stable disease.[27] Our results suggest that therapeutic efficacy PFS and OS of erlotinib therapy can be predicted 2 weeks after starting erlotinib. These data are consistent with the data of a retrospective study recently published by Kobe et al.[26] [35] At the present time anticancer therapy is currently monitored in the context of hormone-sensitive cancers by regular assay of tumor markers (such as prostate-specific antigen in prostate cancer). The efficacy of hormonal therapy is reflected by a decrease in blood levels of the marker. When the marker remains elevated hormonal therapy is considered to be ineffective and is therefore stopped. Repeated PET imaging can be considered to be a promising approach to evaluate cancer therapy such as targeted therapies that do not induce tumor shrinkage. This new approach appears to be supported by the results of recent clinical trials. The ˜Tarceva Versus Docetaxel or Pemetrexed for Second Line Chemotherapy of Advanced Stage NSCLC™ (TITAN) trial failed to demonstrate an improvement in OS with erlotinib compared to chemotherapy in unselected NSCLC patients receiving second-line treatment (HR?=?0.96; 95% CI 0.78“1.19; p?=?0.73).[36] In a similar group of NSCLC patients the results of the TAILOR trial indicated a highly significant increase of PFS in favor of docetaxel (HR?=?0.71; 95% CI 0.53“0.95; p?=?0.02) versus erlotinib.[37] We consider that evaluation of the metabolic response to erlotinib could provide useful information to rapidly identify patients in whom erlotinib therapy is ineffective especially in EGFR patients without EGFR-activating mutations or unknown status. [18F]FDG-PET could also become a theranostic tool for clinicians. By stopping ineffective therapy earlier physicians can rapidly propose other drugs to a larger proportion of patients with better performance status. This approach could increase the number of patients included in early trials and accelerate drug development. However no medico-economic study has been conducted to determine whether the additional costs induced by [18F]FDG-PET are compensated by the decreased costs of drug (erlotinib) and medical care induced by side effects. Our study highlights the need for more prospective and randomized studies to evaluate the theranostic use of [18F]FDG-PET for management of erlotinib therapy in NSCLC including medico-economic considerations. Conclusion [18F]FDG-PET performed within two weeks of starting erlotinib therapy (9±3 days) appears to be able to predict morphologic response at 2 months according to RECIST criteria. [18]FDG-PET may be clinically useful for early evaluation of targeted therapies as a theranostic tool. Nathalie BAIZE MD Université d'Angers CHU Angers Pôle des Spécialités Médicales et Chirurgicales Intégrées Département de Pneumologie Angers France References 1 FerlayJ ParkinDM Steliarova-FoucherE (2010) Estimates of cancer incidence and mortality in Europe in 2008. Eur J Cancer46: 765“78120116997 2 JemalA BrayF CenterMM FerlayJ WardE et al (2011) Global cancer statistics. CA Cancer J Clin61: 69“9021296855 3 Chemotherapy in non-small cell lung cancer: a meta-analysis using updated data on individual patients from 52 randomised clinical trials. Non-small Cell Lung Cancer Collaborative Group. BMJ311: 899“909 4 SchillerJH HarringtonD BelaniCP LangerC SandlerA et al (2002) Comparison of four chemotherapy regimens for advanced non-small-cell lung cancer. N Engl J Med346: 92“9811784875 5 LynchTJ BellDW SordellaR GurubhagavatulaS OkimotoRA et al (2004) Activating mutations in the epidermal growth factor receptor underlying responsiveness of non-small-cell lung cancer to gefitinib. N Engl J Med350: 2129“213915118073 6 MokTS WuYL ThongprasertS YangCH ChuDT et al (2009) Gefitinib or carboplatin-paclitaxel in pulmonary adenocarcinoma. N Engl J Med361: 947“95719692680 7 RosellR CarcerenyE GervaisR VergnenegreA MassutiB et al (2012) Erlotinib versus standard chemotherapy as first-line treatment for European patients with advanced EGFR mutation-positive non-small-cell lung cancer (EURTAC): a multicentre open-label randomised phase 3 trial. Lancet Oncol13: 239“24622285168 8 ShepherdFA Rodrigues PereiraJ CiuleanuT TanEH HirshV et al (2005) Erlotinib in previously treated non-small-cell lung cancer. N Engl J Med353: 123“13216014882 9 CappuzzoF CiuleanuT StelmakhL CicenasS SzczesnaA et al (2010) Erlotinib as maintenance treatment in advanced non-small-cell lung cancer: a multicentre randomised placebo-controlled phase 3 study. Lancet Oncol11: 521“52920493771 10 MillerAB HoogstratenB StaquetM WinklerA (1981) Reporting results of cancer treatment. Cancer47: 207“2147459811 11 TherasseP ArbuckSG EisenhauerEA WandersJ KaplanRS et al (2000) New guidelines to evaluate the response to treatment in solid tumors. European Organization for Research and Treatment of Cancer National Cancer Institute of the United States National Cancer Institute of Canada. J Natl Cancer Inst92: 205“21610655437 12 EisenhauerEA TherasseP BogaertsJ SchwartzLH SargentD et al (2009) New response evaluation criteria in solid tumours: revised RECIST guideline (version 1.1). Eur J Cancer45: 228“24719097774 13 FischerBM MortensenJ HojgaardL (2001) Positron emission tomography in the diagnosis and staging of lung cancer: a systematic quantitative review. Lancet Oncol2: 659“66611902536 14 LardinoisD WederW HanyTF KamelEM KoromS et al (2003) Staging of non-small-cell lung cancer with integrated positron-emission tomography and computed tomography. N Engl J Med348: 2500“250712815135 15 VansteenkisteJF StroobantsSG DupontPJ De LeynPR VerbekenEK et al (1999) Prognostic importance of the standardized uptake value on (18)F-fluoro-2-deoxy-glucose-positron emission tomography scan in non-small-cell lung cancer: An analysis of 125 cases. Leuven Lung Cancer Group. J Clin Oncol17: 3201“320610506619 16 BerghmansT DusartM PaesmansM Hossein-FoucherC BuvatI et al (2008) Primary tumor standardized uptake value (SUVmax) measured on fluorodeoxyglucose positron emission tomography (FDG-PET) is of prognostic value for survival in non-small cell lung cancer (NSCLC): a systematic review and meta-analysis (MA) by the European Lung Cancer Working Party for the IASLC Lung Cancer Staging Project. J Thorac Oncol3: 6“1218166834 17 DinanMA CurtisLH CarpenterWR BiddleAK AbernethyAP et al (2012) Stage migration selection bias and survival associated with the adoption of positron emission tomography among medicare beneficiaries with non-small-cell lung cancer 1998-2003. J Clin Oncol30: 2725“273022753917 18 VelazquezER AertsHJ OberijeC De RuysscherD LambinP (2010) Prediction of residual metabolic activity after treatment in NSCLC patients. Acta Oncol49: 1033“103920831492 19 AukemaTS KappersI OlmosRA CodringtonHE van TinterenH et al (2010) Is 18F-FDG PET/CT useful for the early prediction of histopathologic response to neoadjuvant erlotinib in patients with non-small cell lung cancer? J Nucl Med51: 1344“134820720059 20 plannedT SchefflerM NogovaL KobeC Engel-RiedelW et al (2011) Early prediction of nonprogression in advanced non-small-cell lung cancer treated with erlotinib by using [(18)F]fluorodeoxyglucose and [(18)F]fluorothymidine positron emission tomography. J Clin Oncol29: 1701“170821422426 21 SuH BodensteinC DumontRA SeimbilleY DubinettS et al (2006) Monitoring tumor glucose utilization by positron emission tomography for the prediction of treatment response to epidermal growth factor receptor kinase inhibitors. Clin Cancer Res12: 5659“566717020967 22 UllrichRT ZanderT NeumaierB KokerM ShimamuraT et al (2008) Early detection of erlotinib treatment response in NSCLC by 3?-deoxy-3?-[F]-fluoro-L-thymidine ([F]FLT) positron emission tomography (PET). PLoS One3: e390819079597 23 WahlRL JaceneH KasamonY LodgeMA (2009) From RECIST to PERCIST: Evolving Considerations for PET response criteria in solid tumors. J Nucl Med50 Suppl 1122S“150S19403881 24 StroobantsS GoeminneJ SeegersM DimitrijevicS DupontP et al (2003) 18FDG-Positron emission tomography for the early prediction of response in advanced soft tissue sarcoma treated with imatinib mesylate (Glivec). Eur J Cancer39: 2012“202012957455 25 Van den AbbeeleAD (2008) The lessons of GIST“PET and PET/CT: a new paradigm for imaging. Oncologist13 Suppl 28“1318434632 26 MileshkinL HicksRJ HughesBG MitchellPL CharuV et al (2011) Changes in 18F-fluorodeoxyglucose and 18F-fluorodeoxythymidine positron emission tomography imaging in patients with non-small cell lung cancer treated with erlotinib. Clin Cancer Res17: 3304“331521364032 27 BenzMR HerrmannK WalterF GaronEB ReckampKL et al (2011) (18)F-FDG PET/CT for monitoring treatment responses to the epidermal growth factor receptor inhibitor erlotinib. J Nucl Med52: 1684“168922045706 28 KahramanD SchefflerM ZanderT NogovaL LammertsmaAA et al (2011) Quantitative analysis of response to treatment with erlotinib in advanced non-small cell lung cancer using 18F-FDG and 3?-deoxy-3?-18F-fluorothymidine PET. J Nucl Med52: 1871“187722065872 29 BjurbergM HenrikssonE BrunE EkbladL OhlssonT et al (2009) Early changes in 2-deoxy-2-[18F]fluoro-D-glucose metabolism in squamous-cell carcinoma during chemotherapy in vivo and in vitro. Cancer Biother Radiopharm24: 327“33219538055 30 MessiouC CookG ReidAH AttardG DearnaleyD et al (2011) The CT flare response of metastatic bone disease in prostate cancer. Acta Radiol52: 557“56121498309 31 KrupitskayaY EslamyHK NguyenDD KumarA WakeleeHA (2009) Osteoblastic bone flare on F18-FDG PET in non-small cell lung cancer (NSCLC) patients receiving bevacizumab in addition to standard chemotherapy. J Thorac Oncol4: 429“43119247091 32 BiersackHJ BenderH PalmedoH (2004) FDG-PET in monitoring therapy of breast cancer. Eur J Nucl Med Mol Imaging31 Suppl 1S112“11715112111 33 MortimerJE DehdashtiF SiegelBA TrinkausK KatzenellenbogenJA et al (2001) Metabolic flare: indicator of hormone responsiveness in advanced breast cancer. J Clin Oncol19: 2797“280311387350 34 LindJS PostmusPE SmitEF (2010) Osteoblastic bone lesions developing during treatment with erlotinib indicate major response in patients with non-small cell lung cancer: a brief report. J Thorac Oncol5: 554“55720357621 35 KobeC SchefflerM HolsteinA ZanderT NogovaL et al (2012) Predictive value of early and late residual 18F-fluorodeoxyglucose and 18F-fluorothymidine uptake using different SUV measurements in patients with non-small-cell lung cancer treated with erlotinib. Eur J Nucl Med Mol Imaging39: 1117“112722526960 36 CiuleanuT StelmakhL CicenasS MiliauskasS GrigorescuAC et al (2012) Efficacy and safety of erlotinib versus chemotherapy in second-line treatment of patients with advanced non-small-cell lung cancer with poor prognosis (TITAN): a randomised multicentre open-label phase 3 study. Lancet Oncol13: 300“30822277837 37 GarassinoMC MartelliO BrogginiM FarinaG VeroneseS et al (2013) Erlotinib versus docetaxel as second-line treatment of patients with advanced non-small-cell lung cancer and wild-type EGFR tumours (TAILOR): a randomised controlled trial. Lancet Oncol14: 981“98823883922 Nucleic Acids Res Nucleic Acids Res nar nar Nucleic Acids Research 0305-1048 1362-4962 Oxford University Press 24970867 4117748 10.1093/nar/gku489 15 Methods Online Integrated RNA and DNA sequencing improves mutation detection in low purity tumors Wilkerson Matthew D. 1 2 * Cabanski Christopher R. 1 3 Sun Wei 2 4 Hoadley Katherine A. 1 2 Walter Vonn 1 Mose Lisle E. 1 Troester Melissa A. 1 5 Hammerman Peter S. 6 7 Parker Joel S. 1 2 Perou Charles M. 1 2 Hayes D. Neil 1 8 * 1Lineberger Comprehensive Cancer Center University of North Carolina at Chapel Hill Chapel Hill NC 27599 USA 2Department of Genetics University of North Carolina at Chapel Hill Chapel Hill NC 27599 USA 3The Genome Institute at Washington University St. Louis MO 63108 USA 4Department of Biostatistics University of North Carolina at Chapel Hill Chapel Hill NC 27599 USA 5Department of Epidemiology University of North Carolina at Chapel Hill Chapel Hill NC 27599 USA 6Department of Medical Oncology Dana-Farber Cancer Institute Boston MA 02215 USA 7Broad Institute of Harvard and MIT Cambridge MA 02142 USA 8Department of Internal Medicine Division of Medical Oncology Multidisciplinary Thoracic Oncology Program University of North Carolina at Chapel Hill Chapel Hill NC 27599 USA *To whom correspondence should be addressed. Tel: +1 919 966 3098; Fax: +1 919 966 1587; Email: mwilkers@med.unc.edu Correspondence may also be addressed to D. Neil Hayes. Tel: +1 919 966 3786; Fax: +1 919 966 1587; Email: hayes@med.unc.edu 01 9 2014 26 6 2014 26 6 2014 42 13 e107 e107 15 5 2014 22 4 2014 14 10 2013 © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research. 2014 This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/3.0/) which permits unrestricted reuse distribution and reproduction in any medium provided the original work is properly cited. Identifying somatic mutations is critical for cancer genome characterization and for prioritizing patient treatment. DNA whole exome sequencing (DNA-WES) is currently the most popular technology; however this yields low sensitivity in low purity tumors. RNA sequencing (RNA-seq) covers the expressed exome with depth proportional to expression. We hypothesized that integrating DNA-WES and RNA-seq would enable superior mutation detection versus DNA-WES alone. We developed a first-of-its-kind method called UNCeqR that detects somatic mutations by integrating patient-matched RNA-seq and DNA-WES. In simulation the integrated DNA and RNA model outperformed the DNA-WES only model. Validation by patient-matched whole genome sequencing demonstrated superior performance of the integrated model over DNA-WES only models including a published method and published mutation profiles. Genome-wide mutational analysis of breast and lung cancer cohorts (n = 871) revealed remarkable tumor genomics properties. Low purity tumors experienced the largest gains in mutation detection by integrating RNA-seq and DNA-WES. RNA provided greater mutation signal than DNA in expressed mutations. Compared to earlier studies on this cohort UNCeqR increased mutation rates of driver and therapeutically targeted genes (e.g. PIK3CA ERBB2 and FGFR2). In summary integrating RNA-seq with DNA-WES increases mutation detection performance especially for low purity tumors. cover-date 2014 INTRODUCTION Somatically acquired sequence mutations (nucleotide substitutions insertions and deletions) fuel the initiation and progression of cancer (1). Knowledge of mutations in patient specimens informs therapeutic management (23) and in large patient cohorts provides the basis to assess recurrently altered genes that may drive molecular pathogenesis (14“5). DNA whole exome sequencing (DNA-WES) is currently the popular technology to sequence cancer genomes and has led to an abundance of discoveries in many cancer types (46“8). However detecting somatic mutations by DNA-WES with high sensitivity and specificity remains a challenge (79“10) as evidenced by validation rates of 73% in repeated sequencing and by large inter-rater disagreement among different groups analyzing the same sequencing data (710). The biggest challenge is high quality mutation detection in low purity tumors "

Lung_Cancer

"Urology 1471-2490 BioMed Central 24612599 3975282 1471-2490-14-26 10.1186/1471-2490-14-26 Research an-specific and tumor-size-dependent responses to sunitinib in clear cell renal cell carcinoma Tsuchiya Norihiko 1 tsuchiyamed.akita-u.ac.jp Yuasa Takeshi 2 takeshi.yuasajfcr.or.jp Maita Shinya 1 yamightyyahoo.co.jp Narita Shintaro 1 narishindoc.med.akita-u.ac.jp Inoue Takamitsu 1 takamitudoc.med.akita-u.ac.jp Numakura Kazuyuki 1 numakuradoc.med.akita-u.ac.jp Saito Mitsuru 1 mitsaitomed.akita-u.ac.jp Satoh Shigeru 1 shigerusdoc.med.akita-u.ac.jp Yonese Junji 2 jyonesejfcr.or.jp Habuchi Tomonori 1 thabuchidoc.med.akita-u.ac.jp 1Department of Urology Akita University Graduate School of Medicine Akita Japan 2Department of Urology Cancer Institute Hospital Japanese Foundation for Cancer Research Tokyo Japan 2014 11 3 2014 14 26 26 20 7 2013 28 2 2014 Copyright 2014 Tsuchiya et al.; licensee BioMed Central Ltd. 2014 Tsuchiya et al.; licensee BioMed Central Ltd. This is an Open Access distributed under the terms of the Creative Commons Attribution License (http://creativecommons./licenses/by/2.0) which permits unrestricted use distribution and reproduction in any medium provided the original work is properly credited. Background Tyrosine kinase inhibitors (TKIs) have been used as standard therapy for patients with advanced renal cell carcinoma (RCC). However information on factors predicting response to treatment with TKIs is lacking. This study aimed to assess the association between initial tumor size involved ans pre-treatment C-reactive protein (CRP) levels and reduction in tumor size in patients with clear cell RCC (CCRCC) treated with sunitinib. Methods Patients with advanced CCRCC with target lesions with a maximum diameter???10 mm treated with sunitinib were evaluated. The tumor diameter representing the best overall response was designated as the post-treatment tumor diameter. Results A total of 179 lesions in 38 patients were analyzed. an-specific analysis demonstrated that pre-treatment diameter of lung metastatic lesions had a moderate inverse association with percent reduction in post-treatment tumor diameter (R?=?0.341). Lung lesions showed significantly greater percent reductions in diameter than liver and kidney lesions (P?=?0.007 and 0.002 respectively). Furthermore based on a CRP cut-off level of 2.0 mg/dl mean tumor size reduction was significantly greater in patients with low CRP levels than in patients with high CRP levels in lesions with diameters?<?20 mm (P?=?0.002). CRP level had no effect on mean size reduction in lesions with a diameter???20 mm. Conclusions Patients with CCRCC with smaller lung metastatic lesions and lower CRP levels may achieve greater percent reductions in tumor size with sunitinib therapy than patients with extra-pulmonary lesions large lung lesions and/or higher CRP levels. Advanced renal cell carcinoma Sunitinib Tumor size Tumor response C-reactive protein Background In the era of cytokine therapy tumor response to treatment in advanced or metastatic renal cell carcinoma (RCC) has been reported to vary according to the ans involved [12]. Longer overall survival and a higher response rate to therapy with interferon-? or a combination of interleukin-2 and interferon-? were observed in patients with only lung metastasis compared with those with extra-pulmonary metastasis [12]. Complete remission (CR) after treatment with tyrosine kinase inhibitors (TKIs) which mainly target vascular endothelial growth factor receptors remains a rare event but most patients who do achieve CR have either lung metastasis alone or only lymph node involvement [34]. However most cancer clinical trials evaluate tumor response using the response evaluation criteria in solid tumors (RECIST) in which the longest diameters of target lesions in multiple ans are summed. Tumor response in individual metastatic lesions in specific ans has not been delineated. A reduction in tumor size >10% calculated as the sum of the longest diameter of the target lesions was significantly associated with both time to treatment failure and overall survival suggesting that size reduction of target lesions may predict the outcome of treatment with TKIs [5]. In addition Yuasa et al. recently demonstrated that a smaller initial tumor size predicted a good response to TKIs and that the maximum response was achieved in lung lesions [6]. TKIs have shown significant clinical benefit in advanced clear cell RCC (CCRCC) in large randomized trials [7-9]. However the reported objective responses vary according to the different types of TKIs and a recent phase II trial failed to demonstrate any clinical efficacy of sunitinib in non-CCRCC [10]. Tumor size reduction may thus be affected by many factors including initial tumor size involved ans tumor histology tumor aggressiveness or type of TKI used. In this study we evaluated the association between initial tumor size of individual lesions in specific ans and reduction in tumor size in patients with CCRCC treated with sunitinib. Methods Patients and tumor measurement A total of 38 patients with advanced CCRCC who received at least two cycles of sunitinib at Akita University Hospital and at the Cancer Institute Hospital of the Japanese Foundation for Cancer Research were enrolled in this institutional review-board-approved retrospective study. Pathological diagnosis was made by radical nephrectomy in 30 patients and by percutaneous biopsy in eight patients who were not indicated for surgical treatment because of a significantly higher total volume of metastatic lesions compared with the primary lesion. The initial dose of sunitinib was 50 mg/day which was reduced to 37.5 mg/day based on the patient™s physique age and performance status. Sunitinib was initiated on a 28 days on/14 days off schedule and a dose reduction to 25 mg/day or complete cessation was considered in the event of grade 3 or higher toxicity according to the Common Terminology Criteria for Adverse Events (CTC-AE). All lesions were evaluated using a multidetector computed tomography scanner and lesions???10 mm in diameter were considered target lesions. The maximum diameter of each target lesion was measured before treatment with sunitinib (pre-treatment tumor diameter) and every 2“3 months thereafter. The tumor diameter at the point when best overall response was achieved based on the RECIST version 1.0 was adopted as the post-treatment tumor diameter. In this study the most common metastatic ans including lung liver and lymph nodes as well as the kidney were subjected to analysis. Statistical analysis The association between pre-treatment tumor diameter and percent change between pre- and post-treatment tumor diameters for each lesion was assessed by Pearson™s correlation coefficient. The Kruskal Wallis test was used to compare differences in percent change in tumor diameter between the four different ans. The Mann“Whitney U test was used to compare differences between two groups. A receiver-operator curve (ROC) was constructed to find the pre-treatment tumor diameter predicting tumor response to sunitinib treatment. A value of P?<?0.05 was considered statistically significant. Results Patients and target lesions The patients included 30 men and eight women with a median age of 62 years (range 27“81 years). The patients™ characteristics are listed in . The best response to sunitinib treatment was CR in one patient (3%) partial response (PR) in 11 (29%) stable disease (SD) in 23 (61%) and progressive disease (PD) in three (8%). The objective response rate was 32% and the clinical benefit rate (CR?+?PR?+?SD for at least 3 months) was 92%. A total of 179 lesions ranging from 10 to 106 mm were measured and analyzed in 38 patients. These lesions were localized as follows: 124 in the lung 12 in the liver 24 in the lymph nodes and 19 in the kidney. Of the 15 patients with kidney tumors seven who underwent nephrectomy had target lesions in the contralateral kidney including two patients with multiple lesions. The remaining eight patients had primary kidney tumors that were diagnosed by percutaneous needle biopsy. Patients™ characteristics Characteristic No. of patients (%) Sex ??Male 30 (78.9) ??Female 8 (21.1) Age y ??Median [range] 62 [27“81] ECOG performance status ??0 25 (65.8) ??1 7 (18.4) ??> 1 6 (15.8) MSKCC risk category ??Favorable 8 (21.1) ??Intermediate 20 (52.6) ??Poor 10 (26.3) Target ans ??Lung 31 (81.6) ??Liver 6 (15.8) ??Lymph node 11 (28.9) ??Kidney 15 (39.5) Nephrectomy ??Yes 30 (78.9) ??No (biopsy) 8 (21.1) Prior treatments ??None 27 (71.1) ??Cytokines alone 4 (10.5) ??Sorafenib?±?cytokines 7 (18.4) Associations between pre-treatment tumor diameter and percent change in target lesion size in different ans The associations between pre-treatment tumor diameter and percent change in size of each target lesion in each of four ans were analyzed separately. an-specific analysis demonstrated that pre-treatment diameter of lung metastatic lesions had a moderately positive association with percent change in post-treatment tumor diameter (R?=?0.341 Figure 1). There were fewer target lesions in the other three ans than in the lung and there was no association between liver lymph node or kidney lesion size and percent change in post-treatment tumor diameter (Figure 1). The percent changes in target lesion size differed significantly between the four individual ans (P?=?0.0007 by the Kruskal Wallis test). The mean (± SD) percent changes in target lesion size in the lung liver lymph nodes and kidney were ?27.1?±?33.5 0.5?±?29.4 ?16.7?±?19.6 and ?2.7?±?21.7 respectively. Target lesions in the lung showed the greatest change in size which was significantly greater than in the liver and kidney (P?=?0.007 and 0.002 respectively). There was no difference in the percent change in target lesion size between the lung and lymph nodes (P?=?0.114) (Figure 2). Figure 1 Association between pre-treatment tumor size and percent change in lesion size after sunitinib treatment. Association between pre-treatment tumor size and percent change in size was analyzed for lesions in the lung (a) liver (b) lymph nodes (c) and kidney (d). The pre-treatment size of lung lesions showed a moderately positive association with percent size change after treatment with sunitinib while no association was observed in the liver lymph nodes and kidney. Figure 2 Percent change in target lesion size in different ans. The reduction in lesion size was significantly greater in lung lesions compared with liver and kidney lesions. Lung lesions with an initial diameter?<?17.3 mm (median) showed a significant percent reduction in size compared with lesions???17.3 mm. No significant differences in relation to initial lesion size were observed in the liver lymph nodes and kidney. Lesions in each an were divided into two groups according to the median pre-treatment diameter and percent changes in tumor diameter were compared between the two groups. Lung lesions with a pre-treatment diameter less than the median value of 17.3 mm showed a significant percent reduction in diameter compared with tumors???17.3 mm (P?=?0.002). There were no differences in the percent change in relation to size above or below the median value in other ans (Figure 2). Cut-off value for pre-treatment tumor diameter predicting response to sunitinib in lung metastasis ROC curves were drawn to determine cut-off values predicting 30% and 50% reductions in the diameter of lung metastatic lesions (Figure 3). The cut-off predicting a 30% reduction in diameter was 16.5 mm with a sensitivity of 69.6% specificity of 58.2% and an area under the curve (AUC) of 0.662. The cut-off predicting a 50% reduction in diameter was also 16.5 mm with a sensitivity of 67.0% specificity of 77.8% and an AUC of 0.752. Using this cut-off value the percent change in lesion size for lesions?<?16.5 mm was ?41.7?±?35.5% while that for lesions???16.5 mm was ?16.2?±?26.9% (P?=?0.0005). Figure 3 Cut-off values of initial lung tumor size for predicting 30% and 50% reductions in diameter after sunitinib treatment. Based on ROC analysis the cut-off values of initial lung lesion size for predicting reductions in diameter of both 30% and 50% were 16.5 mm. Influence of pre-treatment CRP value cytoreductive nephrectomy and treatment line on percent change in target lesion size in the lung Metastatic lung lesions were categorized into two groups based on pre-treatment C-reactive protein (CRP) levels. The mean diameter and percent change in lesion size in patients with CRP?<?2.0 mg/ml were 19.0?±?9.3 mm and ?38.3?±?30.5% respectively while those in patients with CRP???2.0 mg/ml were 28.3?±?20.6 mm and ?9.6?±?33.9% respectively. The lesions were further divided into three subgroups according to pre-treatment diameter?<?20 mm ? 20 to?<?40 mm and???40 mm. Percent changes were compared between lesions in patients with CRP?<?2.0 mg/dl (low CRP) and those with CRP???2.0 mg/dl (high CRP) in each subgroup. For lesions?<?20 mm patients with low CRP had significantly greater reductions in tumor diameter than patients with high CRP (?43.8?±?33.4% vs. ?15.3?±?37.7% P?=?0.0019). In patients with lesions ?20 to?<?40 mm there was a tendency towards a greater reduction in patients with low CRP compared with high CRP though the difference was not significant (?29.0?±?17.3% vs. ?12.4?±?30.2% P?=?0.054) and similarly there was no significant association between tumor reduction and CRP level in patients with lesions???40 mm (?13.3?±?20.6 vs. 6.8?±?17.4 P?=?0.151) (Figure 4). Figure 4 Influence of CRP on percent change in lung lesion size. In patients with lung lesions?<?20 mm the percent reduction in size was significantly greater in patients with low compared with high CRP levels. Meanwhile CRP level had a marginal effect on size reduction in lesions???20 to?<?40 mm and no effect in lesions???40 mm. Percent changes in size were compared between lung lesions in patients in each diameter subgroup who did and did not undergo cytoreductive nephrectomy. There were no lung lesions???40 mm in patients who did not undergo cytoreductive nephrectomy. There was no significant difference between mean percent change in lesion size in patients with and without cytoreductive nephrectomy (?36.1?±?32.6 vs. ?28.2?±?41.9 P?=?0.421 and ?20.4?±?25.1 vs. ?32.0?±?21.9 P?=?0.307 in lesions?<?20 mm and???20 mm respectively). Similarly there was no significant difference in percent change in lesion size between lung lesions in patients treated as first-line therapy and those treated as second-line or later therapy in any diameter subgroup (?38.1?±?37.7 vs. ?32.1?±?33.9 P?=?0.280; ?23.5?±?21.6 vs. ?17.5?±?23.3 P?=?0.803; and 3.5?±?2.6 vs. 1.9?±?22.9 P?>?0.9 in lesions?<?20 mm ? 20 to?<?40 mm and???40 mm respectively)."

Lung_Cancer

"Regression analysis was performed to test the association of gene expression with methylation levels in the CHRNA5 gene and with methylation levels in PABPC4 STARD3 and SLC35A3 genes. We tested the association between lung cancer GWAS risk SNPs and gene expression using regression analysis under an additive model adjusting for age sex and PCA scores based on genome-wide SNPs. Testing for enrichment of cis-meQTLs in lung cancer GWAS We tested for enrichment in NCI lung cancer GWAS of European ancestry which included three main histologic subtypes of lung cancer (adenocarcinoma (AD) squamous cell carcinoma (SQ) small cell carcinoma (SC)) and a small number of other lung cancer subtypes. We investigated whether the identified cis-meQTL SNPs were collectively associated with lung cancer risk which was tested by examining whether the GWAS P-values for these SNPs deviated from the uniform distribution (i.e. no enrichment). Because the high linkage disequilibrium (LD) in SNPs increased variability of the enrichment statistic and caused a loss of power we first performed LD-pruning using PLINK so that no pair of remaining SNPs had a r2 ?0.8. The enrichment significance was evaluated by 10000 random permutations. The genomic control ?-values61 based on genome-wide SNPs were 1.010.995 0.977 and 1.00 for overall lung cancer AD SC and SQ respectively. Thus the type-I error rates of our enrichment tests were not inflated. The detailed procedure for testing a set of cis-meQTL SNPs is described as follows: Firstly we performed LD-pruning using PLINK so that no pair of remaining SNPs had an r2 ?0.8. Secondly we tested the association for the LD-pruned SNPs (assuming K SNPs left) in a GWAS and computed the P-values (p1?pK). We then tested whether (p1?pK) followed a uniform distribution i.e. no enrichment. Thirdly we transformed P-values into ?12 quantitles qk = F?1(1 ? pk) with F(·) being the cumulative distribution function (CDF) of ?12. We defined a statistic for testing enrichment as Q=?k=1Klog(1?f+fexp(qk/2))3562 where f is a pre-specified constant reflecting the expected proportion of SNPs associated with the disease. Because only a small proportion of SNPs may be associated with the disease we set f=0.05 for this paper. The statistical power was insensitive to the choice of f in the range of [0.01 0.1]62. Finally the significance of the test Q was evaluated by 10000 random permutations. meQTL mediation analysis We investigated whether trans associations were mediated by the methylation levels of CpG probes nearby the trans-acting SNPs. Note that this analysis was only for trans associations with cis effects i.e. the SNP was associated with at least one proximal CpG probes with p<4—10?5. See Fig. 2c. Suppose a SNP G cis-regulates K proximal (<500kb) CpG sites A1?AK with P<4—10?5 and trans-regulates a distal CpG site B. We performed a linear regression: B~?+?G +?kAk. We also computed marginal correlation coefficient cor(GB) and partial correlation coefficient cor(GB|Ak) using an R package œppcor63. A full mediation was detected if G and B were not significantly correlated after conditioning on Ak or equivalently G was not significant (p>0.01) in regression analysis B~?+?G +?kAk for any k. A partial mediation was detected if any Ak had a P<0.05/K (Bonferroni correction) in the regression analysis and |cor(GB)|?| cor(GB|A) |>0.1. An independent effect model (i.e. no mediation) was detected otherwise. Testing enrichment of meQTL SNPs in regulatory regions We obtained peak data for CTCF DNaseI H3K27me3 H3K4me3 and H3K36me of small airway epithelial cells (SAEC) from the ENCODE project and for H3K27me3 H3K4me3 and H3K9-14Ac from human alveolar epithelial cells (hAEC) from our own laboratory. A SNP is determined to be functionally related to a given mark or CTCF binding site if the SNP or any of its LD SNPs (r2 ?0.8 with LD computed using the genotype data of European population in The 1000 Genome Project) resided in any of the mark regions or CTCF binding sites. We explain our enrichment testing using CTCF as an example. We classified genome-wide SNPs into four categories: SNPs not associated with CpG probes in trans or cis (defined as control SNP set) SNPs only associated with proximal CpG probes via cis-regulation (cis-only21119 SNPs) SNPs only associated with distal CpG probes via trans-regulation (trans-only 192 SNPs) and SNPs detected with both trans and cis effects (cis+trans 277 SNPs). For SNPs in the category of cis-only trans-only and cis+trans we computed the proportion of SNPs functionally related to CTCF. To compute the enrichment of cis-meQTLs in CTCF binding sites we defined a control set of SNPs that are not associated with CpG probes via cis- or trans regulation. The selection of the control set was further complicated by the following two observations. (1) cis-meQTL SNPs tended to be more common (data now shown). (2) The probability of a SNP detected as a cis-meQTL SNP positively depended on the density of the CpG probes in the nearby region. Choosing a control set while ignoring these two factors could underestimate the proportion of functionally related SNPs in the control set and thus overestimate the enrichment for cis-meQTLs. Therefore we created 1000 sets of control SNPs with CpG probe density (measured as the number of CpG probes in the cis region of each SNP) and MAF matched with the meQTL SNP set and then averaged the proportions on the 1000 sets. The enrichment was calculated as the fold change with the proportion in the control SNP set as baseline. Next we investigated whether the enrichment was stronger for SNPs more significantly associated with CpG sites. Because we detected only a few hundred trans-meQTLs we focused this analysis on the set of cis-meQTLs. We classified cis-meQTL SNPs into five categories according to the cis-association P-values: P >10?7 (the weakest) 10?10< P ?10?7 10?15 < P ? 10?10 10?20 < P ? 10?15 and P ? 10?20 (the strongest). For each category we computed the proportion of SNPs functionally related to CTCF binding sites. meQTL SNPs affect CTCF binding We found that meQTL SNPs are strongly enriched in CTCF consensus sequences. We used SAEC data from ENCODE to test whether meQTL heterozygous SNPs directly affect CTCF binding by disrupting the CTCF recognition sites. P-values were calculated based on a binomial distribution Binom(N 0.5). Here N is the total number reads covering the SNPs. Raw sequencing data (.fasstq format) from SAEC cells were generated at the University of Washington as part of the ENCODE project and downloaded from the UCSC genome browser. Raw data was aligned to the hg19 genome using CLC genomics workbench (v 5.5.1) parsing out data with less than 80% contiguous alignment to the genome and duplicate reads in excess of 10 copies. We used the CTCFBSDB 2.0 program64 to predict whether the meQTL SNPs or their LD SNPs (r2 ? 0.8) were within CTCF peaks and then examined in SAEC whether CTCF exhibited allele-specific binding. Because common SNPs are more likely to be heterozygous we only looked for SNPs with MAF ?0.4. Here we present two such examples. Systematic investigation of all meQTL SNPs that are heterozygous in SAEC is warranted once more samples with genotypic data are available. Supplementary Material 1 Acknowledgements This study utilized the high-performance computational capabilities of the Biowulf Linux cluster at the NIH Bethesda MD (http://biowulf.nih.gov). We are grateful to the EAGLE participants and the large number of EAGLE collaborators (listed in http://dceg.cancer.gov/eagle) The Cancer Genome Atlas project for the genotype and methylation data and the ENCODE project for the regulatory region data. This work was supported by the Intramural Research Program of NIH NCI Division of Cancer Epidemiology and Genetics and in part by the Norris Comprehensive Cancer Center core grant (P30CA014089) from NCI the Trandisciplinary Research in Cancer of the Lung (TRICL) and the Genetic Associations and Mechanisms in Oncology (GAME-ON) Network (U19CA148127). AW ZW WZ and AH were also funded by the NCI NIH (HSN261200800001E). IALO and ZB were also funded by NIH grants (1 R01 HL114094 1 P30 H101258 and R37HL062569-13) Whittier Foundation and Hastings Foundation. ZB was also funded by the Ralph Edgington Chair in Medicine. CNM was funded by ACS/Canary postdoctoral fellowship (FTED-10-207-01-SIED). Author contributions M.T.L conceived the study. I.A.L.O. supervised DNA methylome analysis. J.S. performed EAGLE TCGA and ENCODE genetic analyses. C.M. performed allele-specific binding analyses. J.D. contributed to genetic analyses and performed GO analyses. J.S. P.L. I.A.L.O. and M.T.L. performed quality control analyses. A.C.P D.C. P.A.B A.W.B N.E.C. and M.T.L. conducted the EAGLE study and provided tissue samples. AW and AH prepared the tissue samples for the analyses. BZ and ZB isolated and cultured alveolar epithelial cells. T.T. and K.D.S. performed methylation normalization. Z.W. and W.W. performed LD analyses. J.S. C.M. J.D. P.L.H. M.C. D.S.L J.H. P-H.C B.S.I.C.W.Z. L.A. M.F. B.P.B. N.C M.A.T. S.J. C. I.A.L.O. M.T.L. contributed to the data interpretation. J.S. and M.T.L. wrote the manuscript. All authors participated in the discussion and reviewed the manuscript. Supplementary Information accompanies this paper at tttp://www.nature.com/Naturecommunications. "

Lung_Cancer

"The Ventana assay using the D5F3 antibody gave the most intense cytoplasmic signal but this was accompanied by higher background staining which was especially noticeable in macrophages. The ALK1 and 5A4 antibody assays produced weaker staining but with less background. Of the two 5A4 had marginally more background staining especially in macrophages. The value of both intensity and proportion scores was assessed. Cutoffs for positivity were set using ROC analysis to optimize correct classification of ALK status using FISH results as the standard (). The intensity score alone was seen to outperform both proportion and the aggregate score. Therefore intensity scoring using the optimized cutoff was used in subsequent analyses. TABLE 3. Optimised Cutoff Values for Immunohistochemical Tests Concordance between FISH and IHC is shown in . No cases with negative FISH results and positive IHC were identified (100% specificity of IHC in these data). Sensitivity was the same (83%) for all three assays in excision specimens. In small biopsies and cytological specimens however the D5F3 antibody was the most sensitive. The ALK1 and 5A4 assays failed to identify a further one or two FISH-positive cases respectively. All three assays failed to stain the same two cases which contain rearranged ALK genes detectable by FISH. TABLE 4. Concordance of Immunohistochemistry (IHC) and Fluorescence In Situ Hybridization (FISH) Assays Response to Therapy Seven cases with ALK rearrangements detected by FISH went on to receive crizotinib therapy. All but one showed at least a partial response. This crizotinib-refractory case showed no detectable ALK expression by all three IHC assays. DISCUSSION We have compared three different antibody assays for the ALK kinase domain to the current standard FISH assay in a set of archival tumors including 15 FISH-positive cases. We found all three assays to be specific (100%) and sensitive (up to 86%) especially when a signal amplification technique is employed. Furthermore data on response to crizotinib therapy in seven treated cases showed all but one case responded. The case that failed to respond to therapy was negative by all three IHC assays. Of the three antibody methods compared the D5F3 antibody using a Ventana proprietary assay performed the best especially in scanty samples which is likely to be a consequence of the tyramide signal amplification step incorporated into the Ventana assay. It is possible that the other two antibodies would perform as well if a suitable signal amplification step were introduced. However an assay using the 5A4 without tyramide amplification has been successfully applied by To et al in a recent comparable assessment of IHC as a test for ALK rearrangement.5 In a set of 373 tumors that included 20 ALK rearrangements as detected by FISH their IHC assay was 99% specific and 100% sensitive. In contrast to this we find 100% specificity and (at best) 86% sensitivity; that is to say we identified rare FISH-positive IHC-negative cases whereas To et al found occasional FISH-negative IHC-positive cases which were proved to harbor EML4-ALK rearrangements by reverse transcription polymerase chain reaction (RT-PCR).5 It is unsurprising that we do not identify FISH-negative IHC-positive cases as we only examined 17 FISH-negative or indeterminate cases in comparison to the 356 examined by To et al.5 It is more notable that To et al.5 do not identify FISH-positive IHC-negative cases. This might be explained by their use of tissue microarrays for FISH which is even more technically demanding and hard to interpret than FISH using whole sections. This possible shortcoming of tissue microarray methods might be apparent in two other recent studies using tissue microarrays for a comparison of FISH with ALK1 5A4 and D5F3 antibodies.1314 Selinger et al.13 describe 100% sensitivity for all three antibody assays. Conklin et al.14 also find 100% sensitivity and a maximum specificity of 88% (again using the 5A4 antibody). Again it may be that in both these additional studies the approach used hampered the identification of FISH-positive IHC-negative cases because of the difficulty of applying FISH to TMAs especially when the primary test has been IHC and the FISH test is not œblind to the IHC result. Other recent studies compare various immunohistochemical assays and FISH for the detection of ALK rearrangements.1516 As in this study Sholl et al.15 identify occasional FISH-positive IHC-negative cases. They explain two cases by identifying co-existent mutations in other driving oncogenes (presumably thereby relieving the tumor œaddiction to ALK) and one by insufficient tumor material for accurate IHC assessment. Savic et al.16 compared an immunocytochemical assay using the 5A4 antibody to FISH in cytological specimens and achieved a sensitivity of 93% and specificity of 96% which is comparable with our findings in cytological and small biopsy cases (sensitivity 88% specificity 100%). In the current study we detected two œfalse-negative cases which were positive by FISH and negative by all three IHC assays. This combination has two possible explanations. Firstly they might represent tumors which are not expressing ALK protein at detectable levels because of a false-positive FISH result or an absence of addiction to rearranged ALK protein despite presence of recombined ALK DNA. These tumors are unlikely to respond to crizotinib. Secondly they might represent a failure of the IHC assay because of poor preservation of antigen insufficient material or another technical error. In this case crizotinib therapy would still be likely to be effective. The study includes seven cases with positive FISH results with data on response to crizotinib. Six showed at least a partial response to crizotinib therapy as assessed by Response Evaluation Criteria in Solid Tumors criteria. A single case showed no response and this was one of the two œfalse negatives. Thus in this one case the IHC test would have correctly predicted response. This was a scanty cytological specimen in which FISH interpretation was difficult and only 20% of 515 cells showed rearranged ALK signals (fusion plus split red/green probes and fusion plus isolated red signal). Therefore it seems possible that this represents a technical failure of the FISH assay. The other case an excision specimen showed 39% of 626 cells with rearranged signals. It was also shown to harbor a driving mutation in a second gene; PCR testing demonstrated the loss of exon 19 of endothelial growth factor receptor. This has been described in another study that characterized two such œfalse-negative cases.15 Thus these tumors may well escape œoncogene addiction to the ALK kinase activity which would be consistent with indetectable ALK protein expression. Again IHC would be expected to be the best predictor of response to tyrosine kinase inhibitor therapy in such cases. It is essential to identify and molecularly characterize other œfalse-negative cases that have received crizotinib therapy. In addition it seems likely that IHC should guide treatments in œfalse-positive cases that express high levels of ALK from genetic lesions that are invisible to the current FISH assay. Although we identified no œfalse positives i.e. FISH-negative IHC-positive cases our sensitivity may be an overestimate (as judged by FISH) because of the small number of FISH-negative cases under study. Several studies have identified rare cases with rearrangements that are indetectable by FISH but detectable by IHC and confirmed by reverse-transcriptase PCR.5910 Such cases would be expected to respond to crizotinib and a recent study shows that at least one novel œFISH-indetectable rearrangement does indeed drive the malignant phenotype.5"

Lung_Cancer

"The proposed method is suitable to adopt single-layer omics data and expendable to interpret a patient in the context of many published or user-defined pathway gene sets. PARADIGM has less freedom in terms of data and gene sets as it prefers multi-layered omics data and requires predefined functional structure among omics objects. Unlike PDS which extracts the principal curve from entire cohort data our method does not assume an individual sample belongs to a cohort. We introduce using accumulated normal tissue data as a reference. This is a simple and biologically intuitive guideline in such a case to interpret a single sample that lack cohort data.Our method provides a series of analysis steps which consists of four parts: data processing gene-level statistics individualized pathway aberrance score (iPAS) and a significance test. To discover the most feasible method for iPAS we extend existing pathway analysis techniques namely ORA and FCS to properly reflect the nature of testing one cancer to many normal samples.To demonstrate that iPAS captures biologically and clinically relevant information in a sensible valid and useful manner we apply it to samples of lung and colon adenocarcinoma. We show that our representation generates clinically relevant stratifications and outcome predictors which would not have been achieved when the same data are analyzed by the conventional method that does not use accumulated normal data.Our empirical study suggests two different strategies depending on the biological question that iPAS is focused on. In the case of cancer diagnosis a method that uses the inter-gene correlation structure of the accumulated normal samples performs best. In the case of cancer prognosis a simple averaging of all member genes™ standardized gene expression values performs best.2 METHODS AND MATERIALS2.1 Gene expression dataWe built nRef by the manual curation of data obtained from NCBI GEO (Barrett et al. 2012). Microarray data of adjacent normal tissues obtained from patients undergoing surgery were selected to serve as the nRef. Data from biopsied samples primary cultures of normal tissues and post-mortem donors were not included in the nRef. We collected 120 nRef for lung 60 from GSE19804 (Lu et al. 2011) 27 from GSE7670 (Su et al. 2007) and 33 from GSE10072 (Landi et al. 2008). Samples came from individuals with variable smoking histories and different ethnic backgrounds. We collected 101 nRef™ for colon concentrating on normal mucosa tissue samples from six datasets available at GEO. To evaluate the effectiveness of our method in survival analysis we used Beer™s data of 442 lung adenocarcinomas (LUADs) (Beer et al. 2002) to discover survival-related pathways and validated the associations of 61 LUAD samples of GSE8894 (Lee et al. 2008). The pathway based identification of LUAD were tested on 120 cancers and 120 normal samples of GSE19804 GSE7670 and GSE10071. Further validation was conducted with 48 cancers and 35 normal samples collected from GSE19188 (Hou et al. 2010) and GSE31547. For patient stratification by colon cancer differentiation status we used 566 microarrays of GSE39582 (Marisa et al. 2013) which provided in a separate manner 443 for discovery 123 for validation. GSE17536 (Smith et al. 2010) was also used for validation.2.2 Pathway dataInformation from gene sets representing biological pathways were obtained from REACTOME (Croft et al. 2011) which are also provided in the Molecular Signature Database (Subramanian et al. 2005). Pathways with small number of genes are more easily understood by human experts. We decided to filter out pathways of which gene set size is >97. The cutoff covers at least 80% of contents of each public pathway resources. Of 674 pathways in REACTOME 583 pathways (86.7%) remained after filtering by the gene set size.2.3 Individualized analysis using the nRefThe aim of our approach is to identify altered pathways in an individual by making use of the nRef. A schematic diagram of our method of individualized pathway analysis is described in and the following sections describe each step. Fig. 1.Schematic description of individualized pathway analysis using accumulated normal data (nRef). An individual™s tumor data are normalized with the nRef. Gene expression is standardized by mean and SD of the nRef. The iPAS is calculated from standardized gene expression values in the pathway. Null distribution calculated from the nRef provides significance2.3.1 Data preprocessing and gene-level statisticsExpression level was defined by using the robust multichip average (Irizarry et al. 2003). For datasets using different microarrays only those with probes in common from Affymetrix U133A to Affymetrix U133Plus 2.0 were used for further analysis. For individual tumor cases we performed quantile normalization (Bolstad et al. 2003) after combining the single tumor microarray with all nRef samples. In cases of genes with multiple probes gene expression level was summarized by averaging probe-level expression. Individual tumor sample gene expression was standardized using the mean and standard deviation of the reference.2.3.2 Pathway-level statistics and significance testWe introduce five methods as candidates for iPAS. Each method is a modification of existing pathway analysis techniques enabling us to test an individual tumor sample™s pathway aberrance by using the nRef. A summary is provided in . .Modification of existing pathway analysis methods for iPASNote. Significance can be obtained against the null distribution generated from normal samples. All the collected normal samples for the nRef are one by one compared with the nRef to yield statistics of the null distribution. A statistic from a single cancer case is compared with this null distribution to yield P-value.Average ZStandardizing the gene expression by mean and standard deviation from datasets is often used in microarray analysis. A vector Z = (z1 z2 ¦ zn) denotes the expression status of a pathway where zi symbolizes the standardized expression value of i-th gene where the number of genes belonging to the pathway is n. In typical settings standardization is performed using the mean and SD of a given dataset mostly the cancer-only cohort data thus y¯/n indicates how much the given sample™s overall pathway gene expression deviates from the center of the cancer samples. We made the simple modification Z™ = (z1™ z2™ ¦ zn) where zi™ is derived from mean and SD of the nRef. In this case y'¯/n gives the samples deviation from the nRef. We believe this modification is biologically valid because every cancer starts its malignancy from normal cell. Thus the clinical characteristics of a single cancer can be captured by measuring the difference of it against common characteristic of normal cells which is represented by the nRef in our study.Fisher exact testWe generated a 2 — 2 contingency table for a given pathway (S) and DEGs (D) for the test. For individualized interpretation we define D by the ranking of z-value which is standardized gene expression for the mean and SD of the nRef. For each individual sample 5% (highest 2.5% and lowest 2.5%) of the total genes are defined as D. We applied a two-tailed test to detect alteration of pathways due to enrichment or depletion of differential genes. The result of this statistic can be interpreted as how many DEGs are enriched in the given pathway where the expression difference refers to how much a patient™s gene expression deviates from the nRef.Gene set enrichment analysisWe adopted the original version of gene set enrichment analysis (GSEA) proposed by Subramanian et al. (2005). Typically inputs for GSEA are generated by testing whole cohort samples using phenotype label; t-statistic correlation coefficients and fold changes are usually used. In the personalized analysis setting we use the z-value as an input for the GSEA algorithm which is standardized gene expression by mean and SD of the nRef. The GSEA output enrichment score reflects the degree to which a gene set in the pathway is overrepresented at the extremes (low or high) of the entire ranked list of z-values from a single patient.Non-parametric quadratic testGene expression in a pathway of a tumor sample is represented by vector Z = (z1 z2 ¦ zn) where zi is standardized expression level of i-th gene by mean and SD of the nRef where n is the number of genes belonged to the pathway. A pathway characteristic of an individual patient™s pathway can be represented by the averaged Euclidean distance (ZTZ/n). This gives the distance of a single patient from the center of the nRef due to the square of standardized expression difference and thus does not reflect increased or decreased expression only the extent of the expression difference. Genes in the pathway are usually functionally correlated; therefore use of the correlation structure of the normal samples may increase sensitivity enough to capture the aberrance of a single cancer case. We also consider the averaged Mahalanobis (ZTSZ/n) distance which uses the covariance matrix calculated from the nRef. This value describes the statistical distance from the center of normal samples taking into account correlation among normal samples. The covariance matrix S is calculated for each pathway from the nRef.3 RESULTS3.1 Pathway-based identification and validation of cancer survivalTo assess whether our method can sensitively detect pathway aberrances that are associated with a patient™s clinical outcome a known survival pathway that showed strong association with patient survival from Beer™s data was tested. Bryant et al. (2010) reported that the ˜cell cycle stimulatory™ pathway of 51 genes is significantly associated with patient survival (Cox proportional hazards model P = 0.000113). In that study pathway gene expression was represented as an average of z-values where the z-value indicates the standardized expression level by the mean and SD of all cancer samples. The high-risk group was defined as those in which pathway expressions were >0 and the pathway showed poor prognostic outcome. The association was significant with or without adjusted clinical covariates and thus the pathway alone is a strong indicator of cancer prognosis. This finding was also validated in the Japanese LUAD cohort (n = 87 survival data are not provided to public) in Bryant™s study. As studies have shown a clear association between the cell cycle pathway and cancer in terms of driving cancer proliferation we considered this pathway as a pathway that should be detected. All of the methods proposed as candidates for iPAS showed significant associations of the ˜cell cycle stimulatory™ pathway from Beer™s data (Table 2). The same pathway analyzed using GSE8894 (n = 61) data yielded significant associations in all proposed methods with the marginal exception of Mahalanobis (P = 0.0549). Table 2.Survival analysis of ˜cell cycle stimulatory™ pathway reported by Bryant et al. (2010)DatasetPathway statisticsCoefficientP-valueBeer (N = 432) Bryant et al. Overall survivalAverage Za0.370.00011Beer (N = 442) Overall survivalAverage Zb0.620.00003Fisher0.500.00068GSEA0.650.00001Euclidean0.650.00001Mahalanobis0.670.00001GSE8894 (N = 61) Recurrent free survivalAverage Zb0.900.01163Fisher0.910.01076GSEA0.780.02899Euclidean0.870.01544Mahalanobis0.680.05485aDerived from mean and SD of all cancer samples in the dataset bDerived by mean and SD of the nRef.Prognostic gene expression signatures for Stages II and III colon cancers have been reported in seven papers yielding 207 genes in total (Bandres et al. 2007; Barrier et al.2006 2007; Eschrich et al. 2005; Kopetz and Abbruzzese 2009; Lin et al. 2007; Wang et al. 2004). The genes are enriched in 32 REACTOME pathways (False Discovery Rate (FDR) < 0.05 pathway size < 96). We assumed the 32 pathways were valid as ground truth to be identified and analyzed in the colon cancer dataset GSE39585 (Stages II and III were only considered). Average Z provided best performer (sensitivity = 0.88) with 28 pathways deemed as significant. GSEA Fisher Euclidean and Mahalanobis gave the following values0.780.66 0.06 and 0.03 respectively.These results satisfied us that our approach captures the fundamental knowledge of cancer thus it is reasonably considered as iPAS.To investigate which of the candidates for iPAS most robustly reflect phenotype association we evaluated the proposed methods by determining whether survival-associated pathways are validated in datasets never used for discovery using LUAD and colon cancer [LUAD: Beer™s set n = 442 for discovery GSE8894 (n = 61) GSE3141 (n = 58) for validation; colon cancer: GSE39582d (n = 443) for discovery GSE39582v (n = 123) and GSE17536 (n = 109) for validation logrank P < 0.05 comparing tumors in the top 50th percentile of aberrance scores to those in the bottom 50th percentile]. Validation rates varied depending on the dataset and these were possibly affected by the small sample size compared with that of the discovery set. In these cases we were not able to determine a superior method that outperformed the others. Average Z gave the highest validation rate in three of four dataset with validation rates of GSE8894 (43.6% 92/211) GSE3141 (13.3% 28/211) and GSE17536 (10.7% 24/224). When validation rates from four datasets are averaged Average Z gave the highest validation rate (21.9% Fig. 2 blue bars). Pathways validated as significantly associated with patient survival for each cancer are listed in the Supplementary Materials (Supplementary Tables S1 and S2). Fig. 2.Averaged validation rate of discovered survival-related pathway at four datasets. Proposed approach using nRef (blue) versus conventional approach that standardizes individual sample by mean and SD of entire cohort dataset (red)We also investigated the validation rate of iPAS candidates under the conditions where the same data are not standardized by the nRef but instead standardized by the mean and SD of the cohort dataset which consists of only cancers (Fig. 2 red bars). It is noteworthy that use of the nRef increased the validation rate for every iPAS candidate investigated. This implies that the strategy of using accumulated normal samples as a reference is beneficial in terms of pathway-based survival analysis.3.2 Identification of clinical importanceCluster analysis of using Average Z as the iPAS method on Beer™s data identified 12 pathway clusters (denoted by 1?12 in Fig. 3) and 3 sample clusters (S2?S4; S1 is from the nRef; Fig. 3). Sample clusters S2 and S4 represent well the differentiation status of LUAD (Fisher exact test P < 4.65 — 10?15). Well-differentiated adenocarcinoma resembles the normal glandular structure; therefore it is a reasonable result that cluster S2 is close to the nRef. The survival outcome of S2 and S4 are significantly different (P < 0.0028) and this assures us that unbiased clustering-based iPAS has enough sensitivity to capture clinically important associations. This finding is concordant with prior knowledge that well-differentiated LUAD patients are likely to have better prognosis (Barletta et al. 2010). Pathway cluster P9 is distinguished as commonly upregulated in tumor samples. The pathways are transfer RNA aminoacylation amino acid or purine synthesis DNA elongation and the extension of telomeres. Fig. 3.Clustered iPAS of LUAD dataset. Pathways (n = 583) and samples (n = 442) are clustered according to iPAS. Normal samples are clustered at left (S1). Tumors (S2?S4) deviate from normal in both up- and downregulated directions (darker red and blue respectively). Sample clusters are well-representing histopathological differentiation status (S2: for well-differentiated LUAD P < 4.65 — 10?15) and overall survivalUnbiased pathway-based clustering of colon cancer data also captures clinically important associations by revealing sample clusters that are survival related (S2 and S3 P = 0.0037 Supplementary Fig. S1). It is important to note that iPAS is not only sensitive enough to identify clinically meaningful substructure of patients but also reveals common characteristics of a cancer at the same time. For example pathways commonly up- or downregulated in all cancer samples for example P9 or P2 would have not been discovered if the analysis had been performed by a conventional approach that does not make use of ˜nRef™ (Supplementary Fig. S2).3.3 Pathway-based identification of cancerCancer develops unique mechanisms for malignancy. Therefore it is reasonable to believe that identifying the unique molecular aberrances of cancer will aid in cancer diagnosis. Our empirical study of iPAS-based clustering of LUAD revealed several pathways commonly up- or downregulated in all of the cancer samples. Further analysis was performed to determine whether iPAS could be successfully used in the accurate identification of cancer. We tested this in a simple unsupervised way by judging whether an unknown sample is significantly different against the nRef as a tumor if not as normal. We performed a 5-fold cross-validation one hundred times with the LUAD dataset which consisted of 120 cancers and 120 normal samples. Microarray data from the normal samples was randomly divided into five groups and four of the five served as the reference group. The remaining group was used as the true normal set for the test of pathway-based identification of cancer. To build true cancer set for the test the same number of cancer sample was randomly picked. We considered 583 pathways in REACTOME giving 293 500 (583 pathways — 5-fold — 100 repeats) AUCs and accuracy values. We averaged AUCs and accuracies from the five candidate methods for iPAS and used this as a representative AUC and accuracy of a given pathway.By ranking the pathways by AUC top pathways that marked averagely high performance by all iPAS candidates are listed (Supplementary Table S3). The ˜amino acid synthesis and interconversion and transamination™ pathway showed the highest classification performance. Unsurprisingly this pathway was one of the commonly upregulated pathways in the analysis of the Beer™s data (Fig. 3 pathway cluster P9). Among the tested iPAS candidates for this pathway Mahalanobis yielded the highest AUC (0.980) while Average Z gave 0.936 and Fisher™s exact test gave the lowest value (0.914). The standardized gene expression pattern for this pathway differed between tumor and normal. Many of the genes deviated from mean of the nRef by more than two orders of sigma contributing to its best performance out of all iPAS candidate methods including ORA method like Fisher™s exact test (Fig. 4a). Fig. 4.(a) Expression pattern of genes in the pathway. Each line represents sample. (gray: normal red: tumor). Dashed line represents expression value deviated 1.96? from the mean expression value of normal tissues. (b). Performance of classification of cancer by ˜amino acid synthesis and interconversion and transamination™. AUC of 0.980 has marked in discovery set (95% confidence interval provided as error bar) independent validation set results AUC of 0.982 (Validation 1: normal samples in validation set served as reference) and 0.982 (Validation 2: normal samples in discovery set served as reference)We also analyzed the influence of using the subset of normal samples as nRef. We compared the pathway-based cancer identification results using the full set of normal samples (n = 120) against 100 different runs using 75% (n = 90) 50% (n = 60) of randomly chosen normal samples. Among the pathways that marked averagely high performance in the identification of cancer the best and the second best pathways are considered ˜amino acid synthesis and interconversion and transamination™ and ˜unwind of DNA™ respectively. The result shows little loss of performance even though only a half of normal samples were used for the test (Fig. 5a and b). Fig. 5.Performance of pathway-based identification of cancer (AUC) when only a subset of normal samples are served as nRef. (a) ˜amino acid synthesis and interconversion and transamination™ (b) ˜unwind of DNA™3.4 Validation of the discovered pathwayThe ˜amino acid synthesis and interconversion and transamination™ pathway consists of 17 genes involved in three major reactions as it is described at REACTOME. The pathways are responsible for (i) synthesis of three amino acids (aspartate asparagine glutamate) (ii) the synthesis of glucose under fasting conditions by using carbon atoms from these four amino acids and (iii) conversion of amino acids to their corresponding alpha-keto acids coupled to their conversion to glutamate which is the first step in the catabolism of most amino acids.This function makes sense in terms of the ˜glutamine addiction™ of cancer cells. The nutrients glucose and glutamine are specifically required by cancer cells as metabolites for growth and for production of adenosine triphosphate (Munoz-Pinedo et al. 2012). Myc and p53 have been revealed to be associated with this ˜addiction™ by upregulating glutamine synthesis in cancer cells. Thus our finding is in accordance with prior knowledge regarding the upregulation of glutamine synthetase.We further validated our findings with an independent set that were not used in the discovery set. We collected two more LUAD gene expression datasets with normal data at GEO (GSE19188 GSE31547). Aggregated datasets of 48 microarrays from tumor tissues and 35 microarrays from normal tissues were used for independent validation. The pathway was also altered in a cancer-specific way in a validation set yielding an AUC of 0.982 by Mahalanobis-based iPAS (Fig. 4b Validation 1). We also assessed the same validation set in a different manner by using the nRef from the discovery set. Normal sample microarrays from the discovery sets (GSE10082 GSE7670 GSE10072) served as the nRef to classify samples in the independent validation set. The resulting AUC was 0.982 by the Mahalanobis method (Fig. 4b Validation 2).In our experiments using LUAD samples the Mahalanobis distance which used a pre-calculated covariance matrix from the ˜nRef™ gave the best performance. The usage of covariance matrix empowers Mahalanobis to consider a cancer sample as an outlier delivering higher accuracy in terms of pathway-based identification of cancer than other methods. One caution of using Mahalanobis method is that it requires a large number of normal samples to guarantee the estimation of covariance matrix. For a small sample size a structured covariance matrix would be desirable to avoid the estimation issue.The biological role of this identified pathway is to supply nutrients and energy to cancer cells. This may be the reason why this pathway is universally aberrant in all the LUAD samples we assessed. Our analysis of this pathway in other cancer types demonstrated less of a role for this pathway suggesting that it is more LUAD specific. We believe that the common disruption of this pathway is a novel discovery as this pathway consisting of 17 genes has not been reported as an indicator of LUAD in any of the studies we acquired datasets from (GSE10082 GSE7670 GSE10072) nor in a literature search with key words.4 CONCLUSIONSWe have proposed personalized extensions to ORA- and FCS-based pathway analysis by introducing the concept of comparing an individual tumor with many normal samples. Exploratory analyses of our methods with previously published survival pathway signatures reproduced the correct survival outcomes. We have also demonstrated that using nRef improves the validation rate. Unbiased clustering with iPASs revealed sample clustering which is indicative of the cancer differentiation status of LUAD and of different survival outcomes. Clustering also identifies pathway characteristics from patients displaying common up- or downregulations and subgroup-specific deregulations.Pathways that are commonly deregulated across all cancer patients may be useful in identifying cancer from unknown samples. We explored the pathway-based identification of cancer with ˜amino acid synthesis and interconversion and transamination™ pathway which is commonly upregulated in LUAD patients. Validation using independent datasets demonstrated that this pathway is useful in classifying LUAD and normal lung samples.Based on our results we conclude that individualized pathway scores using nRef can provide a sensitive measure of a patient™s clinical features and can be useful for identifying cancer.In our empirical study Average Z performed best in highlighting pathway aberrance and in further revealing clinical importance. It had the best statistical power when identifying a previously known survival-related pathway and the best averaged validation rate for LUAD and colon cancer. In the pathway-based identification of cancer the Mahalanobis method performed best.An important clinical aspect of our methods is that it enables the interpretation of a cancer case in a single patient even if matched normal tissue data from the same individual are unavailable. "

Lung_Cancer

"Genes involved in the carcinogenetic mechanisms underlying malignant pleural mesothelioma (MPM) are still poorly characterized. So far mesothelin (MSLN) has aroused the most interest. It encodes for a membrane glycoprotein frequently over-expressed in various malignancies such as MPM and ovarian and pancreatic cancers. It has been proposed as a diagnostic and immunotherapeutic target with promising results. However an alternative therapeutic approach seems to rise whereby synthetic molecules such as antisense oligonucleotides could be used to inhibit MSLN activity. To date such a gene-level inhibition has been attempted in two studies only both on pancreatic and ovarian carcinoma cell lines with the use of silencing RNA approaches. With regard to MPM only one cell line (H2373) has been employed to study the effects of MSLN depletion. Indeed the knowledge on the role of MSLN in MPM needs expanding. Accordingly we investigated the expression of MSLN in a panel of three MPM cell lines i.e. NCI-H28 Mero-14 and IstMes2; one non-MPM cell line was used as reference (Met5A). MSLN knock-down experiments on MSLN-overexpressing cells were also performed through silencing RNA (siRNA) to verify whether previous findings could be generalized to a different set of cell cultures. In agreement with previous studies transient MSLN-silencing caused decreased proliferation rate and reduced invasive capacity and sphere formation in MSLN-overexpressing Mero-14 cells. Moreover MSLN-siRNA combined with cisplatin triggered a marked increase in apoptosis and a decrease in proliferation as compared to cells treated with each agent alone thereby suggesting a sensitizing effect of siRNA towards cisplatin. In summary our findings confirm that MSLN should be considered a key molecular target for novel gene-based targeted therapies of cancer. The work was funded by the University of Pisa (www.unipi.it) (regular badget ex 60%) and by the Fondazione Buzzi Unicem (www.buzziunicem.it). The funders had no role in study design data collection and analysis decision to publish or preparation of the manuscript. Introduction Malignant pleural mesothelioma (MPM) is a cancer of the pleural cavity triggered by asbestos exposure. Patients with MPM have a poor prognosis with overall survival typically ranging between 6 and 13 months. The carcinogenetic mechanisms underlying MPM and the genes involved are still poorly characterized although so far MSLN has aroused the most interest. The human MSLN gene encodes a ?71 kDa precursor protein of 622 amino acids. The precursor is processed by a removal of 33 N-terminal residues. Moreover the C-terminal residues departing from Ser598 are replaced with glycosyl-phosphatidyl-inositol (GPI) facilitating the anchoring of the peptide to the cell membrane. Then the precursor is cleaved at Arg295 by the endoprotease furin into a ?31 kDa soluble peptide called œmegakaryocyte potentiating factor (from aminoacid Ser34 to Arg286) [1] and a ?40 kDa GPI-anchored membrane-bound glycoprotein (mature mesothelin MSLN starting from Glu296) [2] [3] [4]. It was found that MSLN is present at low levels in a restricted set of normal adult tissues including the mesothelium but it is overexpressed aberrantly by several cancers such as MPM and pancreatic (PC) and ovarian carcinomas (OC) [5] [6]. Moreover a soluble form of MSLN (soluble mesothelin related peptide SMRP) is known lacking the C-terminal GPI-membrane anchor binding segment [7]. Interestingly the levels of SMRP are elevated in the sera of MPM PC or OC patients but not in patients with other types of cancer or inflammatory diseases or in healthy controls [8] [9] [10]. Unfortunately since MSLN knock-out mice did not exhibit any adverse pathology the exact function of MSLN remains unclear [11]. Recent studies highlighted the possible mechanisms by which MSLN could play an active role in cancer progression; it was shown to interact with MUC16 [12] and to activate the p38 pathway leading to the selective induction of matrix metalloproteinase (MMP)-7 [13]. MSLN could also increase cancer cell survival and proliferation via the activation of the NF-?B signaling pathway [14]. Finally it was suggested that MSLN could exert its role in the malignant transformation of human cells through the ?-catenin pathway an important molecule for the epithelial-mesenchymal transition [15]. For all these reasons MSLN was considered a good target for immunotherapeutic strategies. In fact it was used to deliver immunotoxins to specific cancer cells [16] [17] [18] [19] [20] [21] or such as for the case of the monoclonal antibody MORAb-009 to arrest cancer progression by direct inhibition (e.g. disrupting the interaction with MUC16) [22]. Although the use of monoclonal antibodies could provide several advantages (indeed MORAb-009 is currently under clinical trial) target-specific drugs or novel inhibitors (such as antisense oligonucleotides) acting at gene-level could be an alternative for complete inhibition. To date direct inhibition of mesothelin with non-immune strategies has been attempted in a very limited number of studies using silencing RNA (siRNA) approaches. One study on the Eker (Tsc2 mutant) rat model of hereditary renal cancer showed tumor growth inhibition following the use of siRNA microspheres designed against Erc which is considered the rat homologue of MSLN [23]. On human cells one study was carried out on PC cell lines AsPC-1 Capan-1 and Capan-2 [24] whereas another one was performed on cell lines from PC (Miapaca2 and Panc-1) and OC (Skov3 and Ovcar-5) [25]. Overall MSLN depletion significantly hampered proliferation and colony-forming capability. A decreased viability and invasiveness of PC and OC cell lines were also observed [25]. Moreover the expression of bcl-2 decreased whilst that of PUMA and Bax increased; at the same time the activity of caspase-3 increased. Consistently with these observations an increased apoptotic rate was observed in PC cells and the data were conversely corroborated when MSLN was ectopically over-expressed in HPAC cells a PC cell line poorly expressing MSLN [24]. With regard to MPM so far only one cell line (H2373) has been employed to study the effects of MSLN depletion [25]. Indeed the knowledge on the role of MSLN in MPM should be expanded. Accordingly we investigated the expression of MSLN in a panel of three MPM cell lines i.e. NCI-H28 Mero-14 and IstMes2; one non-MPM cell line was used as reference (Met5A). We then performed MSLN knock-down experiments in highly expressing MSLN cells through gene silencing (using silencing RNA siRNA) to verify whether previous findings could be generalized to a different set of cell cultures further corroborating the importance of MSLN in the biology of MPM. Materials and Methods Cell cultures Three mesothelioma cell lines (Mero-14 IstMes2 and NCI-H28) and one mesothelial non-MPM immortalized cell line (Met5A) were used. Mero-14 [26] and IstMes2 [27] mesothelioma cells had been kindly donated by the Istituto Tumori of Genova (National Research Council Genoa Italy). The Met5A mesothelial cells and the NCI-H28 mesothelioma cells had been purchased from the ATCC (American Type Culture Collection) and kindly donated by collaborators of the Pharmaceutical Department of the University of Pisa. Met5A Mero-14 and NCI-H28 cell lines were verified for their identity by analyzing the genetic markers reported in the certification. IstMes2 is a locally established cell line. Mero-14 and IstMes2 were cultured in DMEM medium (Lonza Basel Switzerland). The NCI-H28 cell line was grown in RPMI 1640 medium (Gibco Life Technologies Monza Italy). The Met5A cell line was grown in Medium199 with HEPES (Life Technologies Monza Italy) supplemented with 3.3 nM epidermal growth factor (EGF Life Technologies Monza Italy) 400 nM hydrocortisone (Sigma Aldrich Corp. St Louis MO USA) and 870 nM insulin (Life Technologies Monza Italy). All the cell lines were cultured with supplement of 10% fetal bovine serum (Sigma Aldrich Corp. St Louis MO USA) and 1% Pen-Strep (Lonza Basel Switzerland) and maintained at 37°C in a 5% CO2“humidified atmosphere (Forma* 311 Direct Heat CO2 Incubator Thermo Scientific Waltham MA USA). RNA isolation and cDNA synthesis Total RNA was isolated from each cell line with Rneasy Mini kit (Qiagen MI Italy) according to the standard protocol. In order to remove possible contaminating genomic DNA the extracted RNA was treated with DNAse buffer (Sigma Aldrich Corp. St Louis MO USA). Concentration and purity of cleaned-up RNA were determined with a spectrophotometer (SmartSpec 3000 Bio-Rad Laboratories Hercules CA). The integrity of total RNA was verified by electrophoresis on ethidium bromide agarose gel inspecting the 18S and 28S ribosomal RNA bands. Reverse transcription (RT) was performed with the iSCRIPT cDNA Synthesis Kit using 1µg of total RNA in a final volume of 20µl (Bio-Rad Laboratories Hercules CA). Quantitative Real-Time PCR (RT-qPCR) Pre-designed TaqMan probes (Life Technologies Monza Italy) were employed. For the TaqMan assay the reaction mixture consisted of 2 µl of cDNA template 7 µl of deionized H2O 1 µl of specific TaqMan Assay probe and primer mixture and 10 µl of TaqMan® Gene Expression Master Mix (Life Technologies Monza Italy). The thermal cycling conditions were: 15 min at 95°C followed by 15 s at 95°C and 60 s at 60°C (40 cycles). TaqMan ID assays are reported in Table S1. Seven housekeeping genes GAPDH HPRT1 B2M RPLP0 TBP GUSB and PPIA were tested for stability to be used as reference. The three most stable genes (RPLP0 HPRT and TBP) were determined based on the average M and the pair-wise variation values calculated with the tool geNorm [28]. Chemicals The drugs were dissolved in DMSO at the final concentration of 10 mM. Imatinib was purchased from Cayman Chemical (Michigan USA) and used in the range of 5“25 µM; Gemcitabine was obtained from Sigma Aldrich Corp. (St Louis MO USA) and used in the range of 1“10 µM; Cisplatin kindly donated by Prof. Justin Stebbing (Imperial College London) was used in the range 1“25 µM. The following antibodies were used: MSLN mouse monoclonal (Santa Cruz); ?-actin mouse monoclonal (Abcam) p53 mouse monoclonal (Santa Cruz); pERK mouse polyclonal (Abcam); PARP rabbit polyclonal (Cell Signaling); pAKT rabbit polyclonal (Abcam); ERK1-2 rabbit polyclonal (Abcam); Secondary HRP (horseradish peroxidase)-conjugated goat anti-rabbit IgG and goat antimouse IgG antibodies were from GE Healthcare. The expression plasmid pcDNA3.1 encoding for MSLN (aa 360-2230) was kindly donated by Dr. Uehara (Kansai Medical University Japan); the empty vector pcDNA3.1 employed as control was donated by Dr. Giamas (Imperial College London). siRNA and plasmid transfections siMSLN-1 and-2 were purchased from Qiagen (Qiagen S.p.A Milano Italy). The œAllStars Negative Control siRNA (SI03650318) was used as non-targeting control (siRNA-Ctrl). siRNA oligonucleotides were re-suspended in the provided buffer at a final stock concentration of 20 µM. siRNA transfection was performed with the HiPerfect transfection reagent (Qiagen S.p.A Milano Italy) according to the manufacturer™s instructions. Plasmid transfections were performed using the FuGENE® Transfection Reagent (Promega Corp. Madison Wisc. USA)"

Lung_Cancer

"Twelve studies of various design reported statistically significant association between ICC and survival. General surgeons were surveyed to identify individual and anizational barriers to MCC adoption [22]. Surgeons said that MCCs were not well supported institutionally or widely accessible few had a designated coordinator and most reviewed only rare or select cases rather than all new cancer patients. Interviews and observation were used to explore MCC use in four hospitals [23]. Thirty-seven MCCs were observed at three hospitals and 48 clinicians and administrators were interviewed. Institutions lacked the capacity to fully implement MCCs as part of routine practice. MJD developed a measure of cancer services integration and conducted a population-based survey of Ontario health professionals to evaluate integration. The study identified 12 factors that accounted for the majority of variation in cancer services integration [24]. This work emphasized how leadership coordination resource allocation and communication influence overall integration of cancer services. Further analysis of this data revealed variability in access to electronic health records (EHRs) across different provider groups anization types and geographic locations which may limit ICC [25]. Another analysis focused specifically on the benefits of MCCs as a model of ICC [26]. Overall 74% of respondents were aware of MCCs within their region but only 58% were regular participants. Diagnostic assessment programs MCCs represent one model of ICC for treatment decision making. The time interval from suspicion to diagnosis of cancer involves numerous consultations and testing and is a confusing time for patients. Timely diagnosis can lead to improved access to MCCs or other consultation earlier treatment and a better prognosis [1-21]. Clinicians and managers suggested the need to improve ICC earlier in the cancer trajectory given barriers of access to and coordination of diagnosis and staging and recommended centralized diagnostic facilities [14-19]. An expert panel assembled by the provincial cancer agency issued anizational standards for Diagnostic Assessment Programs (DAPs) to coordinate diagnostic tests and integrate multidisciplinary expertise [2728]. A summary of recommended DAP features appears in . DAP standards Component Description Team composition Administrative ¢ Director/manager ¢ Reception clerical and bookings Health professionals ¢ Assessment coordinators (examples): ¢ Radiologists ¢ Pathologists ¢ Primary care ¢ Psychosocial support Specialists ¢ Surgeon specialists ¢ Respirologists (lung) ¢ Endoscopists (colorectal and other) Technicians ¢ Ultrasound technologists ¢ Mammographers (breast) Scope of diagnostic activity Examination (diagnostic activity differs depending on disease site) ¢ Physical exam ¢ Other disease site specific Imaging diagnostic and staging procedures ¢ Ultrasound ¢ MRI ¢ X-ray ¢ CT scan ¢ PET ¢ Upper endoscopy ¢ Colonoscopy ¢ Bronchoscopy ¢ Cystoscopy ¢ Bone scan ¢ Mammography ¢ Other disease site specific Surgical consultation and procedures ¢ Biopsy ¢ Fine needle aspiration cytology ¢ Biopsy Pathology and laboratory medicine ¢ Standardized surgical pathology requisition forms ¢ Routine analysis and pathology reporting ¢ Special pathological studies such as markers flow molecular etc ¢ Clinical lab testing of tumour markers hematology etc. Supportive care ¢ Education/psychosocial support ¢ Dietetics ¢ Genetic counselling ¢ Other supportive services ¢ Access ¢ Regionalized centralized ¢ One stop ¢ Virtual ¢ Entry point ¢ Primary care providers or specialist ¢ Screening program ¢ Self referral ¢ Operational features ¢ Entry ¢ Fast access booking ¢ Priority booking ¢ Open-access booking ¢ DAP core elements ¢ Assessment coordinator ¢ Multidisciplinary care conference (MCC) team/treatment team ¢ Cross-DAP collaboration ¢ Provincial indicators of quality for cancer DAPs ¢ Time intervals ¢ Clinical outcomes ¢ Quality of care ¢ Patient satisfaction ¢ Guidelines standards and services frameworks ¢ Guidelines and service frameworks for primary care providers ¢ Evidence-based investigative algorithms and guidance documents ¢ Wait-times benchmarks Study rationale ICC for cancer leads to multiple system anizational professional and patient benefits. However our analysis of conceptual literature did not reveal optimal ways to achieve ICC and our review of empirical literature revealed that no interventions apart from MCCs have been used to promote ICC for cancer care. Our research with health professionals identified limited support for use of and access to interventions that enable ICC for cancer particularly outside of designated cancer hospitals in community settings where the majority of cancer care takes place and for cancer diagnosis. DAPs appear to be a promising model by which to enable ICC. In 2007 the provincial cancer agency funded four pilot DAPs and all achieved reductions in wait times (http://www.cancercare.on.ca/pcs/diagnosis/diagprograms/). Hospital one reduced median time from suspicion of breast cancer to biopsy by 60% (38 to 15 days) and from suspicion to diagnosis by 53% (42 to 20 days); hospital two reduced time from referral to colonoscopy for patients with positive fecal occult blood test results by 78%; hospital three reduced lung cancer wait times from 113 to 69 days for referral to diagnosis; and hospital four reduced lung cancer wait times from 120 to 44 days for suspicion to diagnosis. Wait times are only one possible outcome of ICC. We require more information about how to design and implement DAPs to optimize ICC and achieve the range of associated beneficial outcomes. We conducted a systematic review of the cancer literature to describe clinical and economic evaluations of DAPs [29]. Most of the 20 eligible studies did not base their evaluations on guideline recommendations or quality indicators or include economic evaluations. Several DAPs were implemented across Ontario so more comprehensive evaluation was warranted and possible to better understand how various DAP models enabled ICC. The purpose of this study is to: 1. Describe DAP structure function and outcomes according to published DAP standards clinical guideline recommendations and a theoretical framework of ICC. 2. Conduct a pilot costing analysis of delivering diagnostic services with DAPs. 3. Explore challenges of DAP implementation and operation and associated ICC. 4. Issue recommendations that may optimize the implementation operation and outcomes of DAPs. This research will not evaluate DAPs from the perspective of patients. While crucial that objective warrants separate multi-year investigation to explore patient preferences for diagnostic care first through review of the literature then by interviewing patients with various characteristics who did and did not experience DAP care. This would establish patient-informed performance measures of diagnostic services and ICC which do not exist. We found that patient views about cancer care performance measures differed from those of health professionals thus development of patient-informed performance measures is necessary to fully evaluate the services provided by DAPs and the degree to which the DAP model enables ICC [30]. Instead this proposal responds to the expressed needs of our research partners and for multiple reasons including feasibility focuses first on evaluating DAPs according to evidence-based standards for DAPs and clinical care delivery and by soliciting the views of involved health professionals. This preliminary evaluation is needed to establish a baseline understanding of how DAPs were implemented and function. Only then will we have sufficient insight on factors influencing DAP outcomes that we could ask patients about and an established relationship with DAP collaborators to enable an expanded research study that would include patient recruitment. Methods Design A case study approach was chosen to explore multiple factors that influence ICC including DAP structure processes and outcomes [31]. These will be assessed according to DAP standards and guideline recommendations for staging and diagnosis of breast [32-34] and lung cancer [2728]. This will enable comparison between ˜cases™ (DAPs) that vary by type of cancer academic status and geographic region. This may identify whether and how differences in DAP leadership staffing resources and referral patterns influence ICC or whether ICC must be enabled differently by condition. This approach is suitable for examining complex issues that require holistic interpretation (˜triangulation™) of data collected in a variety of ways from different sources. Data will be collected from medical records and interviews. Four hospitals from different regions of Ontario agreed to participate. Two are considered academic teaching hospitals. Each site features a breast DAP and a lung DAP for a total of eight participating DAPs. This study was reviewed and approved by the University Health Network Research Ethics Board and research ethics boards at each of the four participating hospitals. Conceptual framework The overall goal of this study is to explore how DAPs enable ICC and associated outcomes. ICC was defined as ˜interaction among various types of health professionals to plan or evaluate services or plan provide or review results or outcomes for individual patients™. There is no single existing model or theory that describes factors influencing the quality of ICC so we compiled a conceptual framework from several sources. We had reviewed several bodies of knowledge describing models of health professional interaction for patient management according to the concepts of teamwork inter-professional collaboration continuity of care integrated service delivery inter-anizational collaboration and case management and extracted data on common domains and elements and associated outcomes [20]. This generated core components and enablers of ICC that were common across the models. anizational standards for DAPs that are described in [2728] were mapped onto this preliminary framework. The conceptual framework was expanded by adding challenges [10-26] and beneficial outcomes [9-21] identified in our background review of the literature. We also reviewed clinical guidelines for breast [32-34] and lung cancer [2728] to incorporate elements of desirable care delivery and outcomes. The resulting conceptual framework (Figure 1) will be used to inform the development of data collection instruments and data analysis. Findings will be used to validate and extend the conceptual framework to describe how DAP structure function and support enable ICC and associated outcomes. Figure 1 Conceptual framework describing factors that influence how DAPs achieve ICC and associated benefits. Medical record review to describe DAP services and outcomes Approach To describe DAP function and outcomes and gather information that will enable costing recommendations expressed in DAP standards and clinical guidelines will be assessed through retrospective observational study. Data will be acquired from databases maintained by participating DAPs and the provincial cancer agency and confirmed by and supplemented with review of medical records. Sampling Eligible patients include those 18 years of age or older with suspected lung or breast cancer who were referred to participating DAPs between 1 January 2012 and 31 December 2012. Based on input from collaborating sites we initially estimated that this includes a mean of 15 new patients per month by two types of cancer in four sites for an annual total of 360 patients per site and an overall total of 1440 patients. Assuming a type I error (alpha) rate of 0.05 power of 0.80 and equal sample sizes for two comparative groups (i.e. academic/community status or breast/lung cancer) 170 patients (85 in each group) in total would be required to detect a statistically significant difference in compliance with a given DAP or clinical guideline standard of 15%. Thus estimated patient sampling is more than sufficient to identify variations in process or outcome performance measures according to varying DAP features. However DAPs vary in case volume. To give equal weight to each DAP at each participating site based on patient volume 15% of patients will be randomly sampled from among those newly referred during the given time period. For all sites this is equal to or greater than minimal sample sizes estimated by traditional power calculation. Data collection and analysis Data reflecting DAP and guideline recommendations for diagnostic activity () will be extracted from medical records. A trained data abstractor will visit participating sites. Before this a data extraction form will be developed and independently pilot tested on five cases by two individuals. They will compare congruence of extracted data to assess how the form should be revised. This will be repeated until the format and content of the data extraction form is satisfactory and congruence of independently extracted data is high. During chart review 5% of charts will be re-abstracted for data quality monitoring. Summary statistics will be used to report compliance with DAP and guideline standards for patients overall and by DAP academic status and type of cancer. Statistical significance of differing outcomes will be reported with the Pearson™s chi-square test. A generalized linear mixed model approach will be used to address binary and continuous process and outcome variables. Hierarchical modeling (patient level one hospital level two) will be used to allow for clustering by hospital. Pilot costing analysis of DAP diagnostic visits and services Approach Our ultimate goal is to conduct a cost-effectiveness analysis (CEA) but this is a complex undertaking requiring considerable data on the actual number and nature of services provided per patient and their cost. The purpose of CEA is not hypothesis testing but rather it is estimation [35]. To do a CEA one needs to compute estimates of the extra cost (?C) and the extra effect (?E) of an intervention. The ratio of ?C to ?E is called the incremental cost-effectiveness ratio (ICER) and is the main statistic in CEA. Such data are not readily available in administrative databases and often requires primary data collection from medical records. We currently do not know whether data required for a CEA of DAPs is available in medical records."

Lung_Cancer

"These findings may have important therapeutic implications. Pancreatic cancer is one of the deadliest human malignancies. A striking feature of pancreatic cancer is that activating Kras mutations are found in ?90% of cases. However apart from a restricted population of cells expressing pancreatic and duodenal homeobox 1 (PDX1) most pancreatic cells are refractory to Kras-driven transformation. In the present study we sought to determine which subsets of PDX1+ cells may be responsible for tumor growth. Using the Lox-Stop-Lox“KrasG12D genetic mouse model of pancreatic carcinogenesis we isolated a population of KrasG12D-expressing PDX1+ cells with an inherent capacity to metastasize. This population of cells bears the surface phenotype of EpCAM+CD24+CD44+CD133“SCA1? and is closer in its properties to stem-like cells than to more mature cell types. We further demonstrate that the tumorigenic capacity of PDX1+ cells is limited becoming progressively lost as the cells acquire a mature phenotype. These data are consistent with the hypothesis that the adult pancreas harbors a dormant progenitor cell population that is capable of initiating tumor growth under conditions of oncogenic stimulation. We present evidence that constitutive activation of the mitogen-activated protein kinase (MAPK/ERK) signaling and stabilization of the MYC protein are the two main driving forces behind the development of pancreatic cancer cells with stem-cell“like properties and high metastatic potential. Our results suggest that pancreatic cells bearing Kras mutation can be induced to differentiate into quasi-normal cells with suppressed tumorigenicity by selective inhibition of the MAPK/ERK/MYC signaling cascade. pancreatic ductal adenocarcinoma cell of origin Chest Chest chest Chest Chest 0012-3692 1931-3543 American College of Chest Physicians 25117058 4188148 chest.14-0477 10.1378/chest.14-0477 Original Research Critical Care Aggressiveness of Intensive Care Use Among Patients With Lung Cancer in the Surveillance Epidemiology and End Results-Medicare Registry ICU Use Among Elderly Patients With Lung Cancer Cooke Colin R. MD Feemster Laura C. MD Wiener Renda Soylemez MD O™Neil Maya E. PhD Slatore Christopher G. MD From the Division of Pulmonary and Critical Care Medicine (Dr Cooke) Center for Healthcare Outcomes and Policy Institute for Healthcare Innovation and Policy Michigan Center for Integrative Research in Critical Care University of Michigan Ann Arbor MI; the Division of Pulmonary and Critical Care Medicine (Dr Feemster) VA Puget Sound Healthcare System and University of Washington School of Medicine Seattle WA; Boston University School of Medicine (Dr Wiener) Boston MA; Edith Nourse Rogers Memorial VA Hospital (Dr Wiener) Bedford MA; Health Services Research and Development (Drs O™Neil and Slatore) and Section of Pulmonary and Critical Care Medicine (Dr Slatore) Portland VA Medical Center; and the Division of Pulmonary and Critical Care Medicine (Dr Slatore) Department of Medicine Oregon Health and Science University Portland OR. CORRESPONDENCE TO: Colin R. Cooke MD University of Michigan Center for Healthcare Outcomes and Policy 2800 Plymouth Rd Bldg 16 Room 127W Ann Arbor MI 48109; e-mail: cookecrumich.edu 10 2014 19 6 2014 1 10 2015 146 4 916 923 25 2 2014 14 5 2014 2014 AMERICAN COLLEGE OF CHEST PHYSICIANS 2014 BACKGROUND: Approximately 65% of elderly patients with lung cancer who are admitted to the ICU will die within 6 months. Efforts to improve end-of-life care for this population must first understand the patient factors that underlie admission to the ICU. METHODS: We performed a retrospective cohort study examining all fee-for-service inpatient claims in the Surveillance Epidemiology and End Results (SEER)-Medicare registry for elderly patients (aged > 65 years) who had received a diagnosis of lung cancer between 1992 and 2005 and who were hospitalized for reasons other than resection of their lung cancer. We calculated yearly rates of ICU admission per 1000 hospitalizations via room and board codes or International Classification of Diseases Ninth Revision Clinical Modification and diagnosis-related group codes for mechanical ventilation stratified the rates by receipt of mechanical ventilation and ICU type (medical/surgical/cardiac vs intermediate) and compared these rates over time. RESULTS: A total of 175756 patients with lung cancer in SEER were hospitalized for a reason other than surgical resection of their tumor during the study period49373 (28%) of whom had at least one ICU stay. The rate of ICU admissions per 1000 hospitalizations increased over the study period from 140.7 in 1992 to 201.7 in 2005 (P < .001). The majority of the increase in ICU admissions (per 1000 hospitalizations) between 1992 and 2005 occurred among patients who were not mechanically ventilated (118.2 to 173.3 P < .001) and among those who were in intermediate ICUs (20.0 to 61.9 P < .001) but increased only moderately in medical/surgical/cardiac units (120.7 to 139.9 P < .001). S: ICU admission for patients with lung cancer increased over time mostly among patients without mechanical ventilation who were largely cared for in intermediate ICUs. Cell Death Dis Cell Death Dis Cell Death & Disease 2041-4889 Nature Publishing Group 24481441 4040650 cddis2013550 10.1038/cddis.2013.550 Original Ibuprofen enhances the anticancer activity of cisplatin in lung cancer cells by inhibiting the heat shock protein 70 Ibuprofen and cisplatin-mediated apoptosis Endo H 1 2 Yano M 1 2 * Okumura Y 1 Kido H 1 1Division of Enzyme Chemistry Institute for Enzyme Research The University of Tokushima Tokushima Japan 2Department of Nutrition School of Human Cultures The University of Shiga Prefecture Shiga Japan *Department of Nutrition School of Human Cultures The University of Shiga Prefecture Hikone Shiga 522-8533 Japan. Tel: +81 749 28 8441; E-mail: yano.mshc.usp.ac.jp 01 2014 30 01 2014 1 1 2014 5 1 e1027 25 06 2013 27 11 2013 10 12 2013 Copyright 2014 Macmillan Publishers Limited 2014 Macmillan Publishers Limited This work is licensed under a Creative Commons Attribution-NonCommercial-NoDerivs 3.0 Unported License. To view a copy of this license visit http://creativecommons./licenses/by-nc-nd/3.0/ Hsp70 is often overexpressed in cancer cells and the selective cellular survival advantage that it confers may contribute to the process of tumour formation. Thus the pharmacological manipulation of Hsp70 levels in cancer cells may be an effective means of preventing the progression of tumours. We found that the downregulation of Hsp70 by ibuprofen in vitro enhances the antitumoural activity of cisplatin in lung cancer. Ibuprofen prominently suppressed the expression of Hsp70 in A549 cells derived from lung adenocarcinoma and sensitized them to cisplatin in association with an increase in the mitochondrial apoptotic cascade whereas ibuprofen alone did not induce cell death. The cisplatin-dependent events occurring up- and downstream of mitochondrial disruption were accelerated by treatment with ibuprofen. The increase in cisplatin-induced apoptosis caused by the depletion of Hsp70 by RNA interference is evidence that the increased apoptosis by ibuprofen is mediated by its effect on Hsp70. Our observations indicate that the suppression of Hsp70 by ibuprofen mediates the sensitivity to cisplatin by enhancing apoptosis at several stages of the mitochondrial cascade. Ibuprofen therefore is a potential therapeutic agent that might allow lowering the doses of cisplatin and limiting the many challenge associated with its toxicity and development of drug resistance. Hsp70 apoptosis ibuprofen The human Hsp70 family includes ?8 highly homologous members that differ from each other by their intracellular localization and expression patterns.1 Among them the major stress-inducible Hsp70 (also called Hsp72) has an essential role in cell survival under stressful conditions. Compared with its normal counterpart Hsp70 is often overexpressed in various cancer cells and is suspected to contribute to the development of tumours.2 3 Indeed the expression of Hsp70 in certain cancer types has been correlated with poor prognosis and resistance to chemotherapy.45 6 Tumour cells often express several proteins that when abnormally elevated render the tumour resistant to apoptosis.7 Previous studies have confirmed not only that Hsp70 is cytoprotective but also that it interferes effectively with cell death induced by a wide variety of stimuli including several cancer-related stresses. Hsp70 is a potent inhibitor of the stress-activated kinase pathway and apparently blocks apoptotic signals via interactions with JNK Ask1 and SEK1.8910 11 Hsp70 is also a negative regulator of the mitochondrial pathway of apoptosis. Much of the focus on the antiapoptotic function of Hsp70 has been on events that occur after the disruption of the mitochondria. Hsp70 prevents the recruitment of procaspase-9 to the apoptosome and its functional complex formation by direct interaction with apoptotic protease-activating factor 1 (Apaf-1).12 13 Furthermore Hsp70 inhibits the activation of caspase-3 and the cleavage of caspase-3 targets such as ICAD and GATA-1.14 15 On the other hand recent studies have reported that Hsp70 can prevent apoptosis upstream of the mitochondria by inhibiting events which ultimately permeabilize the mitochondrial outer membrane such as the activation of Bax.16 17 As a result of the inhibition by Hsp70 of the apoptosis induced by several anticancer drugs as well as by other stimuli we hypothesized that cancer cells would be sensitized to the induction of apoptosis by the neutralization of Hsp70. Hsp70 has been indeed targeted with pharmaceuticals such as triptolide quercetin and KNK437 which downregulate its expression.1819 20 Although they have prevented the progression of various cancer cells in vitro and in vivo21 22 the optimal clinical use of these small Hsp70 inhibitors singly or combined with other chemotherapeutics remains a challenge. Our overall objective was to pharmacologically control the levels of Hsp70 and increase the effectiveness of anticancer drugs. Several experimental and epidemiologic studies and clinical trials have observed a powerful chemopreventive activity exerted by nonsteroidal anti-inflammatory drugs (NSAIDs).23 24 The anti-carcinogenic properties of NSAID have been attributed to their inhibition of cyclooxygenase (COX) enzymes. However much higher doses of NSAID are needed to obtain an antitumoural effect than to inhibit COX25 suggesting that they also act via COX-independent mechanisms. On the other hand NSAIDs such as aspirin salicylate and sulindac sulphide inhibit the proliferation of cells and induce apoptosis in various cancer cell lines which is considered an important component of their antitumoural activity and increased sensitization of cancer cells to anticancer drugs.262728 29 There is currently interest in the ability of NSAID to directly lower the levels of antiapoptotic molecules such as the Bcl-2 family30 and 14-3-3 protein31 which inhibits the intrinsic mitochondria-dependent apoptosis in various cancer cells. Therefore the NSAID-induced dysfunction of antiapoptotic proteins prompted us to examine whether other antiapoptotic molecules including Hsp70 might also be targets in the prevention of tumour progression by NSAID. In this study we show that ibuprofen is a potent inhibitor of Hsp70 which significantly suppresses its expression by depleting heat shock factor 1 (HSF1) in lung adenocarcinoma-derived A549 cells. The downregulation of Hsp70 by ibuprofen sensitized the cells to cisplatin which was associated with the enhancement of cisplatin-induced apoptotic signalling. Ibuprofen did not only facilitate postmitochondrial events including the activation of cisplatin-induced caspase-9 but also the activation of Bax causing the release of cytochrome c. Besides the demonstration of a similar increase in the sensitivity of A549 cells to cisplatin conferred by Hsp70 knockdown and ibuprofen these observations indicate that ibuprofen accelerates cisplatin-mediated apoptosis at multiple steps of the mitochondrial apoptotic pathway via the inhibition of Hsp70. We conclude that ibuprofen is a potential chemotherapeutic agent which might enable (a) the use of lower less toxic does of cisplatin and (b) the design of a new combination treatment of lung cancer. Results Ibuprofen suppresses the expression of Hsp70 in lung adenocarcinoma cells To define the role of Hsp70 in promoting the formation of tumours we first examined its expression in human lung cancer cell lines. Compared with BEAS-2B a human non-malignant bronchial epithelial cell line the expression levels of Hsp70 in lung cancer cells such as A549 and H358 adenocarcinoma were notably higher (Figure 1a). As in previous studies which showed an increased expression of Hsp70 in various types of human cancers including breast pancreas and colon we found that Hsp70 is also dysregulated in lung cancer cells. In this study we screened conventional NSAID in search of a new pharmacologic inhibitor which neutralizes Hsp70 as they induce apoptosis in cancer cells by selectively downregulating antiapoptotic proteins. The expression of Hsp70 after the exposure of A549 cells to various NSAID in non-toxic concentrations was analyzed by immunoblot. Ibuprofen in a 400-?M concentration decreased the expression of Hsp70 by 23% in comparison with untreated cells whereas other NSAID had no effect (Table 1). Figure 1b shows the decrease in Hsp70 protein and mRNA levels in A549 cells after treatment with various concentrations of ibuprofen versus no apparent decreases in Hsc70 and Actin. Ibuprofen also decreased the expression of Hsp70 in H358 a human lung adenocarcinoma cell line in a dose-dependent manner (Figure 1c). These results suggest that ibuprofen decreases the expression of Hsp70 in various lung cancer cell lines. Ibuprofen enhances the apoptosis induced by cisplatin by suppressing Hsp70 As ibuprofen prominently inhibited the expression of Hsp70 we next examined its effect on the proliferation of cancer cells. We observed no significant change in the viability of A549 and H358 cells after the exposure to ?800??M concentrations of ibuprofen alone which downregulates Hsp70 (Figure 2a) while the exposure to 1.0?mM concentration of ibuprofen caused cell death. Combined these observations indicate that the downregulation of stress-inducible Hsp70 was insufficient to cause the death of A549 and H358 cells. There is evidence that the inhibition of anti-apoptotic molecules such as Hsp70 increases the sensitivity of tumour cells to anticancer drugs thus improving the outcomes of chemotherapy. To study the therapeutic potential of ibuprofen we examined whether its antitumoural effects are synergistic with those of cisplatin widely used in the treatment of lung adenocarcinoma. When we measured the survival of A549 (top of Figure 2b) and H358 (bottom of Figure 2b) cells exposed to increasing concentrations of cisplatin incubated in presence versus absence of ibuprofen the latter prominently magnified the apoptosis induced by cisplatin a synergistic effect confirmed by terminal deoxynucleotidyl transferase-mediated dUTP nick and labelling (TUNEL) staining (Figure 2c). To ascertain the effects conferred by the expression of Hsp70 on cell death while excluding all effects of ibuprofen unrelated to Hsp70 we weakened the expression of Hsp70 by RNA interference (RNAi) (Figure 2d) and measured its effects on the apoptosis induced by cisplatin. The inhibition of Hsp70 decreased the viability of cisplatin-treated cells by approximately 20% (Figure 2e). Transfections with scrambled siRNA serving as a control showed no increase in cell death mediated by cisplatin. Cisplatin had no effect on the expression of Hsp70 (Figure 2g). We quantified the number of apoptotic cells in ibuprofen- and/or cisplatin-treated cultures using the CF488A-annexin V methods. Although cisplatin alone induced apoptosis in 10.2% of A549 cells the co-treatment with ibuprofen increased the percentage of apoptotic cells to 34.0% (Figure 2f). These observations suggest that ibuprofen sensitizes A549 cells to cisplatin by decreasing the expression of Hsp70. Ibuprofen decreases the expression of Hsp70 via transcriptional inactivation The reverse transcriptase-polymerase chain reaction (RT-PCR) analysis described earlier revealed a decrease in RNA level following treatment with ibuprofen suggesting that the expression of Hsp70 can be downregulated at the transcriptional level. After the recently discovered inhibition by its antagonists of the transcription of Hsp70 in cancer cells by blockade of the activation of HSF118 20 (which is often upregulated and constitutively activated in tumour formation) we studied the effects of ibuprofen on HSF1 in A549 cells. We first performed a ChIP assay to explore whether the inhibitory effect of ibuprofen is at the level of HSF1 DNA binding. As expected we found an unequivocal association between HSF1 and the Hsp70 gene promoter containing the HSE site in ibuprofen-untreated cells (Figure 3a). It is noteworthy that ibuprofen eliminated this binding (Figure 3a) suggesting that it inhibits the expression of Hsp70 via the action of HSF1. This also suggests that ibuprofen blocks the binding of HSF1 chromatin or the steps which precede in several processes needed to activate HSF1. Therefore we broadened our analysis to examine the effect of ibuprofen on the expression of HSF1. Compared with unexposed control cells the HSF1 mRNA level was significantly lower in cells exposed to ibuprofen (bottom of Figure 3b). Consistent with its effect on the expression of mRNA ibuprofen also decreased the expression of HSF1 protein in a dose-dependent fashion (top of Figure 3b). To confirm the inhibition of HSF1-mediated Hsp70 by ibuprofen we lowered the amounts of HSF1 present in A549 cells by RNAi and studied its effect on the expression of Hsp70. The treatment of cells with HSF1 dsRNA decreased the Hsp70 level compared with that measured in cells untreated with dsRNA (Figure 3c). Ibuprofen decreased the expression of HSF1 by 16% in comparison with untreated cells whereas other NSAID had no effect (Table 2). Overall these observations indicate that ibuprofen inhibited the expression of Hsp70 by depleting the HSF1 in A549 cells. Ibuprofen accelerates the mitochondrial apoptotic process induced by cisplatin Several studies have found that mitochondria might be a direct and important target of cisplatin in sensitive cells.32 33 We studied the effects of ibuprofen on the depolarization of mitochondrial membranes and the cytochrome c release induced by cisplatin. A549 cells with or without cisplatin were incubated in absence or presence of ibuprofen and stained with JC-1. Treatment with cisplatin and ibuprofen lowered the mitochondrial membrane potential manifest by an attenuated red and an enhanced green mitochondrial fluorescence (Figure 4a lower right panel) compared with that observed with cisplatin alone (Figure 4a upper right panel) while control (Figure 4a upper left panel) or ibuprofen alone (Figure 4a lower left panel) produced the red-dotted staining pattern of polarized mitochondria. The intensity of green mitochondrial fluorescence in cisplatin-treated cells is significantly increased (36.56 to 55.56%) by the co-treatment with ibuprofen. Ibuprofen also promoted the release of cytochrome c from the mitochondria induced by cisplatin (Figure 4b). These findings unequivocally indicated that in A549 cells ibuprofen enhanced the mitochondria-dependent apoptosis caused by cisplatin. Ibuprofen increases the activation of Bax induced by cisplatin The translocation of the pro-apoptotic protein Bax to the mitochondria is closely associated with the apoptosis induced by cisplatin. To explore the mechanisms by which ibuprofen promotes the apoptosis mediated by mitochondria in response to cisplatin we examined whether it was due to its ability to stimulate the translocation of Bax by cisplatin. We first monitored conformational changes in Bax as indicators of its activation. Western blot analysis of the immunoprecipitates with a conformation specific anti-Bax (6A7) antibody which only recognizes the active form revealed the presence of active Bax in A549 cells treated with cisplatin (Figure 5a lane 4) although not in untreated cells (Figure 5a lanes 1 and 2). Further exposure of the cisplatin-treated cells to ibuprofen caused a 1.5-fold increase in active Bax compared with incubation with cisplatin alone (Figure 5a lane 3). When we analyzed the effects conferred by ibuprofen on the translocation of Bax to mitochondria in cisplatin-treated cells we observed an approximately 1.3-fold increase in the amount of translocated Bax (Figure 5b). To exclude an effect of ibuprofen unrelated to the inhibition of Hsp70 we performed RNAi for a selective knock-down of Hsp70 and we studied its effects on the activation of Bax. Consistent with the earlier data presented for ibuprofen the depletion of Hsp70 increased the activation of Bax in cisplatin-treated cells although its extent was greater with Hsp70 RNAi than with ibuprofen (Figure 5c). These observations confirmed that (a) ibuprofen promotes the activation of Bax dependent on cisplatin and its translocation to the mitochondria in A549 cells and (b) its mechanism of action is mediated by the inhibition of Hsp70. Ibuprofen facilitates events occurring upstream and downstream of mitochondrial disruption in cisplatin-mediated apoptosis Previous studies have shown that Hsp70 can inhibit apoptosis by acting downstream of the mitochondria.121314 15 Hsp70 interacts directly with Apaf-1 to prevent the formation of cytochrome c-mediated apoptosome and subsequent activation of caspase-9. To examine whether ibuprofen also influences the downstream mitochondrial events we measured its effects on the cleavage of procaspase-9 in the apoptosis mediated by cisplatin. With an anti-active caspase-9 antibody fully processed caspase-9 was predominantly identified in cisplatin-treated A549 cells (Figure 6a lane 3) over untreated cells (Figure 6a lanes 1 and 2). It is noteworthy that treatment with ibuprofen increased >4-fold the amount of active caspase-9 in cells treated with cisplatin compared with cells incubated with cisplatin alone (Figure 6a lane 4). As as reported earlier the highest increases in the activation of Bax and release of cytochrome c by ibuprofen were <2-fold these observations suggest that ibuprofen also facilitates the post mitochondrial process taking place between the release of cytochrome c and the activation of caspase-9. To verify that this is a specific effect we studied the effect of Hsp70 knock-down on the activation of caspase-9 mediated by cisplatin. The caspase-9 activity in cells depleted of Hsp70 with cisplatin was fourfold greater than in control (scrambled) siRNA-treated cells (Figure 6b). We obtained similar results when we measured the activity of caspase-9 in cells treated with ibuprofen (Figure 6c) or siRNA against Hsp70 (Figure 6d) by a fluorometric assay using a synthetic substrate. Overall these observations confirmed unambiguously that ibuprofen intensified the apoptosis induced by cisplatin by its effects on the events occurring downstream of the mitochondria by inhibiting Hsp70 although whether it stimulated the formation of apoptosome (essential for the recruitment of procaspase-9) remains to be determined. We conclude that ibuprofen promotes the apoptosis induced by cisplatin at multiple stages of the mitochondrial cascade by attenuating the expression of Hsp70 in A549 cells. Discussion We found that compared with non-malignant bronchial epithelial cells human lung cancer cells overexpressed Hsp70. This is an important observation as targeting the expression or function of Hsp70 has been suggested as an effective treatment strategy in several cancers based on the hypothesis that higher levels of Hsp70 protect against cell death and increase the survival rate against modalities used in chemotherapy.11 15 In fact it is well documented that the expression of Hsp70 is significantly increased in cancer tissues and/or serums obtained from patients with non-small cell lung cancer (NSCLC)34353637 38 and its overexpression correlates with poor prognosis in NSCLC.36 Several reports have indicated that functionally related small molecules that inhibit Hsp70 decrease the viability of colo-rectal or pancreatic cancer cells by promoting apoptosis via the downregulation of Hsp70 and may be a promising new class of cancer chemotherapeutics.1921 22 We showed that ibuprofen a relatively non-toxic and widely used NSAID significantly decreased the expression of Hsp70 in lung adenocarcinoma cell lines. We also clearly demonstrated that the inhibitory mechanisms of ibuprofen on Hsp70 are due to a decrease in HSF1 expression. Although the fundamental mechanism behind the reduction in HSF-1 expression is unknown a previous study has indicated that the nuclear factor 1 family member NFIX which codes for site-specific DNA-binding proteins known to have multiple roles in replication signal transduction and transcription exerts a transcriptional repressive effect on the expression of HSF1 in cancer cells.39 Whether NFIX is indeed involved in the inhibition of HSF1 expression evoked by ibuprofen is applicable in further studies. To the best of our knowledge this is the first study of the inhibitory effects of NSAID on the cellular expression of Hsp70. In addition we showed that ibuprofen does not influence the cell viability without additional stimuli unlike its maximal effect on the expression of Hsp70. The lack of inhibitory efficacy of ibuprofen against tumours is consistent with a previous study which showed that low-dose ibuprofen did not induce apoptosis in mouse and human colorectal cancer cell lines.29 Similar observations were made following RNAi of Hsp70 suggesting that the attenuation of Hsp70 per se is insufficient to cause the death of A549 and perhaps other cells. It has been shown that the knockdown of Hsp70 has no effect on the viability of several cancer cell lines although sensitized them to anticancer drugs.40 41 Therefore the therapeutic potential of ibuprofen combined with chemotherapeutic agents needs to be explored. Cisplatin is one of most effective chemotherapeutic drugs against NSCLCs.42 It is noteworthy that damage to DNA caused by cisplatin enables apoptosis involving mitochondrial pathways which is negatively regulated by Hsp70. As ibuprofen prominently suppressed the expression of Hsp70 in A549 and H358 cells we examined the possible synergistic activity of ibuprofen and cisplatin against cancer. As expected ibuprofen potentiated synergistically the anti-proliferative effect of cisplatin in A549 and H358 cells. Despite its potent antitumoural properties the therapeutic use of cisplatin in oncology is seriously limited by dose-dependent adverse effects and frequent development of drug resistance.43 Therefore our findings may make useful contributions toward the development of new and less toxic chemotherapy against NSCLCs. We also examined the molecular mechanisms of these synergistic properties of ibuprofen. Hsp70 protects cells against mitochondria-dependent apoptosis at different levels although the precise mechanism remains hypothetical because of regular contradictory descriptions of Hsp70 function. Earlier reports have shown a protective effect of Hsp70 against cellular apoptosis by inhibition of the apoptosome function a protein complex comprising Apaf-1 and cytochrome c.12 13 However recent reports have questioned this repression of apoptosis downstream of the mitochondrial membrane permeabilization."

Lung_Cancer

"lung cancer patients undergoing radiation therapy. Before 4DCT-ventilation can be implemented clinically it needs to be validated against an established imaging modality. The purpose of this work was to compare 4DCT-ventilation to nuclear medicine ventilation using clinically relevant global metrics and radiologist observations. Methods and Materials Fifteen lung cancer patients with 16 sets of 4DCT and nuclear medicine ventilation-perfusion (VQ) images were used for the study. The VQ-ventilation images were acquired in planar mode using Tc-99m-labeled diethylenetriamine-pentaacetic acid aerosol inhalation. 4DCT data spatial registration and a density-change-based model were used to compute a 4DCT-based ventilation map for each patient. The percent ventilation was calculated in each lung and each lung third for both the 4DCT and VQ-ventilation scans. A nuclear medicine radiologist assessed the VQ and 4DCT scans for the presence of ventilation defects. The VQ and 4DCT-based images were compared using regional percent ventilation and radiologist clinical observations. Results Individual patient examples demonstrate good qualitative agreement between the 4DCT and VQ-ventilation scans. The correlation coefficients were 0.68 and 0.45 using the percent ventilation in each individual lung and lung third respectively. Using radiologist-noted presence of ventilation defects and receiver operating characteristic analysis the sensitivity specificity and accuracy of the 4DCT-ventilation were 90%0.64 and 81% respectively. Conclusions The current work compared 4DCT with VQ-based ventilation using clinically relevant global metrics and radiologist observations. We found good agreement between the radiologist™s assessment of the 4DCT and VQ-ventilation images as well as the percent ventilation in each lung. The agreement lessened when the data were analyzed on a regional level. Our study presents an important step for the integration of 4DCT-ventilation into thoracic clinical practice. Korean J Radiol Korean J Radiol KJR Korean Journal of Radiology 1229-6929 2005-8330 The Korean Society of Radiology 24642766 3955798 10.3348/kjr.2014.15.2.295 Thoracic Imaging Case Report A Rare Case of Diffuse Pulmonary Lymphangiomatosis in a Middle-Aged Woman Lim Hyun-ju MD 1 Han Joungho MD 2 Kim Hong Kwan MD 3 Kim Tae Sung MD 1 1Department of Radiology and Center for Imaging Sungkyunkwan University School of Medicine Seoul 135-710 Korea. 2Department of Pathology Sungkyunkwan University School of Medicine Seoul 135-710 Korea. 3Department of Thoracic Surgery Sungkyunkwan University School of Medicine Seoul 135-710 Korea. Corresponding author: Joungho Han MD Department of Pathology Samsung Medical Center Sungkyunkwan University School of Medicine 81 Irwon-ro Gangnam-gu Seoul 135-710 Korea. Tel: (822) 3410-2765 Fax: (822) 3410-0025 joungho.hansamsung.com Mar-Apr 2014 07 3 2014 15 2 295 299 03 1 2013 13 12 2013 Copyright 2014 The Korean Society of Radiology 2014 This is an Open Access distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons./licenses/by-nc/3.0/) which permits unrestricted non-commercial use distribution and reproduction in any medium provided the original work is properly cited. Diffuse pulmonary lymphangiomatosis (DPL) is a rare lymphatic disorder characterized by lymphatic channel proliferation. It is mostly reported in children and young adults. Here we report a case involving a 52-year-old asymptomatic woman who presented with increased interstitial markings as seen on a chest radiograph. Diffuse interstitial septal thickening was found on a serial follow-up chest computed tomography scan and lymphangitic metastasis was the primary radiologic differential diagnosis. However histologic sections of wedge resected lung revealed diffuse pleural and interlobular septal lymphatic proliferation characteristic of DPL. Lymphangiomatosis Interstitial Lung Computed tomography INTRODUCTION Diffuse pulmonary lymphangiomatosis (DPL) is a diffuse lymphatic disease characterized by the proliferation of lymphatic vessels. DPL mostly affects children and young adults with an equal gender prevalence. DPL is a very rare disease and so far only five cases have been reported in middle-aged patients in the English-language literature to our knowledge (1-5). Computed tomography (CT) findings for DPL include increased interlobular septal thickening peribronchovascular thickening patchy ground glass opacities pleural thickening pleural effusion and mediastinal soft tissue infiltration (5). Possible radiologic differential diagnoses include pulmonary edema pulmonary veno-occlusive disease Erdheim-Chester disease lymphangiectasis lymphangitic carcinomatosis sarcoidosis and pulmonary lymphoma. An increase in the size and the number of anastomosing lymphatic channels in interlobular septa or subpleural areas is seen histopathologically (2). Patients with DPL present with various clinical manifestations and usually have a progressive clinical course (2). Here we describe a middle-aged woman with DPL in whom clinical suspicion of lymphangitic metastasis was raised preoperatively. CASE REPORT A 52-year-old woman with abnormal chest radiographs was referred to our hospital. She was asymptomatic and denied having any cough wheezing or hemoptysis. Her past medical history was unremarkable. The findings of a physical examination were normal. Laboratory examination revealed a hemoglobin level of 14.1 g/dL a white blood cell count of 8160/µL (61.7% neutrophils 31.1% lymphocytes 2.6% eosinophils 4.4% monocytes and 0.2% basophils) and a platelet count of 209000/µL. Urine analysis findings blood chemistry findings and erythrocyte sedimentation rates were normal. Posteroanterior chest radiograph showed increased interstitial markings in both lungs (Fig. 1A). Diffuse smooth and nodular interlobular septal thickening and minimal amounts of bilateral pleural effusion were demonstrated on CT scan (Fig. 1B C). Low-density infiltration of mediastinal fat and lymph node enlargement were noted in the right anterior diaphragmatic area of a mediastinal window (Fig. 1D). Although the patient was asymptomatic these imaging findings persisted on the follow-up CT scan taken one month later. Our primary radiologic impression was that this was a case of lymphangitic carcinomatosis. Pulmonary edema sarcoidosis and lymphoma were included in the differential diagnosis. "

Lung_Cancer

"In one study the ferritin level was found to be higher in malignant pleural effusion than in benign pleural effusion [27]. An experimental study conducted in mesothelioma cases found raised copper levels in mesothelioma cells and reported copper as a possible marker of mesothelioma [28]. In our study the copper levels were similar in the asbestos and control groups; however MM group had a higher copper level as compared to the other two groups. Ceruloplasmin is a copper-carrying glycoprotein. It uses iron oxidase activity to prevent the occurrence of toxic iron products. In the present study ceruloplasmin level was higher in the asbestos group than in the control group while it was also higher in the MM group than in the asbestos group. One study investigated acute phase reactants in rats with asbestos exposure and found elevated ceruloplasmin concentrations [29]. In another study ceruloplasmin levels were observed to be high in lung cancer [30]. In a study in Finland high serum ceruloplasmin concentrations during the years prior to diagnosis were associated with an increased risk of cancer especially with lung cancer [31]. Determining markers that can predict MM development following environmental asbestos exposure are an important research field. Further prospective studies including long follow-up periods are needed to more clearly understand the predictive efficacy of inflammatory and oxidative markers. In the presence of higher transferrin lower ferritin and similar CRP levels in the asbestos group as compared to the control group shows the inflammation in the background. However we believe that elevated acute phase reactants and oxidative stress markers (TOL and OSI) in the MM group can be used as predictive markers for the development of asbestos-related malignancy. Conflict of Interests The authors declare that this paper has not been published anywhere previously and is not simultaneously being considered for any other publication. They are grateful to Dicle University DUBAP for their sponsorship about English editing of this paper. This study has not been published or submitted elsewhere and there is no conflict of interests for this study. 1 Mossman BT Churg A Mechanisms in the pathogenesis of asbestosis and silicosis American Journal of Respiratory and Critical Care Medicine 1998 157 5 1666 1680 2-s2.0-0031799746 9603153 2 Janssen YMW Marsh JP Absher MP Expression of antioxidant enzymes in rat lungs after inhalation of asbestos or silica The Journal of Biological Chemistry 1992 267 15 10625 10630 2-s2.0-0026658119 1316905 3 Sarban S Kocyigit A Yazar M Isikan UE Plasma total antioxidant capacity lipid peroxidation and erythrocyte antioxidant enzyme activities in patients with rheumatoid arthritis and osteoarthritis Clinical Biochemistry 2005 38 11 981 986 2-s2.0-27744591295 16150434 4 Blokhina O Fagerstedt KV Oxidative metabolism ROS and NO under oxygen deprivation Plant Physiology and Biochemistry 2010 48 5 359 373 2-s2.0-77953152723 20303775 5 Matsuzaki H Maeda M Lee S Asbestos-induced cellular and molecular alteration of immunocompetent cells and their relationship with chronic inflammation and carcinogenesis Journal of Biomedicine and Biotechnology 2012 2012 9 pages 492608 6 Janssen YMW Marsh JP Absher MP Oxidant stress responses in human pleural mesothelial cells exposed to asbestos American Journal of Respiratory and Critical Care Medicine 1994 149 3 795 802 2-s2.0-0028343981 8118652 7 Erel O A new automated colorimetric method for measuring total oxidant status Clinical Biochemistry 2005 38 12 1103 1111 2-s2.0-29144527533 16214125 8 Coussens LM Werb Z Inflammation and cancer Nature 2002 420 6917 860 867 2-s2.0-0037180757 12490959 9 Philip M Rowley DA Schreiber H Inflammation as a tumor promoter in cancer induction Seminars in Cancer Biology 2004 14 6 433 439 2-s2.0-5444256371 15489136 10 Robinson SC Coussens LM Soluble mediators of inflammation during tumor development Advances in Cancer Research 2005 93 159 187 2-s2.0-19844373824 15797447 11 Federico A Millo F Tuccillo C Ciardiello F Loguercio C Chronic inflammation and oxidative stress in human carcinogenesis International Journal of Cancer 2007 121 11 2381 2386 2-s2.0-35648946229 12 Craighead JE Abraham JL Churg A The pathology of asbestos-associated diseases of the lungs and pleural cavities: diagnostic criteria and proposed grading schema. Report of the Pneumoconiosis Committee of the College of American Pathologists and the National Institute for Occupational Safety and Health Archives of Pathology and Laboratory Medicine 1982 106 11 544 596 2-s2.0-0020477738 6897166 13 Manning CB Vallyathan V Mossman BT Diseases caused by asbestos: mechanisms of injury and disease development International Immunopharmacology 2002 2 2-3 191 200 2-s2.0-0036147411 11811924 14 Kinnula VL Crapo JD Superoxide dismutases in the lung and human lung diseases American Journal of Respiratory and Critical Care Medicine 2003 167 12 1600 1619 2-s2.0-0038545583 12796054 15 Matsuzaki H Maeda M Lee S Asbestos-induced cellular and molecular alteration of immunocompetent cells and their relationship with chronic inflammation and carcinogenesis Journal of Biomedicine and Biotechnology 2012 2012 9 pages 492608 16 Osada H Takahashi T Genetic alterations of multiple tumor suppressors and oncogenes in the carcinogenesis and progression of lung cancer Oncogene 2002 21 48 7421 7434 2-s2.0-0037152635 12379883 17 Syslov¡ K Kacer P Kuzma M Rapid and easy method for monitoring oxidative stress markers in body fluids of patients with asbestos or silica-induced lung diseases Journal of Chromatography B 2009 877 24 2477 2486 18 Tanrikulu AC Abakay A Kaplan MA A Clinical radiographic and laboratory evaluation of prognostic factors in 363 patients with malignant pleural mesothelioma Respiration 2010 80 6 480 487 2-s2.0-78649327372 20881372 19 Abu-Youssef H Amin S Amin H Osman E Value of C-reactive protein in etiologic diagnos?s of pleural effusion The Egyptian Journal of Bronchology 2010 4 124 130 20 Nojiri S Gemba K Aoe K Survival and prognostic factors in malignant pleural mesothelioma: a retrospective study of 314 patients in the west part of Japan Japanese Journal of Clinical Oncology 2011 41 1 32 39 2-s2.0-78650794570 20798232 21 Chan ED Pott GB Silkoff PE Ralston AH Bryan CL Shapiro L Alpha-1-antitrypsin inhibits nitric oxide production Journal of leukocyte biology 2012 92 6 1251 1260 22975343 22 Huuskonen MS Rsnen JA Hrk¶nen H Asp S Asbestos exposure as a cause of immunological stimulation Scandinavian Journal of Respiratory Diseases 1978 59 6 326 332 2-s2.0-0018217639 311941 23 Kasprzyk M Dyszkiewicz W Zwaru? D Szydlik S Le?niewska K Krzyzanowski M The quantitative evaluation of the serum acute phase proteins (APP) of patients undergoing a curative resection for non-small cell lung cancer (NSCLC) Przeg?d Lekarski 2006 63 10 936 940 2-s2.0-33947492701 24 Wu C Chen C Yang Y Hao C Ni J Che D Relationship between the expression of alpha 1-antitrypsinase in bronchioalveolar carcinoma and clinical pathology Journal of Tongji Medical University 2000 20 1 26 28 2-s2.0-0642366560 12845749 25 Y?ld?r?m A Meral M Kaynar H Polat H U§ar EY Relationship between serum levels of some acute-phase proteins and stage of disease and performance status in patients with lung cancer Medical Science Monitor 2007 13 4 CR195 CR200 2-s2.0-34147180985 17392651 26 Milman N Pedersen LM The serum ferritin concentration is a significant prognostic indicator of survival in primary lung cancer Oncology Reports"

Lung_Cancer

"We demonstrated in this study that the MSLN-targeted fusion protein elicited significant tumor-specific CD8+ T-cell immune responses in ovarian cancer-bearing mice and this adaptive antitumor response has an absolute requirement for tumor-specific CD8+ T cells. Although at the dosing schedule used in these studies tumor-specific T-cell responses did not eventually lead to rejection of the established tumors they significantly prolonged survival time in tumor-bearing mice. DCs are believed to play a pivotal role in the initiation and programming of tumor-specific T-cell responses and are becoming an essential target in efforts to generate therapeutic immunity against cancer [33]. Two main approaches are currently under consideration for providing DCs with tumor-specific antigens. One approach is to culture patient-derived DCs ex vivo with an adjuvant that induces DC maturation in the presence of tumor specific antigens followed by adoptive transfer into the patient [33]. This approach is fraught with technical and practical difficulties such as selection of a suitable antigenic target inappropriate maturation state of selected DCs and the difficulty of generating a sufficient number of DCs ex vivo. In addition a number of investigators have recently reported that ex vivo-derived DC vaccines have an insignificant role in the direct priming of T cells in vivo[33-35]. An alternative approach to generate tumor-specific antigen bearing DCs is to induce them to take up tumor-specific antigens in vivo. It has been shown that in vivo specific targeting of tumor antigens to DCs improves the induction of antigen-specific CD4+ and CD8+ T-cell immunity. In these studies an agonistic anti-CD40 monoclonal antibody was used to mature DCs and eliminate antigen-specific tolerance [36-39]. MTBHsp70 has also been shown to stimulate inflammation and DC maturation via an interaction with CD40 receptors on both DCs and monocytes thus acting as an alternative ligand to CD40L [2940]. In our study we showed the fusion protein up-regulates surface expression of phenotypic markers of DC maturation. Interestingly in addition to CD80 CD86 and MHC class II molecules the expression of CD40 is also enhanced indicating a possible positive feedback loop involving CD40 signaling components. Beyond promoting DC maturation the scFvMTBHsp70 fusion protein also targets tumor cells towards the matured DCs. We propose that binding of the fusion protein with both tumor cells and DCs improves phagocytosis of parts of tumor cells by DCs and therefore any tumor antigen can be processed and loaded on both MHC class II and MHC class I molecules and presented to CD4+ and CD8+ T cells. This could explain the observed augmentation of tumor antigen presentation and cross-presentation brought about by the fusion protein in vitro. This may also explain the observed increased anti-Her2/neu CD8+ T-cell responses in the scFvMTBHsp70-treated ovarian tumor bearing mice although Her2/neu is not directly targeted. We recapitulated these in vitro findings in an in vivo tumor cell immunogenicity study. We used the fusion protein to activate and mature DCs in the skin such as Langerhans cells. These DCs then captured tumor cells or tumor cell fragments through the connection established by the fusion protein and migrated to the draining lymphoid ans where they presented tumor antigens to na¯ve T cells. T cells recovered from the draining lymph node showed significantly enhanced responses to stimulation with a range of tumor antigens. Conclusion Our study provides preclinical evidence that supports a protein-based immunotherapy that induces anti-tumor immune responses which normally require dendritic cell-based approaches. The MSLN-targeted MTBHsp70 fusion protein binds MSLN on tumor cells recruits and activates APCs including DCs loads DCs in vivo with the broadest profile of naturally processed tumor antigens promotes tumor antigen presentation and cross-presentation and enhances tumor specific CD4+ and CD8+ T-cell responses (Figure 5). Our study supports the continued exploration of this novel fusion protein alone or in combination with immune checkpoint inhibitors following conventional surgical reduction and chemotherapy for MSLN-expressing cancers. This new approach could significantly increase time to recurrence and survival in humans with ovarian cancer and mesothelioma where effective second line treatment options are very limited. A schematic model showing that the scFvMTBHsp70 fusion protein binds with MSLN on tumor cells and activates antigen presenting cells (APCs) thus promoting uptake of tumor cells or tumor cell fragments and promoting tumor antigen presentation and cross-presentation as well as adjuvanting tumor specific CD4 + and CD8 + T-cell responses. Methods Production of proteins The plasmid pQE30-MTBhsp70 that encodes full length MTBHsp70 was a generous gift from Dr. Peter Sveshnikov (Moscow Medical Academy Russia). The plasmid pTOR2-scFv that encodes an scFv fragment specific to MSLN and the recombinant P4 scFv protein [13] generated and purified from yeast were generous gifts from Dr. Nathalie Scholler (Penn Ovarian Cancer Research Center University of Pennsylvania). The DNA fragment corresponding to a 15 amino acid linker (GGGGSGGGGSGGGGS) was connected to the scFv at its C-terminal using an overlap PCR approach. The PCR product scFv-linker was subcloned into pQE30-MTBhsp70 at the N-terminal of MTBhsp70. The DNA fragment for scFvMTBhsp70 was PCR amplified and cloned into pPMY5 (Promab) downstream of a human IgG1 Fc domain and separated from the Fc region by the signal cleavage sequence for Tobacco Etch Virus protease (TEV enzyme). scFvMTBHsp70 the MSLN-targeted fusion protein was generated from HEK293 cells and purified using Protein G resin (Pierce). The Fc region of the Protein G eluted protein was then cleaved from the fusion protein by TEV enzyme (Promab) digestion. MTBHsp70 was generated using the same expression system. The production and purification of these two proteins was accomplished by Promab Biotechnologies Inc. at Richmond CA. After purification and hIgG-Fc tag removal the integrity of scFv-MTBHsp70 and MTBHsp70 were determined by SDS-PAGE followed by staining with RAPIDstain (G-Bioscience). Endotoxin contamination levels in scFvMTBHsp70 and MTBHsp70 were determined by Limulus Amebocyte Lysate Assay (LAL-assay Cambrex). Cells The BR5FVB1 ovarian cancer cells a kind gift from Dr. Orsulic in Women™s Cancer Research Institute at Cedars-Sinai Medical Center [41] or 40L mesothelioma cells a kind gift from Dr. Kane in Department of Pathology and Laboratory Medicine at Brown University [42] were maintained at 37°C in DMEM with 2 mmol/L L-glutamine 10 units/ml penicillin 10 ?g/ml streptomycin and 10% fetal bovine serum in humidified atmosphere with 5% CO2. Cells were cultured until 80% confluent and harvested with enzyme-free cell-dissociation buffer (Gibco) for in vitro tumor cell binding assays and cross-presentation studies or harvested with Trypsin EDTA (Mediatech) for animal injections. Mouse PBLs were obtained from FVB mice via tail vein bleeds after lysis of erythrocytes using M-lyse buffer (R&D systems). Small pieces of parietal peritoneal membrane were taken from the mice and digested in enzyme-free cell-dissociation buffer to obtain mouse peritoneal mesothelial cells. To test whether scFvMTBHsp70 or MTBHsp70 binds to the MSLN-expressing tumor cells or non-cancerous cells we incubated BR5FVB1 ovarian tumor cells 40L mesothelioma cells or normal cells from FVB mice including PBLs splenocytes and peritoneal mesothelial cells with 40 ?g/ml scFvMTBHsp70 or 26 ?g/ml MTBHsp70 followed by anti-MTBHsp70 (IgG2a) (Biodesign International) biotinylated anti-IgG2a (BD Bioscience) and Streptavidin-APC (BioLegend) and then analyzed the tumor cells by flow cytometry. As controls cells were incubated with the reagents described above except scFvMTBHsp70 or MTBHsp70. To confirm that scFv portion of the fusion protein binds to MSLN on the surface of tumor cells scFvMTBHsp70 or MTBHsp70 was preincubated with 12 ?g/ml of recombinant human MSLN (R&D Systems) for 30 min before adding to the cells. For fluorescence microscopy cells were cultured on coverslips until 50% confluent stained with 10 ?g/ml scFvMTBHsp70 or 6.5 ?g/ml MTBHsp70 followed by mouse anti-MTBHsp70 (1:500 dilution) and Donkey anti-mouse Alexa Fluor 594 (Invitrogen 1:500 dilution). Cells were observed using a Nikon Eclipse TiE fluorescence microscope. In some experiments tumor cells were treated with 20 ?g/ml mitomycin C at a concentration of 5 — 106/ml for 1 h in a 37°C water bath and washed with complete medium at least 3 times before use. Animal models and tumor treatment Ovarian cancer was established by i.p. injection of syngeneic cancer cells BR5FVB1 (107 cells per mouse) into 6-week-old female FVB/NJ mice as previously described [25]. All mice were purchased from Jackson laboratories. Intraperitoneal mesotheliomas were established by i.p. injection of syngeneic 40L cells (2?—?106 per mouse) into 6-week-old male C57BL/6 mice as previously described [42]. Mice with ovarian tumors were treated 7 days after BR5FVB1 tumor cell inoculation with i.p. injections of scFvMTBHsp70 (2 ?g per mouse) normal saline or an equimolar mixture of MTBHsp70 plus P4 scFv. This was followed by 3 further treatments at 4-day intervals. In the mesothelioma model C57BL/6 mice were treated 5 days after 40L tumor cell inoculation and injected i.p. with scFvMTBHsp70 (2 ?g per mouse) normal saline or an equimolar mixture of MTBHsp70 plus P4 scFv. Three subsequent doses were administered at 3-day intervals thereafter. For survival studies we observed the mice daily 3 weeks after inoculation of BR5FVB1 cells or 1 week after inoculation of 40L cells. Tumor generations were consistently first evident via abdominal distension secondary to malignant ascites and tumor-bearing mice were euthanized at the endpoint when there were signs of distress including fur ruffling rapid respiratory rate hunched posture reduced activity and progressive ascites formation as previously described [25]. For the investigation of anti-tumor T-cell responses all ovarian tumor-bearing mice were sacrificed 7 days after the final scheduled treatment. All studies were performed in a manner that was blinded to the observer under protocols that were approved by the Massachusetts General Hospital Subcommittee on Research Animal Care (SRAC). Treatment of na¯ve mice with experimental or control protein 6-week-old male C57BL/6 mice were injected i.p. with scFvMTBHsp70 (2 ?g per mouse) normal saline or an equimolar mixture of MTBHsp70 plus P4 scFv. Three subsequent doses were administered at 3-day intervals thereafter. Seven days post the administration of the final treatment mice were sacrificed and abdominal wall and intestine were retrieved for histopathological studies of mesothelial tissues. Ex vivo assessment of tumor specific T-cell functions Single cell suspensions were prepared from spleens. Cells were plated in round-bottomed 96-well plates pulsed with a validated CD8+ T-cell Her2/neu peptide (PDSLRDLSVF 1 ?g/ml; EZBiolab) [2543] an in-house designed H2d-restricted MSLN Ld1 peptide (IPLSYLCDF 1 ?g/ml; EZBiolab) that did not induce ovarian cancer specific T-cell response in H-2q FVB mice or medium alone for 72 hours when Golgi Plug (BD Bioscience) was added for the last 5 hours as previously described [44] and then stained with fluorophore-conjugated anti-CD3 anti-CD4 anti-CD8 anti-IFN? (BD Pharmingen) and anti-Granzyme B (eBioscience) antibodies. Cells were then analyzed on a LSRII 4 laser (BD Biosciences). Depletion of CD8+ T cells in vivo FVB/NJ mice were injected i.p. with 200 ?g of anti-CD8 monoclonal antibody (mAb)(53“6.72 Bio X Cell) or an isotype-matched irrelevant rat IgG2a (2A3 Bio X Cell) 2 days before 1 day before and 1 day after i.p. inoculation with BR5FVB1 ovarian tumor cells. Depletion was continued once every week until 29 days after tumor inoculation. The mice were treated with scFvMTBHsp70 or saline as described above. All the mice were bled from the tail vein and the depletion of CD8+ cells was examined by flow cytometry analysis of peripheral blood cells stained with fluorophore-conjugated anti-CD8 on days 7 and 28 after tumor inoculation. Generation and purification of bone marrow-derived DCs (BMDCs) CD11c+ DCs were generated from bone marrow cells of FVB/NJ mice as described [45-47] with minor modifications. Briefly erythrocyte-depleted mouse bone marrow cells from flushed marrow cavities were cultured in complete RPMI 1640 with 10 ng/ml GM-CSF and 1 ng/ml IL-4 at 1 — 106 cells/ml. Medium was changed on day 3. On day 7 DCs were harvested by gentle pipetting and purified with magnetic microbeads conjugated to a monoclonal antibody against CD11c (MiltenyiBiotec) as described [4648] according to the manufacturer™s recommended protocol. In vitro activation of BMDCs CD11c+ BMDCs were plated in a 24-well plate at a density of 2?—?106 cells/ml and incubated with 2 ?g/ml scFvMTBHsp70 (105 kDa) 1.3 ?g/ml MTBHsp70 (70 kDa) 1 ?g/ml LPS equivalent to 103 EU/ml endotoxin (InvivoGen San Diego CA) or 0.1 ng/ml (0.1 EU/ml) LPS equivalent to endotoxin found in 2 ?g/ml of proteins (since LPS level is less than 50 EU per mg of protein) for 24 h at 37°C in humidified atmosphere with 5% CO2. Cells were then placed on ice collected by vigorous pipetting washed and stained with the following fluorophore-conjugated antibodies: anti-CD11c and anti-CD40 (eBioscience) anti-CD80 (BD Horizon) anti-CD86 and anti-MHC class II (I-Aq) (BD Pharmingen). Afterwards the cells were analyzed on an LSRII 4 laser (BD Biosciences). In vitro tumor antigen presentation assay BR5FVB1 cells were harvested and treated with mitomycin C and plated in a 96-well round-bottomed plate with 20 ?g/ml scFvMTBHsp70 or 13 ?g/ml MTBHsp70. After pre-incubation at 4°C for 1 h CD11c+ BMDCs (ratio of tumor cells: DCs = 3: 1) were added to the wells and the plate was incubated at 37°C for 24 h. For generation of BR5FVB1 cell-primed T cells we inoculated FVB/NJ mice by i.p. injection with 107mitomycin C-treated BR5FVB1 cells and sacrificed the mice 60 days after the immunization according to the approved animal protocol. Splenocytes were then harvested and T cells were isolated using the Pan T-Cell Isolation Kit II (MiltenyiBiotec). BR5FVB1 cell-primed T cells were then added to the wells at a DC/T-cell ratio of 1:20. After a 24-hour co-culture of BR5FVB1 cell-pulsed DCs with BR5FVB1 cell-primed T cells the cells were harvested washed and resuspended in PBS with 5% FBS stained for CD3 CD4 CD8 and IFN? and analyzed on a LSRII 4 laser (BD Biosciences). In vivo immunization with mitomycin C-treated ovarian tumor cells BR5FVB1 ovarian tumor cells were harvested with enzyme-free cell-dissociation buffer and treated with mitomycin C as described above. Cells were then pre-incubated with scFvMTBHsp70 (10 ?g/106 cells) MTBHsp70 (6.5 ?g/106 cells) or PBS alone at 4°C for 1 h. 6-week-old FVB mice were shaved and depilated on both left and right flanks and then injected i.d. with 50 ?l of PBS or 1?—?106 tumor cells in 50 ?l of PBS with or without a pre-incubation with scFvMTBHsp70 or MTBHsp70 at both flanks. Histopathology Abdominal walls and intestines from mice were fixed for at least 24 h in PBS-buffered 10% formalin. Tissues were routinely embedded in paraffin. 5 ?m thick sections were stained routinely with H&E. For staining tumor-infiltrating T cells mice were perfused with 4% paraformaldehyde (PFA) in PBS and tumor nodules were fixed in 4% PFA/PBS for additional 2 hours washed and infiltrated with 30% sucrose/PBS at 4°C. 6 ?m thick frozen sections were stained with rat anti-mouse CD8 (BD Biosciences 1:100 dilution) or rat anti-mouse Foxp3 (eBioscience 1:12 dilution) followed by polyclonal rabbit anti-rat immunoglobulin/HRP (Dako 1:750 dilution). Signal was developed with diaminobenzidine (DAB Dako). Images were acquired on a Zeiss Axio A1 microscope. All histopathological and immunohistochemical samples were reviewed and the quantitation of the cellular infiltrate was performed in a blinded manner to the observer. Statistical analysis Statistical differences between three or more experimental groups were analyzed using One-Way ANOVA followed by Turkey™s multiple comparison tests when mean of each group is compared with that of every other group or followed by Dunnett™s multiple comparison tests when mean of each group is compared with that of a control group. Statistical differences between two experimental groups were analyzed using Student™s t-test. Survival was analyzed with the Log-rank test. Prism 6.0 software (GraphPad Software) was used for all the statistical analysis. Abbreviations DC: Dendritic cell; scFv: Single-chain antibody variable fragment; MSLN: Mesothelin; MTB: Mycobacterium tuberculosis; Hsp: Heat shock protein; i.p.: Intraperitoneal; i.d.: Intradermal; BMDCs: Bone marrow-derived dendritic cells; APCs: Antigen-presenting cells; PBMCs: Peripheral blood mononuclear cells; PBLs: Peripheral blood leukocytes; LPS: Lipopolysaccharide; H&E: Haematoxylin and eosin; PFA: Paraformaldehyde; DAB: Diaminobenzidine; mAb: monoclonal antibody. Competing interests The authors declare that they have no competing interests. Authors™ contributions JY played a role in the design of the experiments acquisition analysis and interpretation of the data and writing the manuscript. PR JN YY NHA MN GJ-M XT SK HC PU BF TC and PL participated in the performance of experiments. SK and TB were involved in design of the experiments. RB was involved in data analysis. ER was involved in setting up murine ovarian cancer model. SO provided the murine ovarian cancer model. NS provided the plasmid that encodes an scFv fragment specific to MSLN and the recombinant P4 scFv protein. GD NS and SO gave constructive input on experimental design and data analysis. JG played a role in conception and design of the fusion protein. MP and JG were involved in the conceptualization and design of the study analysis and interpretation of datasets and in writing the manuscript. All authors read and approved the final manuscript. Supplementary Material Additional file 1: Figure S1 scFvMTBHsp70 binds to 40L mesothelioma cells. 40L cells were stained with scFvMTBHsp70 or MTBHsp70 followed by mouse anti-MTBHsp70 and Donkey anti-mouse Alexa Fluor 594. Cells were observed using a Nikon Eclipse TiE fluorescence microscope. A Representative pictures from three independent experiments. Scale bar 10 ?m. B Images were analyzed using the NIS-Elements AR Microscope Imaging Software. Mean Fluorescence Intensity was analyzed using ImageJ. P values were determined using One-Way ANOVA followed by Turkey™s multiple comparison tests. ****p?<?0.0001. Click here for file Additional file 2: Figure S2 scFvMTBHsp70 or MTBHsp70 plus P4 scFv treatment does not lead to infiltration of inflammatory cells into abdominal or intestinal mesothelial tissues. Samples of abdominal wall and intestine were prepared from C57BL/6 mice that had previously received multiple i.p. injections of scFvMTBHsp70 MTBHsp70 plus P4 scFv or saline as described in the Methods section. Sections of these tissues were stained with H&E and images were acquired on a Zeiss Axio A1 microscope. Representative images from 3 animals per treatment group are shown. No detectable level of mononuclear cell or granulocyte infiltrate within mesothelial tissues was seen in any sampled tissues. Scale bar 20 ?m. Click here for file Additional file 3: Figure S3 scFvMTBHsp70 treatment does not affect numbers of tumor-infiltrating CD8+ or Foxp3+ T cells. (A) Representative images of intratumoral CD8+ and Foxp3+ T cells from saline (n?=?3) scFvMTBHsp70 (n?=?3) or MTBHsp70 plus P4 scFv (n?=?3) -treated mice. Mouse spleen sections were used as positive controls: CD8+ and Foxp3+ T cells are clearly evident in the sections. Scale bar 20 ?m. (B) Numbers of CD8+ and Foxp3+ cells were quantified from 3“5 randomized fields. Click here for file Additional file 4: Figure S4 Validation of in vivo depletion of CD8+ cells in FVB/NJ mice. Mice were injected i.p. with 200 ?g of anti-CD8 mAb or an isotype-matched irrelevant rat IgG2a as described in Methods. All the mice were bled from the tail vein and the depletion of CD8+ cells was examined by flow cytometry analysis of peripheral blood cells stained with fluorophore-conjugated anti-CD8 on days 7 and 28 after tumor inoculation. (A) Representative results of flow analyses on 10 mice per group and reported as the percentage of CD8+ cells in lymphocytes. (B) CD8+ cells in the mice treated with isotype IgG2a or anti-CD8 mAb were compared. ***p< 0.001. Click here for file Acknowledgments This manuscript is dedicated to the memory of Janet Gelfand a victim of ovarian cancer. The authors gratefully acknowledge the continuing support for this work from the Edmund C. Lynch Jr. Cancer Fund Arthur Luxenberg Esq. Perry Weitz Esq. and the VIC Mesothelioma Research and Resource Program at MGH and the Friends of VIC Fund. PU and NHA were supported by the Prof. Dulcie V. Coleman Studentship at Imperial College London. We thank Oliver Mitchell John Cao Lujia Zhou Rumbidzai Mushavi and Sayinthen Vivekanantham for their technical assistances Dr. Yuhui Huang for his useful comments Michael Waring Dr. Michael Santuosuosso and Dr. Ravi Mylvaganam for their technical advice Dr. Musie Ghebremichael for his advice in statistical analysis and Mahnoor Valibhoy for her assistance with the schematic figure. Banchereau J Palucka AK Dendritic cells as therapeutic vaccines against cancer Nature reviews Immunology 2005 5 296 306 10.1038/nri1592 15803149 Mellman I Coukos G Dranoff G Cancer immunotherapy comes of age Nature 2011 480 480 489 10.1038/nature10673 22193102 Topalian SL Weiner GJ Pardoll DM Cancer immunotherapy comes of age J Clin Oncol 2011 29 4828 4836 10.1200/JCO.2011.38.0899 22042955 Kantoff PW Higano CS Shore ND Berger ER Small EJ Penson DF Redfern CH Ferrari AC Dreicer R Sims RB Xu Y Frohlich MW Schellhammer PF IMPACT Study Investigators Sipuleucel-T immunotherapy for castration-resistant prostate cancer The New England journal of medicine 2010 363 411 422"

Lung_Cancer

"We lack biomarkers for identifying aggressive primary tumor subsets that give rise to metastases and impact early cancer detection and treatment. Many solid tumors are known to accumulate hyaluronan (HA) a glycosaminoglycan which is also produced by the tumor cells themselves. We report a quantitative approach for uncovering breast cancer heterogeneity using fluorescent HA to detect differential binding patterns to CD44 and RHAMM/HMMR receptors. This approach permits identification of tumor-cell subsets that bind high levels of HA and may be applicable to other ligands/receptors and disease models. Despite representing the invasive/metastatic subset of parental tumors unexpectedly the high HA-binding subset was slow-growing and is thus likely to be a source of dormancy and relapse. Tumor heterogeneity confounds cancer diagnosis and the outcome of therapy necessitating analysis of tumor cell subsets within the tumor mass. Elevated expression of hyaluronan (HA) and HA receptors receptor for HA-mediated motility (RHAMM)/HA-mediated motility receptor and cluster designation 44 (CD44) in breast tumors correlates with poor outcome. We hypothesized that a probe for detecting HA“HA receptor interactions may reveal breast cancer (BCa) cell heterogeneity relevant to tumor progression. A fluorescent HA (F-HA) probe containing a mixture of polymer sizes typical of tumor microenvironments (10“480 kDa) multiplexed profiling and flow cytometry were used to monitor HA binding to BCa cell lines of different molecular subtypes. Formulae were developed to quantify binding heterogeneity and to measure invasion in vivo. Two subsets exhibiting differential binding (HA?/low vs. HAhigh) were isolated and characterized for morphology growth and invasion in culture and as xenografts in vivo. F-HA“binding amounts and degree of heterogeneity varied with BCa subtype were highest in the malignant basal-like cell lines and decreased upon reversion to a nonmalignant phenotype. Binding amounts correlated with CD44 and RHAMM displayed but binding heterogeneity appeared to arise from a differential ability of HA receptor-positive subpopulations to interact with F-HA. HAhigh subpopulations exhibited significantly higher local invasion and lung micrometastases but unexpectedly lower proliferation than either unsorted parental cells or the HA?/low subpopulation. Querying F-HA binding to aggressive tumor cells reveals a previously undetected form of heterogeneity that predicts invasive/metastatic behavior and that may aid both early identification of cancer patients susceptible to metastasis and detection/therapy of invasive BCa subpopulations. tumor cell heterogeneity hyaluronan binding heterogeneity index PLoS One one 1932-6203 Public Library of Science San Francisco USA 24454921 3893258 PONE-D-13-41069 .0085702 Research Biology Biochemistry Bioenergetics Energy-Producing Processes Metabolism Carbohydrate Metabolism Metabolic Pathways Oxygen Metabolism Protein Metabolism Cofactors Drug Discovery Enzymes Genetics Gene Expression Medicine Drugs and Devices Drug Research and Development Drug Discovery Hematology Hematologic Cancers and Related Disorders Leukemias Acute Lymphoblastic Leukemia Nutrition Obstetrics and Gynecology Breast Cancer Oncology Cancers and Neoplasms Hematologic Cancers and Related Disorders Leukemias Breast Tumors Oncology Agents Metabolic Effects of Acute Thiamine Depletion Are Reversed by Rapamycin in Breast and Leukemia Cells Thiamine Depletion and Metabolism in Cancer Cells Liu Shuqian 1 Miriyala Sumitra 2 Keaton Mignon A. 3 Jordan Craig T. 4 Wiedl Christina 5 Clair Daret K. St. 2 Moscow Jeffrey A. 1 * 1 Department of Pediatrics University of Kentucky College of Medicine Lexington Kentucky United States of America 2 Graduate Center for Toxicology University of Kentucky College of Medicine Lexington Kentucky United States of America 3 Metabolon Inc Durham North Carolina United States of America 4 Division of Hematology Hematologic Malignancies and Stem Cell Transplantation University of Colorado Denver Colorado United States of America 5 Department of Pediatrics Virginia Commonwealth University Richmond Virginia United States of America Ahmad Aamir Editor Wayne State University School of Medicine United States of America * E-mail: jmoscowuky.edu Competing Interests: One of the authors of this paper Mignon A. Keaton was employed by Metabolon Inc. during the data acquisition and analysis phases of the study. Dr. Keaton is no longer employed by Metabolon. Her employment history does not alter the authors' adherence to all the PLOS ONE policies on sharing data and materials. Conceived and designed the experiments: MAK CTJ DKS JAM. Performed the experiments: SL SM MAK CTJ CW. Analyzed the data: MAK DKS JAM. Contributed reagents/materials/analysis tools: SM MAK CTJ CW DKS JAM. Wrote the paper: MAK CTJ JAM. 2014 15 1 2014 9 1 e85702 8 10 2013 5 12 2013 2014 Liu et al This is an open-access distributed under the terms of the Creative Commons Attribution License which permits unrestricted use distribution and reproduction in any medium provided the original author and source are credited. Thiamine-dependent enzymes (TDEs) control metabolic pathways that are frequently altered in cancer and therefore present cancer-relevant targets. We have previously shown that the recombinant enzyme thiaminase cleaves and depletes intracellular thiamine has growth inhibitory activity against leukemia and breast cancer cell lines and that its growth inhibitory effects were reversed in leukemia cell lines by rapamycin. Now we first show further evidence of thiaminase therapeutic potential by demonstrating its activity against breast and leukemia xenografts and against a primary leukemia xenograft. We therefore further explored the metabolic effects of thiaminase in combination with rapamycin in leukemia and breast cell lines. Thiaminase decreased oxygen consumption rate and increased extracellular acidification rate consistent with the inhibitory effect of acute thiamine depletion on the activity of the TDEs pyruvate dehydrogenase and 2-oxoglutarate dehydrogenase complexes; these effects were reversed by rapamycin. Metabolomic studies demonstrated intracellular thiamine depletion and the presence of the thiazole cleavage product in thiaminase-treated cells providing validation of the experimental procedures. Accumulation of ribose and ribulose in both cell lines support the thiaminase-mediated suppression of the TDE transketolase. Interestingly thiaminase suppression of another TDE branched chain amino ketoacid dehydrogenase (BCKDH) showed very different patterns in the two cell lines: in RS4 leukemia cells it led to an increase in BCKDH substrates and in MCF-7 breast cancer cells it led to a decrease in BCKDH products. Immunoblot analyses showed corresponding differences in expression of BCKDH pathway enzymes and partial protection of thiaminase growth inhibition by gabapentin indicated that BCKDH inhibition may be a mechanism of thiaminase-mediated toxicity. Surprisingly most of thiaminase-mediated metabolomic effects were also reversed by rapamycin. Thus these studies demonstrate that acute intracellular thiamine depletion by recombinant thiaminase results in metabolic changes in thiamine-dependent metabolism and demonstrate a previously unrecognized role of mTOR signaling in the regulation of thiamine-dependent metabolism. No current external funding sources for this study. Introduction Thiamine (vitamin B1) is a cofactor for enzymes involved in critical metabolic processes involving energy production biomass generation and amino acid catabolism. Despite the requirement for this vitamin in these central processes the role of thiamine and thiamine-dependent enzymes (TDEs) in cancer development and treatment has received little attention although a recent review has summarized the potential importance of TDE™s in cancer metabolism [1]. Unlike antifolates which have a well-established role in cancer therapy analogous small molecule thiamine antagonists are relatively inert leading to a that TDE pathways could not be important as an anticancer targets. However the limitations of small molecule TDE inhibitors should not be confused with the potential role of TDEs as anticancer therapeutic targets. Antifolates can be effective because intracellular folates only transiently associate with enzymes during the catalytic process allowing for inhibition of enzyme activity by molecules designed to bind more tightly than the intracellular substrates. In contrast intracellular thiamine activated by phosphorylation remains tightly bound to enzyme complexes during the catalytic cycle leaving little opportunity for inhibitors to displace it once the complex has assembled. This inherent pharmacologic challenge could disguise the potential of targeting TDEs for cancer therapy. We have previously shown down-regulation of thiamine transporter gene expression in tumors compared to normal tissues [2] [3] and more recently have shown that a low thiamine diet delays onset of mammary tumors in MMTV(her2) mice [4] an effect that is abrogated by a high fat diet. These observations have led to our hypothesis that TDE pathways are altered as part of the overall changes in energy metabolism that occurs in cancer cells and that these changes could produce metabolic vulnerabilities that could be exploited by therapies aimed at TDE activities. To take a novel path in the exploration of TDEs in cancer we have studied the cytotoxic activity of the bacterial enzyme thiaminase which cleaves thiamine into its pyrimidine and thiazole moieties [5]. Thiaminase overcomes the limitations of small molecule TDE "

Lung_Cancer

"Diagnostic assessment programs (DAPs) appear to be a promising model for enabling ICC. The purpose of this study was to explore how DAP structure and function enable ICC and whether that may be associated with anizational and clinical outcomes. Methods A case study approach will be used to explore ICC among eight DAPs that vary by type of cancer (lung breast) academic status and geographic region. To describe DAP function and outcomes and gather information that will enable costing recommendations expressed in DAP standards and clinical guidelines will be assessed through retrospective observational study. Data will be acquired from databases maintained by participating DAPs and the provincial cancer agency and confirmed by and supplemented with review of medical records. We will conduct a pilot study to explore the feasibility of estimating the incremental cost-effectiveness ratio using person-level data from medical records and other sources. Interviews will be conducted with health professionals staff and referring physicians from each DAP to learn about barriers and facilitators of ICC. Qualitative methods based on a grounded approach will be used to guide sampling data collection and analysis. Discussion Findings may reveal opportunities for unique structures interventions or tools that enable ICC that could be developed implemented and evaluated through future research. This information will serve as a formative needs assessment to identify the nature of ongoing or required improvements which can be directly used by our decision maker collaborators and as a framework by policy makers cancer system managers and DAP managers elsewhere to strategically plan for and implement diagnostic cancer services. Inter-professional collaborative care Multidisciplinary care team Inter-professional relations Communication Cooperative behavior Diagnostic assessment program Breast cancer Lung cancer Background Need for collaborative cancer care Most cancer patients require multimodal assessment and treatment including radiologic and pathologic detection confirmation and characterization and surgery chemotherapy and/or radiation for cure or palliation [1]. Following initial treatment patient needs vary as they undergo follow-up surveillance to detect recurrent or secondary cancer with many facing physiological and psychosocial difficulties as a result of their cancer and/or its treatment [2]. In addition most cancer patients require management to prevent or treat co-morbid conditions [3]. Thus cancer management is complex and compounded by the fact that multimodal care is delivered by different professionals in different settings and at different time points. Research has established that coordinated collaborative service delivery improves clinical (i.e. mortality length of stay readmission) and patient-reported (i.e. satisfaction health related quality of life) outcomes for a variety of acute and chronic conditions including cancer [145]. This concept of inter-professional collaborative care (ICC) requires ongoing interaction among various types of health professionals to assess plan negotiate provide and review care for individual patients [6]. Barriers of collaborative cancer care It has been proposed that one-third of cancer cases could be prevented another third cured and the rest effectively treated if management consistently complied with existing guidelines [7]. Most cancer management guidelines recommend ICC but do not specify how this can be achieved [8]. A non-systematic review of the literature on ICC in cancer found that formal policies and structures improved treatment decisions implementation of treatment decisions documentation of treatment decisions attendance at joint meetings professional diversity at meetings completeness of information presented at meetings management according to guideline recommendations time to diagnosis or treatment survival role identification among team members team effectiveness and staff wellbeing [9]. However timely and appropriate ICC was challenged by many patient provider team and system level factors [10]. Other barriers included strategic differences across anizations limited administrative support and identified leads for the collaborative process and anizational and individual provider reluctance to share resources and power [11]. Given multiple associated benefits efforts are needed to promote and support ICC for the clinical management of cancer patients. First improved understanding of which ICC approaches lead to improved patient provider and anizational or system outcomes is required so that we can meaningfully evaluate whether and how cancer patients experience ICC [1213]. Further understanding of how various ICC models lead to beneficial patient provider institutional and health system outcomes will provide insight on when and in what way to implement these models. Our research on collaborative cancer care We have jointly conducted several research studies that identified numerous challenges of ICC for cancer and evaluated the availability and impact of interventions to support ICC. ARG surveyed and interviewed Ontario clinicians and managers involved in cancer care across several studies. Participants identified numerous ICC challenges such as timely access to testing for diagnosis and staging lack of human and technical resources identifying and communicating with specialists coordinating referral to and back from specialists confusion among multidisciplinary team members about who was to coordinate management and the need for system level support [14-19]. Interventions to support ICC suggested by participants included patient held medical records cancer specific medical record standardized referral and reply forms centralized cancer diagnostic facilities regional outreach clinics and use of telemedicine. ARG conceptually analyzed the literature to describe models of ICC [20]. Determinants of positive objective and subjective patient team and anizational outcomes included system or anizational support team structure and team processes. ARG reviewed empirical research evaluating ICC for cancer patients [20]. Twenty-two studies of mixed design published between 2001 and 2009 were eligible. The majority of studies (17/22) assessed the role of general practitioners and supportive/palliative care workers in cancer patient follow-up. Five of 22 studies evaluated ICC for diagnosis or treatment decision making. Apart from tumor boards no studies described interventions to enable ICC. Collectively this research suggests that most cancer providers function through parallel or consultative rather than integrated models of care. FCW spearheaded several investigations to describe and evaluate multidisciplinary cancer conferences (MCCs) as an intervention to support ICC. Also known as tumor boards these are defined as regularly scheduled meetings where healthcare providers discuss the treatment of individual cancer patients [1]. First she chaired a multidisciplinary panel to issue an evidence- and consensus-based guideline describing MCCs [1]. FCW conducted a systematic review of the literature to examine the impact of ICC on clinical outcomes [21]."

Lung_Cancer

"Two methods were used to inhibit the enzyme activity or protein expression of NQO1 an NQO1 inhibitor and NQO1 siRNA knockdown. Dicoumarol has been previously used to specifically inhibit the expression and activity of NQO1 [44]. As shown in pretreatment of cells with 100 or 250 µM sulindac (A) sulindac sulfone (B) or sulindac sulfide (C) followed by addition of 2 µM ?-lapachone for 12 h increased the cytotoxicity of ?-lapachone for both CL1-1 and CL1-5 cells and these effects were significantly reduced by addition of 10 µM dicoumarol. .0088122.g007 The increase in ?-lapachone-induced cell death caused by sulindac and its metabolites is blocked by the NQO1 inhibitor dicoumarol. CL1-1 cells (left) or CL1-5 cells (right) were left untreated or were pretreated for 6 h with 100 or 250 µM sulindac (A) sulindac sulfone (B) or sulindac sulfide (C) with or without 10 µM dicoumarol then were incubated for a further 12 h with or without addition of 2 µM ?-lapachone then cell survival was measured by crystal violet staining and expressed as percentage survival compared to the untreated cells. * : p<0.05. Using siRNA knockdown of NQO1 at days 1 to 3 after NQO1 siRNA transfection of CL1-1 and CL1-5 cells no change in cell growth or cell morphology was noted (Figure S6). Efficiency of knockdown in CL1-1 and CL1-5 cells was demonstrated for RNA expression by RT-PCR (A) and realtime-PCR (Figure S7) and for protein expression by western blotting (B and C) showing that NQO1 siRNA significantly downregulated NQO1 expression. As shown in D NQO1 siRNA transfection significantly inhibited the increase in NQO1 enzyme activity induced in CL1-1 cells by incubation for 6 or 24 h with 100 or 250 µM sulindac (left panel) sulindac sulfone (center panel) or sulindac sulfide (right panel). When cells transfected for 24 h with siNQO1 or control siRNA were pretreated for 6 h with sulindac or its metabolites then cotreated for 12 h with drug plus 2 µM ?-lapachone the percentage cell survival results showed results that transfection with NQO1 siRNA caused a significant decrease in the cytotoxicity of combinations of ?-lapachone with sulindac (A) sulindac sulfone (B) or sulindac sulfide (C). These results showed that NQO1 plays an important role in the increase in ?-lapachone-induced cell death caused by sulindac or its metabolites. .0088122.g008 The knockdown effects of NQO1 siRNA on NQO1 RNA protein and activity. (A“C) CL1-1 cells (left) or CL1-5 cells (right) were transfected for 1 to 3 days with control siRNA (CTL) or siRNA targeting NQO1 then RNA expression was measured by PCR (A) and protein expression by Western blotting (B and C). (D) CL1-1 cells transfected for 2 days with control siRNA or NQO1 siRNA were incubated alone or with 100 or 250 µM sulindac sulindac sulfide or sulindac sulfone for 6 or 24 h then NQO1 activity was measured. * : p<0.05 ***: p<0.001 compared to the identically treated cells transfected with control siRNA. .0088122.g009 NQO1 siRNA transfection significantly inhibits the effect of sulindac and its metabolites on ?-lapachone-induced cell death. CL1-1 cells (left) or CL1-5 cells (right) were transfected with control siRNA (?) or NQO1 siRNA (+) for 24 h then were left untreated or were incubated for 6 h with 100 or 250 µM sulindac (A) sulindac sulfone (B) or sulindac sulfide (C) then 2 µM ?-lapachone or medium was added and the cells incubated for 12 h when cell survival was measured using crystal violet staining and expressed as percentage survival compared to the untreated cells. * : p<0.05 for the indicated comparison. Discussion ?-lapachone Triggers Lung Cancer Cells to Undergo Apoptosis through an Increase in Intracellular Calcium Levels Increased JNK Activation Decreased Activation of PI3K ERK and AKT and a Decrease in the MMP Cell proliferation and cell death are under complex and precise control. Normally the proteins involved in cell proliferation survival or cell death are in a remarkable balance and unbalanced survival and apoptotic signals may lead to cell death. In most cells proliferation is mainly regulated through PI3K AKT and ERK [46] and cell death is regulated through another pathway involving JNK and p38 [47] [48]. JNK has recently been reported to be an important mediator in the ?-lapachone-induced cell death of breast and prostate cancer cells [45] [49]. ?-lapachone also triggers cell death of many cancer cells by increasing calcium signaling [6] [50]. Calcium the key messenger molecule in cells plays an important role in many signaling pathways and an imbalance in intracellular calcium levels causes abnormal cell function and leads to cell death. Treatment of cells with the intracellular calcium chelator BAPTA partially inhibited ?-lapachone-induced cell death showing that calcium was involved (). Activation of the cell death signal JNK (A) and inhibition of the cell survival signals p-PI3K p-AKT and p-ERK (A and B) were also observed in ?-lapachone-mediated lung cancer cell death showing that the MAP kinase signaling pathway is involved in the anticancer effect of ?-lapachone. Although ROS could have caused the cell death induced by ?-lapachone there was no change in intracellular H2O2 levels following ?-lapachone treatment (Figure S1D). However the MMP was dramatically decreased following ?-lapachone treatment (Figure S3C) suggesting that other ROS species might be involved in the ?-lapachone-induced cell death process. NQO1 is a Key Factor in the ?-lapachone-induced Lung Cancer Cell Death High NQO1 activity and expression are seen in many human tumors including carcinoma of the liver [51] [52] colon [53] breast [52] [54] brain [55] and lung [52] and NQO1 has been shown to be an important factor in ?-lapachone-induced cell death in many kinds of cancer cells [9] [44] including breast cancer [2] glioma [56] and prostate cancer [44]. In this study we demonstrated that the cytotoxicity of ?-lapachone for three different lung cancer cell lines was positively correlated with their NQO1 expression and enzyme activity (). Inhibition of NQO1 activity using the NQO1 inhibitor dicoumarol (Figure S3) blocked the ?-lapachone-induced increase in intracellular calcium levels (Figure S3) increase in p-JNK levels (A) and decrease in p-ERK p-PI3K and p-AKT levels (A and B). These results indicated that the balance between survival and death signals in lung cancer cells was disrupted by the decrease in p-PI3K p-AKT and p-ERK levels and the increase in p-JNK levels caused by ?-lapachone treatment and that NQO1 expression and activity were involved in the activation of all these apoptotic signals. Anti-inflammatory Drugs Increase NQO1 Levels and Enzyme Activity in Lung Cancer Cells Many drugs or treatments such as cisplatin [5] heat shock [19] or radiation [57] can increase NQO1 expression or activity and facilitate the cytotoxicity of ?-lapachone for various cancer cells. However such drugs or treatments are usually harmful to normal cells as well as cancer cells so there is a need for drugs or treatments that can facilitate the anti-cancer effect of ?-lapachone while being less harmful for normal cells. Sulindac has been shown to be a potent chemo-protective agent against colorectal cancer in both human and animal models [25] while sulindac sulfide [18] and sulindac and its two metabolites [18] [28]] have been reported to upregulate the expression of carcinogen detoxification enzymes including NQO1. It is known that sulindac compounds inhibit the activity of COX-1 and COX-2 and thus block the biosynthesis of prostaglandins [58]-[60]. In in vivo studies sulindac has been shown to be reversibly reduced to sulindac sulfide which can be irreversibly oxidized to sulindac sulfone all three of which are anti-inflammatory. Since 1995 several clinical trials have established that sulindac is effective at reducing the number and size of polyps in patients with familial adenomatous polyposis a precursor to colorectal cancer (NCI-P97-0110 NCI-P00-0150 [61])."

Lung_Cancer

"This may be the reason why this pathway is universally aberrant in all the LUAD samples we assessed. Our analysis of this pathway in other cancer types demonstrated less of a role for this pathway suggesting that it is more LUAD specific. We believe that the common disruption of this pathway is a novel discovery as this pathway consisting of 17 genes has not been reported as an indicator of LUAD in any of the studies we acquired datasets from (GSE10082 GSE7670 GSE10072) nor in a literature search with key words.4 SWe have proposed personalized extensions to ORA- and FCS-based pathway analysis by introducing the concept of comparing an individual tumor with many normal samples. Exploratory analyses of our methods with previously published survival pathway signatures reproduced the correct survival outcomes. We have also demonstrated that using nRef improves the validation rate. Unbiased clustering with iPASs revealed sample clustering which is indicative of the cancer differentiation status of LUAD and of different survival outcomes. Clustering also identifies pathway characteristics from patients displaying common up- or downregulations and subgroup-specific deregulations.Pathways that are commonly deregulated across all cancer patients may be useful in identifying cancer from unknown samples. We explored the pathway-based identification of cancer with ˜amino acid synthesis and interconversion and transamination™ pathway which is commonly upregulated in LUAD patients. Validation using independent datasets demonstrated that this pathway is useful in classifying LUAD and normal lung samples.Based on our results we conclude that individualized pathway scores using nRef can provide a sensitive measure of a patient™s clinical features and can be useful for identifying cancer.In our empirical study Average Z performed best in highlighting pathway aberrance and in further revealing clinical importance. It had the best statistical power when identifying a previously known survival-related pathway and the best averaged validation rate for LUAD and colon cancer. In the pathway-based identification of cancer the Mahalanobis method performed best.An important clinical aspect of our methods is that it enables the interpretation of a cancer case in a single patient even if matched normal tissue data from the same individual are unavailable. Accumulated information of normal tissues from a data repository will take the place of data unavailable for a specific individual. As the data repository is growing rapidly it is expected that more ˜nRef™ data will be available for many diseases in the near future. We hope that our proposed approach can help in the personalized interpretation of tumor data and can be a useful tool in the upcoming era of data-based personalized medicine.Although we have shown our results in microarray platform our method is applicable to different RNA expression platforms including next-generation sequencer. Our method is also supportive of various pathway resources such as KEGG NCI cancer pathway and Biocarta provided in the gmt format. The R code for our methods along with nRefs of LUAD and colon cancer used in our study is available at http://bibs.snu.ac.kr/ipas. Supplementary Material Supplementary Data ACKNOWLEDGEMENT The authors thank Jaehoon Lee and Sungyoung Lee for discussion. Funding: This work was supported by the National Research Foundation of Korea (NRF) grant (2012R1A3A2026438) and by the Bio & Medical Technology Development Program of the NRF grant (2013M3A9C4078158). Conflict of interest: none declared. REFERENCES Bandres E A gene signature of 8 genes could identify the risk of recurrence and progression in Dukes' B colon cancer patients Oncol. Rep. 2007 17 1089 1094 17390049 Barletta JA Prognostic significance of grading in lung adenocarcinoma Cancer 2010 116 659 669 20014400 Barrett T NCBI GEO: archive for functional genomics data sets”update Nucleic Acids Res. 2012 41 D991 D995 23193258 Barrier A Stage II colon cancer prognosis prediction by tumor gene expression profiling J. Clin. Oncol. 2006 24 4685 4691 16966692 Barrier A Prognosis of stage II colon cancer by non-neoplastic mucosa gene expression profiling Oncogene 2007 26 2642 2648 17043639 Beer DG Gene-expression profiles predict survival of patients with lung adenocarcinoma Nat. Med. 2002 8 816 824 12118244 Bolstad BM A comparison of normalization methods for high density oligonucleotide array data based on variance and bias Bioinformatics 2003 19 185 193 12538238 Breitling R Iterative Group Analysis (iGA): a simple tool to enhance sensitivity and facilitate interpretation of microarray experiments BMC Bioinformatics 2004 5 34 15050037 Bryant CM Clinically relevant characterization of lung adenocarcinoma subtypes based on cellular pathways: an international validation study PLoS One 2010 5 e11712 20661423 Croft D Reactome: a database of reactions pathways and biological processes Nucleic Acids Res. 2011 39 D691 D697 21067998 Dancey JE The genetic basis for cancer treatment decisions Cell 2012 148 409 420 22304912 Drier Y Pathway-based personalized analysis of cancer Proc. Natl Acad. Sci. USA 2013 110 6388 6393 23547110 Eschrich S Molecular staging for survival prediction of colorectal cancer patients J. Clin. Oncol. 2005 23 3526 3535 15908663 Hou J Gene expression-based classification of non-small cell lung carcinomas and survival prediction PLoS One 2010 5 e10312 20421987 Irizarry RA Exploration normalization and summaries of high density oligonucleotide array probe level data Biostatistics 2003 4 249 264 12925520 Jones SJ Evolution of an adenocarcinoma in response to selection by targeted kinase inhibitors Genome Biol. 2010 11 R82 20696054 Khatri P Ten years of pathway analysis: current approaches and outstanding challenges PLoS Comput. Biol. 2012 8 e1002375 22383865 Kopetz S Abbruzzese JL Barriers to integrating gene profiling for stage ii colon cancer Clin. Cancer Res. 2009 15 7451 7452 19996205 Landi MT Gene expression signature of cigarette smoking and its role in lung adenocarcinoma development and survival PLoS One 2008 3 e1651 18297132 Lee ES Prediction of recurrence-free survival in postoperative non-small cell lung cancer patients by using an integrated model of clinical information and gene expression Clin. Cancer Res. 2008 14 7397 7404 19010856 Lin YH Multiple gene expression classifiers from different array platforms predict poor prognosis of colorectal cancer Clin. Cancer Res. 2007 13 498 507 17255271 Lu TP Integrated analyses of copy number variations and gene expression in lung adenocarcinoma PLoS One 2011 6 e24829 21935476 Marisa L Gene expression classification of colon cancer into molecular subtypes: characterization validation and prognostic value PLoS Med. 2013 10 e1001453 23700391 Munoz-Pinedo C Cancer metabolism: current perspectives and future directions Cell Death Dis. 2012 3 e248 22237205 Smith JJ Experimentally derived metastasis gene expression profile predicts recurrence and death in patients with colon cancer Gastroenterology 2010 138 958 968 19914252 Su LJ Selection of DDX5 as a novel internal control for Q-RT-PCR from microarray data using a block bootstrap re-sampling scheme BMC Genomics 2007 8 140 17540040 Subramanian A Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles Proc. Natl Acad. Sci. USA 2005 102 15545 15550 16199517 Tian L Discovering statistically significant pathways in expression profiling studies Proc. Natl Acad. Sci. USA 2005 102 13544 13549 16174746 Vaske CJ Inference of patient-specific pathway activities from multi-dimensional cancer genomics data using PARADIGM Bioinformatics 2010 26 i237 i245 20529912 Wang Y Gene expression profiles and molecular markers to predict recurrence of Dukes' B colon cancer J. Clin. Oncol. 2004 22 1564 1571 15051756 Am J Respir Cell Mol Biol Am. J. Respir. Cell Mol. Biol ajrcmb American Journal of Respiratory Cell and Molecular Biology 1044-1549 1535-4989 American Thoracic Society 23980547 3930939 2013-0314TR 10.1165/rcmb.2013-0314TR Translational Review The Role of Vimentin Intermediate Filaments in the Progression of Lung Cancer Kidd Martha E. 1 2 Shumaker Dale K. 2 Ridge Karen M. 2 1Department of Biomedical Engineering Northwestern University Evanston Illinois; and 2Division of Pulmonary and Critical Care Medicine Northwestern University Feinberg School of Medicine Chicago Illinois Correspondence and requests for reprints should be addressed to Karen M. Ridge Ph.D. Division of Pulmonary and Critical Care Medicine Northwestern University Feinberg School of Medicine 240 East Huron Street McGaw M328 Chicago IL 60611. E-mail: kridge@northwestern.edu 1 2014 1 2014 50 1 1 6 08 7 2013 30 7 2013 Copyright © 2014 by the American Thoracic Society 2014 There is an accumulation of evidence in the literature demonstrating the integral role of vimentin intermediate filaments (IFs) in the progression of lung cancers. Vimentin IF proteins have been implicated in many aspects of cancer initiation and progression including tumorigenesis epithelial-to-mesenchymal transition (EMT) and the metastatic spread of cancer. Specifically vimentin IFs have been recognized as an essential component regulating EMT major signal transduction pathways involved in EMT and tumor progression cell migration and invasion the positioning and anchorage of organelles such as mitochondria and cell“cell and cell“substrate adhesion. In tumorgenesis vimentin forms a complex with 14-3-3 and beclin 1 to inhibit autophagy via an AKT-dependent mechanism. Vimentin is a canonical marker of EMT and recent evidence has shown it to be an important regulator of cellular motility. Transcriptional regulation of vimentin through hypoxia-inducible factor-1 may be a potential driver of EMT. Finally vimentin regulates 14-3-3 complexes and controls various intracellular signaling and cell cycle control pathways by depleting the availability of free 14-3-3. There are many exciting advances in our understanding of the complex role of vimentin IFs in cancer pointing to the key role vimentin IFs may play in tumor progression. Keywords epithelial-to-mesenchymal transition invadopodia lung cancer metastatic cascade vimentin 8711562 6325 Oncogene Oncogene Oncogene 0950-9232 1476-5594 23752194 3839253 10.1038/onc.2013.208 NIHMS490151 Article ARF Inhibits the Growth and Malignant Progression of Non-Small Cell Lung Carcinoma Busch Stephanie E 1 2 Moser Russell D 1 Gurley Kay E 1 Kelly-Spratt Karen S 1 Liggitt H Denny 3 Kemp Christopher J 1 1Division of Human Biology Fred Hutchinson Cancer Research Center Seattle Washington 98109 2Molecular and Cellular Biology Graduate Program University of Washington Seattle Washington 98195 3Department of Comparative Medicine University of Washington Seattle Washington 98195 Corresponding author: Christopher J. Kemp Ph.D. Fred Hutchinson Cancer Research Center 1100 Fairview Ave N Mail Stop C1-015 Seattle WA 98109. cjkemp@fhcrc.org. Phone: (206) 667-4252. Fax: (206) 667-5815 11 7 2013 10 6 2013 15 5 2014 15 5 2015 33 20 2665 2673 Non-small cell lung carcinoma (NSCLC) is among the deadliest of human cancers. The CDKN2A locus which houses the INK4a and ARF tumor suppressor genes is frequently altered in NSCLC. However the specific role of ARF in pulmonary tumorigenesis remains unclear. KRAS and other oncogenes induce the expression of ARF thus stabilizing p53 activity and arresting cell proliferation. To address the role of ARF in Kras-driven NSCLC we compared the susceptibility of NIH/Ola strain wild-type and Arf knockout mice to urethane-induced lung carcinogenesis. Lung tumor size malignancy and associated morbidity were significantly increased in Arf?/? compared to Arf+/+ animals at 25 weeks post-induction. Pulmonary tumors from Arf knockout mice exhibited increased cell proliferation and DNA damage compared to wild-type. A subgroup of tumors in Arf?/? animals presented as dedifferentiated and metastatic with many characteristics of pulmonary sarcomatoid carcinoma a neoplasm previously undocumented in mouse models. Our finding of a role for ARF in NSCLC is consistent with the observation that benign adenomas from Arf+/+ mice robustly expressed ARF while ARF expression was markedly reduced in malignant adenocarcinomas. ARF expression also frequently co-localized with expression of p21CIP1 a transcriptional target of p53 arguing that ARF induces the p53 checkpoint to arrest cell proliferation in vivo. Together these findings demonstrate that induction of ARF is an early response in lung tumorigenesis that mounts a strong barrier against tumor growth and malignant progression. p19Arf p14ARF ethyl carbamate metastasis J Transl Med J Transl Med Journal of Translational Medicine 1479-5876 BioMed Central 24726028 3996904 1479-5876-12-98 10.1186/1479-5876-12-98 Research Thymidylate synthase polymorphisms in genomic DNA as clinical outcome predictors in a European population of advanced non-small cell lung cancer patients receiving pemetrexed Arévalo Estefanía 1 e.arevalo-vazquez@hotmail.com Castañón Eduardo 1 ecastanon@unav.es López Inés 2 milopez@unav.es Salgado Josefa 3 jsalgadog@unav.es Collado Víctor 2 v.d.collado@gmail.com Santisteban Marta 1 msantisteb@unav.es Rodríguez-Ruiz María 4 mrruiz@unav.es Martín Patricia 1 pmromano@unav.es Zubiri Leire 4 lzubiri@unav.es Patiño-García Ana 3 apatigar@unav.es Rolfo Christian 5 christian.rolfo@uza.be Gil-Bazo Ignacio 1 2 igbazo@unav.es 1Department of Oncology Clínica Universidad de Navarra 31008 Pamplona Spain 2Division of Oncology Center for Applied Medical Research (CIMA) 31008 Pamplona Spain 3Laboratory of Clinical Genetics Clínica Universidad de Navarra 31008 Pamplona Spain 4Department of Radiation Oncology Clínica Universidad de Navarra 31008 Pamplona Spain 5Oncology Department Antwerp University Hospital UZA 2650 Edegem Belgium 2014 14 4 2014 12 98 98 3 11 2013 7 4 2014 Copyright © 2014 Arévalo et al.; licensee BioMed Central Ltd. 2014 Arévalo et al.; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0) which permits unrestricted use distribution and reproduction in any medium provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article unless otherwise stated. Background We studied whether thymidylate synthase (TS) genotype has an independent prognostic/predictive impact on a European population of advanced non-small cell lung cancer (NSCLC) patients receiving pemetrexed. Methods Twenty-five patients treated with pemetrexed-based regimens were included. Genomic DNA was isolated prior to treatment. The variable number of tandem repeat (VNTR) polymorphisms the G >?C single nucleotide polymorphisms (SNP) and the TS 6-bp insertion/deletion (6/6) in the 3? untranslated region (UTR) polymorphisms were analyzed and correlated with overall response rate (ORR) progression-free survival (PFS) overall-survival (OS) and toxicity. Results The genotype +6/+6 predicted a higher ORR among active/former smokers compared to +6/-6 genotype (100% vs. 50%; p =?0.085). Overall the 3R/3R genotype predicted a higher ORR (100%) over the rest VNTR polymorphisms (p =?0.055). The presence of 3R/3R genotype significantly correlated with a superior ORR in patients without EGFR activating mutations (100%) compared to 2R/2R 2R/3R and 3R/4R genotype (77.8% 33.3% and 0% respectively; p =?0.017). After a median follow-up of 21 months a trend towards a better PFS although not significant was found among subjects showing 3R/3R polymorphisms (p =?0.089). A significantly superior OS was found in patients showing 3R/3R genotype rather than other VNTR polymorphisms (p =?0.019). No significant correlation with the toxicity was observed. Conclusion In our series 3R/3R polymorphism correlated with a superior OS. Also this polymorphism when associated to wild type EGFR was related to a higher ORR to pemetrexed. Toxicity was not significantly correlated with a specific TS genotype. Thymidylate synthase Polymorphisms Epidermal growth factor receptor Predictive factors Prognostic factors Non-small cell lung cancer Background Lung cancer represents the most frequent cause of cancer deaths. More than 225000 new cases were diagnosed during 2012 only in the United States of America accounting for approximately 160000 annual deaths [12]. More than 50% of the patients diagnosed with non-small cell lung cancer (NSCLC) present advanced disease (stage III and IV) at onset. The most common histology is adenocarcinoma representing approximately 80% of all cases [3]. Pemetrexed is a multitargeted antifolate drug and one of the latest active drugs against NSCLC [4] approved for the first-line [5] (in combination with cisplatin) [6] and second-line treatment (monotherapy) of patients with non-squamous histology [7]. More recently pemetrexed gained approval for its use as a single-agent maintenance therapy [8] after response/stabilization to four cycles of a platinum doublet with or without pemetrexed. Thymidylate synthase (TS) is the main biological target of antifolate drugs such as pemetrexed or 5-fluorouracil. Different studies have evaluated the correlation between tumor TS expression and TS genotype and the prognosis of patients with different cancer types treated with antifolates [9-11]. In NSCLC constitutive expression of TS is lower in tumors with adenocarcinoma histology than among those with squamous differentiation [12]. This finding could possibly explain the higher efficacy of the drug among non-squamous histology patients. The potential predictive role of TS polymorphisms in NSCLC has never been studied in a European population. In addition how differential TS genotypes may impact on the outcome of patients depending on their smoking status or with Epidermal Growth Factor Receptor (EGFR) activating mutations tumors is to be determined. Finally although the toxicity profile described in most patients receiving pemetrexed in combination or as a single agent is usually favorable there are several reported cases of fundamentally dermatological hematological and potentially serious renal toxicities even when the recommended vitamin prophylaxis guidelines have been followed [13-15]. "

Lung_Cancer

"Upon CT examination all lung nodules showed a similar appearance with heterogeneous density consisting of a hypoattenuating center (Fig. 2Fig. 2.CT images of the dog. In pre-contrast CT images (A D and G) at soft tissue window setting (window level=40 window width=400) all lung nodules (arrows) showed heterogeneous density consisting of hypoattenuating center (c). In pre-contrast CT images (B and E) at lung window setting (window level= ?600 window width=1200) the pleural indentations (arrows) were found in the right cranial and left caudal nodules (m). On post contrast CT images (C F and H) partial contrast enhancement (arrows) occurred from peripheral parenchyma of nodules (m) (window level=40 window width=400). The size of the right caudal nodule the largest one was 3.2 — 2.7 cm in diameter. In reconstructed dorsal planes note the obstruction of right caudal bronchus (arrow) by the right caudal nodule (m) in (I) and the cranial deviation of right cranial bronchus (arrow) by the right cranial nodule (m) in (J). The left side of the image is the right side of the dog.). The mean density of lung nodules was 27.28 ± 6.19 HU. The size of each nodule was 2.2 — 2.0 cm (right cranial nodule) 3.2 — 2.7 cm (right caudal nodule) 1.0 — 1.0 cm (left cranial nodule) and 2.7 — 2.0 cm (left caudal nodule) respectively. Only the peripheral parenchyma of nodules was partially enhanced after an iodine contrast injection (iohexol Omnihexol 300 Korea United Pharm Co. Seoul Korea). Thus most of the parenchyma was considered to have undergone an ischemic or necrotic lesion. PET-CT (Discovery 600 PET/CT system GE Healthcare Wauwatosa WI U.S.A.) using FDG was performed at 47 min after the administration of 11.1 MBq/kg of FDG intravenously. The increased FDG uptake was observed from the peripheral region of each nodule and the maximum standardized uptake values were as follows; 6.4 of the right cranial nodule 4.3 of the right caudal nodule 3.8 of the left cranial nodule and 4.7 of the left caudal nodule respectively (Figs. 3 and 4Fig. 3.Positron emission tomography (PET) images using 18F-fluorodeoxyglucose (FDG). Maximum intensity projection (MIP) view showed four hypermetabolic lesions in both lungs and no significant FDG uptake was found from other regions (including mammary gland) except for several physiologic uptakes (esp. brain heart kidneys intestine urinary bladder and so on). B=brain H=heart K=kidney I=intestine U=urinary bladder S=injection site. The left side of the image is the right side of the dog.Fig. 4.Axial view of positron emission tomography and computed tomography (PET-CT) fusion images using 18F-fluorodeoxyglucose (FDG). Each image corresponds to the dashed line of Fig. 3 in order from top to bottom. It shows the increased FDG uptake mainly from the peripheral region of each nodule (arrows) which probably resulted from central necrosis (A“C). H=heart L=liver. The left side of the image is the right side of the dog.). There was no evidence of FDG uptake from other regions including the mammary gland nodules. None other than four pulmonary nodules were detected on CT and PET-CT. Ultrasound guided tru-cut biopsy was performed for the right and left caudal lung nodules. However histopathological diagnosis was not possible due to extensive necrosis of the sample. Multiple lung nodules in the dog were tentatively diagnosed as a primary lung tumor because there was no evidence of an unknown primary tumor on the basis of the diagnostic imaging. "

Lung_Cancer

"Lung and Intrathoracic Tumors Pathology and Laboratory Medicine Anatomical Pathology Surgical Pathology Radiology and Imaging Research and Analysis Methods Imaging Techniques Tumor Size and Computed Tomography Attenuation of Pulmonary Pure Ground-Glass Nodules Are Useful for Predicting Pathological Invasiveness Prediction of Pathological Invasiveness of Pure Ground-Glass Nodules Eguchi Takashi 1 * Yoshizawa Akihiko 2 Kawakami Satoshi 3 Kumeda Hirotaka 1 Umesaki Tetsuya 1 Agatsuma Hiroyuki 1 Sakaizawa Takao 1 Tominaga Yoshiaki 1 Toishi Masayuki 1 Hashizume Masahiro 1 Shiina Takayuki 1 Yoshida Kazuo 1 Asaka Shiho 2 Matsushita Mina 3 Koizumi Tomonobu 4 1 Division of Thoracic Surgery Department of Surgery Shinshu University Matsumoto Japan 2 Department of Pathology Shinshu University Matsumoto Japan 3 Department of Radiology Shinshu University Matsumoto Japan 4 Comprehensive Cancer Center Shinshu University Matsumoto Japan Adusumilli Prasad S. Editor Memorial Sloan-Kettering Cancer Center United States of America * E-mail: tks1976shinshu-u.ac.jp Competing Interests: The authors have declared that no competing interests exist. Conceived and designed the experiments: TE AY SK. Performed the experiments: TE AY SK HK TU HA T. Sakaizawa SA MM. Analyzed the data: TE YT MT MH T. Shiina KY TK. Contributed reagents/materials/analysis tools: TE TK. Wrote the paper: TE AY SK. 2014 20 5 2014 9 5 e97867 6 3 2014 25 4 2014 2014 Eguchi et al This is an open-access distributed under the terms of the Creative Commons Attribution License which permits unrestricted use distribution and reproduction in any medium provided the original author and source are credited. Objectives Pulmonary ground-glass nodules (GGNs) are occasionally diagnosed as invasive adenocarcinomas. This study aimed to evaluate the clinicopathological features of patients with pulmonary GGNs to identify factors predictive of pathological invasion. Methods We retrospectively evaluated 101 pulmonary GGNs resected between July 2006 and November 2013 and pathologically classified them as adenocarcinoma in situ (AIS; n?=?47) minimally invasive adenocarcinoma (MIA; n?=?30) or invasive adenocarcinoma (I-ADC; n?=?24). The age sex smoking history tumor size and computed tomography (CT) attenuation of the 3 groups were compared. Receiver operating characteristic (ROC) curve analyses were performed to identify factors that could predict the presence of pathologically invasive adenocarcinomas. Results Tumor size was significantly larger in the MIA and I-ADC groups than in the AIS group. CT attenuation was significantly greater in the I-ADC group than in the AIS and MIA groups. In ROC curve analyses the sensitivity and specificity of tumor size (cutoff 11 mm) were 95.8% and 46.8% respectively and those for CT attenuation (cutoff ?680 HU) were 95.8% and 35.1% respectively; the areas under the curve (AUC) were 0.75 and 0.77 respectively. A combination of tumor size and CT attenuation (cutoffs of 11 mm and ?680 HU for tumor size and CT attenuation respectively) yielded in a sensitivity and specificity of 91.7% and 71.4% respectively with an AUC of 0.82. Conclusions Tumor size and CT attenuation were predictive factors of pathological invasiveness for pulmonary GGNs. Use of a combination of tumor size and CT attenuation facilitated more accurate prediction of invasive adenocarcinoma than the use of these factors independently. The authors have no support or funding to report. Introduction We have previously evaluated the usefulness of computed tomography (CT) as a screening tool for lung cancer [1] [2]. With the increased use of CT screening cases of lung cancer appearing as pure ground-glass nodules (GGNs) which are radiologically nonsolid nodules are being detected with increasing frequency [3]. Neoplastic cells in pure GGNs are usually distributed along pre-existing alveolar structures in a lepidic growth pattern without interstitial invasion [4] and because of this limited resection is sometimes indicated in patients with pulmonary pure GGNs. However a subset of pulmonary pure GGNs are associated with pathological invasion and in general it is difficult to distinguish between pure GGNs with invasion and those without invasion by CT examination. The relationship between pathological invasiveness and radiological findings of pulmonary pure GGNs has not yet been fully elucidated and hence the objective of this study was to evaluate the demographic and clinicopathological features of patients with pulmonary pure GGNs in order to identify factors predictive of pathological invasion. Patients and Methods This retrospective study was approved by the institutional review board of Shinshu University Hospital Matsumoto Japan and was conducted in accordance with the principles outlined in the Declaration of Helsinki. Between July 2006 and November 2013 775 patients underwent lung resection for primary lung cancer at Shinshu University Hospital. Among these patients 101 tumors in 98 patients appeared as pure GGNs on the last CT examination performed before surgery and we retrospectively investigated the clinicopathological characteristics of these 101 tumors. During this period we used 2 types of CT scanners for the diagnosis of GGNs: Light Speed Ultra (GE Healthcare Freiburg Germany) CT scanner from July 2006 to December 2007; and the Light Speed VCT Vision (GE Healthcare) CT scanner from December 2007 onwards. Written informed consent was not given by participants for their clinical records to be used in this study. Patient records/information was anonymized and de-identified prior to analysis. Radiological Definition All CT examinations were performed at our institute and full resolution scans of 1.25-mm-thick sections were obtained without the use of contrast media. All tumors were viewed in both the lung window setting (window level ?550 Hounsfield units [HU]; window width 1500 HU) and mediastinal window setting (window level 30 HU; window width 400 HU). Two experienced radiologists (SK and MM) who were blinded to the patients™ clinical information independently interpreted all of the scans. Pure GGNs were defined as focal nodular areas of increased lung attenuation through which normal parenchymal structures including airways and vessels could be visualized [5]. Nodules that included both ground-glass and solid components were defined to be ˜part-solid GGNs™ [6] and were excluded from the study. Solid components were evaluated using the mediastinal window setting [6]. The radiological tumor size was defined as the maximum lesion diameter in the lung window setting. The mean CT attenuation was measured using the region-of-interest cursors which traced the edge of the tumor on the slices containing the region of the lesion with the maximum diameter [7]. Histological Examination All tumors were histologically evaluated by two experienced pathologists (AY and SA) who were blinded to the patients™ clinical information. All histological evaluations were performed by examining hematoxylin and eosin stained slides which were prepared using formalin-fixed paraffin-embedded tissues. Adenocarcinoma lesions were classified according to the new lung adenocarcinoma classification proposed by the International Association for the Study of Lung Cancer American Thoracic Society and European Respiratory Society (IASLC/ATS/ERS) [8]. Surgical Criteria In our institute surgical resection for pure GGNs was indicated in cases of tumors ?10 mm in size tumors enlarged during the follow-up period and other tumors with surgical indications present in the ipsilateral lung. The surgical procedure for pure GGNs was determined according to the tumor size as follows: <10 mm partial resection; 10 mm to <20 mm segmentectomy or lobectomy; and ?20 mm lobectomy. However radiological follow-up or limited surgery were occasionally selected by the attending physicians on considering factors such as patient age lung function performance status and pre-existing diseases. Statistical Analysis The tumors were divided into 3 groups according to pathological classifications: (1) adenocarcinoma in situ (AIS) (2) minimally invasive adenocarcinoma (MIA) and (3) invasive adenocarcinoma (I-ADC). Patient characteristics (age sex smoking history and preoperative plasma carcinoembryonic antigen [CEA] levels) tumor size and mean CT attenuation values were compared between the 3 groups. Continuous variables were compared using the analysis of variance with Scheffe™s post-hoc test and categorical data were compared using Chi-square tests. Pearson™s correlation analyses were used to verify whether the tumor size and mean CT attenuation values could be useful for predicting the pathological invasion diameter and receiver operating characteristic (ROC) curve analyses were used to confirm the predictive value of factors identified as predictive of pathologically invasive adenocarcinomas. All statistical analyses were performed using PASW Statistics 18.0 (IBM corp. Armonk NY). All data are reported as mean ± standard deviation and statistical significance was set at P<0.05. Results Patient Characteristics and Radiological Tumor Properties The age sex smoking history serum CEA levels tumor size and mean CT attenuation for all patients and for each group are summarized in Table 1. 10.1371/journal.pone.0097867.t001 Table 1 Patient characteristics and tumor properties. Total (n?=?103) AIS (n?=?47) MIA (n?=?30) I- ADC (n?=?24) p value Age (years) 64.3±9.7 63±10.8 64.3±9.2 66.3±8 0.3953 Sex (male/female) 39/62 19/28 14/16 6/18 0.5983 Smoking history (with/without) 31/70 15/32 13/17 3/21 0.1976 CEA level (ng/ml) 2.1±1.7 1.8±0.9 2.6±2.6 2.1±1.1 0.1408 Tumor size (mm) 13.1±5.5 11±3.6 14.7±7.6# 15.5±3.6# 0.0005 CT attenuation (HU) ?621±86.3 ?649.8±88.4 ?625.8±88.4 ?560.2±69.3* <0.0001 Abbreviations: AIS adenocarcinoma in situ; MIA minimally invasive adenocarcinoma; I-ADC invasive adenocarcinoma; CEA carcinoembryonic antigen; CT computed tomography; HU Hounsfield unit. # significantly higher than tumor size in the AIS group. *significantly higher than CT attenuation in the AIS and MIA groups. Surgical Procedures The surgical procedures performed for the 101 tumors in 98 patients were as follows: lobectomy 34 tumors in 32 patients; segmentectomy 28 tumors in 28 patients; and partial resection 39 tumors in 39 patients. In 2 patients who underwent lobectomy 2 tumors were present in the same lobe. In 1 patient with two tumors in different lobes in the ipsilateral lung lobectomy and partial resection were performed. Pathological Findings and Outcomes Pathologically all lesions were diagnosed as pulmonary adenocarcinoma. The IASLC/ATS/ERS classification of these adenocarcinomas was as follows: AIS 47 lesions; MIA 30 lesions; and I-ADC 24 lesions (lepidic predominant 10 lesions; papillary predominant 8 lesions; and acinar predominant 6 lesions). The mean pathological maximum diameter was 11.0±5.4 mm. The mean invasion diameter was 2.9±3.7 mm. All patients in our study were classified as having pathological stage T1aN0M0 lung cancer. No vascular invasion lymph node metastasis or intrapulmonary metastasis was detected. The median follow-up duration (from the date of surgery to the last follow-up) was 21.2 months (range 1“51.2 months). Recurrence was not observed in any patient and 1 patient in the MIA group died 12 months after surgery due to an unrelated cause. Figure 1 shows representative radiological and histological images from patients in each of the groups. 10.1371/journal.pone.0097867.g001 Figure 1 Representative radiological and histological images. (a) A 64-year-old female patient with adenocarcinoma in situ. (i) Computed tomography (CT) scan (lung window setting) showed a pure ground-glass nodule (GGN) 11.9 mm in size. The mean CT attenuation of the tumor was ?716 Hounsfield units (HU). (ii) Mediastinal window setting CT showed no tumor components except for vessels. (iii) Low magnification image (hematoxylin and eosin (HE) staining) showed a circumscribed tumor growing purely with a lepidic pattern without foci of invasion. A slight thickening of the alveolar walls in the tumor area was observed. (iv) Middle magnification image of the tumor (HE staining) revealed that tumor cells appeared to replace normal pneumocytes on alveolar walls. (b) A 63-year-old female patient with minimally invasive adenocarcinoma. (i) Lung window CT image showed a pure GGN 14.2 mm in size. The mean CT attenuation was ?691 HU. (ii) Mediastinal window CT showed no tumor components. "

Lung_Cancer

"Using fluorescence microscopy we identified apoptotic cells by the presence of highly condensed or fragmented nuclei. Apoptotic cells were counted in 5 different fields under microscopic observation. Western blot analysis The detailed protocol for the Western blot analysis is described in Method S1. It was performed under conventional conditions using the following antibodies: rabbit anti-human REIC/Dkk-3 antibody raised in our laboratory [11]; rabbit anti-human GRP78/BiP (GRP78) (ab21685; Abcam Cambridge MA); rabbit anti-human SAPK/JNK (#9252) and rabbit anti-human phospho-SAPK/JNK (Thr183/Tyr185; #9251) (Cell Signaling Technology Beverly MA); rabbit anti-human coxsackievirus and adenovirus receptor (CAR) (HPA030411; Atlas antibodies Stockholm Sweden); and mouse anti-actin (MAB1501; Millipore Billerica MA). The following secondary antibodies were used: goat anti-rabbit or anti-mouse IgG-conjugated horseradish peroxidase (Santa Cruz Biotechnology Santa Cruz CA). To detect the specific signals the membranes were examined using ECL plus Western Blotting Detection Reagents (Amersham Biosciences UK Limited Buckinghamshire UK). In addition the band intensities for GRP78 CAR and actin representing their expression levels were measured using ImageQuant TL software (GE Healthcare Bioscience) and quantified by GRP78 or CAR/actin ratio. Tumor growth assay in vivo A549 cells (5—106 in 50 µL of phosphate buffered saline [PBS]) mixed with 50 µL of Matrigel (BD Biosciences San Jose CA) were subcutaneously injected into the right flank of adult female BALB/c nu/nu mice (CLEA Japan Tokyo Japan). The tumor volume was calculated using the empirical formula V?=?1/2—[(the shortest diameter)2—(the longest diameter)]. When the tumors had reached approximately 50“100 mm3 mice (n?=?15) were randomly divided into 3 treatment groups: (a) PBS; (b) Ad-LacZ; and (c) Ad-REIC. Viruses (1—109 pfu) in 100 µL of serum-free medium were administered intratumorally. At the end of experiments mice were sacrificed after 24-days after the viral injection and tumors were harvested measured and photographed. Statistical analyses All data were analyzed using STATA ver.12 (STATA Corp. College Station TX). Fisher's exact test was applied when appropriate. For a comparison of induction of apoptosis between Ad-REIC-treated and Ad-LacZ-treated A549 cells a Cochran-Mantel-Haenszel statistics was applied for comparing. Repeated measurement ANOVA was applied for the comparison of xenotransplanted NSCLC tumor sizes among PBS Ad-LacZ and Ad-REIC. P<0.05 was considered significant. All tests were two-sided. Results Effect of Ad-REIC on NSCLC cell lines We examined the inhibition of cell viability using Ad-REIC and an MTS assay. In 13 (52%) of 25 NSCLC cell lines Ad-REIC treatment at 20 MOI inhibited the cell viability (40%“60% inhibition) compared with Ad-LacZ treatment ( ). These cell lines were regarded as highly sensitive to Ad-REIC. In contrast 12 cell lines (48%) were not inhibited by Ad-REIC treatment at 20 MOI and were regarded as resistant cells. OUMS-24 was not inhibited at 20 or 200 MOI of Ad-REIC. Of note Ad-REIC treatment at 100 and 200 MOI improved the inhibition of cell viability (100 MOI: 15%“59% inhibition 200 MOI: 40%“78% inhibition) compared with Ad-LacZ treatment (). Thus we defined 20 MOI as a low MOI value and 200 MOI as a high MOI value. For comparison Ad-REIC treatment was also performed in the human mesothelioma cell line 211H which we previously reported to be Ad-REIC-sensitive [14]. The 211H was not inhibited at 20 MOI but was inhibited at 200 MOI of Ad-REIC (). "

Lung_Cancer

"Both FDR values for discovered pairwise and triplet combinations were zero therefore all of the discovered logic pairwise and triplet combinations were not generated by chance and all of them might represent real associations. In addition we calculated the recurrence rate of discovered logic pairwise and triplet combinations among all random trials. The logic relationships with the recurrence rate larger than were considered as the relationships which were independent of the specimens selected. Finally we derived probe-AC lower logic relationships and probe-AC higher logic relationships (Table A and B in Table S1). Note that the AC profile data and SCC profile data were binary complementary vectors. If a probe (or a probe pair) is related with AC by the th type of lower (higher) logic relationships then the probe (the probe pair) is related with SCC by the th type of lower (higher) logic relationships where the uncertainty coefficient of the probe-SCC lower (higher) logic relationship is equal to that of the probe-AC lower (higher) logic relationship but . Therefore the probe which has a close relationship with AC is also closely related with SCC. Finally we obtained probe-AC/SCC lower logic relationships and probe-AC/SCC higher logic relationships. Identification of gene-subtype lower and higher logic relationships Each probe which was focused on in this paper is mapped to a single gene. Conversely a gene may be detected by more than one probe. For example the CLCA2 gene was detected by four different probes: 206164_at 206165_s_at 206166_s_at and 217528_at. All of the above four probes were related with AC by the second type of lower logic relationships. Moreover and were the mean uncertainty coefficients for each of the four probes related with AC in both directions respectively. A probe-AC logic relationship set comprised several probe-AC logic relationships where probes were associated to the same gene. In a probe-AC logic relationship set the probe-AC/SCC logic relationship with the largest mean uncertainty coefficients in both directions was used to generate a gene-AC/SCC logic relationship as described in Section Materials and Methods. Thus CLCA2 was related with AC by the second type of lower logic relationships and the coefficient of the CLCA2-AC/SCC relationship was . According to the above method gene-AC/SCC lower logic relationships were generated from probe-AC/SCC lower logic relationships (Table A in Table S2). Each of the rest probe-AC/SCC lower logic relationships generated a gene-AC/SCC lower logic relationship. Finally we obtained gene-AC/SCC lower logic relationships (Table A in Table S3). We found that if a gene was detected by more than one probe and the probes were related with subtypes by lower logic relationships then the types of the probe-AC/SCC lower logic relationships were the same. It is suggested that the probes which are associated to the same gene may be related with subtypes by the same way. We obtained six gene-AC/SCC higher logic relationships from probe-AC/SCC higher logic relationships (Table B in Table S2). Each of the rest probe-AC/SCC higher logic relationships generated a gene-AC/SCC higher logic relationship. Finally we obtained gene-AC/SCC higher logic relationships (Table B in Table S3). In what follows we discussed examples of logic relationships which may be inferred from phenomenons previously described in the literature. Examples of gene-subtype lower logic relationships If each of the genes DSG3 CLCA2 DSC3 and PKP1 was expressed then SCC was present while AC was absent. In addition if each of above genes was not expressed then SCC was absent and AC was present. That is the expression of each of above genes was a sufficient and necessary condition of the presence of SCC as well as the absence of AC. Our results suggested that genes (DSG3 CLCA2 DSC3 and PKP1) may distinguish subtype AC from SCC. Given that intracellular bridges are one of the most characteristic of SCC but not of AC proteins involved in these bridges may be up-regulated in SCC only such as desmosome proteins and intercellular junctional proteins [25]. Desmoglein 3 is the protein encoded by DSG3. This protein is a calcium-binding transmembrane glycoprotein component of desmosome in vertebrate epithelial cells."

Lung_Cancer

"Methods: Twenty-six rabbits with lung VX2 tumor were randomly divided into experimental and control group. In the experimental group microwave ablation guided by ultrasound or CT was performed based on location of the tumor. Enhanced CT scan was carried out immediately before and after the ablation for all animals. Two animals from each group were sacrificed immediately or 1 week after the ablation respectively and the others were followed for the rest of their lives. Results: CT scan revealed that the tumor was greatly reduced or ablated after ablation. Pathological examination immediately after ablation also confirmed the tumor reduction or ablation. The survival time of the animals in the experimental group was significantly longer than that in the control group. Conclusions: Microwave ablation is a safe and effective method for treating lung cancer in rabbits showing potential clinical applicability. Microwave ablation VX2 tumor lung cancer 9421547 4136 Hum Pathol Hum. Pathol. Human pathology 0046-8177 1532-8392 24444464 3965626 10.1016/j.humpath.2013.10.016 NIHMS537247 A PIK3CA mutation detected in plasma from a patient with synchronous primary breast and lung cancers Jelovac Danijela MD 1 * Beaver Julia A. MD 1 * Balukrishna Sasidharan MD 2 Wong Hong Yuen BS 1 Toro Patricia Valda BS 1 Cimino-Mathews Ashley MD 1 Argani Pedram MD 1 Stearns Vered MD 1 Jacobs Lisa MD 1 VanDenBerg Dustin BS 1 Kessler Jill BS 1 Jeter Stacie BS 1 Park Ben H. MD PhD 1 Wolff Antonio C. MD 1 1The Sidney Kimmel Comprehensive Cancer Center at Johns Hopkins 1650 Orleans Street Baltimore MD 21287 2Christian Medical College Vellore Tamil Nadu India 632004 * These authors contributed equally to this work 18 12 2013 31 10 2013 4 2014 01 4 2015 45 4 880 883 2013 Elsevier Inc. All rights reserved. 2013 Digital PCR is a new technology that enables detection and quantification of cancer DNA molecules from peripheral blood. Using this technique we identified mutant PIK3CA DNA in circulating plasma tumor DNA (ptDNA) from a patient with concurrent early stage breast cancer and non-small cell lung cancer. The patient underwent successful resection of both her breast and lung cancers and using standard Sanger sequencing the breast cancer was shown to harbor the identical PIK3CA mutation identified in peripheral blood. This case report highlights potential applications and concerns that can arise with the use of ptDNA in clinical oncology practice. plasma tumor DNA breast cancer lung cancer PIK3CA digital PCR Br J Cancer Br. J. Cancer British Journal of Cancer 0007-0920 1532-1827 Nature Publishing Group 24983368 4102953 bjc2014353 10.1038/bjc.2014.353 Genetics and Genomics Assessing standardization of molecular testing for non-small-cell lung cancer: results of a worldwide external quality assessment (EQA) scheme for EGFR mutation testing Worldwide external quality assessment for EGFR gene mutation testing Patton S 1 * Normanno N 2 Blackhall F 3 Murray S 4 Kerr K M 5 Dietel M 6 Filipits M 7 Benlloch S 8 Popat S 9 Stahel R 10 Thunnissen E 11 1EMQN Manchester Centre for Genomic Medicine St Mary's Hospital Manchester M13 9WL UK 2Cell Biology and Biotherapy Unit Istituto Nazionale per lo Studio e la Cura dei Tumori ˜Fondazione Giovanni Pascale'”IRCCS 80131 Naples Italy 3Christie Hospital Manchester M20 4BX UK 4Biomarker Solutions Ltd London EC1V 2NX UK 5Department of Pathology Aberdeen Royal Infirmary Aberdeen AB25 2ZN UK 6Charit Humboldt-Universitt zu Berlin Berlin 10117 Germany 7Medical University of Vienna 1010 Vienna Austria 8Pangaea Biotech USP Dexeus University Institute Barcelona 08028 Spain 9Royal Marsden Hospital London SW3 6JJ UK 10University Hospital Z¼rich CH-8091 Z¼rich Switzerland 11Department of Pathology VU University Medical Center Amsterdam 1081 HZ The Netherlands *E-mail: simon.pattoncmft.nhs.uk 15 07 2014 01 07 2014 15 7 2014 111 2 413 420 22 01 2014 19 05 2014 20 05 2014 Copyright 2014 Cancer Research UK 2014 Cancer Research UK This work is licensed under the Creative Commons Attribution-NonCommercial-Share Alike 3.0 Unported License. To view a copy of this license visit http://creativecommons./licenses/by-nc-sa/3.0/ Background: The external quality assurance (EQA) process aims at establishing laboratory performance levels. Leading European groups in the fields of EQA Pathology and Medical and Thoracic Oncology collaborated in a pilot EQA scheme for somatic epidermal growth factor receptor (EGFR) gene mutational analysis in non-small-cell lung cancer (NSCLC). Methods: EQA samples generated from cell lines mimicking clinical samples were provided to participating laboratories each with a mock clinical case. Participating laboratories performed the analysis using their usual method(s). Anonymous results were assessed and made available to all participants. Two subsequent EQA rounds followed the pilot scheme. Results: One hundred and seventeen labs from 30 countries registered and 91 returned results. Sanger sequencing and a commercial kit were the main methodologies used. The standard of genotyping was suboptimal with a significant number of genotyping errors made. Only 72 out of 91 (72%) participants passed the EQA. False-negative and -positive results were the main sources of error. The quality of reports submitted was acceptable; most were clear concise and easy to read. However some participants reported the genotyping result in the absence of any interpretation and many obscured the interpretation required for clinical care. Conclusions: Even in clinical laboratories the technical performance of genotyping in EGFR mutation testing for NSCLC can be improved evident from a high level of diagnostic errors. Robust EQA can contribute to global optimisation of EGFR testing for NSCLC patients. non-small-cell lung carcinoma EGFR gene mutations quality assessment Assessment of epidermal growth factor receptor (EGFR) mutations has become mandatory to choose the most active first-line treatment for patients with advanced non-small-cell lung cancer (NSCLC). Indeed randomized phase III clinical trials have demonstrated that first-line administration of an EGFR TKI results in a prolonged progression-free survival as compared with chemotherapy in patients carrying EGFR mutations (Mok et al 2009; Maemondo et al 2010; Mitsudomi et al 2010; Fukuoka et al 2011; Zhou et al 2011; Rosell et al 2012). These studies have also confirmed that EGFR mutations are a reliable marker that predicts sensitivity to EGFR TKIs (Mok et al 2009). Activating mutations occur in exons 18 through 21 of the TK domain of the EGFR gene and either point mutations or in-frame small deletions or insertions (Sharma et al 2007; De Luca and Normanno 2010). Although more than 250 mutations of the EGFR gene have been described to date two mutations a single point mutation in exon 21 the L858R and a series of small in-frame deletions in exon 19 account for ?90% of all EGFR mutations (Sharma et al 2007; Linardou et al 2008). EGFR mutations are strongly associated with defined clinical and pathological features: they are far more frequent in female patients as compared with male; in adenocarcinoma as compared with other histological types; in non-smokers as compared with current smokers or former smokers; and in East-Asian NSCLC patients as compared with Non-East-Asian patients (Normanno et al 2006). External quality assessment (EQA) is a system of objectively checking laboratory results by an independent external agency (van Krieken et al 2013). The main objective of an EQA programme is to establish inter-laboratory comparability. In this respect the EQA process can identify latent systematic errors in methodology that may not be revealed by a laboratory's own internal QA processes. Representatives from ETOP ESMO ESP EMQN and other leading European groups met in July 2010 to discuss a pan-European approach to EQA for EGFR mutation testing in NSCLC. In this paper we present the results of this pilot EQA scheme for EGFR testing that was completed in 2013. Materials and Methods anisation of the scheme A meeting was anised in July 2010 by ETOP and EMQN to bring together a group of professionals representing EMQN ESP ETOP ESMO and other leading European groups involved in NSCLC testing (see Supplementary Information). From this group a steering group of five individuals was formed who planned designed and assessed the results of the pilot EQA scheme. The scheme was coordinated and administered by the EMQN and three rounds were anised within a period of 18 months. The workflow of the scheme process is shown in Figure 1. Validation of samples The primary aim of this scheme was to develop a flexible scalable EQA scheme designed to assess issues related to techniques and minimum detection limits used in standard laboratory practice focusing exclusively on the analytical (that is sample processing genotyping) and reporting phases (interpretation of the results in relation to the clinical context). To enable this and to avoid the significant challenges of sample heterogeneity in real tissue samples 20 artificial materials were used composed of formalin-fixed paraffin-embedded (FFPE) cell line samples. These EQA materials were designed to mimic real tissue samples as closely as possible and contained homogenous mixtures of mutant vs wild-type cell lines at a range of different allelic ratios. The paraffin blocks were cut and 10??m sections placed in eppendorf tube at the Pathology department of the VU University Medical Centre in Amsterdam The Netherlands by Dr Erik Thunnissen. H&E (4??m) sections were used to estimate the number of tumour cells. In each EQA sample section at least 200 nuclei were present (usually >300) roughly mimicking the amount of cells from a small NSCLC biopsy. For each EQA sample one 10-?m-thick section was sent by EMQN to each of the three validating laboratories for mutational analysis in a blinded fashion. Different sections from the block were analysed for EGFR mutation status to ensure that the mutation was homogeneously represented within each block. The validating laboratories independently analysed the samples by using three different approaches: direct sequencing of the PCR product for exons 18“21 mutations; fragment analysis for exon 19 deletions and an allelic discrimination-based real-time PCR assay for the L858R mutation in exon 21; and the Therascreen EGFR RGQ kit (Qiagen Hilden Germany) reporting the results directly to the EMQN. The allelic ratios of mutations in each sample used in rounds 2 and 3 were accurately quantified by a commercial sponsor (Horizon Diagnostics Cambridge UK) using droplet digital PCR (ddPCR) on a BioRad QX100 (Hercules CA USA) platform. Genomic DNA (gDNA) was extracted from FFPE sections on the Promega (Madison WI USA) Maxwell System using the Maxwell 16 FFPE Plus LEV DNA purification kit according to the manufacturer's protocol. Quantification was performed using a Promega QuantiFluor dsDNA assay kit according to the manufacturer's protocol. ddPCR was performed using Taqman custom SNP 40 — primer/probe assays (Life Technologies Carlsbad CA USA) to assess the frequency of each mutation with the exception of the p.(E746_A750) assay which was designed in-house. DNA (40?ng) was added to each ddPCR reaction. Reactions were performed in quadruplicate and droplets were generated using a Droplet Generator according to the manufacturer's instructions. PCR was performed on a standard thermocycler using previously optimised assay-specific cycling conditions. Droplets were analysed using a QX100 Droplet Reader as described in the manufacturer's instructions. Data from at least 45?000 useable droplets were collected for each sample. Formalin-fixed paraffin-embedded reference standards (Horizon Diagnostics) were included as assay controls. Registration of participant laboratories and shipment of samples Laboratories that performed EGFR mutational analysis were invited to participate in the EQA via an open call from the EMQN in conjunction with the ESP ETOP and ESMO. Participating laboratories registered via the EMQN website (European Molecular Genetics Quality Network (EMQN) 2014) and were requested to perform DNA extraction and analysis using their routine method. In each round 10 samples (one 10-?m-thick section for each) with accompanying mock clinical referral information were sent to participating laboratory. Each laboratory was identified only by a unique EMQN ID code to avoid exchange of information between participants and minimise bias in the results' interpretation process. The laboratories were given 8 weeks to complete their analyses and to submit the results of genotyping to the EMQN website. The centres were requested to provide information on the technique used for mutational analysis and metrics relating to their experience of performing EGFR mutational analyses. Evaluation of results The scheme included three rounds: the first was restricted to a maximum of 30 labs to establish proof of principle and validate the materials. A subsequent second round of the scheme was anised with no restriction on participation. Laboratories that failed the second round were provided with another set of samples in a restricted third round. The steering group evaluated the results according to a pre-defined scoring system. The scoring system assigned two points to correct genotype and zero points to false-positive or -negative results (Table 1). Errors in mutation nomenclature that might lead to misinterpretation of the results (for example stating ˜deletion' without specifying the exon in which the deletion occurs) were assigned 1.50 points. This deduction was applied only once for each center generally to the first sample for which the error was found. One point was awarded for cases in which the genotype was mispositioned or miscalled: this error sometimes occurs with exon 19 deletions for which it might be difficult to define the precise base or amino acid in which the deletion starts or ends. If a test failed giving no result on the sample (analytical failure) then the lab received 1.00 point for that sample. The threshold to pass the EQA was set at a total score for the 10 samples of ?18 out of 20 (Thunnissen et al 2011) “ laboratories with a genotyping score <18 were classified as poor performers (applied to rounds 2 and 3 only). Performance in the assessment of clinical interpretation and reporting did not contribute to poor performance. Results Selection of the samples for the EQA The first step of the EQA scheme was the selection and the validation of the samples. Twenty materials were manufactured by Dr Thunnissen by mixing four lung cancer cell lines (A549 EGFR wild type) H1650 (EGFR p.(E746_A750del) H1975 (EGFR p.(T790M) p.(L858R)) and SW48 (p.G719S). Cell lines with mutations were serially diluted into A549 or SIHA cells at different ratios relevant to establishing the analytical sensitivity of the tests used by labs. Each material was validated in three different reference laboratories using different techniques to confirm the genotype and the results showed that the mutations were detectable at all the designated ratios dependent on the technology used (Table 2). A good yield of gDNA was obtained from all the samples. In addition there was complete concordance on the EGFR mutational status of the selected specimens and therefore all were selected for use in the quality assessment scheme with samples A1“A10 used for the pilot and B1“10 and C1“C10 in subsequent rounds 2 and 3. To accurately establish quantitative measurements of the allelic frequencies of the EGFR mutations all 10 EQA samples (Table 2; samples B/C1“B/C10) used in rounds 2 and 3 were analysed on a ddPCR platform (BioRad QX100). Three of the samples had allelic frequencies higher than expected (C3 C8 and C9) two were lower (C2 and C10) and in one (C5) it was not possible to establish the true value due to insufficient availability of sample material (Table 3). First round proof of principle pilot scheme Twenty-nine laboratories registered from 13 countries and 25 participated in the pilot EQA scheme (4 labs withdrew due to customs sample importation problems) which was run in fourth quarter of 2011. A set of 10 samples were sent to the laboratories (Table 2; samples A1“A10). All the participating laboratories submitted results within the 8-week time frame. The main methodology used by the participants was PCR/sequencing (n=10 laboratories; 34%) and real-time PCR (n=10; 34%) (Figure 2). Two analytical errors (false-negative results) were observed. A further five laboratories made process errors (sample swaps) that resulted in an additional 24 genotype errors. In all cases the genotypes were correct but reported for the wrong sample. Therefore 92% of the false-negative results were concentrated in five laboratories. No false-positive results were reported. The materials performed well and there were no analytical test failures. As this was designed to ascertain proof of principle we did not apply a measure of successful laboratory performance. The pilot established that the scheme design and methods used were acceptable for use in a larger scheme. Second round One hundred and seventeen laboratories from 30 countries registered and 101 participated in the second round (due to customs issues we were not able to get samples to 16 labs) run in the second quarter of 2012. Ninety-one laboratories submitted results within the 8-week time frame “ the remaining 10 labs gave no reason why they did not submit results. A different set of samples from those used in the pilot first round were sent to the laboratories with the emphasis being on the inclusion of mutations at allelic frequencies that would challenge the analytical sensitivity of all the commonly used technologies (Table 2; samples B1“B10). A code number different from the one assigned in the first round was given to the samples. In addition to the genotype results all participating laboratories were also required to submit for assessment copies of their clinical reports for three samples (B1 B4 and B9). The main methodology used by the participants was PCR/sequencing (n=35 laboratories; 39%) and real-time PCR (n=17; 18.6% Figure 2). It was common for labs to use a combination of different methodologies in their testing process (Table 4). A variety of different errors were detected by the second scheme round including 74 (8.1%) genotype errors (false-positive (n=13; 1.5%) false-negative (n=61; 82.4%) and a combination of false-negative and -positive results (n=1; 1.4%)) as well as analytical test failures (n=31; 3.4%) mispositioning of the genotype (n=7; 0.8%) and significant errors in the mutation nomenclature (n=36; 3.9%). Two samples (B2 and B8) gave a disproportionately high error rate compared with the other samples used in this round (Table 5) with 94.1% of errors for B2 made by labs using PCR/sequencing vs 40.7% of errors for sample B8 made by labs using a version of the Therascreen EGFR kit (Qiagen). Laboratories did not lose marks if the declared limitations of their assay meant that they would not detect a particular mutation at the given frequency used in the EQA materials. Eighteen laboratories (19.8%) from 13 countries with a total score below 18 did not pass the second round and were thus classified as poor performers “ 72.2% of these labs used PCR/Sequencing as their main diagnostic test for EGFR mutation status. "

Lung_Cancer

"colon cancer Clin. Cancer Res. 2009 15 7451 7452 19996205 Landi MT Gene expression signature of cigarette smoking and its role in lung adenocarcinoma development and survival PLoS One 2008 3 e1651 18297132 Lee ES Prediction of recurrence-free survival in postoperative non-small cell lung cancer patients by using an integrated model of clinical information and gene expression Clin. Cancer Res. 2008 14 7397 7404 19010856 Lin YH Multiple gene expression classifiers from different array platforms predict poor prognosis of colorectal cancer Clin. Cancer Res. 2007 13 498 507 17255271 Lu TP Integrated analyses of copy number variations and gene expression in lung adenocarcinoma PLoS One 2011 6 e24829 21935476 Marisa L Gene expression classification of colon cancer into molecular subtypes: characterization validation and prognostic value PLoS Med. 2013 10 e1001453 23700391 Munoz-Pinedo C Cancer metabolism: current perspectives and future directions Cell Death Dis. 2012 3 e248 22237205 Smith JJ Experimentally derived metastasis gene expression profile predicts recurrence and death in patients with colon cancer Gastroenterology 2010 138 958 968 19914252 Su LJ Selection of DDX5 as a novel internal control for Q-RT-PCR from microarray data using a block bootstrap re-sampling scheme BMC Genomics 2007 8 140 17540040 Subramanian A Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles Proc. Natl Acad. Sci. USA 2005 102 15545 15550 16199517 Tian L Discovering statistically significant pathways in expression profiling studies Proc. Natl Acad. Sci. USA 2005 102 13544 13549 16174746 Vaske CJ Inference of patient-specific pathway activities from multi-dimensional cancer genomics data using PARADIGM Bioinformatics 2010 26 i237 i245 20529912 Wang Y Gene expression profiles and molecular markers to predict recurrence of Dukes' B colon cancer J. Clin. Oncol. 2004 22 1564 1571 15051756 Am J Respir Cell Mol Biol Am. J. Respir. Cell Mol. Biol ajrcmb American Journal of Respiratory Cell and Molecular Biology 1044-1549 1535-4989 American Thoracic Society 23980547 3930939 2013-0314TR 10.1165/rcmb.2013-0314TR Translational Review The Role of Vimentin Intermediate Filaments in the Progression of Lung Cancer Kidd Martha E. 1 2 Shumaker Dale K. 2 Ridge Karen M. 2 1Department of Biomedical Engineering Northwestern University Evanston Illinois; and 2Division of Pulmonary and Critical Care Medicine Northwestern University Feinberg School of Medicine Chicago Illinois Correspondence and requests for reprints should be addressed to Karen M. Ridge Ph.D. Division of Pulmonary and Critical Care Medicine Northwestern University Feinberg School of Medicine 240 East Huron Street McGaw M328 Chicago IL 60611. E-mail: kridgenorthwestern.edu 1 2014 1 2014 50 1 1 6 08 7 2013 30 7 2013 Copyright 2014 by the American Thoracic Society 2014 There is an accumulation of evidence in the literature demonstrating the integral role of vimentin intermediate filaments (IFs) in the progression of lung cancers. Vimentin IF proteins have been implicated in many aspects of cancer initiation and progression including tumorigenesis epithelial-to-mesenchymal transition (EMT) and the metastatic spread of cancer. Specifically vimentin IFs have been recognized as an essential component regulating EMT major signal transduction pathways involved in EMT and tumor progression cell migration and invasion the positioning and anchorage of anelles such as mitochondria and cell“cell and cell“substrate adhesion. In tumenesis vimentin forms a complex with 14-3-3 and beclin 1 to inhibit autophagy via an AKT-dependent mechanism. Vimentin is a canonical marker of EMT and recent evidence has shown it to be an important regulator of cellular motility. Transcriptional regulation of vimentin through hypoxia-inducible factor-1 may be a potential driver of EMT. Finally vimentin regulates 14-3-3 complexes and controls various intracellular signaling and cell cycle control pathways by depleting the availability of free 14-3-3. There are many exciting advances in our understanding of the complex role of vimentin IFs in cancer pointing to the key role vimentin IFs may play in tumor progression. Keywords epithelial-to-mesenchymal transition invadopodia lung cancer metastatic cascade vimentin 8711562 6325 Oncogene Oncogene Oncogene 0950-9232 1476-5594 23752194 3839253 10.1038/onc.2013.208 NIHMS490151 ARF Inhibits the Growth and Malignant Progression of Non-Small Cell Lung Carcinoma Busch Stephanie E 1 2 Moser Russell D 1 Gurley Kay E 1 Kelly-Spratt Karen S 1 Liggitt H Denny 3 Kemp Christopher J 1 1Division of Human Biology Fred Hutchinson Cancer Research Center Seattle Washington 98109 2Molecular and Cellular Biology Graduate Program University of Washington Seattle Washington 98195 3Department of Comparative Medicine University of Washington Seattle Washington 98195 Corresponding author: Christopher J. Kemp Ph.D. Fred Hutchinson Cancer Research Center 1100 Fairview Ave N Mail Stop C1-015 Seattle WA 98109. cjkempfhcrc.. Phone: (206) 667-4252. Fax: (206) 667-5815 11 7 2013 10 6 2013 15 5 2014 15 5 2015 33 20 2665 2673 Non-small cell lung carcinoma (NSCLC) is among the deadliest of human cancers. The CDKN2A locus which houses the INK4a and ARF tumor suppressor genes is frequently altered in NSCLC. However the specific role of ARF in pulmonary tumorigenesis remains unclear. KRAS and other oncogenes induce the expression of ARF thus stabilizing p53 activity and arresting cell proliferation. To address the role of ARF in Kras-driven NSCLC we compared the susceptibility of NIH/Ola strain wild-type and Arf knockout mice to urethane-induced lung carcinogenesis. Lung tumor size malignancy and associated morbidity were significantly increased in Arf?/? compared to Arf+/+ animals at 25 weeks post-induction. Pulmonary tumors from Arf knockout mice exhibited increased cell proliferation and DNA damage compared to wild-type. A subgroup of tumors in Arf?/? animals presented as dedifferentiated and metastatic with many characteristics of pulmonary sarcomatoid carcinoma a neoplasm previously undocumented in mouse models. Our finding of a role for ARF in NSCLC is consistent with the observation that benign adenomas from Arf+/+ mice robustly expressed ARF while ARF expression was markedly reduced in malignant adenocarcinomas. ARF expression also frequently co-localized with expression of p21CIP1 a transcriptional target of p53 arguing that ARF induces the p53 checkpoint to arrest cell proliferation in vivo. Together these findings demonstrate that induction of ARF is an early response in lung tumorigenesis that mounts a strong barrier against tumor growth and malignant progression. p19Arf p14ARF ethyl carbamate metastasis J Transl Med J Transl Med Journal of Translational Medicine 1479-5876 BioMed Central 24726028 3996904 1479-5876-12-98 10.1186/1479-5876-12-98 Research Thymidylate synthase polymorphisms in genomic DNA as clinical outcome predictors in a European population of advanced non-small cell lung cancer patients receiving pemetrexed Arvalo Estefan­a 1 e.arevalo-vazquezhotmail.com Casta±n Eduardo 1 ecastanonunav.es Lpez Ins 2 milopezunav.es Salgado Josefa 3 jsalgadogunav.es Collado V­ctor 2 v.d.colladogmail.com Santisteban Marta 1 msantistebunav.es Rodr­guez-Ruiz Mar­a 4 mrruizunav.es Mart­n Patricia 1 pmromanounav.es Zubiri Leire 4 lzubiriunav.es Pati±o-Garc­a Ana 3 apatigarunav.es Rolfo Christian 5 christian.rolfouza.be Gil-Bazo Ignacio 1 2 igbazounav.es 1Department of Oncology Cl­nica Universidad de Navarra 31008 Pamplona Spain 2Division of Oncology Center for Applied Medical Research (CIMA) 31008 Pamplona Spain 3Laboratory of Clinical Genetics Cl­nica Universidad de Navarra 31008 Pamplona Spain 4Department of Radiation Oncology Cl­nica Universidad de Navarra 31008 Pamplona Spain 5Oncology Department Antwerp University Hospital UZA 2650 Edegem Belgium 2014 14 4 2014 12 98 98 3 11 2013 7 4 2014 Copyright 2014 Arvalo et al.; licensee BioMed Central Ltd. 2014 Arvalo et al.; licensee BioMed Central Ltd. This is an Open Access distributed under the terms of the Creative Commons Attribution License (http://creativecommons./licenses/by/2.0) which permits unrestricted use distribution and reproduction in any medium provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver (http://creativecommons./publicdomain/zero/1.0/) applies to the data made available in this unless otherwise stated. Background We studied whether thymidylate synthase (TS) genotype has an independent prognostic/predictive impact on a European population of advanced non-small cell lung cancer (NSCLC) patients receiving pemetrexed. Methods Twenty-five patients treated with pemetrexed-based regimens were included. Genomic DNA was isolated prior to treatment. The variable number of tandem repeat (VNTR) polymorphisms the G >?C single nucleotide polymorphisms (SNP) and the TS 6-bp insertion/deletion (6/6) in the 3? untranslated region (UTR) polymorphisms were analyzed and correlated with overall response rate (ORR) progression-free survival (PFS) overall-survival (OS) and toxicity. Results The genotype +6/+6 predicted a higher ORR among active/former smokers compared to +6/-6 genotype (100% vs. 50%; p =?0.085). Overall the 3R/3R genotype predicted a higher ORR (100%) over the rest VNTR polymorphisms (p =?0.055). The presence of 3R/3R genotype significantly correlated with a superior ORR in patients without EGFR activating mutations (100%) compared to 2R/2R 2R/3R and 3R/4R genotype (77.8% 33.3% and 0% respectively; p =?0.017). After a median follow-up of 21 months a trend towards a better PFS although not significant was found among subjects showing 3R/3R polymorphisms (p =?0.089). A significantly superior OS was found in patients showing 3R/3R genotype rather than other VNTR polymorphisms (p =?0.019). No significant correlation with the toxicity was observed. Conclusion In our series 3R/3R polymorphism correlated with a superior OS. Also this polymorphism when associated to wild type EGFR was related to a higher ORR to pemetrexed. "

Lung_Cancer

"of erythrocytes in systemic lupus erythematosus: analysis of the stability of the defect and of a restriction fragment length polymorphism of the CR1 gene J Immunol 1987 138 2708 2710 2881967 Xiang L Rundles JR Hamilton DR Wilson JG Quantitative alleles of CR1: coding sequence analysis and comparison of haplotypes in two ethnic groups J Immunol 1999 163 4939 4945 10528197 Birmingham DJ Chen W Liang G Schmitt HC Gavit K Nagaraja HN A CR1 polymorphism associated with constitutive erythrocyte CR1 levels affects binding to C4b but not C3b Immunology 2003 108 531 538 10.1046/j.1365-2567.2003.01579.x 12667215 Holers VM Chaplin DD Leykam JF Gruner BA Kumar V Atkinson JP Human complement C3b/C4b receptor (CR1) mRNA polymorphism that correlates with the CR1 allelic molecular weight polymorphism Proc Natl Acad Sci U S A 1987 84 2459 2463 10.1073/pnas.84.8.2459 3031685 Zhang Q Yu JT Zhu QX Zhang W Wu ZC Miao D Tan L Complement receptor 1 polymorphisms and risk of late-onset Alzheimer™s disease Brain Res 2010 1348 216 221 20558149 He JR Xi J Ren ZF Qin H Zhang Y Zeng YX Mo HY Jia WH Complement receptor 1 expression in peripheral blood mononuclear cells and the association with clinicopathological features and prognosis of nasopharyngeal carcinoma Asian Pac J Cancer Prev 2012 13 6527 6531 10.7314/APJCP.2012.13.12.6527 23464487 Srivastava A Mittal B Complement receptor 1 (A3650G RsaI and intron 27 HindIII) polymorphisms and risk of gallbladder cancer in north Indian population Scand J Immunol 2009 70 614 620 10.1111/j.1365-3083.2009.02329.x 19906204 Ferreira CG Lung cancer in developing countries Am Soc Clin Oncol Educ Book 2013 327 331 PMID:23714537 23714537 Amos CI Wu X Broderick P Gorlov IP Gu J Eisen T Dong Q Zhang Q Gu X Vijayakrishnan J Sullivan K Matakidou A Wang Y Mills G Doheny K Tsai YY Chen WV Shete S Spitz MR Houlston RS Genome-wide association scan of tag SNPs identifies a susceptibility locus for lung cancer at 15q25.1 Nat Genet 2008 40 616 622 10.1038/ng.109 18385676 Hung RJ McKay JD Gaborieau V Boffetta P Hashibe M Zaridze D Mukeria A Szeszenia-Dabrowska N Lissowska J Rudnai P Fabianova E Mates D Bencko V Foretova L Janout V Chen C Goodman G Field JK Liloglou T Xinarianos G Cassidy A McLaughlin J Liu G Narod S Krokan HE Skorpen F Elvestad MB Hveem K Vatten L Linseisen J A susceptibility locus for lung cancer maps to nicotinic acetylcholine receptor subunit genes on 15q25 Nature 2008 452 633 637 10.1038/nature06885 18385738 Wang Y Broderick P Webb E Wu X Vijayakrishnan J Matakidou A Qureshi M Dong Q Gu X Chen WV Spitz MR Eisen T Amos CI Houlston RS Common 5p15.33 and 6p21.33 variants influence lung cancer risk Nat Genet 2008 40 1407 1409 10.1038/ng.273 18978787 McKay JD Hung RJ Gaborieau V Boffetta P Chabrier A Byrnes G Zaridze D Mukeria A Szeszenia-Dabrowska N Lissowska J Rudnai P Fabianova E Mates D Bencko V Foretova L Janout V McLaughlin J Shepherd F Montpetit A Narod S Krokan HE Skorpen F Elvestad MB Vatten L Nj¸lstad I Axelsson T Chen C Goodman G Barnett M Loomis MM Lung cancer susceptibility locus at 5p15.33 Nat Genet 2008 40 1404 1406 10.1038/ng.254 18978790 Markiewski MM Lambris JD The role of complement in inflammatory diseases from behind the scenes into the spotlight Am J Pathol 2007 171 715 727 10.2353/ajpath.2007.070166 17640961 Ricklin D Lambris JD Complement-targeted therapeutics Nat Biotechnol 2007 25 1265 1275 10.1038/nbt1342 17989689 Hugli TE Biochemistry and biology of anaphylatoxins Complement 1986 3 111 127 3542363 Ostrand-Rosenberg S Cancer and complement Nat Biotechnol 2008 26 1348 1349 10.1038/nbt1208-1348 19060872 Markiewski MM DeAngelis RA Benencia F Ricklin-Lichtsteiner SK Koutoulaki A Gerard C Coukos G Lambris JD Modulation of the antitumor immune response by complement Nat Immunol 2008 9 1225 1235 10.1038/ni.1655 18820683 Markiewski MM Lambris JD Is complement good or bad for cancer patients? A new perspective on an old dilemma Trends Immunol 2009 30 286 292 10.1016/j.it.2009.04.002 19428302 Fan Q He JF Wang QR Cai HB Sun XG Zhou XX Qin HD Shugart YY Jia WH Functional polymorphism in the 5?-UTR of CR2 is associated with susceptibility to nasopharyngeal carcinoma Oncol Rep 2013 30 11 16 23612877 Cerhan JR Novak AJ Fredericksen ZS Wang AH Liebow M Call TG Dogan A Witzig TE Ansell SM Habermann TM Kay NE Slager SL Risk of non-Hodgkin lymphoma in association with germline variation in complement genes Br J Haematol 2009 145 614 623 10.1111/j.1365-2141.2009.07675.x 19344414 Zhang Z Yu D Yuan J Guo Y Wang H Zhang X Cigarette smoking strongly modifies the association of complement factor H variant and the risk of lung cancer Cancer Epidemiol 2012 36 e111 e115 10.1016/j.canep.2011.11.004 22197220 Shen M Vermeulen R Rajaraman P Menashe I He X Chapman RS Yeager M Thomas G Burdett L Hutchinson A Yuenger J Chanock S Lan Q Polymorphisms in innate immunity genes and lung cancer risk in Xuanwei China Environ Mol Mutagen 2009 50 285 290 10.1002/em.20452 19170196 Fearon DT Identification of the membrane glycoprotein that is the C3b receptor of the human erythrocyte polymorphonuclear leukocyte B lymphocyte and monocyte J Exp Med 1980 152 20 30 10.1084/jem.152.1.20 6967510 Besaratinia A Pfeifer GP Second-hand smoke and human lung cancer Lancet Oncol 2008 9 657 666 10.1016/S1470-2045(08)70172-4 18598930 Coyle YM Minahjuddin AT Hynan LS Minna JD An ecological study of the association of metal air pollutants with lung cancer incidence in Texas J Thorac Oncol 2006 1 654 661 10.1097/01243894-200609000-00009 17409932 Garshick E Laden F Hart JE Rosner B Smith TJ Dockery DW Speizer FE Lung cancer in railroad workers exposed to diesel exhaust Environ Health Perspect 2004 112 1539 1543 10.1289/ehp.7195 15531439 Brennan P Buffler PA Reynolds P Wu AH Wichmann HE Agudo A Pershagen G Jockel KH Benhamou S Greenberg RS Merletti F Winck C Fontham ET Kreuzer M Darby SC Forastiere F Simonato L Boffetta P Secondhand smoke exposure in adulthood and risk of lung cancer among never smokers: a pooled analysis of two large studies Int J Cancer 2004 109 125 131 10.1002/ijc.11682 14735478 Lee G Walser TC Dubinett SM Chronic inflammation chronic obstructive pulmonary disease and lung cancer Curr Opin Pulm Med 2009 15 303 307 10.1097/MCP.0b013e32832c975a 19417670 Engels EA Inflammation in the development of lung cancer: epidemiological evidence Expert Rev Anticancer Ther 2008 8 605 615 10.1586/14737140.8.4.605 18402527 Kullo IJ Ding K Shameer K McCarty CA Jarvik GP Denny JC Ritchie MD Ye Z Crosslin DR Chisholm RL Manolio TA Chute CG Complement receptor 1 gene variants are associated with erythrocyte sedimentation rate Am J Hum Genet 2011 89 131 138 10.1016/j.ajhg.2011.05.019 21700265 Teeranaipong P Ohashi J Patarapotikul J Kimura R Nuchnoi P Hananantachai H Naka I Putaporntip C Jongwutiwes S Tokunaga K A functional single-nucleotide polymorphism in the CR1 promoter region contributes to protection against cerebral malaria J Infect Dis 2008 198 1880 1891 10.1086/593338 18954261 Chen GB Xu Y Xu HM Li MD Zhu J Lou XY Practical and theoretical considerations in study design for detecting gene-gene interactions using MDR and GMDR approaches PLoS One 2011 6 e16981 .0016981 21386969 Lou XY Chen GB Yan L Ma JZ Zhu J Elston RC Li MD A generalized combinatorial approach for detecting gene-by-gene and gene-by-environment interactions with application to nicotine dependence Am J Hum Genet 2007 80 1125 1137 10.1086/518312 17503330 PLoS One one 1932-6203 Public Library of Science San Francisco USA 24416392 3887046 PONE-D-13-33822 .0085329 Research Mathematics Statistics Biostatistics Statistical Methods Medicine Clinical Research Design Meta-Analyses Oncology Basic Cancer Research Metastasis Cancers and Neoplasms Lung and Intrathoracic Tumors Pulmonology Surgery Thoracic Surgery Evaluation of Video-Assisted Thoracoscopic Surgery for Pulmonary Metastases: A Meta-Analysis VATS for Pulmonary Metastases Dong Siyuan Zhang Lin * Li Wenya Du Jiang Liu Xiangli Chen Xitao Department of Thoracic Surgery First Hospital of China Medical University Shenyang Liaoning Province People's Republic of China Arnold Paul Editor University of Kansas United States of America * E-mail: zhanglincmu@163.com Competing Interests: The authors have declared that no competing interests exist. Conceived and designed the experiments: SYD LZ. Performed the experiments: SYD LZ WYL JD XLL XTC. Analyzed the data: SYD LZ WYL JD XLL XTC. Contributed reagents/materials/analysis tools: SYD LZ WYL JD XLL XTC. Wrote the paper: SYD LZ. 2014 9 1 2014 9 1 e85329 16 8 2013 25 11 2013 2014 Dong et al This is an open-access distributed under the terms of the Creative Commons Attribution License which permits unrestricted use distribution and reproduction in any medium provided the original author and source are credited. Background To evaluate the evidence comparing video-assisted thoracic surgery (VATS) and open thoracotomy in the treatment of metastatic lung cancer using meta-analytical techniques. Methods A literature search was undertaken until July 2013 to identify the comparative studies evaluating disease-free survival rates and survival rates. The pooled odds ratios (OR) and the 95% confidence intervals (95% CI) were calculated with the fixed or random effect models. Results Six retrospective studies were included in our meta-analysis. These studies included a total of 546 patients: 235 patients were treated with VATS and 311 patients were treated with open thoracotomy. The VATS and the thoracotomy did not demonstrate a significant difference in the 1-3-5-year survival rates and the 1-year disease-free survival rate. There were significant statistical differences between the 3-year disease free survival rate (p?=?0.04) which favored open thoracotomy. Conclusions The VATS approach is a safe and feasible treatment in terms of the survival rate for metastatic lung cancer compared with the thoracotomy. The 3-year disease-free survival rate in the VATS group is inferior to that of open thoracotomy. The VATS approach could not completely replace open thoracotomy. The authors have no support or funding to report. Introduction Metastasectomy is considered a beneficial treatment for a patient with metastatic lung cancer whose primary tumor has been well controlled[1].After surgery 5-year survival rates of 30% to 50% could be achieved depending on the underlying primary cancer[2]“[4].In practice the surgical approaches to pulmonary metastases are variable. Video-assisted thoracoscopic surgery (VATS) is an emerging technique; many procedures that had previously required a thoracotomy have been performed with the minimally invasive VATS. VATS has been used for the treatment of pulmonary metastases. The routine use of VATS for the treatment of respectable metastatic lung cancer remains controversial. Critics of the VATS approach have argued that it might not be an equivalent oncological operation[5] [6]. A prospective study by Cerfolio[7]found that 22% of the nodules that could be detected by thoracotomy were missing by VATS.Whether the VATS approach can provide a satisfactory outcome is unknown. An evidenced-based investigation of the VATS approach is needed we undertook this meta-analysis to achieve a more objective assessment of the published studies and to provide a more accurate comparison between VATS and thoracotomy for metastatic lung cancer. Methods Search Strategy Electronic searches were of the MEDLINECochrane Controlled Trial Register (CENTRAL) Ovid MEDILINE PubMed and Embase databases were performed until July 2013.The following MeSH search headings were used: œmetastatic lung cancer œpulmonary metastases œvideo-assisted thoracic surgery œthoracotomy and œcomparative study.We searched the reference lists of relevant studies reviews editorials lettersand meeting abstracts. We used the Science Citation Index to cross-reference for further studies that met our criteria. Study Selection The studies included in this meta-analysis were based on our predetermined criteria as follows: (1) clinical trials that include the full text of the paper published in peer-reviewed English journals or reports of presentations at major thoracic surgery meetings; (2) comparison of the efficacy of VATS to that of thoracotomy in patients with metastatic lung cancer; and (3) similarity in the patients' baseline characteristics. Data extraction and quality assessment Two independent reviewers (Siyuan and Wenya) assessed the quality and the risk of bias of the included trials as follows: (1) the studies that did not include a comparative group with surgery as a form of intervention were excluded; (2) the trials focusing on patients undergoing surgery for primary lung cancer were excluded; (3) the studies on robotic video-assisted thoracic surgery were excluded; (4) if there was an overlap between authors centers or patient cohorts evaluated in the published literature only the most recent report was included; (5) studies published more than 20 years ago were excluded because of the significant technological changes that has occurred. The s were evaluated with the Downs and Black quality assessment method[8]. Discrepancies between the two investigators were resolved by discussion and consensus with a senior investigator. The final results were reviewed by two senior investigators (Lin and Jiang).The disease-free survival was defined as the date of the initial metastasectomy until the date of a recurrence. Statistical and sensitivity analyses The meta-analysis was performed using the RevMan 5.1.0. software package. The odds ratio (OR) or the mean difference with 95% confidence intervals (95% CI) was calculated for the dichotomous outcomes and the continuous outcomes respectively. A P value<0.05 was considered a significant difference in the value between the two groups. We used the I2 statistic to investigate the heterogeneity among the studies.The heterogeneity was explored by X2 and I2; I2<25% and I2>50% reflect a small and large inconsistency respectively. P<0.05 was considered significant. If there were a statistical difference in terms of the heterogeneity (P?0.05) a random-effect model was selected to pool the data. Otherwise a fixed-effect model was used. Taking into account the presence of different sample sizes of the included studies a sensitivity analysis was performed to compare the of 1-year survival rate and the 3-year disease free survival rate between VATS and open thoracotomy. Publication bias A funnel plot was used to explore bias. Asymmetry in the funnel plot of trial size against treatment effect was used to assess the risk of bias. Results Description of the studies Six retrospective cohort studies the met our criteria were included in this meta-analysis. A total of 546 patients were included in the six studies;235 patients were allocated to the VATS group whereas 311 were allocated to the open thoracotomy group to evaluate their survival rate.The search algorithm results of the search strategies and selection criteria are shown in Fig 1. The patient characteristics and evaluation index are shown in Table 1. .0085329.g001 Figure 1 Identification of studies for inclusion. .0085329.t001 Table 1 Study Design Country NO(V/O) Gender (M/F) Mean age (years) Assessment score Nakajima2001[28] OC Japan 45/55 V59/41 O34/21 V55±15 O55±14 13 Mutsaerts2002[29] OC Netherlands 8/12 NR NR 19 Nakas2009[30] OC UK 25/27 V16/9 O 19/8 V69 O66 16 Carballo2009[31] OC USA 36/135 V18/18 O82/53 V58.5 O49 15 Gossot2009[32] OC France 31/29 V21/10 O13/16 V43 O40 18 Chao2012[33] OC Taiwan 90/53 V49/41 O35/18 NR 13 V VATS; O Open thoracotomy; NR Not reported; OC observational cohort. Assessment of Recurrence and Survival Six studies documented the 1-year survival rateand there was no significant heterogeneity among the six studies (x2?=?3.79 P?=?0.58I2?=?0%).A fixed effect model was used.The combined result is shown in Fig 2(OR?=?1.15; 95%CI 0.72“1.84; p?=?0.58). Because of the heterogeneity in sample size the sensitivity analyses were conducted using larger sample sizes. There was no difference between the two surgical methods with an OR of 1.00(95%CI 0.55“1.79) and with heterogeneity(?2?=?3.23P?=?0.07 I2?=?69%). Five studies reported the 3-year survival rate and heterogeneity was identified through the five studies (x2?=?11.32P?=?0.02I2?=?65%); and a random effect model was adopted (OR?=?1.07; 95%CI 0.50“2.27; p?=?0.86) (Fig 3). Three studies compared the 5-year survival rate (OR?=?0.96; 95%CI 0.34“2.71; p?=?0.93) with certain heterogeneity(x2?=?8.86P?=?0.01I2?=?77%) (Fig 4). .0085329.g002 Figure 2 1-year survival rate. Forest plot of the Odds Ratio(OR) of the 1-year survival rate following VATS versus open thoracotomy for metastatic lung cancer.The estimate of the OR of each individual trial corresponds to the middle of the squares and horizontal line gives the 95% CI.On each linethe numbers of events as a fraction of the total number randomized are shown for both treatment groups.For each subgroupthe sum of the statistics along with the summary OR is represented by the middle of the solid diamonds.A test of heterogeneity between the trials within a subgroup is given below the summary statistics. .0085329.g003 Figure 3 3-year survival rate. Forest plot of the Odds Ratio(OR) of the 3-year survival rate following VATS versus open thoracotomy for metastatic lung cancer."

Lung_Cancer

"Two methods were used to inhibit the enzyme activity or protein expression of NQO1 an NQO1 inhibitor and NQO1 siRNA knockdown. Dicoumarol has been previously used to specifically inhibit the expression and activity of NQO1 [44]. As shown in pretreatment of cells with 100 or 250 µM sulindac (A) sulindac sulfone (B) or sulindac sulfide (C) followed by addition of 2 µM ?-lapachone for 12 h increased the cytotoxicity of ?-lapachone for both CL1-1 and CL1-5 cells and these effects were significantly reduced by addition of 10 µM dicoumarol. .0088122.g007 The increase in ?-lapachone-induced cell death caused by sulindac and its metabolites is blocked by the NQO1 inhibitor dicoumarol. CL1-1 cells (left) or CL1-5 cells (right) were left untreated or were pretreated for 6 h with 100 or 250 µM sulindac (A) sulindac sulfone (B) or sulindac sulfide (C) with or without 10 µM dicoumarol then were incubated for a further 12 h with or without addition of 2 µM ?-lapachone then cell survival was measured by crystal violet staining and expressed as percentage survival compared to the untreated cells. * : p<0.05. Using siRNA knockdown of NQO1 at days 1 to 3 after NQO1 siRNA transfection of CL1-1 and CL1-5 cells no change in cell growth or cell morphology was noted (Figure S6). Efficiency of knockdown in CL1-1 and CL1-5 cells was demonstrated for RNA expression by RT-PCR (A) and realtime-PCR (Figure S7) and for protein expression by western blotting (B and C) showing that NQO1 siRNA significantly downregulated NQO1 expression. As shown in D NQO1 siRNA transfection significantly inhibited the increase in NQO1 enzyme activity induced in CL1-1 cells by incubation for 6 or 24 h with 100 or 250 µM sulindac (left panel) sulindac sulfone (center panel) or sulindac sulfide (right panel). When cells transfected for 24 h with siNQO1 or control siRNA were pretreated for 6 h with sulindac or its metabolites then cotreated for 12 h with drug plus 2 µM ?-lapachone the percentage cell survival results showed results that transfection with NQO1 siRNA caused a significant decrease in the cytotoxicity of combinations of ?-lapachone with sulindac (A) sulindac sulfone (B) or sulindac sulfide (C). These results showed that NQO1 plays an important role in the increase in ?-lapachone-induced cell death caused by sulindac or its metabolites. .0088122.g008 The knockdown effects of NQO1 siRNA on NQO1 RNA protein and activity. (A“C) CL1-1 cells (left) or CL1-5 cells (right) were transfected for 1 to 3 days with control siRNA (CTL) or siRNA targeting NQO1 then RNA expression was measured by PCR (A) and protein expression by Western blotting (B and C). (D) CL1-1 cells transfected for 2 days with control siRNA or NQO1 siRNA were incubated alone or with 100 or 250 µM sulindac sulindac sulfide or sulindac sulfone for 6 or 24 h then NQO1 activity was measured. * : p<0.05 ***: p<0.001 compared to the identically treated cells transfected with control siRNA. .0088122.g009 NQO1 siRNA transfection significantly inhibits the effect of sulindac and its metabolites on ?-lapachone-induced cell death. CL1-1 cells (left) or CL1-5 cells (right) were transfected with control siRNA (?) or NQO1 siRNA (+) for 24 h then were left untreated or were incubated for 6 h with 100 or 250 µM sulindac (A) sulindac sulfone (B) or sulindac sulfide (C) then 2 µM ?-lapachone or medium was added and the cells incubated for 12 h when cell survival was measured using crystal violet staining and expressed as percentage survival compared to the untreated cells. * : p<0.05 for the indicated comparison. Discussion ?-lapachone Triggers Lung Cancer Cells to Undergo Apoptosis through an Increase in Intracellular Calcium Levels Increased JNK Activation Decreased Activation of PI3K ERK and AKT and a Decrease in the MMP Cell proliferation and cell death are under complex and precise control. Normally the proteins involved in cell proliferation survival or cell death are in a remarkable balance and unbalanced survival and apoptotic signals may lead to cell death. In most cells proliferation is mainly regulated through PI3K AKT and ERK [46] and cell death is regulated through another pathway involving JNK and p38 [47] [48]. JNK has recently been reported to be an important mediator in the ?-lapachone-induced cell death of breast and prostate cancer cells [45] [49]. ?-lapachone also triggers cell death of many cancer cells by increasing calcium signaling [6] [50]. Calcium the key messenger molecule in cells plays an important role in many signaling pathways and an imbalance in intracellular calcium levels causes abnormal cell function and leads to cell death. Treatment of cells with the intracellular calcium chelator BAPTA partially inhibited ?-lapachone-induced cell death showing that calcium was involved (). Activation of the cell death signal JNK (A) and inhibition of the cell survival signals p-PI3K p-AKT and p-ERK (A and B) were also observed in ?-lapachone-mediated lung cancer cell death showing that the MAP kinase signaling pathway is involved in the anticancer effect of ?-lapachone. Although ROS could have caused the cell death induced by ?-lapachone there was no change in intracellular H2O2 levels following ?-lapachone treatment (Figure S1D). However the MMP was dramatically decreased following ?-lapachone treatment (Figure S3C) suggesting that other ROS species might be involved in the ?-lapachone-induced cell death process. NQO1 is a Key Factor in the ?-lapachone-induced Lung Cancer Cell Death High NQO1 activity and expression are seen in many human tumors including carcinoma of the liver [51] [52] colon [53] breast [52] [54] brain [55] and lung [52] and NQO1 has been shown to be an important factor in ?-lapachone-induced cell death in many kinds of cancer cells [9] [44] including breast cancer [2] glioma [56] and prostate cancer [44]. In this study we demonstrated that the cytotoxicity of ?-lapachone for three different lung cancer cell lines was positively correlated with their NQO1 expression and enzyme activity (). Inhibition of NQO1 activity using the NQO1 inhibitor dicoumarol (Figure S3) blocked the ?-lapachone-induced increase in intracellular calcium levels (Figure S3) increase in p-JNK levels (A) and decrease in p-ERK p-PI3K and p-AKT levels (A and B). These results indicated that the balance between survival and death signals in lung cancer cells was disrupted by the decrease in p-PI3K p-AKT and p-ERK levels and the increase in p-JNK levels caused by ?-lapachone treatment and that NQO1 expression and activity were involved in the activation of all these apoptotic signals. Anti-inflammatory Drugs Increase NQO1 Levels and Enzyme Activity in Lung Cancer Cells Many drugs or treatments such as cisplatin [5] heat shock [19] or radiation [57] can increase NQO1 expression or activity and facilitate the cytotoxicity of ?-lapachone for various cancer cells. However such drugs or treatments are usually harmful to normal cells as well as cancer cells so there is a need for drugs or treatments that can facilitate the anti-cancer effect of ?-lapachone while being less harmful for normal cells. Sulindac has been shown to be a potent chemo-protective agent against colorectal cancer in both human and animal models [25] while sulindac sulfide [18] and sulindac and its two metabolites [18] [28]] have been reported to upregulate the expression of carcinogen detoxification enzymes including NQO1. It is known that sulindac compounds inhibit the activity of COX-1 and COX-2 and thus block the biosynthesis of prostaglandins [58]-[60]. In in vivo studies sulindac has been shown to be reversibly reduced to sulindac sulfide which can be irreversibly oxidized to sulindac sulfone all three of which are anti-inflammatory. Since 1995 several clinical trials have established that sulindac is effective at reducing the number and size of polyps in patients with familial adenomatous polyposis a precursor to colorectal cancer (NCI-P97-0110 NCI-P00-0150 [61])."

Lung_Cancer

"30 These findings prompted us to investigate the possible presence of SETDB1 gene amplification and its associated overexpression in lung cancer cells and primary tumors. Extra copies of an oncogene may give tumor cells a growth advantage as well as being a mechanism associated with different sensitivity to therapies.31 The identification of amplified target genes is of great importance for cancer diagnosis and prognosis and ultimately for designing targeted therapies ERBB2/HER-2 in breast cancer being the best example.32 Thus we examined whether the SETDB1 gene amplification occurs in lung cancer cell lines and primary tumors and studied its impact on mRNA and protein expression levels its functional role in lung cancer growth and its potential value as a biomarker for predicting the response to particular chemotherapeutic agents in lung tumors. Results and Discussion We first screened a collection of 15 human lung cancer cell lines for SETDB1 gene copy-number alterations. These included seven non-small (A549 NCI-H1299 NCI-H1975 NCI-H1993 NCI-H2170 NCI-H1437 and NCI-H1395) and eight small (HCC-33 N417 NCI-H446 NCI-H1048 NCI-H1963 NCI-H2029 DMS-114 and DMS-273) cell lung cancer types. The lung cancer cell lines were purchased from the American Type Culture Collection (Rockville MD USA) and were grown and maintained in 10% fetal bovine serum in Roswell Park Memorial Institute medium. Primary normal tissues such as lung epithelium and leukocytes were used as normal SETDB1 copy-number control samples. Using a quantitative genomic PCR approach we observed that two non-small (NCI-H1437 and NCI-H1395) and one small (DMS-273) cell lung cancer lines had a greater than four-fold change in SETDB1 gene copy number (a). This increase was particularly important in the small lung cancer cell line DMS-273 (a). The remaining eleven lung cancer cell lines did not present any evident change in SETDB1 gene copy number (that is amplification half gene dosage or homozygous deletion). We performed fluorescence in situ hybridization analyses to confirm the presence of SETDB1 gene amplification suggested to occur in the three lung cancer cell lines by the competitive genomic PCR approach (b). The fluorescence in situ hybridization technique confirmed the presence of SETDB1 gene amplification in NCI-H1437 NCI-H1395 and DMS-273 (b). The applied fluorescence in situ hybridization technique was validated by the observation of the normal copy-number of the SETDB1 gene in lymphocytes (b). Using reported copy-number variation data33 we have determined the size of the amplicon that contains SETDB1 in the three studied lung cancer cell lines: DMS-273 (1?038?210?bp) NCI-H1437 (4?539?342?bp) and NCI-H1395 (4?623?419?bp). SETDB1 is genomically located in the middle of all three amplicons even in the case of the smallest one (DMS-273; Supplementary Figure S1). In melanoma the only other tumor type where SETDB1 genetic amplification has been reported21 all the melanoma cell lines with amplification at this genomic locus (1q21) contain the SETDB1 gene according to the copy-number variation data.33 In addition in the smallest amplicon detected in the melanoma setting (cell line COLO-679 2?797?611?bp) SETDB1 is also located right in the middle (Supplementary Figure S1). Thus SETDB1 is within the smallest identified region of recurrent amplification. We next considered the possible existence of an association between extra copies of the SETDB1 gene and overexpression of the corresponding RNA transcript and protein using quantitative reverse transcription“PCR and western blot approaches respectively (Figures 1c and d). We found that the expression of SETDB1 for both mRNA and protein was enhanced in cancer cell lines harboring the SETDB1 gene amplification event relative to non-amplified cancer cells (Figures 1c and d). In the smallest SETDB1 amplicon (present in DMS-273 cells) thirty-four genes are also co-amplified (Supplementary Figure S1). Using reported microarray expression data we have observed that in addition to SETDB1 only 7 of these other 34 genes (21%) are overexpressed in DMS-273 NCI-H1437 and NCI-H1395 in comparison with unamplified lung cancer cells (NCI-H1299 and A549; Supplementary Figure S1). In this regard we have confirmed by quantitative reverse transcription“PCR that six of these seven genes are overexpressed in the SETDB1-amplified lung cell lines (Supplementary Figure S1). Once we had demonstrated the presence of SETDB1 gene amplification and its associated overexpression in the lung cancer cell lines we examined its contribution to the tumorigenic phenotype in vitro and in vivo. We first analyzed the effect of SETDB1 depletion in lung cancer cells harboring its gene amplification and its associated overexpression. Supplementary Table S1 includes all the used short hairpin RNA (shRNA) sequences. Three SETDB1 shRNA-depleted clones were established for DMS-273 cells (A30 A31 and B32-63) and two clones for NCI-H1437 (A56-B and B49-6). Experiments for each clone were performed in triplicate. We observed that the reduction of SETDB1 expression in the gene-amplified cells had cancer growth inhibitory features (). Upon stable transfection of shRNAs against SETDB1 in the gene-amplified DMS-273 and NCI-H1437 lung cancer cell lines and efficient depletion of the SETDB1 protein (a) the cells proved less viable in the 3-(45-dimethyl-2-thiazolyl)-25-diphenyl-2H-tetrazolium bromide (MTT) assay (b and Supplementary Figure S2) and had a markedly reduced percentage colony-formation density in the assay developed on plastic plate (c and Supplementary Figure S2). Transfection of the scramble shRNA did not reduce cell viability (b and Supplementary Figure S2) and had no impact on the colony formation assay (c and Supplementary Figure S2). Confocal microscopy experiments in the NCI-H1437 lung cancer cell line confirmed the expected nuclear staining of the SETDB1 protein (4'6-diamidino-2-phenylindole colocalization; Supplementary Figure S3) and the disappearance of the nuclear signal upon SETDB1 shRNA-mediated depletion (Supplementary Figure S3). SETDB1 knockdown by the shRNA approach in a lung cancer cell line without gene amplification (NCI-H1299) did not cause a significant effect in the cell growth determined by the MTT experiments or the colony formation assay (Supplementary Figure S3) suggesting the SETDB1 dependence for cell growth only in the amplified cancer cells. We next tested the ability of SETDB1 shRNA-transfected DMS-273 and -NCI-H1437 cells to form tumors in nude mice compared with scramble shRNA-transfected cells (d). DMS-273- and NCI-H1437-scramble shRNA-transfected cells formed tumors rapidly but cells with shRNA-mediated depletion of SETDB1 had much lower tumorigenicity (d). "

Lung_Cancer

"Among biomarkers genes have been used to distinguish AC from SCC in practice and other six genes were newly discovered biomarkers for distinguishing subtypes. Furthermore NKX2-1 has been considered as a molecular target for the targeted therapy of AC and other genes may be novel molecular targets. By gene ontology analysis we found that two biological processes (˜epidermis development™ and ˜cell adhesion™) were closely related with the tumorigenesis of subtypes of NSCLC. More generally the current method could be extended to other complex diseases for distinguishing subtypes and detecting the molecular targets for targeted therapy. The authors' work is supported by the National Natural Science Foundation of China (Grant Nos. 61100145 61033003 and 91130034). The funders had no role in study design data collection and analysis decision to publish or preparation of the manuscript. Introduction Lung cancer is the leading cause of cancer-related deaths in the world [1]. It has been divided into two classes by the World Health anization (WHO): non-small cell lung cancer (NSCLC) and small cell lung cancer (SCLC) [2]. NSCLC which has two major subtypes: adenocarcinoma (AC) and squamous cell carcinoma (SCC) accounts for more than a half of all lung cancer cases [2]. However less than of NSCLC patients survive beyond five years [3]. The limited effectiveness of the diagnosis and treatment of NSCLC is mainly caused by the difficulty to distinguish the subtypes and the limited knowledge about the pathogenesis mechanisms of subtypes of NSCLC. NSCLC is a system disease and the difference of AC and SCC may be reflected on the cellular and molecular level. Traditional methods rely on visual cell morphology (e.g. size of tumor and histological features) to distinguish subtypes which are based on cellular level [4]“[6]. It has been proposed that traditional methods could effectively distinguish SCLC from NSCLC because of the clear distinction between the morphology of SCLC cells and that of NSCLC cells [7]. However the morphological difference among the subtypes of NSCLC remains unclear [8]. Multiple molecular level data (mRNA microRNA and methylation data) between NSCLC and normal have been used for analyzing dysfunctions of NSCLC [9]. It was suggested that the discriminating ability of genes obtained by mRNA data was significant greater than those by microRNA and methylation data. Therefore it is reasonable to retrieve valuable genes and biological processes that have great discriminating ability between AC and SCC on the mRNA level. A targeted therapeutic agent is designed to interfere with a specific molecular target which plays a crucial role for tumor growth and progression [10]. For example which is a targeted therapeutic agent for the targeted therapy of NSCLC is a monoclonal antibody for VEGF. The gene VEGF is crucial because it is higher expressed in lung cancer than in normal lung [11]. Hence the molecules which play distinct roles between cancer and normal may be important for selecting therapeutic agents. Although targeted therapy shows clinical benefits targeted agents have not enabled targeted therapies to change clinical outcome dramatically. Moreover existing targeted therapeutic schedules may be suitable for the prognostic of a special subtype of NSCLC. For example only patients with non-SCC are better to use [12]. Therefore it is necessary to research the molecular mechanisms that are related with the subtypes of NSCLC to develop effective methods to distinguish AC from SCC and novel therapeutic agents special for the subtypes of NSCLC. The expression patterns of several genes are found to be special for the subtypes of diseases. For example the NKX2-1 gene is expressed in lung AC [13]. The knockdown of NKX2-1 results growth inhibition in lung AC cell. Therefore the presence of lung AC depends on the expression of NKX2-1 [14]. Another example is involved in the research of esophageal cancer the combination of the genes GATA6 and SPRR3 may discriminate among normal epithelium Barrett's dysplasia and Barrett's esophagus associated AC [15]. Some special relationships exist between the gene pair (GATA6 and SPRR3) and the phenotypes of esophageal cancer. Such examples suggest the existence of relationships between genes and the subtypes of diseases. The methods that indirectly identify gene-phenotype relationships can be roughly divided into three common steps: construct a gene-gene (or protein-protein) network and a phenotype-phenotype network by pooling interaction data from several databases; connect the gene-gene (or protein-protein) network with the phenotype-phenotype network; use an algorithm (e.g. random walk with restart on heterogeneous network algorithm) to infer pairwise gene-phenotype relationships [16] [17]. However the noise from the integration of data limits the effectiveness of the detection of gene-phenotype relationships. Many methods have been developed to directly associate single molecules to phenotypes. The nonnegative matrix factorization (NMF) method is a dimensionality-reducing algorithm to obtain a set of metagenes and associated coefficients [18]. Each phenotype corresponds to a metagene. The coefficient of a gene in a metagene represents the closeness of the relationship between the gene and the phenotype corresponding to the metagene. This method requires to filter several data to ensure the nonnegative condition which may loss some useful information. Linear correlation coefficients were used to measure genotype-phenotype associations between single proteins in a microbe and the microbe's phenotypes [19]. Slonim et al. used the relevance analysis method (RA) to infer gene-phenotype relationships by estimating mutual information [20]. However phenotype traits are often influenced not by a single gene but by combinations of genes. Association rule mining (ARM) is a data mining technique to extract if-then rules with the general form [21]. Bowers et al. designed the logic analysis method to obtain if-then rules from an item or a combination of items to another one. Previous studies have been done to infer logic relationships among genes or proteins using pairwise and triplet logic analysis on expression data or phylogenetic profiles [22]. However if-then rules may not have many biological cases unless the converse relation holds as well [23]. In this paper we improve the logic analysis method to mine the necessary and sufficient conditions for the presence states (presence or absence) of phenotypes [22]. The current method takes into consideration both a single gene and a gene pair which may influence phenotypes. We apply the method to infer gene-subtype relationships based on AC and SCC specimens. It is suggested that the expression patterns (expression or no-expression) of identified genes are necessary and sufficient conditions for the presence states of AC or SCC. The effectiveness of the current method is demonstrated on NSCLC and normal specimens. Our results show that the current method outperforms the two existing methods (the NMF method and the RA method) in recall rate and classification accuracy. This work could help to find the biomarkers to distinguish the subtypes of diseases and to design novel targeted therapeutic agents for diseases as well as reveal the biological processes which are closely related with diseases. Results We applied our method to identify relationships between genes and two major subtypes of NSCLC (AC and SCC). Further the performance comparison of our method with those of the two earlier methods (the NMF method and the RA method) was made by comparing two measures (the recall rate and classification accuracy) on the data of GSE18842 which contains similar numbers of NSCLC and normal specimens. The biomarkers as well as biological processes which were closely related with the subtypes of NSCLC could be obtained from several interesting relationships between genes and subtypes of NSCLC. Identification of gene-subtype lower and higher logic relationships Given that the number of AC specimens () was much larger than that of SCC specimens () () we randomly selected the fixed number (i.e.) of AC specimens to ensure the similar number of specimens for different phenotypes. We exacted the columns of binary probe data as well as those of phenotype profile data which correspond to the selected AC specimens and all of the SCC specimens. The new binary probe data and phenotype profile data were formed by the exacted columns of binary probe data and phenotype profile data maintaining the relative positions of columns. The new binary probe data had size where the first columns corresponded to AC specimens and the last columns refered to SCC specimens. The new phenotype profile data had size where the first row represented AC and the second one represented SCC. For convenience we defined the first and second row of the new phenotype profile data as AC profile data and SCC profile data respectively. The subtypes of NSCLC data comprised the new binary probe data and the new phenotype profile data. We applied our method to the subtypes of NSCLC data to mine gene-subtype logic relationships. 10.1371/journal.pone.0094644.t001 Data source. Subtype No.(n) AC GSE10245(40) GSE37745(106) GSE18842(14) GSE28571 (50) SCC GSE10245(18) GSE37745(66) GSE18842(32) GSE28571 (28) Normal ” ” GSE18842(45) ” ˜No.™ is the accession number from the Gene Expression Omnibus (GEO) database in NCBI; ˜n™ is the number of specimens; ˜”™ means there are no specimens from the corresponding data set. Identification of probe-subtype lower and higher logic relationships Based on the subtypes of NSCLC data we calculated the uncertainty coefficient for a subtype of NSCLC predicted by a probe (or a probe pair) as well as the uncertainty coefficient for a probe (or a probe pair) predicted by the subtype in the reverse direction. The same procedure was applied to random binary probe data and phenotype profile data. The maximum random uncertainty coefficients for logic pairwise and triplet combinations were used as the thresholds for lower and higher logic relationships respectively. That is the association of a probe or a probe pair with a subtype was considered significant if and only if its uncertainty coefficients in both directions were found to be greater than the maximal value obtained from the random data. Let and be the thresholds of lower and higher logic relationships respectively. We obtained logic pairwise combinations and logic triplet combinations with uncertainty coefficients higher than and respectively. Because the significance of the discovered logic pairwise and triplet combinations cannot be exactly verified by the limited knowledge of gene-subtype interactions a statistical analysis is deserved to be estimated [24]. Suppose the significance level was . The p-values were all zeros for the discovered logic pairwise and triplet combinations which were smaller than the significance level. The results of the statistical analysis showed that the discovered logic pairwise and triplet combinations did not interact randomly. Next we evaluated the false discovery rate (FDR) to control the global significance of the discovered logic pairwise and triplet combinations."

Lung_Cancer

" have indicated that there is a significant correlation between decreased KLK11 mRNA expression level and poor prognosis in lung cancer. This study supports the increasing body of literature demonstrating the expression of kallikrein family gene involvement in the prognosis of human cancers. The most striking association we observed in NSCLC patients was a significant correlation between increased KLK11 level and favorable prognosis. We have demonstrated that high KLK11 was significantly associated with an increased PFS and OS in univariate analysis. This relationship was further illustrated in the Kaplan“Meier survival curves. Multivariate analysis also indicated that KLK11 was an independent indicator of PFS and OS. In our data suggest that serum KLK11 may be a useful diagnostic biomarker and shows a promising potential as prognostic marker in NSCLC patients. More large-scale prospective studies are warranted to confirm the findings. Conflicts of interest None. References 1. Chen Z Wang T Cai L Su C Zhong B Lei Y Clinicopathological significance of non-small cell lung cancer with high prevalence of Oct-4 tumor cells J Exp Clin Cancer Res 2012 31 10 10.1186/1756-9966-31-10 22300949 2. Smith RA Cokkinides V Brawley OW Cancer screening in the United States 2009: a review of current American Cancer Society guidelines and issues in cancer screening CA Cancer J Clin 2009 59 27 41 10.3322/caac.20008 19147867 3. Oguz A Unal D Tasdemir A Karahan S Aykas F Mutlu H Lack of any association between blood groups and lung cancer independent of histology Asian Pac J Cancer Prev. 2013 14 453 456 10.7314/APJCP.2013.14.1.453 23534772 4. Jemal A Siegel R Xu J Ward E Cancer statistics 2010 CA Cancer J Clin 2010 60 277 300 10.3322/caac.20073 20610543 5. Sano A Sangai T Maeda H Nakamura M Hasebe T Ochiai A Kallikrein 11 expressed in human breast cancer cells releases insulin-like growth factor through degradation of IGFBP-3 Int J Oncol 2007 30 1493 1498 17487371 6. Luo LY Shan SJ Elliott MB Soosaipillai A Diamandis EP Purification and characterization of human Kallikrein 11 a candidate prostate and ovarian cancer biomarker from seminal plasma Clin Cancer Res 2006 12 742 750 10.1158/1078-0432.CCR-05-1696 16467084 7. McIntosh MW Liu Y Drescher C Urban N Diamandis EP Validation and characterization of human Kallikrein-11 as a serum marker for diagnosis of ovarian carcinoma Clin Cancer Res 2007 13 4422 4428 10.1158/1078-0432.CCR-06-2224 17671125 8. Unal D Tasdemir A Oguz A Eroglu C Cihan YB Turak EE Is human Kallikrein-11 in gastric cancer treated with surgery and adjuvant chemoradiotherapy associated with survival? Pathol Res Pract 2013 209 779 783 10.1016/j.prp.2013.09.004 24169449 9. Yu X Tang HY Li XR He XW Xiang KM Overexpression of human kallikrein 11 is associated with poor prognosis in patients with low rectal carcinoma Med Oncol 2010 27 40 44 10.1007/s12032-009-9167-2 19184568 10. Diamandis EP Bo±o CA Scorilas A Harbeck N Dorn J Schmitt M Human kallikrein 11: an indicator of favorable prognosis in ovarian cancer patients Clin Biochem 2004 37 823 829 10.1016/j.clinbiochem.2004.04.009 15329323 11. Sasaki H Kawano O Endo K Suzuki E Haneda H Yukiue H Decreased Kallikrein 11 messenger RNA expression in lung cancer Clin Lung Cancer 2006 8 45 48 10.3816/CLC.2006.n.032 16870045 12. Lei KF Liu BY Zhang XQ Jin XL Guo Y Ye M Development of a survival prediction model for gastric cancer using serine proteases and their inhibitors Exp Ther Med 2012 3 109 116 10.1084/jem.20110399 22969854 13. Planque C Li L Zheng Y Soosaipillai A Reckamp K Chia D A multiparametric serum kallikrein panel for diagnosis of non-small cell lung carcinoma Clin Cancer Res 2008 14 1355 1362 10.1158/1078-0432.CCR-07-4117 18316555 14. Alexopoulou DK Papadopoulos IN Scorilas A Clinical significance of kallikrein-related peptidase (KLK10) mRNA expression in colorectal cancer Clin Biochem 2013 46 1453 1461 10.1016/j.clinbiochem.2013.03.002 23499583 15. Talieri M Alexopoulou DK Scorilas A Kypraios D Arnogiannaki N Devetzi M Expression analysis and clinical evaluation of kallikrein-related peptidase 10 (KLK10) in colorectal cancer Tumour Biol 2011 32 737 744 10.1007/s13277-011-0175-4 21487810 16. Patsis C Yiotakis I Scorilas A Diagnostic and prognostic significance of human kallikrein 11 (KLK11) mRNA expression levels in patients with laryngeal cancer Clin Biochem 2012 45 623 630 10.1016/j.clinbiochem.2012.03.005 22429520 17. Xi Z Kaern J Davidson B Klokk TI Risberg B Trop C Kallikrein 4 is associated with paclitaxel resistance in ovarian cancer Gynecol Oncol 2004 94 80 85 10.1016/j.ygyno.2004.03.044 15262123 18. Yousef GM Scorilas A Kyriakopoulou LG Rendl L Diamandis M Ponzone R Human kallikrein gene 5 (KLK5) expression by quantitative PCR: an independent indicator of poor prognosis in breast cancer Clin Chem 2002 48 1241 1250 12142380 19. Kountourakis P Psyrri A Scorilas A Markakis S Kowalski D Camp RL Expression and prognostic significance of kallikrein-related peptidase 8 protein levels in advanced ovarian cancer by using automated quantitative analysis Thromb Haemost 2009 101 541 546 19277417 20. Bo±o CA Kishi T Scorilas A Harbeck N Dorn J Schmalfeldt B Human kallikrein 8 protein is a favorable prognostic marker in ovarian cancer Clin Cancer Res 2006 12 1487 1493 10.1158/1078-0432.CCR-05-2106 16533772 21. Talieri M Devetzi M Scorilas A Pappa E Tsapralis N Missitzis I Human kallikrein-related peptidase 12 (KLK12) splice variants expression in breast cancer and their clinical impact Tumour Biol 2012 33 1075 1084 10.1007/s13277-012-0347-x 22351561 9502500 8794 Clin Cancer Res Clin. Cancer Res. Clinical cancer research : an official journal of the American Association for Cancer Research 1078-0432 24423612 4136748 10.1158/1078-0432.CCR-13-2195 NIHMS556385 HEDGEHOG-GLI signaling inhibition suppresses tumor growth in squamous lung cancer Huang Lingling 1 Walter Vonn 2 Hayes D. Neil 2 Onaitis Mark 1 1Duke University Department of Surgery 2University of North Carolina Department of Medicine Corresponding Author: Mark Onaitis DUMC Box 3305 Durham NC 27710 mwoduke.edu phone: 919-684-6974 fax: 919-684-8508 4 4 2014 14 1 2014 15 3 2014 15 3 2015 20 6 1566 1575 Purpose Lung squamous cell carcinoma (LSCC) currently lacks effective targeted therapies. Previous studies reported overexpression of HEDGEHOG (HH)-GLI signaling components in LSCC. However they addressed neither the tumor heterogeneity nor the requirement for HH-GLI signaling. Here we investigated the role of HH-GLI signaling in LSCC and studied the therapeutic potential of HH-GLI suppression. Experimental Design Gene expression datasets of two independent LSCC patient cohorts were analyzed to study the activation of HH-GLI signaling. Four human LSCC cell lines were examined for HH-GLI signaling components. Cell proliferation and apoptosis were assayed in these cells after blocking the HH-GLI pathway by lentiviral-shRNA knockdown or small molecule inhibitors. Xenografts in immunodeficient mice were used to determine the in vivo efficacy of GLI inhibitor GANT61. Results In both cohorts activation of HH-GLI signaling was significantly associated with the classical subtype of LSCC. In cell lines genetic knockdown of SMO produced minor effects on cell survival while GLI2 knockdown significantly reduced proliferation and induced extensive apoptosis. Consistently the SMO inhibitor GDC-0449 resulted in limited cytotoxicity in LSCC cells whereas the GLI inhibitor GANT61 was very effective. Importantly GANT61 demonstrated specific in vivo anti-tumor activity in xenograft models of GLI-positive cell lines. Conclusion Our studies demonstrate an important role for GLI2 in LSCC and suggest GLI inhibition as a novel and potent strategy to treat a subset of LSCC patients. Squamous cell lung cancer HEDGEHOG GLI J Korean Med Sci J. Korean Med. Sci JKMS Journal of Korean Medical Science 1011-8934 1598-6357 The Korean Academy of Medical Sciences 24431917 3890464 10.3346/jkms.2014.29.1.129 Original Medical Imaging Computed Tomography Guided Percutaneous Injection of a Mixture of Lipiodol and Methylene Blue in Rabbit Lungs: Evaluation of Localization Ability for Video-Assisted Thoracoscopic Surgery Jin Kwang Nam 1 Lee Kyung Won 2 Kim Tae Jung 2 Song Yong Sub 3 Kim Dong Il 4 1Department of Radiology Seoul Metropolitan Government-Seoul National University Boramae Medical Center Seoul Korea. 2Department of Radiology Seoul National University Bundang Hospital Seongnam Korea. 3Department of Radiology Seoul National University Hospital Seoul Korea. 4Department of Pathology Green Cross Laboratories Yongin Korea. Address for Correspondence: Kyung Won Lee MD. Department of Radiology Seoul National University Bundang Hospital 82 Gumi-ro 173beon-gil Bundang-gu Seongnam 463-707 Korea. Tel: +82.31-787-7604 Fax: +82.31-787-4011 lkwradradiol.snu.ac.kr 1 2014 26 12 2013 29 1 129 136 13 5 2013 22 10 2013 2014 The Korean Academy of Medical Sciences. 2014 This is an Open Access distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons./licenses/by-nc/3.0/) which permits unrestricted non-commercial use distribution and reproduction in any medium provided the original work is properly cited. Preoperative localization is necessary prior to video assisted thoracoscopic surgery for the detection of small or deeply located lung nodules. We compared the localization ability of a mixture of lipiodol and methylene blue (MLM) (0.6 mL 1:5) to methylene blue (0.5 mL) in rabbit lungs. CT-guided percutaneous injections were performed in 21 subjects with MLM and methylene blue. We measured the extent of staining on freshly excised lung and evaluated the subjective localization ability with 4 point scales at 6 and 24 hr after injections. For MLM radio-opacity was evaluated on the fluoroscopy. We considered score 2 (acceptable) or 3 (excellent) as appropriate for localization. The staining extent of MLM was significantly smaller than methylene blue (0.6 vs 1.0 cm P<0.001). MLM showed superior staining ability over methylene blue (2.8 vs 2.2 P=0.010). Excellent staining was achieved in 17 subjects (81%) with MLM and 8 (38%) with methylene blue (P=0.011). An acceptable or excellent radio-opacity of MLM was found in 13 subjects (62%). An appropriate localization rate of MLM was 100% with the use of the directly visible ability and radio-opacity of MLM. MLM provides a superior pulmonary localization ability over methylene blue. Lung Ethiodized Oil Methylene Blue Tomography X-Ray Computed Radiology Interventional Seoul National University College of Medicine 800-20120036 INTRODUCTION Preoperative localization is necessary for video-assisted thoracoscopic surgery (VATS) when pulmonary nodules are too small or distant from the visceral pleura to be detected (1-3). A failure to localize nodules disturbs the success of the thoracoscopic resection and leads to conversion to thoracotomy (4 5). There are two kinds of localizing procedures: marking with thoracoscopically directly visible materials and marking with radio-opaque materials. Examples of directly visible materials are hook wire methylene blue and indocyanine green. Ethiodized oil (lipiodol) barium and iodine contrast agents are used for radio-opaque markers. Each marking method has strong and weak points. Localization with a hook wire is easy to perform but carries a high risk of pneumothorax and a propensity to dislodge during transport and surgical preparation (6 7). Methylene blue and indigo carmine have a tendency to diffuse over a large area by the time the operation is done and render localization features inadequate (8 9). The use of a radio-opaque marker (such as barium or lipiodol)"

Lung_Cancer

"Background Ocular sebaceous carcinoma is an uncommon aggressive ocular neoplasm with potential for regional and distant metastasis. Case presentation A 77-year-old woman was found to have a solitary pulmonary lesion 6 years after the initial treatment of sebaceous carcinoma of the eyelid. Video-assisted lung wedge resection of an undetermined pulmonary nodule was carried out successfully. Microscopically the tumor showed foamy cytoplasm and atypical nuclei consistent with metastasis of eyelid sebaceous carcinoma. Conclusion This is the first case report of resected solitary pulmonary metastasis of eyelid sebaceous carcinoma. Pulmonary resection is a good option for the treatment and diagnosis of metastatic eyelid sebaceous carcinoma. Sebaceous carcinoma Lung metastasis Solitary metastasis Background Sebaceous carcinoma of the eyelid is a relatively rare malignant tumor and accounts for less than 1% of all eyelid tumors [1]. As well as being a rare tumor sebaceous carcinoma can mimic other benign inflammatory and malignant processes thus errors or delays in diagnosis are not unusual [2-5]. Although local management strategies for this tumor have previously been described [6-10] very few reports have focused on the patterns of metastasis of this tumor and the treatment strategies for such metastases [78]. Here we report a case of solitary lung metastasis of eyelid sebaceous carcinoma and discuss the clinical implication of surgery for a solitary pulmonary metastasis from sebaceous carcinoma. Case presentation A 77-year-old woman underwent left upper lid resection in April 2006 for sebaceous carcinoma of the eyelid. The surgical margin was negative for cancer cells. In January 2008 she had developed a recurrence in the left upper eyelid and underwent radiotherapy with a total dose of 57.6 Gy of proton beam therapy followed by orbital exenteration of the left eye [1112]. In July 2012 positron emission tomography“computed tomography (PET-CT) revealed a solitary pulmonary nodule 0.5 cm in size in the right upper lobe of the patient™s lung which had increased to 1.1 cm by September 2013 (A). PET-CT revealed a focus of increased uptake in that nodule with a standardized uptake value of 3.7 (B). There was no evidence of other metastatic disease on PET-CT scans. In September 2013 the patient underwent video-assisted thoracoscopic wedge resection of the pulmonary nodule. Frozen sections using oil red O stain revealed accentuation of lipid and presences of foamy cytoplasm in tumor cells which was positive for lipid staining (). Permanent histology demonstrated tumor cells with foamy cytoplasm and atypical nuclei accompanying numerous lipid globules within the cytoplasm () consistent with metastasis of eyelid sebaceous carcinoma. At the last follow-up 7 months after resection there was no loco-regional recurrence or distant metastasis of the tumor after surgery. Computed tomography (CT) and positron emission tomography of the tumors. (A) Chest CT showed a 1.1 cm nodule in the anterior segment of the right upper lobe (arrow). (B) PET-CT showed fluorodeoxyglucose accumulation with a Standardized uptake value (SUV) of 3.7 (arrowhead). Accentuation of lipid by staining. The lipid globules have a red color (frozen sections oil red O magnification?—?100). Sebaceous carcinoma cells. Foamy and frothy cytoplasm and atypical nuclei occurred with numerous lipid globules within the cytoplasm of the tumors cells seen as clear spaces (hematoxylin and eosin magnification?—?100). Discussion Sebaceous carcinoma of the eyelid refers to a group of carcinomas derived from sebaceous gland cells that occur in the ocular adnexa. It can be invasive in the eyelid and conjunctiva and can metastasize to regional lymph nodes and distant ans [81314]. Treatment strategies for primary eyelid sebaceous carcinoma are surgery radiotherapy and chemotherapy [15-17]. Distant hematogenous metastases to the lung liver and brain have a mortality rate as high as 30% [1618]. However few reports demonstrated the surgical treatment of metastatic eyelid sebaceous carcinoma. Standard treatment strategy for pulmonary metastatic sebaceous carcinoma has not yet been established because of the limited number of cases. Chemotherapy regimens in existing reports are largely based on the combination regimens commonly used in the treatment of other forms of poorly differentiated carcinomas of the head and neck region [1920]. Husain et al. reported combined chemotherapy of carboplatin and docetaxel for the patient who had multiple lung and lymph node metastases which resulted in a 30% decrease in tumor size but the efficacy of this regimen for sebaceous carcinoma has not yet been fully evaluated [21]. Radiotherapy for primary eyelid sebaceous carcinoma was described in several reports; however there have been no reports describing radiotherapy for pulmonary metastatic eyelid sebaceous carcinoma [2223]. Resection of pulmonary metastases in patients with sebaceous carcinoma is controversial. However our case suggests that a surgical approach to lung metastasis of eyelid sebaceous carcinoma could prolong survival in certain subgroups of patients namely those with a limited number of metastatic nodules or a significant disease-free interval. The possibility of metastasis from eyelid sebaceous carcinoma or primary lung cancer cannot be predicted only on the basis of radiologic findings or disease-free interval. In the present case we could successfully differentiate solitary lung metastasis of eyelid sebaceous carcinoma from primary lung cancer using oil red O stain which stains lipid has a red color on frozen sections. Conclusion We report a rare case of solitary lung metastasis of eyelid sebaceous carcinoma which was successfully resected and differentiated from primary lung cancer using oil red O stain on frozen sections. Pulmonary resection is a good option for the treatment and diagnosis of metastatic eyelid sebaceous carcinoma. Consent Written informed consent was obtained from the patient for the publication of this case presentation and accompanying images. A copy of the written consent is available for the review by the Editor-in-Chief of this journal. Abbreviations CT: Computed tomography; FDG: Fluorodeoxyglucose; PET: Positron emission tomography. Competing interests The authors declare that they have no competing interests. Authors™ contributions KK and TO wrote the manuscript. KK TO KA and IK performed surgery. YH and KE carried out the pathological examination. MK and TG were involved in the final editing. All authors approved the final manuscript. Cook BE Jr Bartley GB Cook BE Jr Bartley GB Treatment options and future prospects for the management of eyelid malignancies: an evidence-based update Ophthalmology 2001 108 2088 2209 quiz 2099“2100 2121 10.1016/S0161-6420(01)00796-5 11713084 Lai TF Huilgol SC Selva D James CL Eyelid sebaceous carcinoma masquerading as in situ squamous cell carcinoma Dermatol Surg 2004 30 222 225 10.1111/j.1524-4725.2004.30069.x 14756656 Leibovitch I Selva D Huilgol S Davis G Dodd T James CL Intraepithelial sebaceous carcinoma of the eyelid misdiagnosed as Bowen™s disease J Cutan Pathol 2006 33 303 308 10.1111/j.0303-6987.2006.00423.x 16630181 Pereira PR Odashiro AN Rodrigues-Reyes AA Correa ZM de Souza Filho JP Burnier MN Jr Histopathological review of sebaceous carcinoma of the eyelid J Cutan Pathol 2005 32 496 501 10.1111/j.0303-6987.2005.00371.x 16008694 Sinard JH Immunohistochemical distinction of ocular sebaceous carcinoma from basal cell and squamous cell carcinoma Arch Ophthalmol 1999 117 776 783 10.1001/archopht.117.6.776 10369589 Chao AN Shields CL Krema H Shields JA Outcome of patients with periocular sebaceous gland carcinoma with and without conjunctival intraepithelial invasion Ophthalmology 2001 108 1877 1883 10.1016/S0161-6420(01)00719-9 11581065 Shields JA Demirci H Marr BP Eagle RC Jr Shields CL Sebaceous carcinoma of the eyelids: personal experience with 60 cases Ophthalmology 2004 111 2151 2157 10.1016/j.ophtha.2004.07.031 15582067 Shields JA Demirci H Marr BP Eagle RC Jr Shields CL Sebaceous carcinoma of the ocular region: a review Surv Ophthalmol 2005 50 103 122 10.1016/j.survophthal.2004.12.008 15749305 Yen MT Tse DT Wu X Wolfson AH Radiation therapy for local control of eyelid sebaceous cell carcinoma: report of two cases and review of the literature Ophthal Plast Reconstr Surg 2000 16 211 215 10.1097/00002341-200005000-00008 10826762 Wang JK Liao SL Jou JR Lai PC Kao SC Hou PK Chen MS Malignant eyelid tumours in Taiwan Eye (Lond) 2003 17 216 220 10.1038/sj.eye.6700231 12640409 Zenda S Kawashima M Nishio T Kohno R Nihei K Onozawa M Arahira S Ogino T Proton beam therapy as a nonsurgical approach to mucosal melanoma of the head and neck: a pilot study Int J Radiat Oncol Biol Phys 2011 81 135 139 10.1016/j.ijrobp.2010.04.071 20950948 Zenda S Kohno R Kawashima M Arahira S Nishio T Tahara M Hayashi R Kishimoto S Ogino T Proton beam therapy for unresectable malignancies of the nasal cavity and paranasal sinuses Int J Radiat Oncol Biol Phys 2011 81 1473 1478 10.1016/j.ijrobp.2010.08.009 20961697 Ginsberg J Present Status of Meibomian gland carcinoma Arch Ophthalmol 1965 73 271 277 10.1001/archopht.1965.00970030273022 14237799 Rao NA Hidayat AA McLean IW Zimmerman LE Sebaceous carcinomas of the ocular adnexa: a clinicopathologic study of 104 cases with five-year follow-up data Hum Pathol 1982 13 113 122 10.1016/S0046-8177(82)80115-9 7076199 Gardetto A Rainer C Ensinger C Baldissera I Piza-Katzer H Sebaceous carcinoma of the eyelid: a rarity worth considering Br J Ophthalmol 2002 86 243 244 10.1136/bjo.86.2.243 11815355 Kass LG Hornblass A Sebaceous carcinoma of the ocular adnexa Surv Ophthalmol 1989 33 477 490 10.1016/0039-6257(89)90049-0 2658172 Lan MC Lan MY Lin CZ Ho DM Ho CY Sebaceous carcinoma of the eyelid with neck metastasis Otolaryngol Head Neck Surg 2007 136 670 671 10.1016/j.otohns.2006.08.019 17418274 Boniuk M Zimmerman LE Sebaceous carcinoma of the eyelid eyebrow caruncle and orbit Trans Am Acad Ophthalmol Otolaryngol 1968 72 619 642 5706692 Midena E Angeli CD Valenti M de Belvis V Boccato P Treatment of conjunctival squamous cell carcinoma with topical 5-fluorouracil Br J Ophthalmol 2000 84 268 272 10.1136/bjo.84.3.268 10684836 Yeatts RP Engelbrecht NE Curry CD Ford JG Walter KA 5-Fluorouracil for the treatment of intraepithelial neoplasia of the conjunctiva and cornea Ophthalmology 2000 107 2190 2195 10.1016/S0161-6420(00)00389-4 11097594 Husain A Blumenschein G Esmaeli B Treatment and outcomes for metastatic sebaceous cell carcinoma of the eyelid Int J Dermatol 2008 47 276 279 10.1111/j.1365-4632.2008.03496.x 18289332 Hata M Koike I Omura M Maegawa J Ogino I Inoue T Noninvasive and curative radiation therapy for sebaceous carcinoma of the eyelid Int J Radiat Oncol Biol Phys 2012 82 605 611 10.1016/j.ijrobp.2010.12.006 21300468 Howrey RP Lipham WJ Schultz WH Buckley EG Dutton JJ Klintworth GK Rosoff PM Sebaceous gland carcinoma: a subtle second malignancy following radiation therapy in patients with bilateral retinoblastoma Cancer 1998 83 767 771 10.1002/(SICI)1097-0142(19980815)83:4<767::AID-CNCR20>3.0.CO;2-P 9708943 101274235 33311 J Thorac Oncol J Thorac Oncol Journal of thoracic oncology : official publication of the International Association for the Study of Lung Cancer 1556-0864 1556-1380 24736085 4271824 10.1097/JTO.0000000000000082 NIHMS648380 Article A Randomized Placebo-Controlled Multicenter Biomarker-Selected Phase 2 Study of Apricoxib in Combination with Erlotinib in Patients with Advanced Non“Small-Cell Lung Cancer Gitlitz Barbara J. MD * Bernstein Eric MD   Santos Edgardo S. MD ¡ Otterson Greg A. MD § Milne Ginger PhD ? Syto Mary MS ¶ Burrows Francis PhD ¶ Zaknoen Sara MD ¶ *University of Southern California Keck School of Medicine Norris Comprehensive Cancer Center Los Angeles California  Providence Cancer Center Portland Oregon ¡University of Miami Sylvester Comprehensive Cancer Center Miami Florida §Ohio State University Columbus Ohio ?Vanderbilt University Nashville Tennessee ¶Tragara Pharmaceuticals San Diego California Address for correspondence: Barbara Gitlitz MD University of Southern California Keck School of Medicine Norris Comprehensive Cancer Center 1441 Eastlake Avenue Suite 3400 Los Angeles CA 90089. gitlitz@usc.edu 13 12 2014 4 2014 19 12 2014 9 4 577 582 Copyright © 2013 by the International Association for the Study of Lung Cancer 2013 Cyclooxygenase-2 (COX-2) overexpression is associated with a poor prognosis in non“small-cell lung cancer (NSCLC) and may promote resistance to epidermal growth factor receptor inhibitors. This randomized phase 2 trial evaluated apricoxib a novel COX-2 inhibitor in combination with erlotinib in biomarker-selected patients. Patients with stage IIIB/IV NSCLC previously treated with platinum-based chemotherapy were randomized (2:1) to 400 mg/day apricoxib plus 150 mg/day erlotinib (AP/E) or placebo plus erlotinib (P/E) in 21-day cycles until disease progression or unacceptable toxicity. The primary endpoint was time to progression (TTP)."

Lung_Cancer

" in penicillin/streptomicine-free DMEM for 24 hs according to manufacturer's instructions. Protein extraction and Western Blotting Cell pellets were suspended in ice-cold RIPA buffer containing protease and phosphatase inhibitors (Sigma Aldrich Corp. St Louis MO USA). The extracts were then clarified by centrifugation at 15000 rpm for 15 min at 4°C and the protein concentration was determined with the Bradford reagent (Bio-Rad Laboratories Hercules CA) and spectrophotometric analysis. Lysates were incubated in 5x sodium dodecyl sulfate (SDS) sample buffer (5 min 95°C). An amount of 10-30 µg of proteins for each sample was loaded onto 8“15% SDS polyacrylamide gel. Proteins were then transferred onto a nitrocellulose membrane. The membrane was blocked for 1h with non-fat dry milk in TBS containing 0.05% Tween 20 washed and successively incubated with different primary antibodies for 12h at 4°C. The membranes were then washed three times for 10 min and incubated with the HRP-conjugated secondary antibody for 1h at room temperature (RT). After a thorough washing the blot was exposed to ECL (GE Healthcare NJ) followed by autoradiography. The intensity of the bands was quantified using Image J software (NIH Bethesda MD). Sulphorhodamine (SRB) assay Cells were seeded in 96 well plates at a density of 3—103. The next day (day 0) one plate was assessed. The remaining plates were tested at 2-day intervals for a total of 6“8 days. Cells were fixed with 100 µL per well of ice-cold 40% (vol/vol) TCA (Sigma Aldrich Corp. St Louis MO USA) gently added on top of the medium overlaying the cells. The plates were then incubated for 60 min at 4°C. Wells were rinsed five times with tap water and then stained with 0.4% SRB solution (100 µl stain/well; Sigma Aldrich Corp. St Louis MO USA) for 30 min at RT. After staining SRB solution was removed unbound dye was removed by washing five times with 1% acetic acid solution and left to air dry. The bound SRB dye was then solubilized by adding unbuffered Tris-base solution (100 µl/well) and plates were placed on a plate shaker for 10 min at room temperature. Plates were then read at OD 492 nm using a microplate reader. 3D Overlay Culture on Matrigel Thawed Matrigel (BD Bioscience) in a volume of 70 µl/well was added into each of the wells of the eight-well glass slide chambers (Thermo Scientific) and spread to form a 1-mm thick bed. Matrigel was left to solidify at 37°C for 15 min. Then cells (1—103/well) were plated in medium containing 2% Matrigel and allowed to grow in a 5% CO2 humidified incubator at 37°C. Flow cytometry (FACS) After treatments 1—105 cells were collected washed in phosphate-buffered saline (PBS) pelleted by centrifugation and fixed in 70% ethanol. Immediately prior to staining the cells were washed twice in PBS and suspended in PBS containing 50 µg/ml of RNAse A (Qiagen S.p.A Milano Italy). The cells were stained with propidium iodide (final concentration 100 µg/ml) for at least 1 h at 4°C and analyzed using a LSR II flow cytometer (BD Biosciences). The percentage of cells in subG1 G0/G1 S and G2/M phases were determined from >10000 cells using the FACSDiva 6.0 software (BD Biosciences). Caspase - Glo® 3/7 assay Caspase-3/7 activation was measured using the Caspase-Glo 3/7 Luminescence Assay (Promega Corp. Madison Wisc. USA) according to the manufacturer™s instructions. In a 6 well plate 3—105 cells were incubated. The day after the cells were treated with siRNAs both with and without drugs for 48 h. Then the cells were collected by trypsinization and approximately 15—103 cells were transferred in a 96-well white plate. Caspase-3/7-Glo reagent was added and the samples were incubated at 37°C for 1 h. The luminescence that is proportional to the caspase 3/7 activities was determined by luminometer (Tecan Sunrise Austria GMBH). Transwell Cell Invasion Assay About 5—104 cells in 200 µl of ?-MEM (Gibco Life Technologies Monza Italy) were plated in the Matrigel-coated upper chambers of the 24-well Transwell invasion assay plate (Corning NY 14831 USA). Plates were incubated at 37°C for 48 h. Cells in the lower chamber (including those attached to the lower surface of the membrane) were fixed in 4% paraformaldehyde (VWR Milan Italy) stained with DAPI (Lonza Basel Switzerland) and counted with fluorescence microscope (Metamorph “ Axiovert microscope). Wound-Healing Assay About 25—103 cells were seeded in a 12-well plate and after 24 h transfected with siMSLN-1. A linear scratch in the confluent cell monolayer was made with a sterile pipette tip after 12 h (time optimized following preliminary trials) following siRNA transfections. Then cells were rinsed and incubated in full medium. Finally cells were inspected and fixed with paraformaldehyde after 36 h following the scratch. Cells were stained with crystal violet 0.1%solution (dissolved in 20% ethanol) to enhance contrast and photographed with a phase-contrast microscope at 10X magnification. The migration was then evaluated on the images and measured with Image J software. Statistical analyses The measurements of gene expression performed on cell lines and the results obtained from the in vitro assays were statistically evaluated using a two-tailed Student™s t-test. The effects of the combination of treatments (drugs +/“ siRNAs) were evaluated with a multifactor analysis of variance (MANOVA) model. The statistics were performed with the software R (http://www.r-project./) and Statgraphics Centurion XV (StatPoint Inc.). Results MSLN expression in MPM cell lines The expression level of MSLN was screened in Mero-14 IstMes2 and NCI-H28 human MPM cell lines. Met5A a non-malignant immortalized cell line was also screened and used as reference. The expression of MSLN mRNA in Mero-14 cells was higher than in Met5A (A). Western blotting supported these data showing high MSLN levels in Mero-14 cells (B) and low levels in Met5A. Similar to mRNA expression IstMes2 had lower levels of MSLN than Met5A.No levels of MSLN were observed for NCI-H28. Thus two different silencing-RNAs (siRNAs) were assayed: siMSLN-1 and siMSLN-2 for MSLN in Mero-14 cells (Table S2; C). For further experiments siMSLN-1 was employed given its better performance in gene silencing (>95% for siMSLN-1 D). .0085935.g001 Expression levels of MSLN in human MPM cell lines and Met5A. A. RT-qPCR showing the mRNA expression levels of MSLN measured on MPM cell lines and related to Met5A cells (set to 1). RPLP0 HPRT and TBP were used for normalization. Error bars show the standard error of the mean (SEM) from three independent experiments each performed in triplicate. Mero-14 cells showed the highest expression levels of MSLN (P?=?0.02). B. The protein levels of MSLN in Met5A Mero-14 IstMes2 and NCI-H28 cells. ?-actin was used as reference. The protein levels were confirmed by two independent experiments. MSLN is shown as a band at 40 kDa. C. RT-qPCR showing the endogenous mRNA expression levels of MSLN in Mero-14 cells related to their own siCtrl (set to 1). RPLP0 HPRT and TBP were used for normalization. Error bars are SEM from three independent experiments each performed in triplicate. The siRNA chosen for the analysis is: siMSLN-1 (40 nM; *P?=?0.002) active on Mero-14 cells. D. Protein levels of MSLN (shown as a band at 40 kDa) after depletion with siMSLN-1 and -2 (40 nM). ?-actin was used as reference. The protein levels were confirmed by three independent experiments. Role of MSLN in cellular growth The effect of MSLN silencing on cellular growth was evaluated by performing two different assays: the SRB assay and the 3D Matrigel-overlay model. The first facilitates the assessment of the number of cells grown in a bi-dimensional context at a given time [29] whilst the latter facilitates the evaluation of the dimension and shape of spheroids formed in a three-dimensional context. Following the administration of siMSLN-1 a significant reduction (p < 0.05) in the proliferation rate was observed for Mero-14 cells starting from the third day of treatment as compared to cells treated with control siRNA (siCtrl) reaching a 86% decrease at day 6 (A). This result was also corroborated by a reduced expression of the phosphorylated forms of AKT and ERK pAKT and pERK being markers of proliferation [30] (B). When MSLN was transiently over-expressed in the non-MSLN expressing NCI-H28 cells increased levels of pAKT and pERK were observed confirming a link between MSLN expression and proliferation (B). The silencing of MSLN in Mero-14 cells was also associated with smaller and uniform spheres (mean ?=? 34.4 µm±3.11) as compared to the cells treated with siCtrl (mean ?=? 52.5 µm ±7.65 p<10?6). About 72.5% of siCtrl-treated spheres and only 22.5% of siMSLN-1-treated spheres measured > 40 µm (C). Thus Mero-14 cells following MSLN silencing showed a low proliferation rate and a reduced capacity of forming spheroids. .0085935.g002 Role of MSLN in cellular growth. A. SRB proliferation assay in Mero-14 cells treated with 40 nM of the siCtrl or siMSLN-1 (*P ?=? <10?4). Error bars represent SEM of three independent experiments each performed in quadruplicate. B. Western blotting analysis of MSLN p-AKT p-ERK and ERK1-2 on Mero-14 cells treated with siCtrl or siMSLN-1 and on NCI-H28 cells transfected with an empty vector (pcDNA3.1) or a plasmid overexpressing MSLN (pcDNA3.1-MSLN). ?-actin was used as reference. The protein levels were confirmed with three independent experiments. C. The picture represents the phase contrast microscopy of Mero-14 cells cultured in 3D Matrigel-overlay chambers after silencing of MSLN (siMSLN-1 at 40 nM). Magnification 10X. Two different experiments were performed each in triplicate. The percentages of Mero-14 cells classified according to the dimensions of the spheres following treatments with siCtrl or siMSLN-1 in 3D Matrigel-overlay chambers were also reported. Legend to figure 2: Gray line?=? cells treated with siMSLN-1; Dark line?=? cells treated with siCtrl. Role of MSLN in cell cycle progression and apoptosis To examine the effects of MSLN silencing on cell cycle progression Mero-14 cells were treated with siCtrl and siMSLN-1 for 72 h and analyzed with flow cytometry. A statistically significant decreased share of Mero-14 cells in S+G2+M-phases was observed following MSLN silencing as compared to controls (Figure 3). The reduction (standardized for siCtrl) was approximately by 25%. Measured at 48 h after siRNA transfection the Mero-14 cell line did not show any changes in the activities of apoptosis markers: caspase-3 and -7. .0085935.g003 Figure 3 Progression of cells through the cell cycle following flow cytometry analysis. The graph shows the percentage of Mero-14 cells in phase S+G2+M treated with 40 nM of the siCtrl or siMSLN-1. The S+G2+M phase of the cell cycle was slightly reduced following the treatment with siMSLN-1 (*P?=? 0.033). Error bars represent SEM of six independent experiments. Role of MSLN in migration and invasion The effect of gene silencing on cellular migration was evaluated using the wound-healing assay (assessing the repopulation of a scratched area in a plate) [31].The invasiveness was measured using the trans-well assay (assessing the number of cells passing through the pores of the membrane) [32]. No statistically significant differences in migration parameters were observed in Mero-14 following the siRNA treatments (Figure 4A). However Mero-14 cells showed a statistically significant reduced invasion as compared to controls at 48 h after MSLN silencing (Figure 4B). .0085935.g004 Figure 4 Role of MSLN in cellular migration and invasion. A. No effects observed in the wound-healing assay following siRNA transfections. Confluent monolayers of Mero-14 cells transfected with 40 nM of siCtrl or siMSLN-1 respectively. Two different experiments were carried out each performed in triplicate. B. Trans-well cell invasion assay on Mero-14 cells transfected with 40 nM of the siCtrl (top) or siMSLN-1 (bottom). Pictures were taken using a fluorescence microscope at 10X magnification and are reported as negative of the originals to enhance the contrast between the background and the DAPI-stained cells. The bar chart shows the average of invasive cells (error bars represent SEM of two independent experiments each done in triplicate *P ?=? 0.0044). Role of MSLN in cellular growth following treatments with chemotherapeutic drugs After 6 days of treatment cisplatin used as a single agent caused a 26% reduction (not statistically significant) in the proliferation rate of Mero-14 cells. Then the effect of siMSLN-1 was evaluated in combination with cisplatin. When the two agents were used in combination the growth was completely inhibited (p<0.05 Figure 5A). Moreover the addition of siMSLN-1 in cultures treated with imatinib or gemcitabine (each as a single agent) or imatinib+gemcitabine caused further reductions in proliferation. However the effect of siMSLN-1 was not statistically significant in contrast to cultures treated with the two chemotherapeutic drugs together with siCtrl (p?=?0.21 p?=?0.38 and p?=?0.17 respectively). "

Lung_Cancer

"reads in RNA-seq but only a few mutant reads in DNA-WES such as the example Luminal A tumor with a single DNA mutant read in the PIK3CA hotspot. This study's results support that RNA sequencing could be beneficial when added to DNA sequencing in clinical settings. Future studies could explore alternative ways to integrate DNA and RNA sequencing beyond UNCeqRMETA which is the first method of this kind. UNCeqRMETA applied the same quality filters for DNA and RNA and potentially different filters could be beneficial. UNCeqRMETA includes a basic indel realignment and integrated DNA and RNA reassembly could potentially be beneficial. Different statistical modeling could further advance the performance displayed by UNCeqRMETA over DNA only based methods. Balancing sensitivity and specificity is important in applying and developing mutation detectors. Receiver operating characteristic curve analysis such as that presented in this study enables assessment of sensitivity and specificity tradeoffs between alternate models. Integrated RNA-seq and DNA-WES mutation detection is important because it boosts sensitivity in low purity tumors in therapeutically-relevant genes and in driver genes relative to DNA-only detection. Integrated mutation detection could also enable more inclusive cohort profiling studies that censor tumors based on purity and could lead to more comprehensive characterizations of cancer genomes. In integrating DNA-WES and RNA-seq by UNCeqRMETA increases mutation detection performance and was extremely beneficial for low purity tumors. AVAILABILITY UNCeqR software is available at http://lbg.med.unc.edu/tools/unceqr. UNCeqR mutation detections for the lung and breast cohorts are available at ://tcga-data-secure.nci.nih.gov/tcgafiles/tcga4yeo/tumor/ and http://lbg.med.unc.edu/tools/unceqr. SUPPLEMENTARY DATASupplementary Data are available at NAR Online. SUPPLEMENTARY DATA FUNDING National Cancer Institute [F32CA142039 to M.D.W. Breast SPORE P50-CA058223 to C.M.P.]; National Institutes of Health [U24 CA143848 to C.M.P. D.N.H and U24 CA143848-02S1 to C.M.P. D.N.H.]. Funding for open access charge: National Institutes of Health. Conflict of interest statement. M.D.W. was a consultant for GeneCentric Diagnostics and Cancer Therapeutics Innovation Group. C.M.P. is an equity stock holder and Board of Director Member of BioClassifier LLC and GeneCentric Diagnostics. D.N.H. is equity stock holder and Board of Director Member GeneCentric Diagnostics. REFERENCES 1. Stratton M.R. Campbell P.J. Futreal P.A. The cancer genome Nature 2009 458 719 724 19360079 2. Roychowdhury S. Iyer M.K. Robinson D.R. Lonigro R.J. Wu Y.M. Cao X. Kalyana-Sundaram S. Sam L. Balbin O.A. Quist M.J. Personalized oncology through integrative high-throughput sequencing: a pilot study Sci. Transl. Med. 2011 3 111ra121 3. Korf B.R. Rehm H.L. New approaches to molecular diagnosis JAMA 2013 309 1511 1521 23571590 4. The Cancer Genome Atlas Research Network Comprehensive genomic characterization of squamous cell lung cancers Nature 2012 489 519 525 22960745 5. Wilkerson M.D. Yin X. Walter V. Zhao N. Cabanski C.R. Hayward M.C. Miller C.R. Socinski M.A. Parsons A.M. Thorne L.B. Differential pathogenesis of lung adenocarcinoma subtypes involving sequence mutations copy number chromosomal instability and methylation PLoS One 2012 7 e36530 22590557 6. The Cancer Genome Atlas Research Network Comprehensive molecular portraits of human breast tumours Nature 2012 490 61 70 23000897 7. The Cancer Genome Atlas Research Network Comprehensive molecular characterization of clear cell renal cell carcinoma Nature 2013 499 43 49 23792563 8. Meyerson M. Gabriel S. Getz G. Advances in understanding cancer genomes through second-generation sequencing Nat. Rev. Genet. 2010 11 685 696 20847746 9. Cibulskis K. Lawrence M.S. Carter S.L. Sivachenko A. Jaffe D. Sougnez C. Gabriel S. Meyerson M. Lander E.S. Getz G. Sensitive detection of somatic point mutations in impure and heterogeneous cancer samples Nat. Biotechnol. 2013 31 213 219 23396013 10. Kim S.Y. Speed T.P. Comparing somatic mutation-callers: Beyond Venn diagrams BMC Bioinformatics 2013 14 189 23758877 11. Ku C.S. Wu M. Cooper D.N. Naidoo N. Pawitan Y. Pang B. Iacopetta B. Soong R. Exome versus transcriptome sequencing in identifying coding region variants Expert Rev. Mol. Diagn. 2012 12 241 251 22468815 12. Carter S.L. Cibulskis K. Helman E. McKenna A. Shen H. Zack T. Laird P.W. Onofrio R.C. Winckler W. Weir B.A. Absolute quantification of somatic DNA alterations in human cancer Nat. Biotechnol. 2012 30 413 421 22544022 13. Goya R. Sun M.G. Morin R.D. Leung G. Ha G. Wiegand K.C. Senz J. Crisan A. Marra M.A. Hirst M. SNVMix: predicting single nucleotide variants from next-generation sequencing of tumors Bioinformatics 2010 26 730 736 20130035 14. Koboldt D.C. Chen K. Wylie T. Larson D.E. McLellan M.D. Mardis E.R. Weinstock G.M. Wilson R.K. Ding L. VarScan: variant detection in massively parallel sequencing of individual and pooled samples Bioinformatics 2009 25 2283 2285 19542151 15. Koboldt D.C. Zhang Q. Larson D.E. Shen D. McLellan M.D. Lin L. Miller C.A. Mardis E.R. Ding L. Wilson R.K. VarScan 2: somatic mutation and copy number alteration discovery in cancer by exome sequencing Genome Res. 2012 22 568 576 22300766 16. Larson D.E. Harris C.C. Chen K. Koboldt D.C. Abbott T.E. Dooling D.J. Ley T.J. Mardis E.R. Wilson R.K. Ding L. SomaticSniper: identification of somatic point mutations in whole genome sequencing data Bioinformatics 2012 28 311 317 22155872 17. Saunders C.T. Wong W.S. Swamy S. Becq J. Murray L.J. Cheetham R.K. Strelka: accurate somatic small-variant calling from sequenced tumor-normal sample pairs Bioinformatics 2012 28 1811 1817 22581179 18. Bamshad M.J. Ng S.B. Bigham A.W. Tabor H.K. Emond M.J. Nickerson D.A. Shendure J. Exome sequencing as a tool for Mendelian disease gene discovery Nat. Rev. Genet. 2011 12 745 755 21946919 19. Kolata G. Treatment for Leukemia Glimpses of the Future New York Times 2012 20. Wang Z. Gerstein M. Snyder M. RNA-Seq: a revolutionary tool for transcriptomics Nat. Rev. Genet. 2009 10 57 63 19015660 21. Cirulli E.T. Singh A. Shianna K.V. Ge D. Smith J.P. Maia J.M. Heinzen E.L. Goedert J.J. Goldstein D.B. Screening the human exome: a comparison of whole genome and whole transcriptome sequencing Genome Biol. 2010 11 R57 20598109 22. Xu X. Zhu K. Liu F. Wang Y. Shen J. Jin J. Wang Z. Chen L. Li J. Xu M. Identification of somatic mutations in human prostate cancer by RNA-Seq Gene 2013 519 343 347 23434521 23. Kridel R. Meissner B. Rogic S. Boyle M. Telenius A. Woolcock B. Gunawardana J. Jenkins C. Cochrane C. Ben-Neriah S. Whole transcriptome sequencing reveals recurrent NOTCH1 mutations in mantle cell lymphoma Blood 2012 119 1963 1971 22210878 24. Shah S.P. Kobel M. Senz J. Morin R.D. Clarke B.A. Wiegand K.C. Leung G. Zayed A. Mehl E. Kalloger S.E. Mutation of FOXL2 in granulosa-cell tumors of the ovary N. Engl. J. Med. 2009 360 2719 2729 19516027 25. Chandrasekharappa S.C. Lach F.P. Kimble D.C. Kamat A. Teer J.K. Donovan F.X. Flynn E. Sen S.K. Thongthip S. Sanborn E. Massively parallel sequencing aCGH and RNA-Seq technologies provide a comprehensive molecular diagnosis of Fanconi anemia Blood 2013 121 e138 e148 23613520 26. Miller A.C. Obholzer N.D. Shah A.N. Megason S.G. Moens C.B. RNA-seq-based mapping and candidate identification of mutations from forward genetic screens Genome Res. 2013 23 679 686 23299976 27. Hill J.T. Demarest B.L. Bisgrove B.W. Gorsi B. Su Y.C. Yost H.J. MMAPPR: mutation mapping analysis pipeline for pooled RNA-seq Genome Res. 2013 23 687 697 23299975 28. Kleinman C.L. Majewski J. Comment on œWidespread RNA and DNA sequence differences in the human transcriptome Science 2012 335 1302 author reply 1302 22422962 29. Lin W. Piskol R. Tan M.H. Li J.B. Comment on œWidespread RNA and DNA sequence differences in the human transcriptome Science 2012 335 1302 author reply 1302 22422964 30. Pickrell J.K. Gilad Y. Pritchard J.K. Comment on œWidespread RNA and DNA sequence differences in the human transcriptome Science 2012 335 1302 author reply 1302 22422963 31. Li H. Handsaker B. Wysoker A. Fennell T. Ruan J. Homer N. Marth G. Abecasis G. Durbin R. The sequence alignment/map format and SAMtools Bioinformatics 2009 25 2078 2079 19505943 32. Wang K. Singh D. Zeng Z. Coleman S.J. Huang Y. Savich G.L. He X. Mieczkowski P. Grimm S.A. Perou C.M. MapSplice: accurate mapping of RNA-seq reads for splice junction discovery Nucleic Acids Res. 2010 38 e178 20802226 33. Li H. Durbin R. Fast and accurate short read alignment with Burrows-Wheeler transform Bioinformatics 2009 25 1754 1760 19451168 34. Kleinman C.L. Adoue V. Majewski J. RNA editing of protein sequences: a rare event in human transcriptomes RNA 2012 18 1586 1596 22832026 35. Nemlich Y. Greenberg E. Ortenberg R. Besser M.J. Barshack I. Jacob-Hirsch J. Jacoby E. Eyal E. Rivkin L. Prieto V.G. MicroRNA-mediated loss of ADAR1 in metastatic melanoma promotes tumor growth J. Clin. Investig. 2013 123 2703 2718 23728176 36. Stouffer S.A. Suchman E.A. DeVinney L.C. Star S.A. Williams R.M. Studies in Social Pyschology in World War II 1949 Princeton New Jersey Princeton University Press 37. Mosteller F. Bush R. Llindzey G. Handbook of Social Pyschology 1954 Cambridge MA Addison-Wesley 289 334 38. Zaykin D.V. Optimally weighted Z-test is a powerful method for combining probabilities in meta-analysis J. Evol. Biol. 2011 24 1836 1841 21605215 39. Yee T. The {VGAM} package R News 2008 8 28 39 40. Karolchik D. Barber G.P. Casper J. Clawson H. Cline M.S. Diekhans M. Dreszer T.R. Fujita P.A. Guruvadoo L. Haeussler M. The UCSC genome browser database: 2014 update Nucleic Acids Res. 2014 42 D764 D770 24270787 41. Cabanski C.R. Wilkerson M.D. Soloway M. Parker J.S. Liu J. Prins J.F. Marron J.S. Perou C.M. Hayes D.N. BlackOPs: increasing confidence in variant detection through mappability filtering Nucleic Acids Res. 2013 41 e178 23935067 42. Wang K. Li M. Hakonarson H. ANNOVAR: functional annotation of genetic variants from high-throughput sequencing data Nucleic Acids Res. 2010 38 e164 20601685 43. Robinson J.T. Thorvaldsdottir H. Winckler W. Guttman M. Lander E.S. Getz G. Mesirov J.P. Integrative genomics viewer Nat. Biotechnol. 2011 29 24 26 21221095 44. Witten I.H. Frank E. Data Mining : Practical Machine Learning Tools and Techniques 2005 2nd edn Amsterdam; Boston MA Morgan Kaufman 45. Roberts N.D. Kortschak R.D. Parker W.T. Schreiber A.W. Branford S. Scott H.S. Glonek G. Adelson D.L. A comparative analysis of algorithms for somatic SNV detection in cancer Bioinformatics 2013 29 2223 2230 23842810 46. Iggo R. Gatter K. Bartek J. Lane D. Harris A.L. Increased expression of mutant forms of p53 oncogene in primary lung cancer Lancet 1990 335 675 679 1969059 47. Forbes S.A. Bindal N. Bamford S. Cole C. Kok C.Y. Beare D. Jia M. Shepherd R. Leung K. Menzies A. COSMIC: mining complete cancer genomes in the Catalogue of Somatic Mutations in Cancer Nucleic Acids Res. 2011 39 D945 950 20952405 48. Perou C.M. Sorlie T. Eisen M.B. van de Rijn M. Jeffrey S.S. Rees C.A. Pollack J.R. Ross D.T. Johnsen H. Akslen L.A. Molecular portraits of human breast tumours Nature 2000 406 747 752 10963602 49. Futreal P.A. Coin L. Marshall M. Down T. Hubbard T. Wooster R. Rahman N. Stratton M.R. A census of human cancer genes Nat. Rev. Cancer 2004 4 177 183 14993899 50. Wilkerson M.D. Yin X. Hoadley K.A. Liu Y. Hayward M.C. Cabanski C.R. Muldrew K. Miller C.R. Randell S.H. Socinski M.A. Lung squamous cell carcinoma mRNA expression subtypes are reproducible clinically important and correspond to normal cell types Clin. Cancer Res. 2010 16 4864 4875 20643781 51. Liao R.G. Jung J. Tchaicha J. Wilkerson M.D. Sivachenko A. Beauchamp E.M. Liu Q. Pugh T.J. Pedamallu C.S. Hayes D.N. Inhibitor-sensitive FGFR2 and FGFR3 mutations in lung squamous cell carcinoma Cancer Res. 2013 73 5195 5205 23786770 52. Bose R. Kavuri S.M. Searleman A.C. Shen W. Shen D. Koboldt D.C. Monsey J. Goel N. Aronson A.B. Li S. Activating HER2 mutations in HER2 gene amplification negative breast cancer Cancer Discov. 2013 3 224 237 23220880 Interact Cardiovasc Thorac Surg Interact Cardiovasc Thorac Surg icvts icvtsurg Interactive Cardiovascular and Thoracic Surgery 1569-9293 1569-9285 Oxford University Press 24130089 3867036 10.1093/icvts/ivt419 ivt419 New Ideas Thoracic Comparison of local tissue damage: monopolar cutter versus Nd:YAG laser for lung parenchyma resection. An experimental study Kirschbaum Andreas a * Braun Steve b Rexin Peter c Bartsch Detlef K. a Seyfer Perla b aVisceral Thoracic and Vascular Surgery Clinic University Hospital Giessen and Marburg GmbH Marburg Germany bClinic of Diagnostic and Interventional Radiology University Hospital Giessen and Marburg Marburg Germany cInstitute of Pathology University Hospital Giessen and Marburg Marburg Germany *Corresponding author: Visceral Thoracic and Vascular Surgery Clinic University Hospital Giessen and Marburg GmbH Baldingerstraße 35033 Marburg Germany. Tel: +49-6421-5862561; fax: +49-6421-5866593; e-mail: akirschb@med.uni-marburg.de (A. Kirschbaum). 1 2014 14 10 2013 18 1 1 6 26 4 2013 17 7 2013 19 8 2013 © The Author 2013. Published by Oxford University Press on behalf of the European Association for Cardio-Thoracic Surgery. All rights reserved. 2013 OBJECTIVES Lung metastases are non-anatomically resected while sparing as much parenchyma as possible. For this purpose a few surgeons use the Nd:YAG Laser LIMAX® 120 whereas the majority of surgeons use a monopolar cutter like the MAXIUM®. The aim of this experimental study was to investigate which instrument causes less lung-tissue damage at the same power output. METHODS These experiments were conducted on left lungs (n = 6) taken from freshly slaughtered pigs. The laser and the monopolar cutter were fixed in a hydraulic mover. The laser was focused at a distance of 3 cm to the lung tissue and the monopolar cutter was fixed in pressure-free contact with the lung surface. Both instruments were manoeuvred at a speed of 5 10 and 20 mm/s in a straight line at an output of 100 watts over the lung surface. The lung lesions that ensued were then examined macro- and microscopically. The same procedures were repeated at a distance of 1 cm creating parallel lesions in order to analyse the lung tissue in between the lesions for thermal damage. In addition two implanted capsules in the lung tissue simulating a lung nodule were resected with either the laser or the monopolar cutter. The resection surfaces were then examined by magnetic resonance imaging and histology for tissue damage. Finally we created a 2-cm wide mark on the lung surface to test the resection capacity of both instruments within 1 min. RESULTS The laser created sharply delineated lesions with a vaporization and coagulation zone without thermal damage of the surrounding lung tissue. With lowering the working speed each zone was extended. At a working speed of 10 mm/s the mean vaporization depth using the laser was 1.74 ± 0.1 mm and the mean coagulation depth was 1.55 ± 0.09 mm. At the same working speed the monopolar cutter demonstrated a greater cutting effect (mean vaporization depth 2.7 ± 0.11 mm; P < 0.001) without leaving much coagulation on the resection surface (mean coagulation depth 1.25 ± 0.1 mm; P = 0.002). In contrast to the laser the monopolar cutter caused thermal damage of the adjacent lung tissue. The adjacent tissue injury was detected in histological examination as well as in the MRI findings. Adjacent lung tissue after lung metastasectomy using the monopolar cutter was hyper-intensive in T2-weighted MR imaging indicating a severe tissue damage. No significant changes in signal intensity were observed in T2-weighted imaging of the adjacent lung tissue after using the laser for lung resection. One minute of laser applied at a 100-watt output penetrated a lung surface area of 3.8 ± 0.4 cm2 compared with 4.8 ± 0.6 cm2 of surface after application of the monopolar cutter (P = 0.001). CONCLUSIONS The monopolar cutter possesses indeed a greater cutting capacity than the laser but it also causes more adjacent tissue injury. Thus laser resection might be preferred for lung metastasectomy. Electrosurgical scalpel Laser Lung metastases Lung resection Tissue damage BMC Urol BMC Urol BMC "

Lung_Cancer

"cells treated with thiaminase are consistent with inhibition of BCKDH complex pyruvate dehydrogenase complex and transketolase inhibition. However inhibition of the same enzyme was shown to result in different metabolic consequences in the case of BCKDH where inhibition in RS4 cells caused a demonstrable increase in BCKDH substrates whereas in MCF-7 cells inhibition led to a decrease in the products of the enzymatic reaction. This difference may then lead to different consequences on cell growth as the substrates for BCKDH are known to be toxic metabolites and result in the an toxicity in the metabolic syndrome maple syrup urine disease. We have previously shown that RS4 cells as well as other lymphoid leukemia cell lines have a biphasic dose response to thiaminase where there is an initial growth inhibition related to extracellular thiamine depletion and a cytotoxic response at higher concentrations related to intracellular thiamine depletion [7]. Gabapentin appears to be protective against the growth inhibitory effects of thiaminase in RS4 cells at the concentrations that produce extracellular thiamine depletion indicating that growth inhibition is not due solely to thiamine depletion but also to the accumulation of branched-chain amino acid catabolites. These studies demonstrate that the cell lines and presumable tumors have different metabolic consequences resulting from inhibition of the same enzymes and that these consequences may form the basis of sensitivity to TDE inhibition as well as identify potential biomarkers of response. In addition thiaminase treatment was associated with increased lipolysis and decreased polyamine synthesis (data not shown) both of which were reversed by co-treatment with rapamycin. These changes are consistent with altered energy production and reduced cellular proliferation as a result of thiamine depletion but also may be related to our previous observation that mammary tumor formation is delayed in mice fed a low-thiamine normal-fat diet but not in mice fed a low-thiamine high-fat diet [4]. Although fatty acid metabolism may be affected by inhibition of 2-hydroxyl-CoA lyase (HACL1) a peroxisomal enzyme that also requires thiamine pyrophosphate as a cofactor and mediates the catabolism of branched chain fatty acids and 2-hydroxyl straight chain fatty acids [17] we did not see any evidence for accumulation of these metabolites in either cell line. Conclusions Overall these studies demonstrate that TDE disruption leads to specific metabolic consequences that are predictable from its role as a cofactor for enzymes that catalyze important steps in energy production biomass generation and amino acid catabolism. Comparison of the changes observed with thiaminase treatment in RS4 cells versus MCF-7 cells reveals different biochemical signatures as a result of thiamine depletion that may reflect differences in the relative contributions of different pathways to energy production and anaplerotic contributions to the TCA cycle. The near-global reversal of the specific metabolic effects of thiaminase by rapamycin indicate a closer regulation of thiamine-dependent metabolism by mTOR than has been previously appreciated and further studies are needed to determine how mTOR signaling pathways regulates thiamine-dependent metabolism. The disruption of thiamine metabolism results in cytotoxicity in breast cancer and leukemia tumor model systems and has the potential to provide novel targets for therapies directed toward these malignancies. Supporting Information Figure S1 Results of metabolomic analysis for branched-chain amino acid metabolites in A.) RS4 cell line and B.) MCF7 cell cline analyzed under six conditions: control for 24 hours (C-24); incubation in thiaminase for 24 hours (T-24); control for 48 hours (C-48); thiaminase for 48 hours (T-48); rapamycin for 48 hours (R-48); and both rapamycin and thiaminase for 48 hours (R+T-48). The median is indicated by the bar in the center of the rectangle the rectangle dimensions reflect the range of the two mid-quartile values and the outer bars represent the ranges of all of the values. The data represent four independent experiments. For C-48 vs T-48 and C-48 vs T+R-48 comparisons ** indicates p<0.05 and * indicates 0.05<p<0.1). (TIF) Click here for additional data file. Table S1 Metabolomic pathway heat map data for RS4 and MCF-7 cells treated with thiaminase (T) rapamycin (R) or both (R+T) for 24 and 48 hours. (XLSX) Click here for additional data file. The authors thank the Research Communication Office of the Markey Cancer Center at the University of Kentucky for editorial and graphics assistance. This work was supported by DanceBlue an effort of the University of Kentucky student community to support pediatric oncology care and research. References 1 ZastreJA SweetRL HanberryBS YeS (2013) Linking vitamin B1 with cancer cell metabolism. Cancer & Metabolism1: 1“1424280107 2 LiuS HuangH LuX GolinskiM ComesseS et al (2003) Down-regulation of thiamine transporter THTR2 gene expression in breast cancer and its association with resistance to apoptosis. Mol Cancer Res1: 665“67312861052 3 LiuS StrombergA TaiHH MoscowJA (2004) Thiamine transporter gene expression and exogenous thiamine modulate the expression of genes involved in drug and prostaglandin metabolism in breast cancer cells. Mol Cancer Res2: 477“48715328374 4 Daily A Liu S Bhatnagar S Karabakhtsian RG Moscow JA (2013) Low thiamine diet increases mammary tumor latency in FVB/N-Tg(MMTVneu) mice. Int J Vitamin Nutrition Res In press. 5 CostelloCA KelleherNL AbeM McLaffertyFW BegleyTP (1996) Mechanistic studies on thiaminase I. Overexpression and identification of the active site nucleophile. J Biol Chem271: 3445“34528631946 6 LiuS BaeY LeggasM DailyA BhatnagarS et al (2012) Pharmacologic properties of polyethylene glycol-modified Bacillus thiaminolyticus thiaminase I enzyme. J Pharmacol Exp Ther341: 775“78322431205 7 DailyA LiuS BaeY BhatnagarS MoscowJA (2011) Linear chain PEGylated recombinant Bacillus thiaminolyticus thiaminase I enzyme has growth inhibitory activity against lymphoid leukemia cell lines. Mol Cancer Ther10: 1563“157021697396 8 LiuS MonksNR HanesJW BegleyTP YuH et al (2010) Sensitivity of breast cancer cell lines to recombinant thiaminase I. Cancer Chemother Pharmacol. 66: 171“179 9 HassaneDC SenS MinhajuddinM RossiRM CorbettCA et al (2010) Chemical genomic screening reveals synergism between parthenolide and inhibitors of the PI-3 kinase and mTOR pathways. Blood116: 5983“599020889920 10 EvansAM DeHavenCD BarrettT MitchellM MilgramE (2009) Integrated nontargeted ultrahigh performance liquid chromatography/electrospray ionization tandem mass spectrometry platform for the identification and relative quantification of the small-molecule complement of biological systems. Anal Chem81: 6656“666719624122 11 OhtaT MasutomiN TsutsuiN SakairiT MitchellM et al (2009) Untargeted metabolomic profiling as an evaluative tool of fenofibrate-induced toxicology in Fischer 344 male rats. Toxicol Pathol37: 521“53519458390 12 DehavenCD EvansAM DaiH LawtonKA (2010) anization of GC/MS and LC/MS metabolomics data into chemical libraries. J Cheminform2: 920955607 13 Le HuerouY GunawardanaI ThomasAA BoydSA de MeeseJ et al (2008) Prodrug thiamine analogs as inhibitors of the enzyme transketolase. Bio Med Chem Lett18: 505“50818083562 14 ThomasAA Le HuerouY De MeeseJ GunawardanaI KaplanT et al (2008) Synthesis in vitro and in vivo activity of thiamine antagonist transketolase inhibitors. Bio Med Chem Lett18: 2206“221018267359 15 HutsonSM BerkichD DrownP XuB AschnerM et al (1998) Role of branched-chain aminotransferase isoenzymes and gabapentin in neurotransmitter metabolism. J Neurochem71: 863“8749681479 16 SantraS BaumannU (2008) Experience of nitisinone for the pharmacological treatment of hereditary tyrosinaemia type 1. Expert Opin Pharmacother9: 1229“123618422479 17 CasteelsM SniekersM FraccasciaP MannaertsGP Van VeldhovenPP (2007) The role of 2-hydroxyacyl-CoA lyase a thiamin pyrophosphate-dependent enzyme in the peroxisomal metabolism of 3-methyl-branched fatty acids and 2-hydroxy straight-chain fatty acids. Biochem Soc Trans35: 876“88017956236 9502500 8794 Clin Cancer Res Clin. Cancer Res. Clinical cancer research : an official journal of the American Association for Cancer Research 1078-0432 24536073 3962777 10.1158/1078-0432.CCR-13-0583 NIHMS557917 Article NEW STRATEGIES FOR TRIPLE NEGATIVE BREAST CANCER “ DECIPHERING THE HETEROGENEITY Mayer Ingrid A. 1 3 Abramson Vandana G. 1 3 Lehmann Brian D. 2 3 Pietenpol Jennifer A. 2 3 1Department of Medicine Vanderbilt University School of Medicine Nashville TN 2Department of Cancer Biology Vanderbilt University School of Medicine Nashville TN 3Breast Cancer Research Program Vanderbilt-Ingram Cancer Center Vanderbilt University School of Medicine Nashville TN Corresponding author: Ingrid A. Mayer Div. Hematology/Oncology VUMC 2220 Pierce Avenue 777 PRB Nashville TN 37232-6307 Tel: 615 936 3524 Fax: 615 343-7602 ingrid.mayer@vanderbilt.edu 11 3 2014 15 2 2014 15 2 2015 20 4 782 790 Triple-negative breast cancer (TNBC) is a heterogeneous disease; gene expression (GE) analyses recently identified six distinct TNBC subtypes each displaying a unique biology. Exploring novel approaches to treatment of these subtypes is critical since less than 30% of women with metastatic breast cancer survive five years and virtually all women with metastatic TNBC will ultimately die of their disease despite systemic therapy. To date not a single targeted therapy has been approved for the treatment of TNBC and cytotoxic chemotherapy remains the standard treatment. We will discuss the current and upcoming therapeutic strategies being explored in an attempt to œtarget TNBC. J Womens Health (Larchmt) J Womens Health (Larchmt) jwh Journal of Women's Health 1540-9996 1931-843X Mary Ann Liebert Inc. 140 Huguenot Street 3rd FloorNew Rochelle NY 10801USA 24372085 4011422 10.1089/jwh.2013.4516 10.1089/jwh.2013.4516 Original Articles Perceived Versus Objective Breast Cancer Breast Cancer Risk in Diverse Women Fehniger Julia MD 1 2 Livaudais-Toman Jennifer PhD 1 Karliner Leah MD 1 3 Kerlikowske Karla MD 34 5 Tice Jeffrey A. MD 1 3 Quinn Jessica MS 1 Ozanne Elissa PhD 6 Kaplan Celia P. DrPH MA 1 3 1Department of Medicine Division of General Internal Medicine University of California San Francisco California. 2Department of Obstetrics and Gynecology University of California San Francisco California. 3Helen Diller Family Comprehensive Cancer Center University of California San Francisco California. 4General Internal Medicine Section Department of Veterans Affairs University of California San Francisco California. 5Departments of Medicine and Epidemiology and Biostatistics University of California San Francisco California. 6Institute for Health Policy Studies and Department of Surgery University of California San Francisco California. Address correspondence to: Celia P. Kaplan DrPH MA Helen Diller Family Comprehensive Cancer Center University of California San Francisco 3333 California Street Box 0856 San Francisco CA 94143 E-mail: celia.kaplan@ucsf.edu 01 5 2014 23 5 420 427 Copyright 2014 Mary Ann Liebert Inc. 2014 Abstract Background: Prior research suggests that women do not accurately estimate their risk for breast cancer. Estimating and informing women of their risk is essential for tailoring appropriate screening and risk reduction strategies. Methods: Data were collected for BreastCARE a randomized controlled trial designed to evaluate a PC-tablet based intervention providing multiethnic women and their primary care physicians with tailored information about breast cancer risk. We included women ages 40“74 visiting general internal medicine primary care clinics at one academic practice and one safety net practice who spoke English Spanish or Cantonese and had no personal history of breast cancer. We collected baseline information regarding risk perception and concern. Women were categorized as high risk (vs. average risk) if their family history met criteria for referral to genetic counseling or if they were in the top 5% of risk for their age based on the Gail or Breast Cancer Surveillance Consortium Model (BCSC) breast cancer risk model. Results: Of 1261 participants 25% (N=314) were classified as high risk. More average risk than high risk women had correct risk perception (72% vs. 18%); 25% of both average and high risk women reported being very concerned about breast cancer. Average risk women with correct risk perception were less likely to be concerned about breast cancer (odds ratio [OR]=0.3; 95% confidence interval [CI]=0.2“0.4) while high risk women with correct risk perception were more likely to be concerned about breast cancer (OR=5.1; 95%CI=2.7“9.6). Conclusions: Many women did not accurately perceive their risk for breast cancer. Women with accurate risk perception had an appropriate level of concern about breast cancer. Improved methods of assessing and informing women of their breast cancer risk could motivate high risk women to apply appropriate prevention strategies and allay unnecessary concern among average risk women. Clin Exp Immunol Clin. Exp. Immunol cei Clinical and Experimental Immunology 0009-9104 1365-2249 Blackwell Science Inc Oxford UK 24654775 4226594 10.1111/cei.12332 Original Articles Spontaneous antibodies against Engrailed-2 (EN2) protein in patients with prostate cancer Annels N E * Simpson G R * Denyer M * McGrath S E * Falgari G * Killick E   Eeles R   Stebbing J ¡ Pchejetski D ¡ Cutress R § Murray N § Michael A * Pandha H * * Oncology Faculty of Health and Medical Sciences University of Surrey Guildford Surrey UK   Institute of Cancer Research Sutton Surrey UK ¡ Charing Cross Hospital London Hampshire UK § University Hospital Southampton Southampton Hampshire UK H. Pandha Oncology Faculty of Health and Medical Sciences Leggett Building University of Surrey Guildford Surrey GU2 7WG UK. E-mail: h.pandha@surrey.ac.uk 8 2014 09 7 2014 177 2 428 438 16 3 2014 © 2014 British Society for Immunology 2014 We reported the expression of the homeodomain-containing transcription factor Engrailed-2 (EN2) in prostate cancer and showed that the presence of EN2 protein in the urine was highly predictive of prostate cancer. This study aimed to determine whether patients with prostate cancer have EN2 autoantibodies what the prevalence of these antibodies is and whether they are associated with disease stage. The spontaneous immunoglobulin (Ig)G immune response against EN2 and for comparison the tumour antigen New York Esophageal Squamous Cell Carcinoma 1 (NY-ESO-1) were tested by enzyme-linked immunosorbent assay (ELISA) in three different cohorts of prostate cancer patients as well as a group of men genetically predisposed to prostate cancer. Thirty-two of 353 (9·1%) of the SUN cohort representing all stages of prostate cancer demonstrated EN2 IgG responses 12 of 107 patients (11·2%) in the advanced prostate cancer patients showed responses while only four of 121 patients (3·3%) with castrate-resistant prostate cancer showed EN2 autoantibodies. No significant responses were found in the predisposed group. Anti-EN2 IgG responses were significantly higher in patients with prostate cancer compared to healthy control males and similarly prevalent to anti-NY-ESO-1 responses. While EN2 autoantibodies are not a useful diagnostic or monitoring tool EN2 immunogenicity provides the rationale to pursue studies using EN2 as an immunotherapeutic target. autoantibodies Engrailed-2 prostate cancer BMC Cancer BMC Cancer BMC Cancer 1471-2407 BioMed Central 24383403 3880410 1471-2407-14-1 10.1186/1471-2407-14-1 Research Article Prolyl-4-hydroxylase ? subunit 2 promotes breast cancer progression and metastasis by regulating collagen deposition Xiong Gaofeng 1 gaofeng.xiong@uky.edu Deng Lei 1 dnaxy@hotmail.com Zhu Jieqing 1 jzh254@g.uky.edu Rychahou Piotr G 1 2 piotr.rychahou@uky.edu Xu Ren 1 3 ren.xu2010@uky.edu 1Markey Cancer Center University of Kentucky Lexington KY 40536 USA 2Department of Surgery University of Kentucky Lexington KY 40536 USA 3Department of Molecular and Biomedical Pharmacology University of Kentucky 741 S. Limestone BBSRB Lexington KY 40536 USA 2014 2 1 2014 14 1 1 27 9 2013 26 12 2013 Copyright © 2014 Xiong et al.; licensee BioMed Central Ltd. 2014 Xiong et al.; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons./licenses/by/2.0) which permits unrestricted use distribution and reproduction in any medium provided the original work is properly cited. The Creative Commons Public Domain Dedication waiver (http://creativecommons./publicdomain/zero/1.0/) applies to the data made available in this article unless otherwise stated. Background Increased collagen deposition provides physical and biochemical signals to support tumor growth and invasion during breast cancer development. Therefore inhibition of collagen synthesis and deposition has been considered a strategy to suppress breast cancer progression. Collagen prolyl-4-hydroxylase ? subunit 2 (P4HA2) an enzyme hydroxylating proline residues in -X-Pro-Gly- sequences is a potential therapeutic target for the disorders associated with increased collagen deposition. However expression and function of P4HA2 in breast cancer progression are not well investigated. Methods Gene co-expression analysis was performed in the published microarray datasets to identify potential regulators of collagen I III and IV in human breast cancer tissue. Expression of P4HA2 was silenced by shRNAs and its activity was inhibited by 1 4-DPCA a prolyl-4-hydroxylase inhibitor. Three-dimensional culture assay was used to analyze roles of P4HA2 in regulating malignant phenotypes of breast cancer cells. Reduced deposition of collagen I and IV was detected by Western blotting and immunofluorescence. Control and P4HA2-silenced breast cancer cells were injected into fat pad and tail vein of SCID mice to examine effect of P4HA2 on tumor growth and lung metastasis. Results Using gene co-expression analysis we showed that P4HA2 was associated with expression of Col1A1 Col3A1 and Col4A1 during breast cancer development and progression. P4HA2 mRNA levels were significantly upregulated in breast cancer compared to normal mammary tissue. Increased mRNA levels of P4HA2 correlated with poor clinical outcome in breast cancer patients which is independent of estrogen receptor status. Silencing P4HA2 expression or treatment with the P4HA inhibitor significantly inhibited cell proliferation and suppressed aggressive phenotypes of breast cancer cells in 3D culture accompanied by reduced deposition of collagen I and IV. We also found that knockdown of P4HA2 inhibited mammary tumor growth and metastasis to lungs in xenograft models. Conclusion These results suggest the critical role of P4HA2 in breast cancer progression and identify P4HA2 as a potential therapeutic target and biomarker for breast cancer progression. Tumor microenvironment Breast cancer Collagen deposition Cancer progression Cell proliferation Background Extracellular matrix (ECM) is an important component of tumor microenvironment and plays critical roles in cancer development [1-3]. Collagens are the major structural ECM proteins and form fibers or networks in tumor tissue [4-6]. Cell-collagen interaction controls a variety of cellular activities including proliferation migration and invasion through integrin and discoidin domain receptor [7-9]. Enhanced expression and deposition of collagens are associated with tumor development and progression [10-12]. Recent studies demonstrate that increased collagen deposition and crosslinking enhance the stiffness and density of mammary tissue [51013] which is an important risk factor for breast cancer development. Type I collagen has been identified as a prognosis marker and is associated with cancer recurrence in human breast cancer patients [14]. Collagen VI knockout mice have reduced primary tumor formation and growth [12] while enhancing collagen deposition and inhibiting collagen degradation significantly enhances tumor initiation and tumor growth [510]. In addition cancer cell invasion usually occurs at tumor-stromal interfaces with oriented collagen fibers and aligned collagen fibers can facilitate cell migration and metastasis [5101115]. These results indicate that increased collagen expression and deposition promotes breast cancer development and progression by enhancing tumor growth and invasion. Therefore inhibiting collagen synthesis or deposition is a promising strategy to suppress breast cancer progression. Collagen biosynthesis is a multistep process that involves several post-transcription modification enzymes and one of the most important members of these enzymes is collagen prolyl-4-hydroxylase [16]. It catalyzes the formation of 4-hydroxyproline by hydroxylating proline residues in -X-Pro-Gly- sequences [17-20]. Collagen prolyl-4-hydroxylase resides within the lumen of the endoplasmic reticulum (ER) [18] and its expression is used as a marker for collagen synthesis [2122]. Because 4-hydroxyproline residues formed in this reaction are essential for triple helix formation and stabilization of collagen [22-24] inhibiting the prolyl-4-hydroxylases activity efficiently blocks collagen synthesis and deposition. All known vertebrate collagen prolyl-4-hydroxylases are ?2?2 tetramers consisting of two ? subunits and two ? subunits. Each ? subunit contains the peptide substrate binding domain and the two catalytic sites of the enzyme and the ? subunits have been identified as protein disulfide isomerases [171925]. Three types of collagen prolyl-4-hydroxylases ? isoforms (P4HA1 P4HA2 and P4HA3) have been identified in human tissue. P4HA1 is expressed in most cell types; P4HA2 is mainly expressed in chondrocytes osteoblasts and capillary endothelial cells; P4HA3 expression is detected in adult and fetal tissues at very low levels compared to P4HA1 and P4HA2 [1826]. Increased P4HA2 expression has been detected in many solid tumors including oral cavity squamous cell carcinoma papillary thyroid cancer and breast cancer [27-30] however the function of P4HA2 in cancer progression largely remains to be determined. Here we showed that expression of P4HA2 and collagen genes (Col1A1 Col3A1 and Col4A1) is significantly correlated during breast cancer development and progression and that increased mRNA levels of P4HA2 are associated with poor prognosis in breast cancer patients. Silencing P4HA2 or treatment with the P4HA inhibitor attenuates cell proliferation and suppresses aggressive 3D phenotypes tumor growth and cancer metastasis"

Lung_Cancer

"Mesothelin; MTB: Mycobacterium tuberculosis; Hsp: Heat shock protein; i.p.: Intraperitoneal; i.d.: Intradermal; BMDCs: Bone marrow-derived dendritic cells; APCs: Antigen-presenting cells; PBMCs: Peripheral blood mononuclear cells; PBLs: Peripheral blood leukocytes; LPS: Lipopolysaccharide; H&E: Haematoxylin and eosin; PFA: Paraformaldehyde; DAB: Diaminobenzidine; mAb: monoclonal antibody. Competing interests The authors declare that they have no competing interests. Authors™ contributions JY played a role in the design of the experiments acquisition analysis and interpretation of the data and writing the manuscript. PR JN YY NHA MN GJ-M XT SK HC PU BF TC and PL participated in the performance of experiments. SK and TB were involved in design of the experiments. RB was involved in data analysis. ER was involved in setting up murine ovarian cancer model. SO provided the murine ovarian cancer model. NS provided the plasmid that encodes an scFv fragment specific to MSLN and the recombinant P4 scFv protein. GD NS and SO gave constructive input on experimental design and data analysis. JG played a role in conception and design of the fusion protein. MP and JG were involved in the conceptualization and design of the study analysis and interpretation of datasets and in writing the manuscript. All authors read and approved the final manuscript. Supplementary Material Additional file 1: Figure S1 scFvMTBHsp70 binds to 40L mesothelioma cells. 40L cells were stained with scFvMTBHsp70 or MTBHsp70 followed by mouse anti-MTBHsp70 and Donkey anti-mouse Alexa Fluor 594. Cells were observed using a Nikon Eclipse TiE fluorescence microscope. A Representative pictures from three independent experiments. Scale bar 10 ?m. B Images were analyzed using the NIS-Elements AR Microscope Imaging Software. Mean Fluorescence Intensity was analyzed using ImageJ. P values were determined using One-Way ANOVA followed by Turkey™s multiple comparison tests. ****p?<?0.0001. Click here for file Additional file 2: Figure S2 scFvMTBHsp70 or MTBHsp70 plus P4 scFv treatment does not lead to infiltration of inflammatory cells into abdominal or intestinal mesothelial tissues. Samples of abdominal wall and intestine were prepared from C57BL/6 mice that had previously received multiple i.p. injections of scFvMTBHsp70 MTBHsp70 plus P4 scFv or saline as described in the Methods section. Sections of these tissues were stained with H&E and images were acquired on a Zeiss Axio A1 microscope. Representative images from 3 animals per treatment group are shown. No detectable level of mononuclear cell or granulocyte infiltrate within mesothelial tissues was seen in any sampled tissues. Scale bar 20 ?m. Click here for file Additional file 3: Figure S3 scFvMTBHsp70 treatment does not affect numbers of tumor-infiltrating CD8+ or Foxp3+ T cells. (A) Representative images of intratumoral CD8+ and Foxp3+ T cells from saline (n?=?3) scFvMTBHsp70 (n?=?3) or MTBHsp70 plus P4 scFv (n?=?3) -treated mice. Mouse spleen sections were used as positive controls: CD8+ and Foxp3+ T cells are clearly evident in the sections. Scale bar 20 ?m. (B) Numbers of CD8+ and Foxp3+ cells were quantified from 3“5 randomized fields. Click here for file Additional file 4: Figure S4 Validation of in vivo depletion of CD8+ cells in FVB/NJ mice. Mice were injected i.p. with 200 ?g of anti-CD8 mAb or an isotype-matched irrelevant rat IgG2a as described in Methods. All the mice were bled from the tail vein and the depletion of CD8+ cells was examined by flow cytometry analysis of peripheral blood cells stained with fluorophore-conjugated anti-CD8 on days 7 and 28 after tumor inoculation. (A) Representative results of flow analyses on 10 mice per group and reported as the percentage of CD8+ cells in lymphocytes. (B) CD8+ cells in the mice treated with isotype IgG2a or anti-CD8 mAb were compared. ***p< 0.001. Click here for file Acknowledgments This manuscript is dedicated to the memory of Janet Gelfand a victim of ovarian cancer. The authors gratefully acknowledge the continuing support for this work from the Edmund C. Lynch Jr. Cancer Fund Arthur Luxenberg Esq. Perry Weitz Esq. and the VIC Mesothelioma Research and Resource Program at MGH and the Friends of VIC Fund. PU and NHA were supported by the Prof. Dulcie V. Coleman Studentship at Imperial College London. We thank Oliver Mitchell John Cao Lujia Zhou Rumbidzai Mushavi and Sayinthen Vivekanantham for their technical assistances Dr. Yuhui Huang for his useful comments Michael Waring Dr. Michael Santuosuosso and Dr. Ravi Mylvaganam for their technical advice Dr. Musie Ghebremichael for his advice in statistical analysis and Mahnoor Valibhoy for her assistance with the schematic figure. Banchereau J Palucka AK Dendritic cells as therapeutic vaccines against cancer Nature reviews Immunology 2005 5 296 306 10.1038/nri1592 15803149 Mellman I Coukos G Dranoff G Cancer immunotherapy comes of age Nature 2011 480 480 489 10.1038/nature10673 22193102 Topalian SL Weiner GJ Pardoll DM Cancer immunotherapy comes of age J Clin Oncol 2011 29 4828 4836 10.1200/JCO.2011.38.0899 22042955 Kantoff PW Higano CS Shore ND Berger ER Small EJ Penson DF Redfern CH Ferrari AC Dreicer R Sims RB Xu Y Frohlich MW Schellhammer PF IMPACT Study Investigators Sipuleucel-T immunotherapy for castration-resistant prostate cancer The New England journal of medicine 2010 363 411 422 10.1056/NEJMoa1001294 20818862 Chambers JD Neumann PJ Listening to provenge“what a costly cancer treatment says about future medicare policy The New England journal of medicine 2011 364 1687 1689 10.1056/NEJMp1103057 21470004 Chang K Pastan I Molecular cloning of mesothelin a differentiation antigen present on mesothelium mesotheliomas and ovarian cancers Proc Natl Acad Sci USA 1996 93 136 140 10.1073/pnas.93.1.136 8552591 Argani P Iacobuzio-Donahue C Ryu B Rosty C Goggins M Wilentz RE Murugesan SR Leach SD Jaffee E Yeo CJ Cameron JL Kern SE Hruban RH Mesothelin is overexpressed in the vast majority of ductal adenocarcinomas of the pancreas: identification of a new pancreatic cancer marker by serial analysis of gene expression (SAGE) Clinical cancer research: an official journal of the American Association for Cancer Research 2001 7 3862 3868 11751476 Ho M Bera TK Willingham MC Onda M Hassan R FitzGerald D Pastan I Mesothelin expression in human lung cancer Clinical cancer research: an official journal of the American Association for Cancer Research 2007 13 1571 1575 10.1158/1078-0432.CCR-06-2161 17332303 Tang Z Qian M Ho M The role of mesothelin in tumor progression and targeted therapy Anti-cancer agents in medicinal chemistry 2013 13 276 280 10.2174/1871520611313020014 22721387 Hassan R Bullock S Premkumar A Kreitman RJ Kindler H Willingham MC Pastan I Phase I study of SS1P a recombinant anti-mesothelin immunotoxin given as a bolus I.V. infusion to patients with mesothelin-expressing mesothelioma ovarian and pancreatic cancers Clinical cancer research: an official journal of the American Association for Cancer Research 2007 13 5144 5149 10.1158/1078-0432.CCR-07-0869 17785569 Kreitman RJ Hassan R Fitzgerald DJ Pastan I Phase I trial of continuous infusion anti-mesothelin recombinant immunotoxin SS1P Clinical cancer research: an official journal of the American Association for Cancer Research 2009 15 5274 5279 10.1158/1078-0432.CCR-09-0062 19671873 Feldhaus MJ Siegel RW Opresko LK Coleman JR Feldhaus JM Yeung YA Cochran JR Heinzelman P Colby D Swers J Graff C Wiley HS Wittrup KD Flow-cytometric isolation of human antibodies from a nonimmune Saccharomyces cerevisiae surface display library Nature biotechnology 2003 21 163 170 10.1038/nbt785 12536217 Bergan L Gross JA Nevin B Urban N Scholler N Development and in vitro validation of anti-mesothelin biobodies that prevent CA125/Mesothelin-dependent cell attachment Cancer"

Lung_Cancer

"As one of the DNA repair genes ataxia-telangiectasia mutated (ATM) gene which is responsible for the multisystem autoxomal recessive disorder ataxia-telangiectasia (A“T) plays a crucial role in the recognition signaling and repair of DNA damage especially DNA double-strand breaks (DSBs) [4] [5]. The ATM protein is a member of phosphoinositide 3-kinase (PI-3 kinases) and can be activated by DSBs caused by ionizing radiation or reactive oxygen intermediates [6] [7]. Once activated ATM can phosphorylate various downstream substates that function in cell cycle arrest apoptosis and DNA repair such as p53 NBS1 BRCA1 and Chk2 [8] [9]. Therefore genetic variants in ATM gene may lead to the structure and function change of the protein and act as important factors indicating individual susceptibility to cancer. ATM -111G>A (rs189037) resides in the promoter of ATM gene. Increasing studies have shown that variations in the DNA promoter sequence may potentially alter the affinities of multiple regulatory proteins-DNA interactions or the specificity of the transcriptional process [10]“[13]. Although this polymorphism makes no amino acid change the alleles may have different binding affinity to the transcription factor and exhibit different levels of mRNA expression [14] [15]. Zhang et al. [16]declared that ATM rs189037 AA genotype was associated with a lower ATM mRNA levels than GG genotype in lung tissue samples. Their results showed that the G-to-A change might create a transcriptional inhibitor-binding site for ATM rs189037 A allele promoter and subsequently reduce the ATM mRNA expression. Consequently lower expression of ATM might cause elevated sensitivity to ionizing radiation defects in the activation of cell cycle checkpoints a reduced capacity for DNA repair and abnormal apoptosis. All of these features would contribute to increased individual cancer susceptibility. In recent years a number of studies have evaluated the association between this polymorphism and cancer risk such as thyroid carcinoma [17] oral cancer [18] breast cancer [19] leukemia [20] nasopharyngeal carcinoma [21] glioma [22] and lung caner [23]“[25]. Previous studies of ATM rs189037 have included cigarette smokers as cases and controls that made it difficult to judge whether this polymorphism were associated with lung cancer or tobacco use. Considering the facts in China the incidence and death rate of lung cancer in women continues to increase and this phenomenon is frequently occurring in those who have never smoked. In order to have a better control of confounding of gender or smoking we performed a case-control study to identify the association between the polymorphism of ATM rs189037 and the risk of lung cancer in the non-smoking females in Chinese Han population. We also investigated the interaction between genetic polymorphism and environmental exposure in lung cancer. Methods Subjects This hospital-based case-control study included 487 lung cancer patients and 516 cancer-free hospital controls. All subjects were female non-smokers and they were from unrelated ethic Han Chinese. The cases were recruited during January 2002 to November 2012 at Liaoning Cancer Hospital & Institute. All patients were histologically confirmed to have lung cancer before any radiotherapy and chemotherapy. During the same time controls were selected from patients with other lung diseases but free of cancer history and symptom. Controls suffered mainly from bronchitis pneumonias fibrosis sarcoidosis chronic obstructive pulmonary disease and emphysema. Controls were all non-smoking females and frequency-matched to case subjects for age (±5 years). This study was approved by the institutional review board of China Medical University and written informed consent was obtained from each participant or each participant's representatives if direct consent could not be obtained. Data Collection A total of 10 ml of venous blood was collected from each patient. Patients were interviewed to collect information for demographics and environmental exposure at the time they were admitted to hospital. Information concerning demographic characteristics passive smoking cooking oil fume exposure fuel smoke exposure family history of cancer occupational exposure and dietary habit was obtained for each case and control by trained interviewers. An individual was defined as a smoker if she had consumed a total of 100 cigarettes in her lifetime; otherwise she was considered as a non-smoker. About fuel smoke exposure participants who used coal-fuel-burning stoves without chimneys were regarded as fuel smoke exposure. For exposure to cooking oil fumes participants were mainly asked about the method of cooking and eyes or throat irritation. For cooking methods participants were asked whether they cooked food in a stir-frying way and how many times a week; for eyes or throat irritation participants were asked how often they felt eyes or throat irritated by the oily smoke. There were four possible responses ranging from œnever œseldom œsometimes and œfrequently. Subjects were considered as cooking oil fume exposure if they met criteria as follows: (1) have cooked for over 15 years; (2) cooked food in a stir-frying way for more than twice a week; (3) felt eyes or throat irritated by oily smoke. Exposure for cooking oil fume was categorized as an indicator variable equal to 1 if participants reported frequently or sometimes and equal to 0 otherwise. Genotype Analysis Genomic DNA was extracted from peripheral blood samples by the conventional phenol-chloroform extraction method. SNP was genotyped by investigators blinded to case-control status in order to avoid any genotyping bias using TaqMan methodology and read with the Sequence Detection Software on an Applied Biosystems 7500 FAST Real-Time PCR System according to the manufacturer's instructions (Applied Biosystems Foster City CA). Amplification was done under the following conditions: 95°C for 10 min followed by 47 cycles of 92°C for 30 s and 60°C for 1 min. In this study 487 lung cancer patients and 516 controls were all genotyped successfully and 5% duplicated samples were randomly selected to assess the reproducibility for quality control with a concordance rate of 100%. Statistical Analysis The x2 test and t test were applied to estimate differences in demographic variables and distributions of genotypes between cases and controls. The association of genotypes of ATM rs189037 with risk of lung cancer was estimated by computing the odds ratios (ORs) and 95% confidence intervals (CIs) in unconditional logistic regression analysis. The Hardy-Weinberg equilibrium (HWE) was tested using goodness-fit x2 test to compare the genotype frequencies in the control subjects from those expected. A logistic regression model was used to evaluate gene-environment interactions. All data were analyzed with Statistical Product and Service Solutions (SPSS) v13.0 for Windows if not otherwise specified. All statistical analysis were two-sided and the significance level was set at P<0.05. Results Population characteristics A total of 487 lung cancer and 516 age-matched cancer-free controls were enrolled in this study. As shown in the mean ages of cases and controls (mean ±S.D.) were almost identical (56.5±11.7 and 56.3±12.5 respectively). All cases were female non-smoking lung cancer patients. No statistically significant difference was found between cases and controls in terms of age (P?=?0.248) and monthly income (P?=?0.084). Cases included 434 non-small cell lung cancer (NSCLC) patients and 53 small cell carcinoma patients. In the NSCLC cases there were 320 adenocarcinomas 73 squamous cell carcinomas and 41 other tumors with a variety of different pathologies (such as large cell carcinomas mixed cell carcinomas or undifferentiated carcinomas). .0096911.t001 Characteristics of lung cancer cases and controls. Variables Cases(%) Controls(%) P value Female 487 516 Mean age (years) 56.5±11.7 56.3±12.5 0.248a Income (yuan/month) 628.9±419.3 563.5±387.6 0.084a Never smoker 487 516 Histological type NSCLC 434(89.1) Adenocarcinoma 320(65.7) Squamous cell carcinoma 73(15.0) Small cell carcinoma 53(10.9) Other 41(8.4) a Student's t-test was used to compare the frequency distributions of demographic variables between the cases and controls. Association analysis The observed genotype frequencies among the control subjects was in agreement with that expected under the Hardy-Weinberg equilibrium (P?=?0.119). The distribution of ATM rs189037 genotypes among subjects were displayed in Table 2. Using subjects with the ATM rs189037 GG genotype as the reference group we calculated the ORs and 95%CIs for heterozygous carriers of GA genotype and homozygous carriers of AA genotype. No significant difference was observed between lung cancer cases and controls in each test (P>0.05). In order to increase the statistical power we combined the GA genotype with the AA genotype to compare with GG genotype as a dominant model and combined the GA genotype with the GG genotype to compare with AA genotype as a recessive model. The results indicated that individuals with AA genotype had a significantly elevated risk of lung adenocarcinoma compared with those carrying the GG or GA genotype (OR?=?1.44 95%CI 1.02“2.02 P?=?0.039). .0096911.t002 Table 2 Distribution of ATM rs189037 genotypes and ORs for lung cancer cases and controls. Genotype Cases(%) Controls(%) ORc 95%CI P overall (n?=?487) GG 148(30.4) 152(29.5) ref GA 240(49.3) 272(52.7) 0.91 0.68“1.20 0.494 AA 99(20.3) 92(17.8) 1.11 0.77“1.59 0.590 dominant modela 0.96 0.73“1.25 0.742 recessive modelb 1.18 0.86“1.61 0.313 NSCLC (n?=?434) GG 129(29.7) 152(29.5) ref GA 213(49.1) 272(52.7) 0.92 0.68“1.24 0.573 AA 92(21.2) 92(17.8) 1.18 0.81“1.71 0.397 dominant model 0.98 0.74“1.30 0.906 recessive model 1.24 0.90“1.71 0.192 Adenocarcinoma (n?=?320) GG 94(29.4) 152(29.5) ref GA 150(46.9) 272(52.7) 0.89 0.64“1.23 0.485 AA 76(23.7) 92(17.8) 1.33 0.90“1.99 0.156 dominant model 1.00 0.74“1.36 0.987 recessive model 1.44 1.02“2.02 0.039* Squamous cell carcinoma (n?=?73) GG 24(32.9) 152(29.5) ref GA 39(53.4) 272(52.7) 0.90 0.52“1.56 0.706 AA 10(13.7) 92(17.8) 0.69 0.32“1.51 0.355 dominant model 0.85 0.50“1.43 0.537 recessive model 0.74 0.37“1.50 0.400 *P<0.05. a GA+AA vs GG. b AA vs GA+GG. c adjusted for age and data were calculated by unconditional logistic regression. According to the results above we assumed that ATM rs189037 AA genotype might affect lung adenocarcinoma risk among non-smoking Chinese females. To test this hypothesis and explore the gene-environment interaction we adopted all the lung adenocarcinoma patients and cancer-free controls whose information about environmental risk factors were completely obtained such as fuel smoke exposure cooking oil fume exposure passive smoking and family history of cancer. Cases and controls were not included in the association analysis if any item of their environmental risk factors data was incomplete. After screening we had 242 lung adenocarcinoma cases and 277 cancer-free controls that were eligible. Selected demographic variables and environmental risk factors for the cases and controls were listed in Table 3. .0096911.t003 Table 3 Basic demographic data and environmental risk factor in lung adenocarcinoma cases and controls. Variable Cases(%) Controls(%) P value Female 242 277 Mean age (±S.D.) 55.7±11.6 56.6±11.0 0.346a Income(yuan/month) 626.5±384.0 558.1±391.4 0.066a Education Never 26(10.7) 26(9.4) 0.305 Elementary school 111(45.9) 141(50.9) Junior school 76(31.4) 69(24.9) Senior school and upwards 29(12.0) 41(14.8) Fuel smoke exposure 66(27.3) 76(27.4) 0.967b Cooking oil fume exposure 86(35.5) 70(25.3) 0.011b* Family history of cancer 26(10.7) 30(10.8) 0.975b Passive smoking exposure 141(58.3) 158(57.0) 0.778b *P<0.05. a Student's t-test was used to compare the frequency distribution of demographic variables between the cases and controls. b Peason's chi square was used to compare the frequency distribution of demographic variables fuel smoke exposure cooking oil fume exposure family history of cancer passive smoking between the cases and controls. As shown in Table 3 the mean ages of lung adenocarcinoma cases and controls (mean±S.D.) were similar (P>0.05). All cases were female non-smokers. There was no significant difference in the distribution of education fuel smoke exposure family history of cancer and passive smoking status between cases and controls. However the cases were more likely than the controls to report cooking oil fume exposure (P?=?0.011). Table 4 summarized the relationship between ATM rs189037 genotypes and lung adenocarcinoma risk with the stratification analysis of cooking oil fume exposure. The results indicated that in the recessive model (AA vs GA/GG) individuals carrying AA genotype had a 1.69-fold risk of lung adenocarcinoma compared with those carrying GA or AA genotype (95%CI 1.09“2.61 P?=?0.019). Considering the difference in the distribution of cooking oil fume exposure between cases and controls we conducted the stratification analysis. Our data revealed that AA homozygous carriers had an increased risk of lung adenocarcinoma among women who were never or seldom exposed to cooking oil fume (OR?=?1.89 95%CI 1.03“3.49 P?=?0.040). To well-understood the possible interaction between rs189037 polymorphism and cooking oil fumes exposure next we conducted a combined analysis. But there was no significant correlation found between this SNP and cooking oil fumes exposure. .0096911.t004 Table 4 Overall association stratification analysis and combined analysis between ATM rs189037 polymorphism and lung adenocarcinoma risk. Comparison model Genotype ORc 95%CI P value Overall GG ref GA 0.89 0.59“1.35 0.592 AA 1.57 0.93“2.62 0.089 dominant modela 1.05 0.70“1.55 0.825 recessive modelb 1.69 1.09“2.61 0.019* Stratified by cooking oil fuel exposure Yes GG ref GA 0.72 0.34“1.54 0.395 AA 1.19 0.43“3.24 0.740 dominant modela 0.81 0.39“1.68 0.573 recessive modelb 1.48 0.62“3.52 0.381 No GG ref GA 0.94 0.57“1.56 0.811 AA 1.89 1.03“3.49 0.040* dominant modela 1.16 0.72“1.87 0.542 recessive modelb 1.97 1.18“3.29 0.009* Cooking oil fumes exposure-genotype combined analysis non-exposed GG ref non-exposed GA 0.91 0.55“1.50 0.714 non-exposed AA 1.71 0.94“3.09 0.078 exposed GG 1.99 0.96“4.12 0.063 exposed GA 1.58 0.88“2.82 0.127 exposed AA 2.07 0.87“4.93 0.099 *P<0.05. a GA+AA vs GG. b AA vs GA+GG. c the overall test was adjusted for age fuel smoke exposure cooking oil fume exposure family history of cancer and passive smoking and the stratified analysis was adjusted for age fuel smoke exposure family history of cancer and passive smoking. Discussion It is well known that smoking is the most important risk factor for lung cancer but in the past 30years the incidence and death rate of lung cancer continues to increase in women who have a low rate of smoking [26]“[28]. Adenocarcinoma accounts for about 40% of all lung cancer with a higher incidence in women especially in those who have never smoked. Undoubtedly female non-smokers are the ideal subjects to examine unknown yet important environmental and genetic factors of lung adenocarcinoma. Exposure to cooking oil fume fuel smoke passive smoking and occupational exposures have been implicated as possible risk factors among Chinese women mainly based on Chinese people's traditional diet habits lifestyle and social environment [29] [30]. So we designed this study to evaluate the association between genetic variant and environmental risk factors and lung adenocarcinoma in female non-smokers. To date the association between ATM rs189037 and host susceptibility to lung adenocarcinoma in Chinese female non-smokers has not been well addressed. ATM rs189037 was a common polymorphism in the promoter of ATM gene. Studies have shown that this site possibly may regulate ATM protein activity due to regulation function of promoter as shown in most genes. And specific genotypes or haplotypes of ATM may play an important role in carcinogenesis through expression regulation or alternative splicing of the ATM gene [31]. We searched through NCBI (National Center for Biotechnology Information) dbSNP database to get the allele frequency of this polymorphism. The data indicated that the frequency of wild-type allele G was 61.1% and the frequency of variant allele A was 38.9% in Chinese Han population (http://www.ncbi.nlm.nih.gov/SNP/snp_ref.cgi?rs=rs189037). In this study our results was in accordance with the data from NCBI. In 2006 Kim et al.[25] evaluated the role of ATM rs189037 in lung cancer development In Korean population for the first time. No significant association was found between this polymorphism and lung cancer risk (P>0.05). They recruited 616 lung cancer patients in which 78.4% were male and 79.6% were cigarette smokers. As cigarette smoking might modulate the risk of lung cancer in turn it could be a confounder in the association between ATM rs189037 and lung cancer risk. Besides there was no gene-environment interactions be considered in their research. In 2010 Lo et al.[23] suggested that ATM rs189037 was associated with lung cancer risk among never smokers (AA vs GG: OR?=?1.61 95%CI 1.10“2.35) and this association might be modified by passive smoking. Although they have eliminated the cofounding effect of cigarette smoking by conducting their study in non-smokers the risk of lung cancer among different histological types still needed to be clarified. Recently Hsia et al.[24] put their attention on the association of ATM rs189037 with lung cancer susceptibility among ever smokers. No genotype frequency difference was found between lung cancer cases and controls among ever smokers (P>0.05). After summing up the omissions of their studies and combining with the current situation that Chinese non-smoking female lung adenocarcinoma incidence and fatality rate was increasingly rising up we performed this case-control study to elucidate the association between ATM rs189037 and lung adenocarcinoma risk. To the best of our knowledge this is the first study that has investigated whether ATM rs189037 was associated with lung adenocarcinoma risk in non-smoking Han-Chinese females. Our results have shown that individuals with exposure to cooking oil fume had a 1.63-fold increased risk of developing lung adenocarcinoma (P?=?0.011). Similar significant associations were observed in our previous studies of Chinese non-smoking females. Experimental studies have presented that fumes from cooking oils could be genotoxic because of the potential carcinogenic components such as polycyclic aromatic hydrocarbons (PAHs) and benzo[a]pyrene 78-diol 910-epoxide (BPDE) which involved in inducing DNA adducts and thus made a predisposition to lung adenocarcinoma [32]“[34]. Besides the method of cooking and throat or eyes irritation the interviewers also asked each woman the information on cooking oil fumes exposure such as the types of cooking oils she used the frequency she used stir frying or deep frying to prepare food ventilation conditions and the use of a fume extractor. Increasing epidemiological studies have reported cooking method and types of cooking oils on lung cancer susceptibility among Chinese females. Seow et al.[35]found that women who reported that they stir fried daily had a significantly increased risk of lung cancer (OR?=?2.0 95%CI 1.0“3.8) and risk was enhanced for those who stir fried meat daily (OR?=?2.7 95%CI 1.3“5.5). The elevated lung cancer risk might be attributed to heterocyclic amines generated during frying of meats. In addition the frequency of stir frying seemed to be related with lung cancer susceptibility. Gao et al. [36]investigated the association between the frequency of stir frying and lung cancer risk in Chinese females they observed that stir frying more than 30 dishes per week was associated with high risk of lung cancer (OR?=?2.6 95%CI 1.3“5.0). In a case-control study in northeast China Wu-Williams et al.[37] found that women who deep fried twice per month had a 2.1-fold increased risk of developing lung cancer than those who never used deep frying method. And there was a significant trend in risk with increasing number of meals cooked by deep frying. Also this kind of correlation was found in both non-smokers and lung adenocarcinoma population. For types of cooking oils Zhong et al.[38] reported that soybean oil was most commonly used in Shanghai and the use of rapeseed oil was associated with a higher risk of lung cancer (OR?=?1.84 95%CI 1.12“3.03). In this study we observed that ATM rs189037 AA genotype carriers were more susceptible to lung adenocarcinoma than GA or GG genotype carriers in a recessive model. This might not give direct support for AA genotype as a risk factor for lung adenocarcinoma. But the results reflected that G allele might be a protective factor for lung adenocarcinoma. So we compared AA genotype with GA genotype and our data showed that women who were AA genotype carriers had an elevated risk of lung adenocarcinoma (OR?=?1.74 95%CI 1.10“2.74 P?=?0.018). In other words GA genotype might be protective for developing lung adenocarcinoma. In the stratified analysis of cooking oil fumes exposure we also found that AA genotype carriers had a predisposition to lung adenocarcinoma in women who had no exposure of cooking oil fumes (OR?=?1.89 95%CI 1.03“3.49). Considering that G allele might be a protective factor for lung adenocarcinoma we then compared AA genotype with GA genotype to further validate our previous results. And it turned out that in the non-exposed group women who were AA genotype carriers had a higher risk of lung adenocarcinoma than those GA genotype carriers (OR?=?1.98 95%CI 1.15“3.40 P?=?0.014) which was in accordance with our previous data that G allele might be a protective factor for lung adenocarcinoma. But in the combined analysis of interaction of cooking oil fumes exposure and rs189037 polymorphism no significant association was found. We have described the distribution of any possible factors such as age passive smoking status fuel smoke exposure family history of cancer between cooking oil fumes exposed group and non-exposed group that might affect the association but none of these seemed to be different between exposed group and non-exposed group (Table 5). As tumor is a multifactorial disease we could infer that there might be other risk factors playing a role in the development of lung adenocarcinoma. We tended to believe that there might be other host genetic susceptibility or unknown risk factors caused the results. .0096911.t005 Table 5 Comparisons of distribution of risk factors between cooking oil fumes exposed group and non-exposed group. Variable Exposed(%) Non-exposed(%) P value Mean age (±S.D.) 56.3±11.7 56.1±11.1 0.871a Fuel smoke exposure 44(28.2%) 98(27.0%) 0.777b Passive smoking exposure 96(61.5%) 203(55.9%) 0.235b Family history of cancer 19(12.2%) 37(10.2%) 0.504b a Student's t-test was used to compare the frequency distribution of demographic variables between the exposed group and non-exposed group. b Peason's chi square was used to compare the frequency distribution of demographic variables fuel smoke exposure family history of cancer passive smoking between the exposed group and non-exposed group. There are several limitations in the current study. First hospital-based studies are likely to include some controls with non-malignant lung diseases especially those associated with chronic inflammatory processes are suspected to have predisposing factors for lung cancer. "

Lung_Cancer

"The greater than 2-fold increase in affinity is indicative of multivalent binding of the peptide to the cell surface and not merely an increase in the number of peptide units. Attachment of the peptides to the CB-TE2A chelator does not affect the affinity of the peptide compared to the parental dimer of H2009.1-10mer. Interestingly the two divalent conjugates H2-(M10)2 and H2-D10 have the same affinity for H2009 cells. Thus displaying the peptide off a lysine core or the divalent CB-TE2A core does not significantly affect the specific cell binding. Of note CB-TE2A conjugates of the A20FMDV peptide have also been reported 48. However in the modification one of the carboxylate groups was consumed for the peptide conjugation which might compromise the stability of the Cu(II) complex moiety. In addition it adds an extra positive charge to the peptide conjugate when labeled with 64Cu which might contribute to the high kidney uptake. In contrast all our peptide conjugates maintain an intact CB-TE2A core to form the neutral Cu(II)-CB-TE2A complex with non-compromised stability. Towards the goal of utilizing the multivalent effect for ?v?6-integrin PET imaging we conducted non-invasive imaging evaluation studies in two SCID mouse models bearing H2009 (?v?6+) and H460 (?v?6-) tumors. The H2009 (?v?6+) tumor was clearly visualized by all four probes monovalent (64Cu-M10) and divalent (64Cu-(M10)2 64Cu-D10 and 64Cu-AcD10) at 1 h p.i. In contrast much lower tumor uptake was observed for all the probes in H460 (?v?6-) tumor while their distribution profiles in the other tissue were almost identical to those observed in the H2009 tumor-bearing mice. This result demonstrates the ?v?6 binding specificity of the H2009.1-10mer peptide. However though the H2009 tumor was visualized by 64Cu-M10 at 1 h p.i. its imaging contrast became barely visible at 4 and 24 h p.i. The low tumor contrast of 64Cu-M10 is likely caused by its suboptimal in vivo kinetics receptor binding and stability. These drawbacks can be potentially resolved or mitigated by multimeric presentation of the peptide on a scaffold. Indeed the divalent probes (64Cu-(M10)2 64Cu-D10 and 64Cu-AcD10) showed an approximate 3-fold tumor uptake increase as compared to 64Cu-M10 which clearly demonstrates the role of the multivalent effect in imaging signal amplification. In addition the tumor PET signal retention of the three divalent probes stayed above 0.70 %ID/g even at 24 h p.i. While the increased affinity of the dimeric probes contributes to the increased tumor accumulation increased stability and improved in vivo kinetics are likely to play a role as well. Interestingly no significant tumor uptake difference was observed for the three divalent probes out to 24 h p.i. indicating the two multivalent presentation approaches afforded virtually the same result. While this observation was somewhat to our surprise it may result from the flexible PEG spacer that has been incorporated into our probe design which provides no spatial constraints to the ligand-receptor binding. All three divalent probes showed a similar biodistribution profile in the H2009 and H460 tumor models with elevated uptake (< 3 fold) in major ans other than kidneys as compared to the monovalent one. This is likely caused by the molecular weight induced difference of in vivo kinetics. Although we observe relatively high tumor uptake compared to background accumulation in the mediastinum region we recognize the need to further increase accumulation of radiolabel in the tumor. Improved tumor uptake is anticipated to increase sensitivity of detection. One advantage of our bifunctional chelator design is that we can layer the valency moving rapidly from monomeric to octomeric peptides. As the valency increases we anticipate an increase in affinity for ?v?6 and improved in vivo kinetics 30. Additionally the design allows for facile PEGylation of both the peptide ligand and the chelator which may improve tumor uptake by increasing circulation time of the probe 49. Defined length PEG linkers are available allowing for controlled empirical testing. Rapid kidney uptake and efficient clearance is a desired feature of targeted PET imaging probes. However high kidney uptake is unwanted even for lung cancer imaging because it renders the kidneys to unnecessary radiation exposure. Given the high kidney uptake and retention observed for both 64Cu-(M10)2 and 64Cu-D10 ( ) they may not find practical applications in PET imaging of ?v?6-integrin. By immunocytochemical staining we found negligible expression of ?v?6 integrin in the kidneys of H2009 tumor bearing mice (data not shown) indicating the non-specific nature of the observed high kidney accumulation. Further as shown in the PET imaging results of 64Cu-CB-TE2A-(c(RGDyK))2 in both H2009 and H460 tumor models the CB-TE2A-based construct is not the culprit of the high kidney uptake. Therefore we reasoned that the high kidney uptake and retention resulted from the peptide itself. Two factors may play an important role - the peptide's stability and charge in vivo. As such we introduced an acetyl group to cap the N-terminus of the H2D10 conjugate which led to H2AcD10. The acetylation reduces the overall charge from +4 (H2D10) to +2 (H2AcD10) while limiting proteolysis of the peptide by N-terminal peptidases 36. As anticipated 64Cu-AcD10 showed a drastic decrease in kidney uptake and retention and the level of tumor uptake was maintained compared to its non-acetylated counterpart 64Cu-D10 (). In addition a significant uptake reduction was also observed in other non-target ans including lung and liver. The improved tumor-to-lung contrast is of great importance to the imaging detection of NSCLCs. "

Lung_Cancer

"The time-varying exposure profiles for ns subjects are represented as series of occurrences xt at time t = 1 ¦100 generated by random exposure events with an intensity in the range 0“10. The exposure“lag“response associations are defined by the function fs(x) · ws(?) in (4) which is simpler to simulate if compared with the truly bivariate alternative in (5) for each value of exposure x and lag ?. Different scenarios explore alternative choices for the exposure“response function fs(x) and the lag“response function ws(?). These are obtained by simple mathematical functions involving logarithms or exponentials. Specifically fs(x) is specified as linear plateau and exponential while ws(?) as constant decay and peak (see Figure S7 in the supporting information). Three scenarios out of the nine possible combinations are shown in the top panels of the others in Figure S8 (supporting information). Results of the simulation study for three scenarios of exposure“lag“response associations (linear-constant plateau-decay and exponential-peak in each column). The graphs illustrate the true simulated 3-D exposure“lag“response association (first row) and the lag“response (second“third rows) and exposure“response curves (fourth“fifth rows) from AIC and BIC-selected models corresponding to the bold lines in the 3-D plots. These last panels compare the true simulated associations with the average of the estimated associations together with a sample of estimated curves corresponding to the first 25 simulations (in grey). Results from m = 500 simulated data sets with ns = 400 subjects. Time-to-event data are simulated conditional on the cumulative contribution of the simulated exposure using a permutational algorithm previously proposed for time-varying exposures 29. The cumulative effect is calculated in the form of a function defined in (4) given the exposure history of each subject at time t over a lag period 0“L with L = 40. Censoring events are included and represent approximately 25% of the total. For each of the nine scenarios m = 500 data sets are simulated with a number of subjects ns equal to 200400 or 800. 4.2. Evaluation of performance For each data set i = 1 ¦500 the exposure“lag“response association is estimated by Cox regression models with a cross-basis as defined in (5)“(7). The Efron method is used for tie handling. Similarly to the example in the exposure“response function fe(x) is specified as a simple linear term or quadratic B-splines with 01 or 2 knots placed at 3.35 or 6.7. The lag“response function we(?) is specified as a simple constant term with 1 df or quadratic B-splines with intercept and 01 or 2 knots placed at 13.320 or 26.7 lags. The total number of df for the cross-basis function se(xt) ranges from 1 — 1 = 1 to 4 — 5 = 20 in the 36 models. For each simulated data set the best-fitting models are selected as those minimizing AIC and BIC in (12) respectively. Performance is formally evaluated using a synthetic risk summary ?c from (10) corresponding to an overall cumulative effect and then visually assessed on the whole exposure“lag“response association. The formal evaluation consists in the computation of different ?ci at each ith iteration given an exposure history qhi evaluated at a random time t between 41 and 100 for a random individual among the ns subjects. Indices of relative bias coverage and relative RMSE are derived from the following: (13) where I is an indicator function and ?? 1(1 ? ?) is the quantile function of the cumulative normal distribution related to probability 1 ? ? with ? = 0.05. The effect summary ?ci corresponds to the true effect from while is estimated from the best fitting model selected by AIC and BIC by using given the specific exposure history qhi of the random subject at the random time. This approach assures that the performance indicators in (13) are evaluated on the whole range of simulated exposure histories and do not depend on a specific choice. A visual inspection of performance is also provided by computing from the best-fitting models the grid of risk contributions defined in (9) composing the exposure“lag“response surface. Bias is then assessed across the surface by comparing the average fit of the the m = 500 models with the true exposure“lag“response relationship. A bidimensional display of coverage is also provided for each scenario. The performance of the AIC and BIC are also evaluated through their empirical rejection rate for the hypotheses of linearity or constant effect namely the proportion of times the selection procedure favors a model with a non-linear term for fe(x) and a non-constant term for we(?). When H0 is true namely fs(x) = x or ws(?) = c the rejection rate is an estimate of the probability of error of the selection criteria which wrongly select unnecessarily complex models. When H0 is false namely fs(x) ? x or ws(?) ? c the rejection rate is an estimate of the power of the selection criteria for identifying non-linearity and constant lag structures. In a formal hypothesis testing setting these measures would be interpreted as the type I error and the power of the test. 4.3. Results of the simulation study The results of simulations under the nine scenarios with ns = 400 producing approximately 300 uncensored events are summarized in tables in graphs. Table IV reports the formal evaluation of performance on the synthetic risk summary ?c in terms of relative bias coverage and relative RMSE. A visual assessment for three scenarios is provided in each column of the multi-panel . The true simulated exposure“lag response associations are displayed in the top panels while the other panels offer a comparison of the true lag“response and exposure“response curves at specific values with the average of the estimates from AIC and BIC-selected models together with a sample of 25 individual curves. Table IV Synthetic indices of relative bias coverage and relative root mean square error (RSME) for the nine scenarios of exposure“lag“response associations. Results from m = 500 simulated data sets with ns = 400 subjects Bias Coverage RMSE f(x) ? w(?) AIC BIC AIC BIC AIC BIC Linear-constant 0.01 0.01 0.91 0.94 0.07 0.04 Linear-decay 0.00 0.00 0.93 0.94 0.07 0.05 Linear-peak 0.01 0.01 0.92 0.90 0.08 0.07 Plateau-constant 0.06 0.13 0.84 0.72 0.08 0.09 Plateau-decay 0.04 0.14 0.90 0.74 0.09 0.13 Plateau-peak 0.07 0.21 0.87 0.62 0.11 0.18 Exponential-constant 0.01 0.03 0.90 0.80 0.09 0.09 Exponential-decay 0.05 0.04 0.93 0.87 0.12 0.13 Exponential-peak 0.00 0.17 0.91 0.75 0.12 0.17 Generally AIC-selected models offer a better performance with a lower relative bias and a coverage of confidence intervals closer to the 95% nominal value. The values of relative RMSE suggest that the higher variability of AIC-based estimators is often balanced by the higher bias affecting BIC. At least part of the bias can be attributed to lack of fit due to the insufficient flexibility of quadratic spline functions when used to fit logarithmic or exponential shapes. This phenomenon appears quite relevant for the plateau-type exposure response characterized by the highest relative bias in the order of 4“7% for AIC but up to 21% for BIC (see Table IV and second column). This pattern is confirmed by the results in Table V showing the average df in each dimension and the empirical rejection rates for the hypotheses of linearity and constant risk. The AIC selection is affected by moderate overfitting sometimes suggesting flexible models in scenarios of linear and/or constant risk. In contrast BIC shows severe underfitting often selecting simple models for complex exposure“lag“response associations in particular regarding linearity. Table V Average df in each dimension for the best fitting models selected through AIC and BIC (left part) and empirical rejection rate for the AIC and BIC-based selection for the hypotheses of linearity and constant risk (right part) for the nine scenarios of exposure“lag“response associations. Results from m = 500 simulated data sets with ns = 400 subjects Average df Empirical rejection rate f(x) w(?) H0 : f(x) = x H0 : w(?) = c f(x) ? w(?) AIC BIC AIC BIC AIC BIC AIC BIC Linear-constant 1.50 1.03 1.57 1.02 0.29* 0.03* 0.23* 0.01* Linear-decay 1.26 1.00 3.60 3.17 0.18* 0.00* 1.00 1.00 Linear-peak 1.22 1.00 4.02 3.72 0.15* 0.00* 1.00 0.98 Plateau-constant 2.26 1.54 1.47 1.00 0.82 0.47 0.19* 0.00* Plateau-decay 2.53 1.55 3.49 3.10 0.97 0.54 1.00 1.00 Plateau-peak 2.18 1.21 4.01 3.56 0.85 0.19 1.00 0.93 Exponential-onstant 2.20 1.56 1.43 1.00 0.83 0.52 0.16* 0.00* Exponential-decay 2.36 1.81 3.58 3.12 0.99 0.80 1.00 1.00 Exponential-peak 2.15 1.29 4.05 3.69 0.90 0.27 1.00 0.93 * H0 is true The undercoverage of confidence intervals as shown in Table IV can be attributed to both lack of fit and a posteriori model selection. The latter as discussed in Section 2.5 may generate undercoverage through the underestimation of the true sampling (co)variance. A comparison of the importance of the two sources can be provided by the assessment of undercoverage in the first scenario where linear and constant functions are actually among the options of the selection procedure and the underlying simulated association can be potentially recovered with no lack of fit. In this scenario AIC-selected models affected by overfitting show a coverage of 91% very close to the nominal value as illustrated in Table IV. The under-coverage seems to be proportional to the bias as confirmed by Figure 6 with a lower coverage corresponding to sections of the bidimensional space characterized by worse fit. Figure 6 Empirical coverage across the risk surfaces for three scenarios of exposure“lag“response associations (linear-constant plateau-decay and exponential-peak in each column). Results from m = 500 simulated data sets with ns = 400 subjects. The simulated examples with ns = 200 and ns = 800 generate approximately 150 and 600 uncensored events respectively. The versions of Tables IV“V and for these examples are reported in Tables S2“S5 and Figures S9“S10 of the supporting information. The comparison suggests that varying the sample size does not dramatically affect the performance of the AIC-based test apart from the expected different power in identifying nonlinear and noncostant exposure“time“response associations. Consistently AIC-based selection seems to perform well across the range of number of subjects included in the analysis with a small bias and reasonable coverage. The results of this simulation study are consistent with previous findings on one-dimensional models for exposure“lag“response associations assuming a linear exposure“response relationship 18. 5. Discussion In this contribution I illustrate a statistical framework for modeling temporal dependencies with time-varying exposures defined here as exposure“lag“response associations. The approach is based on the extension of distributed lag non-linear models a modeling class previously proposed in time series analysis 2324. The extended DLNM methodology brings together and extends previous methodological developments on the topic as summarized in. Briefly it provides a unified framework for different study designs and regression methods and is applicable to time series cross-sectional case-control survival and longitudinal data. A major advantage is the possibility to describe the lag structure of either linear or nonlinear exposure“response relationships through the choice of two functions that define the association along the dimensions of the predictor and lags including most of the previous approaches as special cases. The example in illustrates how such flexibility is important for obtaining correct estimates of the association. Model specification easily accounts for previous knowledge on the association and incorporates assumptions on the phenomenon to be investigated through the choice of specific functions lag period and constraints. Interpretation of complex exposure“lag“response associations is aided by the definition of simple summary measures of effect and prediction and by graphical representation. The modeling framework is defined through a neat and compact algebraic representation including the derivation of measures of uncertainty such as standard errors and confidence intervals. Estimation is carried out with standard regression models which do not require specialized optimization procedures and may include terms for multiple exposure“lag“response dependencies as shown for radon and smoking here. The parameterization prediction and graphical representation are carried out with few general functions implemented in a freely available and documented software as discussed in. A key issue of the DLNM methodology is about selecting the appropriate model among different options for modeling the bidimensional exposure“lag“response relationship. The simulation study in indicates that AIC-based selection performs reasonably well over a range of 150“600 uncensored events while the strong penalty of BIC induces the selection of models too simple to recover the underlying dependency."

Lung_Cancer

"was connected to the scFv at its C-terminal using an overlap PCR approach. The PCR product scFv-linker was subcloned into pQE30-MTBhsp70 at the N-terminal of MTBhsp70. The DNA fragment for scFvMTBhsp70 was PCR amplified and cloned into pPMY5 (Promab) downstream of a human IgG1 Fc domain and separated from the Fc region by the signal cleavage sequence for Tobacco Etch Virus protease (TEV enzyme). scFvMTBHsp70 the MSLN-targeted fusion protein was generated from HEK293 cells and purified using Protein G resin (Pierce). The Fc region of the Protein G eluted protein was then cleaved from the fusion protein by TEV enzyme (Promab) digestion. MTBHsp70 was generated using the same expression system. The production and purification of these two proteins was accomplished by Promab Biotechnologies Inc. at Richmond CA. After purification and hIgG-Fc tag removal the integrity of scFv-MTBHsp70 and MTBHsp70 were determined by SDS-PAGE followed by staining with RAPIDstain (G-Bioscience). Endotoxin contamination levels in scFvMTBHsp70 and MTBHsp70 were determined by Limulus Amebocyte Lysate Assay (LAL-assay Cambrex). Cells The BR5FVB1 ovarian cancer cells a kind gift from Dr. Orsulic in Women™s Cancer Research Institute at Cedars-Sinai Medical Center [41] or 40L mesothelioma cells a kind gift from Dr. Kane in Department of Pathology and Laboratory Medicine at Brown University [42] were maintained at 37°C in DMEM with 2 mmol/L L-glutamine 10 units/ml penicillin 10 ?g/ml streptomycin and 10% fetal bovine serum in humidified atmosphere with 5% CO2. Cells were cultured until 80% confluent and harvested with enzyme-free cell-dissociation buffer (Gibco) for in vitro tumor cell binding assays and cross-presentation studies or harvested with Trypsin EDTA (Mediatech) for animal injections. Mouse PBLs were obtained from FVB mice via tail vein bleeds after lysis of erythrocytes using M-lyse buffer (R&D systems). Small pieces of parietal peritoneal membrane were taken from the mice and digested in enzyme-free cell-dissociation buffer to obtain mouse peritoneal mesothelial cells. To test whether scFvMTBHsp70 or MTBHsp70 binds to the MSLN-expressing tumor cells or non-cancerous cells we incubated BR5FVB1 ovarian tumor cells 40L mesothelioma cells or normal cells from FVB mice including PBLs splenocytes and peritoneal mesothelial cells with 40 ?g/ml scFvMTBHsp70 or 26 ?g/ml MTBHsp70 followed by anti-MTBHsp70 (IgG2a) (Biodesign International) biotinylated anti-IgG2a (BD Bioscience) and Streptavidin-APC (BioLegend) and then analyzed the tumor cells by flow cytometry. As controls cells were incubated with the reagents described above except scFvMTBHsp70 or MTBHsp70. To confirm that scFv portion of the fusion protein binds to MSLN on the surface of tumor cells scFvMTBHsp70 or MTBHsp70 was preincubated with 12 ?g/ml of recombinant human MSLN (R&D Systems) for 30 min before adding to the cells. For fluorescence microscopy cells were cultured on coverslips until 50% confluent stained with 10 ?g/ml scFvMTBHsp70 or 6.5 ?g/ml MTBHsp70 followed by mouse anti-MTBHsp70 (1:500 dilution) and Donkey anti-mouse Alexa Fluor 594 (Invitrogen 1:500 dilution). Cells were observed using a Nikon Eclipse TiE fluorescence microscope. In some experiments tumor cells were treated with 20 ?g/ml mitomycin C at a concentration of 5 — 106/ml for 1 h in a 37°C water bath and washed with complete medium at least 3 times before use. Animal models and tumor treatment Ovarian cancer was established by i.p. injection of syngeneic cancer cells BR5FVB1 (107 cells per mouse) into 6-week-old female FVB/NJ mice as previously described [25]. All mice were purchased from Jackson laboratories. Intraperitoneal mesotheliomas were established by i.p. injection of syngeneic 40L cells (2?—?106 per mouse) into 6-week-old male C57BL/6 mice as previously described [42]. Mice with ovarian tumors were treated 7 days after BR5FVB1 tumor cell inoculation with i.p. injections of scFvMTBHsp70 (2 ?g per mouse) normal saline or an equimolar mixture of MTBHsp70 plus P4 scFv. This was followed by 3 further treatments at 4-day intervals. In the mesothelioma model C57BL/6 mice were treated 5 days after 40L tumor cell inoculation and injected i.p. with scFvMTBHsp70 (2 ?g per mouse) normal saline or an equimolar mixture of MTBHsp70 plus P4 scFv. Three subsequent doses were administered at 3-day intervals thereafter. For survival studies we observed the mice daily 3 weeks after inoculation of BR5FVB1 cells or 1 week after inoculation of 40L cells. Tumor generations were consistently first evident via abdominal distension secondary to malignant ascites and tumor-bearing mice were euthanized at the endpoint when there were signs of distress including fur ruffling rapid respiratory rate hunched posture reduced activity and progressive ascites formation as previously described [25]. For the investigation of anti-tumor T-cell responses all ovarian tumor-bearing mice were sacrificed 7 days after the final scheduled treatment. All studies were performed in a manner that was blinded to the observer under protocols that were approved by the Massachusetts General Hospital Subcommittee on Research Animal Care (SRAC). Treatment of na¯ve mice with experimental or control protein 6-week-old male C57BL/6 mice were injected i.p. with scFvMTBHsp70 (2 ?g per mouse) normal saline or an equimolar mixture of MTBHsp70 plus P4 scFv. Three subsequent doses were administered at 3-day intervals thereafter. Seven days post the administration of the final treatment mice were sacrificed and abdominal wall and intestine were retrieved for histopathological studies of mesothelial tissues. Ex vivo assessment of tumor specific T-cell functions Single cell suspensions were prepared from spleens. Cells were plated in round-bottomed 96-well plates pulsed with a validated CD8+ T-cell Her2/neu peptide (PDSLRDLSVF 1 ?g/ml; EZBiolab) [2543] an in-house designed H2d-restricted MSLN Ld1 peptide (IPLSYLCDF 1 ?g/ml; EZBiolab) that did not induce ovarian cancer specific T-cell response in H-2q FVB mice or medium alone for 72 hours when Golgi Plug (BD Bioscience) was added for the last 5 hours as previously described [44] and then stained with fluorophore-conjugated anti-CD3 anti-CD4 anti-CD8 anti-IFN? (BD Pharmingen) and anti-Granzyme B (eBioscience) antibodies. Cells were then analyzed on a LSRII 4 laser (BD Biosciences). Depletion of CD8+ T cells in vivo FVB/NJ mice were injected i.p. with 200 ?g of anti-CD8 monoclonal antibody (mAb)(53“6.72 Bio X Cell) or an isotype-matched irrelevant rat IgG2a (2A3 Bio X Cell) 2 days before 1 day before and 1 day after i.p. inoculation with BR5FVB1 ovarian tumor cells. Depletion was continued once every week until 29 days after tumor inoculation. The mice were treated with scFvMTBHsp70 or saline as described above. All the mice were bled from the tail vein and the depletion of CD8+ cells was examined by flow cytometry analysis of peripheral blood cells stained with fluorophore-conjugated anti-CD8 on days 7 and 28 after tumor inoculation. Generation and purification of bone marrow-derived DCs (BMDCs) CD11c+ DCs were generated from bone marrow cells of FVB/NJ mice as described [45-47] with minor modifications. Briefly erythrocyte-depleted mouse bone marrow cells from flushed marrow cavities were cultured in complete RPMI 1640 with 10 ng/ml GM-CSF and 1 ng/ml IL-4 at 1 — 106 cells/ml. Medium was changed on day 3. On day 7 DCs were harvested by gentle pipetting and purified with magnetic microbeads conjugated to a monoclonal antibody against CD11c (MiltenyiBiotec) as described [4648] according to the manufacturer™s recommended protocol. In vitro activation of BMDCs CD11c+ BMDCs were plated in a 24-well plate at a density of 2?—?106 cells/ml and incubated with 2 ?g/ml scFvMTBHsp70 (105 kDa) 1.3 ?g/ml MTBHsp70 (70 kDa) 1 ?g/ml LPS equivalent to 103 EU/ml endotoxin (InvivoGen San Diego CA) or 0.1 ng/ml (0.1 EU/ml) LPS equivalent to endotoxin found in 2 ?g/ml of proteins (since LPS level is less than 50 EU per mg of protein) for 24 h at 37°C in humidified atmosphere with 5% CO2. Cells were then placed on ice collected by vigorous pipetting washed and stained with the following fluorophore-conjugated antibodies: anti-CD11c and anti-CD40 (eBioscience) anti-CD80 (BD Horizon) anti-CD86 and anti-MHC class II (I-Aq) (BD Pharmingen). Afterwards the cells were analyzed on an LSRII 4 laser (BD Biosciences). In vitro tumor antigen presentation assay BR5FVB1 cells were harvested and treated with mitomycin C and plated in a 96-well round-bottomed plate with 20 ?g/ml scFvMTBHsp70 or 13 ?g/ml MTBHsp70. After pre-incubation at 4°C for 1 h CD11c+ BMDCs (ratio of tumor cells: DCs = 3: 1) were added to the wells and the plate was incubated at 37°C for 24 h. For generation of BR5FVB1 cell-primed T cells we inoculated FVB/NJ mice by i.p. injection with 107mitomycin C-treated BR5FVB1 cells and sacrificed the mice 60 days after the immunization according to the approved animal protocol. Splenocytes were then harvested and T cells were isolated using the Pan T-Cell Isolation Kit II (MiltenyiBiotec). BR5FVB1 cell-primed T cells were then added to the wells at a DC/T-cell ratio of 1:20. After a 24-hour co-culture of BR5FVB1 cell-pulsed DCs with BR5FVB1 cell-primed T cells the cells were harvested washed and resuspended in PBS with 5% FBS stained for CD3 CD4 CD8 and IFN? and analyzed on a LSRII 4 laser (BD Biosciences). In vivo immunization with mitomycin C-treated ovarian tumor cells BR5FVB1 ovarian tumor cells were harvested with enzyme-free cell-dissociation buffer and treated with mitomycin C as described above. Cells were then pre-incubated with scFvMTBHsp70 (10 ?g/106 cells) MTBHsp70 (6.5 ?g/106 cells) or PBS alone at 4°C for 1 h. 6-week-old FVB mice were shaved and depilated on both left and right flanks and then injected i.d. with 50 ?l of PBS or 1?—?106 tumor cells in 50 ?l of PBS with or without a pre-incubation with scFvMTBHsp70 or MTBHsp70 at both flanks. Histopathology Abdominal walls and intestines from mice were fixed for at least 24 h in PBS-buffered 10% formalin. Tissues were routinely embedded in paraffin. 5 ?m thick sections were stained routinely with H&E. For staining tumor-infiltrating T cells mice were perfused with 4% paraformaldehyde (PFA) in PBS and tumor nodules were fixed in 4% PFA/PBS for additional 2 hours washed and infiltrated with 30% sucrose/PBS at 4°C. 6 ?m thick frozen sections were stained with rat anti-mouse CD8 (BD Biosciences 1:100 dilution) or rat anti-mouse Foxp3 (eBioscience 1:12 dilution) followed by polyclonal rabbit anti-rat immunoglobulin/HRP (Dako 1:750 dilution). Signal was developed with diaminobenzidine (DAB Dako). Images were acquired on a Zeiss Axio A1 microscope. All histopathological and immunohistochemical samples were reviewed and the quantitation of the cellular infiltrate was performed in a blinded manner to the observer. Statistical analysis Statistical differences between three or more experimental groups were analyzed using One-Way ANOVA followed by Turkey™s multiple comparison tests when mean of each group is compared with that of every other group or followed by Dunnett™s multiple comparison tests when mean of each group is compared with that of a control group. Statistical differences between two experimental groups were analyzed using Student™s t-test. Survival was analyzed with the Log-rank test. Prism 6.0 software (GraphPad Software) was used for all the statistical analysis. Abbreviations DC: Dendritic cell; scFv: Single-chain antibody variable fragment; MSLN: "

Lung_Cancer

" in Japanese families [19]. A FTSJ2 locus in the genome gene amplification and mRNA over-expression were discovered in several non-small cell lung cancer (NSCLC) tissue samples [20] and FTSJ3 was revealed to function in pre-rRNA processing [21] [22]. However little is known about these three homologs in mammals. Thus in this study we used E. coli RrmJ as a starting point to construct a phylogenetic tree containing several typological species and mammals which showed that FTSJ2 is an ortholog of RrmJ. Based on the highly conserved FTSJ2 protein sequences within mammals we established the basic characteristics of FTSJ2 and its gene expression during the heat shock response in different porcine tissues and human cancer cells. Because previous studies have shown the abnormal expression of FTSJ2 in NSCLC we further investigated the functions of FTSJ2 in cell invasion and migration using human lung adenocarcinoma and rhabdomyosarcoma cell lines. Materials and Methods Phylogenetic Analysis of the E. coli RrmJ Homologs The RrmJ domain of 39 protein sequences and the three out-group proteins fibrillarin (PDB code: 1FBN) [10] [23] vaccinia VP39 (1AV6) [24] and catechol-O- methyltransferase (1VID) [25] which are structurally and functionally similar to E. coli RrmJ were used for the construction of a phylogenetic tree. The distance matrix was calculated using the JTT model. The minimum evolution (ME) method with 1000 bootstrap replicates was performed using the MEGA5 program (www.megasoftware.net/) [26]. The nodes of the tree with a bootstrapping support of >50% are shown. Database Search for RrmJ Homologs and the Multiple Sequence Alignment BLASTp was used to search the complete protein sequences in the non-redundant (nr) database at the National Center for Biotechnology Information (NCBI) website. Fourteen proteins from humans Methanococcus jannaschii and three invertebrate species were obtained using E. coli RrmJ as a query and an E-value of <3e-08 was defined as the cut-off value. Twenty-two vertebrate proteins were found using human FTSJ1 FTSJ2 and FTSJ3 as the queries and a 50% amino acid identity was defined as the cut-off value in this search. The putative RrmJ domains of the 38 protein sequences were aligned with that of E. coli RrmJ using ClustalW and were slightly adjusted according to their predicted secondary structures which were calculated using the PORTER query (distill.ucd.ie/porter/) [27]. The Animals and the Heat Stress Treatment Twelve three-month-old female Landrace—Yorkshire crossbred (LYC) piglets were purchased from the Animal Industry Division of the Livestock Research Institute of the Council of Agriculture (COA) (Tainan Taiwan). The procedures used in this study were approved by the Institutional Animal Care and Use Committee (IACUC) of the COA Livestock Research Institute (Approval No. 98021). The piglets (n?=?4) were raised at 25°C and 60% humidity in animal houses which were equipped for temperature and humidity control [28] [29]. For the heat stress treatment the piglets that were raised at room temperature (25°C) were exposed to heat shock temperatures of 30°C or 35°C and maintained at 60% humidity for 1 week. The piglets were then sacrificed and tissue samples from 11 ans were isolated for total RNA extraction. Cell Culture The cancer cell lines of HepaG2 (ATCC No. HB-8065) TE671 (ATCC No. CCL-136) and A549 (ATCC No. CCL-185) were purchased from American Type Culture Collection (ATCC; Manassas VA USA). The lung adenocarcinoma CL1 sublines CL1-0 and CL1-5 were kindly provided by Dr. Jeremy J.W. Chen National Chung Hsing University Taichung Taiwan [30]. All of the cell lines were grown in Dulbecco™s Modified Eagle™s Medium (DMEM; Invitrogen Corp. Grand Island NY USA) containing high glucose (4500 mg/L) and supplemented with 10% fetal bovine serum (FBS) at 37°C and 5% CO2. At 80% confluence the cells were subcultured at a ratio of 1?3 to 1?5 and the medium was changed every three days as described previously [31] [32]. Heat Shock Treatment of the Cells In our heat shock response analysis the cancer cells that grew at 37°C and 5% CO2 were subjected to heat shock at 42°C or 45°C and 5% CO2 for 1 hour. After this heat shock treatment the cells were transferred to 37°C for 0 3 or 6 hours and then harvested for total RNA extraction. Cell Transfection via Electroporation The 6.74-kb pCMV-hFTSJ2-IRES2-DsRed plasmid was constructed by inserting the full-length human FTSJ2 (hFTSJ2) protein coding sequence into the EcoRI restriction site of the pIRES2-DsRed2 vector (Clontech Laboratories Inc. Mountain View CA USA). The TE671 and HepG2 cell lines were transfected with this plasmid via electroporation with a BTX ECM2001 system (BTX Holliston MA USA). Briefly 6—106 TE671 or 2—107 HepG2 cells were suspended in 400 µL of DMEM which contained 5 µg or 50 µg of plasmid DNA respectively and then the cells were subjected to electroporation at 200 V for 4 msec or 100 V for 30 msec respectively. After electroporation the cells were grown in a culture medium containing 400 µg/mL of the antibiotic G418 for the selection of cells that were stably expressing hFTSJ2. Isolation of the Mitochondrial and Cytosolic Protein Fractions The mitochondrial and cytosolic proteins of the TE671 cell fractions were isolated using the reagent-based method of the Mitochondria Isolation Kit (Pierce Rockford IL USA) according to the manufacturer™s instructions. Western Blot Analysis To analyze the expression of hFTSJ2 stable expression colonies of the TE671-hFTSJ2 and HepG2-hFTSJ2 cells were collected homogenized in 300 µL of RIPA buffer (5 mM Tris-HCl [pH 7.4] 0.15 M NaCl 1% NP-40 0.25% sodium deoxycholate 5 mM EDTA [pH 8.0] and 1 mM EGTA) held on ice for 30 min and then centrifuged at 14000 rpm for 30 min. The supernatants were collected as the total protein lysate. The supernatants (20 µg) were then separated by SDS-PAGE in a 12% acrylamide gel (acryl:bis of 30?0.8) and transferred to a polyvinylidene difluoride (PVDF) membrane [33] [34]. The membrane was blocked with 5% BSA (filtered through a 0.22-µm membrane) and immunoblotted with anti-hFTSJ2 (1?1000) and anti-GAPDH (1?500) antibodies overnight at 4°C. After washing with phosphate-buffered saline containing Tween 20 (PBST) the membrane was incubated with the appropriate horseradish peroxidase-conjugated secondary antibody for 1 hour at 25°C and the protein bands were detected by enhanced chemiluminescence (PerkinElmer Waltham MA USA) and an ImageQuant LAS 4000 mini system (GE Healthcare Biosciences Pittsburgh PA USA). For immunoblotting of the mitochondrial and cytosolic protein fractions 5 µg of protein from each fraction was separated by SDS-PAGE and immunoblotted with anti-hFTSJ2 (1?1000) anti-VDAC (mitochondrial fraction control 1?1000) and/or anti-MEK-1 (cytosolic fraction control 1?1000) antibodies. Immunofluorescence Microscopy The TE671-hFTSJ2 and HepG2-hFTSJ2 cells were grown to 80% confluence in 24-well dishes. Then the cells were fixed with 4% paraformaldehyde for 20 min and permeabilized with 0.1“0.3% Triton X-100 for 5 min followed by three washes with PBS. The cells were blocked with horse serum for 1 hour and incubated with an anti-hFTSJ2 antibody (1?1000) overnight at 4°C and then with the appropriate fluorescein isothiocyanate (FITC)-conjugated antibody for 1 hour. The cells were counter-stained with MitoTracker Red CMXRos (Invitrogen Corp. Grand Island NY USA) to stain the mitochondria and DAPI to stain the nuclei and then mounted with glycerol. The cells were examined by laser scanning confocal fluorescence microscopy in which FITC was excited at 488 nm MitoTracker Red was excited at 580 nm and DAPI was excited at 358 nm. Real-time RT-PCR and Semi-quantitative RT-PCR The total RNA was isolated from the cell lines or the porcine tissues using the TRIzol reagent (Invitrogen Corp. Grand Island NY USA) according to the manufacturer™s instructions. The total RNA was treated with DNase I "

Lung_Cancer

"lung tumors. The use of proton beam therapy can further reduce dose to normal structures. However uncertainty exists in proton-based treatment plans including range uncertainties large sensitivity to position uncertainty and calculation of dose deposition in heterogeneous areas. This study investigated the feasibility of proton transmission beams i.e. without the Bragg peak to treat lung tumors with stereotactic ablative radiotherapy. We compared three representative treatment plans using proton transmission beams versus conformal static-gantry photon beams. It was found that proton treatment plans using transmission beams passing through the patient were feasible and demonstrated lower dose to normal structures and markedly reduced treatment times than photon plans. This is the first study to demonstrate the feasibility of proton-based stereotactic ablative radiotherapy planning for lung tumors using proton transmission beams alone. Further research using this novel approach for proton-based planning is warranted. The authors have no support or funding to report. Introduction Stereotactic ablative radiotherapy (SABR) plays an essential role in the treatment of patients with medically inoperable early stage lung cancer and oligometastasis. The use of protons for lung SABR is emerging as an appealing treatment option because of its potential to deliver higher doses of conformal radiotherapy and spare normal tissues better than traditional photons [1] [2] [3] [4]. This can be achieved because of the natural characteristics of proton beams that deposit its dose at depth with no exit dose referred to as a Bragg peak. However conventional dosimetric models fail to accurately model how protons scatter and deposit dose in highly heterogeneous areas which leads to uncertainties in proton treatment plans [5]. In addition the uncertainties in the stopping power of the various tissues in the body and the interplay effect between spot scanning proton therapy and the target motion leads to large uncertainties in the treatment of lung tumors [5] [6]. In this study we report on the feasibility of proton transmission-beam SABR (PT-SABR) for lung tumors which uses the transmission portion of a spot scanning proton beam i.e. without the Bragg peak. This technique eliminates the major uncertainties of proton therapy mentioned above by having the proton beams pass through the patient. In addition the use of the transmission beam allows an entire field to be treated in one breath hold. This quick treatment and decreased uncertainties lead to smaller planning volumes. To the best of the authors™ knowledge this is the first report on the use of this novel approach to plan SABR with protons without using the Bragg peak which may have dosimetric advantages over photon treatments. Materials and Methods Ethics Statement Written informed consent was obtained from all patients registered in the SABR database. This study including the consent procedure was approved by the Mayo Clinic institutional review board. Patient Cohort Patients were identified from a prospectively collected institutional database of patients treated with SABR. Patients with lung tumors less than one centimetre in maximum dimension were included. The radiation treatment plans of three patients were extracted from the treatment planning system. All patients were treated using three-dimensional conformal multiple static-gantry photon beams. Plans were normalized so that 95% of the planning target volume (PTV) received at least 95% of the prescription dose. The prescription doses for these plans were adjusted to 34 Gy in one fraction based on the recently reported results of Radiation Therapy Oncology Group (RTOG) 0915 which established this dose fractionation regimen as a possible standard dose to be used in future trials [7]. Dose calculations for photon plans used the anisotropic analytical algorithm. Proton Treatment Planning A machine was commissioned in Eclipse v.10 (Varian Medical Systems Palo Alto CA) which allowed for planning and calculating transmission dose plans. The spot size (sigma) of the transmission beam which had an energy of 229 MeV was 2.2 mm. A proton plan that only used the transmission portion of the beam was created for each patient. Proton beam arrangements were selected so that no beams entered through the heart or spinal cord and allowed up to two non-coplanar beams. Four to five beams were used to keep the skin dose comparable to photon plans. The energy of the protons for each spot of a field was 229 MeV; this ensured the Bragg peak was not located within the patient. Dose calculations for the transmission portion of the proton beam were verified with Monte Carlo (Geant4). The proton plans were normalized so that the internal target volume (ITV) receives at least 95% of prescription dose including when range and position errors were included (3.5% and 2 mm) which is standard for spot scanning proton therapy. ITVs were created based on motion of the gross tumor volume in three dimensions using four-dimensional computed tomography image data. The dose constraints from RTOG 0915 were compared for the photon and proton plans as well as the total time that would be required to deliver the treatment. The radiotherapy delivery time per beam was estimated at 1 nC per second for proton therapy which is readily achievable by most spot scanning proton centers and 600 MU per minute for the photon plans. Differences in dosimetric and treatment planning parameters between photon and proton plans were analyzed with two-sided paired t-tests using SAS version 9.2 (SAS Institute Inc. Cary NC). Results The ITVs of the three tumors measured 0.220.42 and 0.99 cubic centimeters. All three proton plans had excellent coverage of the ITV. For all ITVs over 99.4% of the volume received at least 95% of the prescription dose including when uncertainties were examined. This was comparable with the photon plans where 100% of the ITVs received at least 95% of the prescription dose. For most normal tissues lower doses to these ans were achieved with the proton plans compared to the photon plans (). In fact (near) complete sparing of the spinal cord heart and esophagus was possible with protons through careful selection of beam angles (). .0098621.g001 Dose-volume histogram comparison of ans at risk. .0098621.t001 Dosimetric comparison of photon and proton plans. Parameter Photon Proton P-value Mean Range Mean Range Internal target volume (cc) 0.54 0.22“0.99 0.54 0.22“0.99 N/A Spinal cord Maximum dose (Gy) 5.66 2.39“8.07 1.97 0.00“3.06 0.04 Lungs (bilateral) Mean lung dose (Gy) 1.35 0.95“1.92 0.69 0.03“1.36 0.12 V20 (%) 0.66 0.39“1.20 0.49 0.16“1.01 0.06 V5 (%) 7.32 5.4“11.30 6.65 2.96“11.70 0.56 Heart Mean dose (Gy) 8.36 6.27“12.51 0.00 0.00“0.00 0.13 Skin Maximum dose (Gy) 11.75 9.86“13.28 11.40 7.37“16.23 0.89 Esophagus Maximum dose (Gy) 6.49 2.98“9.43 3.40 0.00“7.51 0.05 Homogeneity Index 1.25 1.21“1.29 1.07 1.03“1.11 0.06 Conformity Index 17.14 8.23“30.05 3.47 2.17“4.64 0.15 Proton plans used four to five non-coplanar beams compared to nine to ten beams for photon plans (). The average number of monitor units per field was 818 (range 758“871) with photons and only 38 (range 31“59) with protons. This would translate to an average beam-on time per field of 82 seconds versus 6 seconds for photon and proton plans respectively. These differences in monitor units and beam-on time were statistically significant with P<0.01(). .0098621.g002 Comparison of isodose distributions. Proton (left) and photon (right) treatment plans. .0098621.t002 Comparison of treatment time between photon and proton plans. Parameter Photon Proton P-value Mean Range Mean Range Total monitor units (MU) 7929 6820“8713 178 122“235 <0.01 Fields 9.7 9“10 4.7 4“5 N/A Average MU/field 818 758“871 38 30.5“46.9 <0.01 Beam on time per field (seconds) 81.8 75.6“87.1 5.8 4.7“7.2 <0.01 Discussion Exploiting the transmission beam in proton therapy planning has significant potentials for dose escalation and re-irradiation in lung tumors and eliminates the concern over the uncertainty of the stopping power and its impact on the Bragg peak location. PT-SABR planning requires fewer beams than photons and careful selection of optimal beam angles allows for minimal dose to adjacent normal tissues and tumor dose escalation which may translate to improved local control rates. RTOG 0915 showed that 34 Gy in a single fraction was comparable to 48 Gy in four fractions [7] and the dosimetric constraints from the protocol were easily achieved using both proton and photon plans for patients in this study. Further optimization with proton therapy can allow even higher doses to be delivered while still respecting established dosimetric constraints for normal tissues. This may translate to better tumor control but requires more investigation in a clinical setting. Patients planned with PT-SABR required fewer beams (5 vs. 10) which reduce the total treatment time and the low dose outside the tumor. The average monitor units per field for PT-SABR plans were a fraction of those needed for the photon plans (). This translates to a beam on time per field of between 5 and 10 seconds for the PT-SABR plans compared to 75 to 90 seconds for photon plan. This 5 to 10 second time estimate is based on a conservative 1 nC/sec dose rate however new proton centers may be able to achieve greater than 2 nC/sec thereby reducing this time by a factor of 2. By decreasing the treatment time to less than 10 seconds per field breath-hold techniques may be better tolerated in greater number of lung cancer patients with suboptimal lung function. Breath-hold technique would minimize tumor motion (i.e. ITV) leading to a smaller overall irradiation volume and interplay would not be a significant issue [8]. Spot scanning proton therapy that utilizes the Bragg peak would require a larger planning volume due to the various uncertainties that need to be taken into account; and it would require a longer treatment time due to the use of multiple proton energies. Each change in energy requires several seconds (2 to 7) and at least 5 to 10 energies would be required for these treatments. Volumetric modulated arc therapy (VMAT) with photons may decrease treatment times compared to multiple static-gantry beams. However VMAT comes at the cost of larger volumes of normal tissue receiving low doses of radiation since the beam is continuously on as it rotates about the patient. The use of four to five proton transmission beams achieves both shorter treatment times as well as a lower integral dose to the body. The dosimetric data of the normal tissues in the photons plans met the constraints of RTOG 0915. The dosimetric gains of protons over these plans may be considered modest and the statistical analysis comparing plans is limited by the small sample size. However in some plans the dose to particular critical ans can be avoided completely without compromising target coverage by choosing beam arrangements appropriately. This may be beneficial in treating patients with tumors in challenging locations [9] or recurrent tumors that have had prior radiotherapy. The interim analysis of RTOG 0617 reported local failure rates of 25% and 34% in the standard and high dose RT arms [10] and therefore re-irradiation may play a role in this subset of patients who fail after definitive chemoradiotherapy. For these patients keeping dose at or near zero to the spinal cord heart lungs or other critical structures is feasible with protons. Planning with PT-SABR using only transmission beams without the Bragg peak is feasible. This proof of principle as described in our study eliminates the uncertainty of proton dose distribution in lung tumors which has the potential to underdose the target and overdose surrounding normal tissues. Proton therapy planning with this technique also demonstrates better sparing of normal tissues and fast treatment times than photon plans. Further study of this novel approach to proton SABR is warranted. The authors thank Katy Nelson for maintaining the SABR database. References 1 GeD HillbrandM StockM DieckmannK PotterR (2008) Can protons improve SBRT for lung lesions? Dosimetric considerations. Radiotherapy and oncology: journal of the European Society for Therapeutic Radiology and Oncology88: 368“37518405986 2 HoppeBS HuhS FlampouriS NicholsRC OliverKR et al (2010) Double-scattered proton-based stereotactic body radiotherapy for stage I lung cancer: a dosimetric comparison with photon-based stereotactic body radiotherapy. Radiotherapy and oncology: journal of the European Society for Therapeutic Radiology and Oncology97: 425“43020934768 3 MacdonaldOK KruseJJ MillerJM GarcesYI BrownPD et al (2009) Proton beam radiotherapy versus three-dimensional conformal stereotactic body radiotherapy in primary peripheral early-stage non-small-cell lung carcinoma: a comparative dosimetric analysis. International journal of radiation oncology biology physics75: 950“958 4 WestoverKD SecoJ AdamsJA LanutiM ChoiNC et al (2012) Proton SBRT for medically inoperable stage I NSCLC. Journal of thoracic oncology: official publication of the International Association for the Study of Lung Cancer7: 1021“1025 5 PaganettiH (2012) Range uncertainties in proton therapy and the role of Monte Carlo simulations. Physics in medicine and biology57: R99“11722571913 6 SecoJ PanahandehHR WestoverK AdamsJ WillersH (2012) Treatment of non-small cell lung cancer patients with proton beam-based stereotactic body radiotherapy: dosimetric comparison with photon plans highlights importance of range uncertainty. International journal of radiation oncology biology physics83: 354“361 7 VideticGM HuC SinghA ChangJY ParkerW et al (2013) Radiation Therapy Oncology Group (RTOG) Protocol 0915: A Randomized Phase 2 Study Comparing 2 Stereotactic Body Radiation Therapy (SBRT) Schedules for Medically Inoperable Patients With Stage I Peripheral Non-Small Cell Lung Cancer. International journal of radiation oncology biology physics87: S3 8 KeallPJ MagerasGS BalterJM EmeryRS ForsterKM et al (2006) The management of respiratory motion in radiation oncology report of AAPM Task Group 76. Medical physics33: 3874“390017089851 9 RegisterSP ZhangX MohanR ChangJY (2011) Proton stereotactic body radiation therapy for clinically challenging cases of centrally and superiorly located stage I non-small-cell lung cancer. International journal of radiation oncology biology physics80: 1015“1022 10 BradleyJD PaulusR KomakiR MastersGA ForsterK et al (2013) A randomized phase III comparison of standard-dose (60 Gy) versus high-dose (74 Gy) conformal chemoradiotherapy with or without cetuximab for stage III non-small cell lung cancer: Results on radiation dose in RTOG 0617. Journal of Clinical Oncology31: 7501 Cancer Cancer cncr Cancer 0008-543X 1097-0142 BlackWell Publishing Ltd Oxford UK 24752945 4140446 10.1002/cncr.28714 Original Articles A phase 2 cooperative group adjuvant trial using a biomarker-based decision algorithm in patients with stage I non-small cell lung cancer (SWOG-0720 NCT00792701) Bepler Gerold MD PhD 1 Zinner Ralph G MD 2 Moon James MS 3 Calhoun Royce MD 4 Kernstine Kemp MD 5 Williams Charles C MD 6 Mack Philip C PhD 4 Oliveira Vasco PhD 1 Zheng Zhong MD PhD 6 Stella Philip J MD 7 Redman Mary W PhD 2 Gandara David R MD 4 1 Karmanos Cancer Institute Detroit Michigan 2 The University of Texas MD Anderson Cancer Center Houston Texas 3 SWOG Statistical Center Seattle Washington 4 University of California at Davis Sacramento California 5 City of Hope Duarte California 6 H. Lee Moffitt Cancer Center Tampa Florida 7 Michigan Cancer Research Consortium Community Clinical Oncology Program Ann Arbor Michigan Corresponding author: Gerold Bepler MD PhD Karmanos Cancer Institute 4100 John R Detroit MI 48201; Fax: (313) 576-8628; beplerg@karmanos. 01 8 2014 18 4 2014 120 15 2343 2351 10 2 2014 17 3 2014 18 3 2014 © 2014 The Authors. Cancer published by Wiley Periodicals Inc. on behalf of American Cancer Society 2014 This is an open access article under the terms of the Creative Commons Attribution-NonCommercial-NoDerivs License which permits use and distribution in any medium provided the original work is properly cited the use is non-commercial and no modifications or adaptations are made. BACKGROUND This cooperative group adjuvant phase 2 trial in patients with completely resected stage I non-small cell lung cancer with tumor diameters measuring ??2 cm was designed to assess the feasibility and preliminary efficacy of assigning patients to therapy or observation using a molecularly based decision algorithm. METHODS At least a lobectomy and sampling of recommended mediastinal lymph node stations good Zubrod performance status adequate an function and a formalin-fixed and paraffin-embedded tumor specimen were required. Excision repair cross-complementing group 1 (ERCC1) and ribonucleotide reductase M1 (RRM1) were analyzed using immunofluorescence-based in situ automated quantitative image analysis and categorized as high or low using prespecified cutoff values. Patients with high ERCC1 and RRM1 were assigned to observation and all others to 4 cycles of cisplatin and gemcitabine. Feasibility was defined as treatment assignment within 84 days from surgery in >?85% of patients. Secondary objectives were to estimate the 2-year survival. RESULTS Treatment assignment met the feasibility criteria in 88% of eligible patients (71 of 81 patients). The collective 2-year disease-free and overall survival rates were 80% and 96% respectively. Protein levels for RRM1 fell within the previously established range ERCC1 levels were slightly lower than expected and they were significantly correlated (correlation coefficient 0.4). The rates of assignment of patients to observation (22%) and chemotherapy (78%) were as expected. CONCLUSIONS Gene expression analysis for treatment assignment is feasible. Survival results are encouraging and require future validation. Real-time performance of quantitative in situ ERCC1 and RRM1 analysis requires further development. lung cancer adjuvant therapy personalized medicine ERCC1 (excision repair cross-complementing group 1) RRM1 (ribonucleotide reductase M1) INTRODUCTION After publication of the International Adjuvant Lung Cancer Trial in 2004 adjuvant chemotherapy containing a platinum agent has become the standard of care for patients with a complete surgical resection of American Joint Committee on Cancer stage II to III (version 6) non-small cell lung cancer (NSCLC).1 The trial included patients with stage I to III disease and demonstrated an absolute 4.1% improvement in overall survival (OS) and a subgroup analysis indicated that the OS benefit increased with stage: the hazards ratio (HR) for death among patients receiving adjuvant chemotherapy compared with controls was approximately 0.98 for patients with stage I disease 0.88 for patients with stage II disease and 0.79 for patients with stage III disease.1 The data were confirmed by the National Cancer Institute of Canada Clinical Trials Group JBR.10 trial in 2005 which included patients with stage IB and stage II disease.2 A third trial Cancer and Leukemia Group B (CALGB) 9633 which included only patients with stage IB disease was terminated early and also reported a therapeutic benefit for adjuvant chemotherapy.3 However a final analysis of mature data revealed no statistically significant OS benefit (HR 0.83) but demonstrated a benefit for patients with tumor diameters of ??4 cm (HR 0.69).4 During the same time period an increasing number of correlative biomarker analyses demonstrated that the efficacy of platinum agents was associated with intratumoral levels of the excision repair cross-complementing group 1 (ERCC1) gene with high levels indicating resistance.5“9 Similarly high intratumoral levels of the regulatory subunit of ribonucleotide reductase M1 (RRM1) were reported to be predictive of resistance to gemcitabine.9“13 Finally both biomarkers had also been reported to be prognostic of survival in patients who had not received chemotherapy or radiation with high levels indicating longer survival.814“16 Based on these data we designed an adjuvant trial in 2007. The underlying hypothesis was that patients with high intratumoral levels of ERCC1 and RRM1 would not benefit from chemotherapy and would have a good prognosis because of a less aggressive tumor phenotype. In contrast patients with low levels of ERCC1 and RRM1 would have tumors that were sensitive to chemotherapy but with a more aggressive phenotype. Because a biomarker-driven adjuvant chemotherapy selection trial had not been performed in patients with NSCLC we focused on demonstrating the feasibility of such an approach before launching a phase 3 trial. In addition because adjuvant chemotherapy had quickly become the standard of care for patients with stage II/IIIA disease we focused our efforts on patients with stage I disease. After discussions within the SWOG (formerly the Southwest Oncology Group) lung cancer working group and the National Cancer Institute (NCI)'s Cancer Therapy Evaluation Program and after peer review by a National Institutes of Health study section the consensus was to focus this feasibility trial on patients with stage I disease and tumor diameters of ?2 cm. MATERIALS AND METHODS Trial Design and Treatment Plan The trial (NCT00792701 SWOG-0720) complied with the Declaration of Helsinki and was approved by the Institutional Review Boards of the study institutions. Eligibility criteria included a diagnosis of NSCLC; stage I disease (according to version 6 of the American Joint Committee on Cancer staging manual) with a tumor diameter ??2?cm; a complete surgical resection by lobectomy bilobectomy or pneumonectomy; surgical staging of the mediastinum through sampling of at least 2 lymph node stations; a positron emission tomography scan; a computed tomographic scan of the chest and abdomen; adequate bone marrow liver and renal function; a Zubrod performance status of 0 or 1; and willingness to provide a smoking history. Patients with a prior malignancy prior radiation to the chest or other significant illnesses according to good medical practice were excluded. Patients had to be registered on the trial within 35 days of surgery. Tumor specimens were then retrieved and shipped to a central laboratory. They were analyzed for in situ tumor levels of ERCC1 and RRM1 using an immunofluorescence-based automated quantitative analysis method.17 Prespecified cutoff levels that had been determined in 187 patients with stage I disease (??65 for ERCC1 and ??40 for RRM1) were used to categorize specimens as high or low expressors for each marker (Fig. 1).16 The appropriate therapeutic assignment was then passed on to the statistical center and the participating therapeutic center; however specific protein levels were not communicated to the treatment center. Therapeutic assignment was based solely on biomarker categories and no other stratification parameters were used. CONSORT (Consolidated Standards Of Reporting Trials) diagram of the trial is shown. Patients with high levels of both biomarkers received active surveillance and patients with low levels of one or both biomarkers received 4 cycles of cisplatin (at a dose of 80 mg/m2 on day 1) and gemcitabine (at a dose of 1 g/m2 on days 1 and 8) every 21 days. The protocol included provisions for dose reductions or treatment delays. The addition of other targeted or cytotoxic agents during therapy or as maintenance was not permitted. Specimen Collection Processing and Gene Expression Analysis The study required the collection and shipment of formalin-fixed and paraffin-embedded tumor blocks before therapy. However if local policies did not permit submission of a tissue block 10 serial unstained sections could be submitted. Processing was done in a reference laboratory by 1 of 2 investigators (V.O. and Z.Z.). Sections measuring 5 ?m in thickness were placed on frosted glass slides and in situ quantification was performed by the automated quantitative analysis method (PM-2000 [version 1] HistoRx Inc New Haven CT) as previously described.91618 The primary antibody for the detection of ERCC1 was clone 8F1 (product code NB500-704 lots G412 and H347 from Novus Biologicals [Littleton Colo]) and the antiserum for RRM1 was R1AS-6 (generated in a rabbit in 2003 against a keyhole limpet hemocyanin [KLH]-conjugated 21-aminoacid peptide specific to the N-terminal of RRM1 column purification lot 09-2008). Slides were scanned with SpotGrabber (HistoRx New Haven Conn.) and image data were captured with a digital camera and fluorescence microscope and analyzed. Scores were adjusted to range from 1 to 255. Because full sections were evaluated for each specimen multiple spots with diameters of 0.6 mm were analyzed to obtain a representative level of protein expression. The number of spots was dependent on suitable areas with tumor cells and it ranged from 5 to 25 spots (median 10 spots) for both targets. Runs included a tissue microarray of 15 control specimens in triplicate for control purposes. Statistical Analysis The primary objective of the current study was the feasibility of a biomarker-based treatment assignment in the cooperative group setting. If the true success rate were ??75% then a biomarker-based treatment assignment would not be considered feasible but if the true success rate were ??90% it would be feasible. If ??47 of 55 eligible patients (85%) were successfully assigned to treatment or active monitoring within 84 days from surgery this would be considered evidence of feasibility. The design had 91% power using an exact binomial test with a 1-sided type I error of 5%. Secondary objectives included estimating the collective 2-year disease-free survival (DFS) for patients who accepted their treatment assignment and in the subset of patients who received adjuvant chemotherapy. However there would be no comparison made between treatment arms. To assess DFS the disease status was monitored every 2 months for the first 6 months and subsequently every 3 months by computed tomography after enrollment and according to good medical practice. Toxicities related to the administration of chemotherapy were assessed according to the National Cancer Institute Common Terminology Criteria for Adverse Events (version 3.0; ctep.cancer.gov). DFS was defined as the time from the date of enrollment to disease recurrence or death due to any cause and estimated according to the Kaplan-Meier method. A Cox regression model was fit with the time from surgery to enrollment as a covariate to evaluate its effect on DFS. A natural log transformation was applied to the raw protein measurement data and the Pearson correlation coefficient was used to test associations. Bivariate comparison of baseline characteristics between the assigned treatment groups was performed using the Fisher exact test for categorical variables or the Student t test or Wilcoxon rank sum test for continuous variables. A multivariable logistic model to evaluate baseline factors and treatment assignment was fit using backwards selection. Median ERCC1 and RRM1 expression levels were compared with historical medians using the 1-sample Wilcoxon signed rank test. The percentage of patients with both ERCC1 ??65 and RRM1 ??40 was compared with the historical rate using a chi-square test. All statistical analyses and graphics were performed using SAS statistical software (version 9.2; SAS Institute Inc Cary NC). A significance level of 5% was used for all analyses. RESULTS Patient and Trial Characteristics To ensure an adequate sample size of eligible patients and biomarker-specific subgroups a total of 85 patients was registered between April 2 2009 and April 1 2011 from 27 participating sites. Four patients were ineligible; 3 had inadequate lymph node sampling and 1 did not have a tumor measuring ??2 cm. provides the characteristics of the 81 eligible patients. Patient Demographics and Disease Characteristics Variablesa All Patients Assigned to Chemotherapy Assigned to Observation P Refused Assignment Accepted Assignment P N = 81 N = 63 N = 18 N = 20 N = 61 Age y .37 .39 ?Median 64 63.3 68.8 67.2 63.3 ?Mean 63.5 62.9 65.5 65.2 62.9 "

Lung_Cancer

"The most stringent quality control for ESC lines is the ability of the chimeras to give germline transmission (GLT). Although strictly speaking not required for an approach in which chimeras serve as an endpoint we decided to maintain this quality control as a means to identify ESC clones with impaired germline-competence caused by loss of pluripotency or the acquisition of genetic defects during culture and manipulation. We observed efficient GLT for chimeras obtained from both the C57BL/6J and the FVB/n ESC clones regardless of the injection procedure (supplementary Table S1). Derivation of germline-competent ESCs from mouse models with complex genotypes Two GEMMs of human lung cancer were selected for the derivation of ESCs: the KrasLSL-G12D non small cell lung cancer (NSCLC) model and the Rb1F/F ;Trp53F/F small cell lung cancer (SCLC) model (Jackson et al 2001; Meuwissen et al 2003). These mice develop lung tumors after switching of the conditional alleles by a Cre recombinase introduced in the target cells via adenovirus (Ad5-Cre) intubation in the lung. ESCs were also derived from Nf2F/F ;Trp53F/F ;Cdkn2a*/* mice which carry”in addition to conditional Nf2 and Trp53 alleles”a homozygous mutation in Cdkn2a that results in loss of p16Ink4a expression but retention of the alternative reading frame protein p19Arf (Krimpenfort et al 2001). Nf2F/F ;Trp53F/F ;Cdkn2a*/* mice develop invasive mesotheliomas after intrathoracic Ad5-Cre injection due to loss of Nf2 and p53 in the mesothelial lining (Jongsma et al 2008). The NSCLC model was maintained on a C57BL/6J background whereas the SCLC and mesothelioma models were on a mixed FVB/n;129/Ola background. As expected the efficiency of ESC derivation was similar between genotypes and comparable to the two wild-type strains (). The gender of the derived ESC clones was determined by Y-chromosome specific PCR. We observed a strong bias towards male ESC clones () which was likely caused by reduced morphological appearance and growth of female ESC clones resulting in their discontinuation early in the derivation process. Only in cases where we decided to expand all clones e.g. wild-type FVB/n we obtained both male and female clones. At later passage these female ESC clones caught up and were indistinguishable from male ESC clones on basis of growth and morphology. However we restricted ourselves to male ESC clones as it has been reported that female lines derived from inbred strains often loose one of the two X chromosomes during expansion (Barakat & Gribnau 2010). Three Rb1F/F ;Trp53F/F ESC clones two Nf2F/F ;Trp53F/F ;Cdkn2a*/* clones and one KrasLSL-G12D clone were tested for their contribution to chimeras. All clones gave reasonable numbers of chimeric animals relative to the implanted embryos and as expected most of the chimeras were males (supplementary Table S1). Most chimeras were of high quality showing coat-color chimerism of more than 70% (Fig 2A and B supplementary Fig S2A) and efficient GLT in the first litter (supplementary Table S1). Validation of chimeras. AB Three Rb1F/F ;Trp53F/F ESC clones (A) and two Nf2F/F ;Trp53F/F ;Cdkn2a*/* ESC clones (B) were injected into C57BL/6N blastocysts and scored for their chimeric contribution. All ESC clones gave reasonable numbers of chimeric animals relative to the implanted embryos (supplementary Table S1) and as expected most of the chimeras were males as we exclusively used male ESC clones. male female n.d. CD Comparison between chimeric contribution estimated on basis of coat-color versus genetic chimerism tested in various tissues. Southern blot analysis was performed with a probe that distinguishes between a wild-type Trp53 allele or the floxed Trp53 allele reflecting the contribution by the host ESCs or cultured ESCs respectively (example in supplementary Fig S3). Controls are wild-type spleen (0% chimerism expected) and F1 offspring of chimeras (50% chimerism expected). (C) Genetic chimerism of Rb1F/F ;Trp53F/F chimeras with coat color chimerism ranging from 70 to 100% (average 84% n = 7). (D) Genetic chimerism of Nf2F/F ;Trp53F/F ;Cdkn2a*/* chimeras with coat color chimerism ranging from 85 to 100% (average 95% n = 4). E Survival curves of Rb1F/F ;Trp53F/F mice intratracheally injected with Ad5-Cre. Black line conventional mice; red line chimeras. F Survival curves of Nf2F/F ;Trp53F/F ;Cdkn2a*/* mice intrathoracically injected with Ad5-Cre. Black line: conventional mice; Red line: chimeras. G Typical example of a neuroendocrine carcinoma (Small Cell Lung Cancer) in the lung (left panel) and a metastatic lesion in the liver (right panel). H Typical example of a mesotheliomatous lesion in the thoracic cavity. Tumor cells are either spindle sarcomatoid cells (left panel) or vacuolated epithelioid cells (right panel). Contribution of derived ESCs to various ans of chimeric mice is extensive and allows for efficient tumor induction One of the key features of the GEMM-ESC approach is the ability to directly evaluate tumor phenotypes in chimeric mice bypassing the need for any breeding. The success of this approach depends on the contribution of cultured ESCs to the various tissues in the chimeric mice. To assess this we performed Southern blot analysis on genomic DNA extracted from multiple tissues of chimeric mice from two independent GEMMs. To determine the level of genetic chimerism we used a probe that distinguishes between a wild-type Trp53 allele and the floxed Trp53F2-10 allele (Jonkers et al 2001) reflecting the contribution by the host ESCs or cultured ESCs respectively (supplementary Fig S3). The contribution of the cultured ESCs was comparable for most ans with the exceptions of the lung and brain which consistently scored the lowest (Fig 2C and D). In general the percentage of coat-color chimerism was scored higher than the genetic chimerism. A potential limitation of the GEMM-ESC approach is that chimeric mice have a smaller target cell population for oncogenic transformation. To determine whether this influences tumor type latency and incidence a comparison was made between conventional mice and chimeras for the three GEMMs (Fig 2E and F and supplementary Fig S2B). For the SCLC and mesothelioma models the tumor type incidence and latency was identical between the conventional and the chimeric mice (Fig 2E“H). All chimeric mice from the SCLC model developed lung neuroendocrine carcinomas resembling SCLC often with invasion to the mediastinum and metastases to the liver (Fig 2G). All chimeric mice from the mesothelioma model developed epithelioid sarcomatoid or biphasic mesotheliomas that were highly invasive into nearby tissues (Fig 2H). In the NSCLC model the incidence and tumor types in the chimeric mice was again identical to the incidence and tumor types observed in the original strain. All NSCLC chimeras developed multiple lesions in the lung ranging from adenomatous or bronchioalveolar hyperplasia to bronchioalveolar adenomas adenocarcinomas and papillary carcinomas (supplementary Fig S2B and C). Surprisingly the tumor latency was shorter for the NSCLC chimeras than for the conventional mice. It is possible that host-derived FVB/n cells in the lung create a tumor-permissive or pro-tumorigenic microenvironment. Alternatively as the NSCLC chimeric cohort was produced from a single ESC clone an unidentified genetic lesion might have been acquired during the re-derivation process that leads to accelerated tumor growth. Combined these data illustrate that tumor induction in chimeras is as efficient as in animals carrying the conditional lesions in all of their cells. The GEMM-ESC approach is therefore a very effective strategy to swiftly generate cohorts of mice for in vivo tumor studies. Targeting of GEMM-ESCs under 2i culture conditions is efficient but requires genetic and phenotypic quality control The second step in the GEMM-ESC approach involves targeting of GEMM-ESCs with a Flp-in module just after the 3?UTR of the Col1a1 locus (Beard et al 2006). This module named Col1a1-frt serves as a docking site for introduction of transgene-coding plasmids by Flp recombinase-mediated integration."

Lung_Cancer

"About half (49%) of UNCeqRMETA mutations had no RNA evidence and were based only on DNA evidence. Surprisingly among UNCeqRMETA expressed somatic mutations (those with RNA and DNA mutant read evidence) the MAF in RNA was often significantly greater than in DNA (lung: 21% of expressed mutations breast: 17% fdr < 0.05) (A and Supplementary Figure S6A). This increase was often >2-fold (lung: 12% of expressed mutations breast: 11%). In contrast DNA MAF was significantly greater than RNA MAF at much lower frequency (lung: 2% of expressed mutations breast: 3% fdr < 0.05). As a control germline variants were detected in germline DNA-WES and patient-matched germline RNA-seq relative to the reference genome by UNCeqRMETA under the same settings as somatic mutation detection (B and Supplementary Figure S6B). In contrast to expressed somatic mutations expressed germline variants displayed rare significant differences in allele fraction (RNA greater than DNA: lung: 0.8% breast: 0.7%; DNA > RNA: lung 0.1% breast: 0.3%). Therefore the prevalent increased mutation signal in RNA-seq was cancer-specific. . Mutation signal in RNA versus DNA. Mutant allele fraction distributions of UNCeqRMETA expressed mutations from the lung triplet cohort tumor sequencing (A). Germline variant allele fraction distributions of expressed germline variants from lung quadruplet cohort germline sequencing (B). Diagonal lines indicate equal allelic fraction between DNA and RNA with points above the diagonal having greater allelic fraction in RNA below the diagonal greater allelic fraction in DNA. Breast cancer somatic mutation and germline allele distributions in Supplementary Figure S6. Distributions of MAF difference among driver genes having a significant difference in MAF over all mutations (C). MAF distributions for all TP53 UNCeqRMETA mutations expressed and unexpressed (C and D). In addition to the genome-wide phenomenon the increased mutation signal in RNA versus DNA might additionally be frequent in cancer driver genes. Lung and breast cancer's driver genes (46) with at least 10% prevalence were analyzed for differences in RNA to DNA MAF across all mutations whether expressed or not. Eight driver genes had significantly different MAF between DNA and RNA (Wilcoxon signed rank test fdr < 0.05; C). All of these genes had greater median MAF in RNA than in DNA including an oncogene PIK3CA and tumor suppressors such as TP53. The TP53 MAF distributions of lung and breast cancer had remarkable similarities (D) in that nonsynonymous and splice site mutations had extremely high RNA MAF relative to DNA MAF often 2-fold greater. Stop-gain and frameshift mutations in TP53 had greater MAF in DNA versus RNA but these decreases were less common and had a smaller magnitude in MAF difference. The TP53 results extend an earlier report in lung cancer using direct sequencing of TP53 RNA transcripts which found mutant transcript predominant expression (46). In summary expressed mutations tend to have larger mutation signal in RNA than in DNA. Importantly this effect was common among driver genes suggesting that integrating DNA and RNA for mutation detection provides the best opportunity to identify cancer causing mutations. Because DNA copy number can affect the quantity of tumor versus germline DNA at a locus tumor DNA copy number alterations were compared among mutations with a significantly greater MAF in RNA versus DNA and vice versa. Mutations with greater MAF in RNA exhibited a small (roughly 5%) relative increase in DNA copy number deletions (Supplementary Figure S7) suggesting that RNA is beneficial to detect mutations in regions of genome deletion. MAF differences in TP53 mutations did not associate with either DNA amplifications or DNA deletions (Supplementary Figure S7). Large gains in low purity tumors Because low tumor purity (caused by normal contamination and multiple clones) can affect mutation detection (28) the outcome of integrating RNA-seq and DNA-WES in mutation detection was compared among tumors by their purity. The rate of mutation gain after adding RNA-seq to DNA-WES was non-uniform both in the breast and lung triplet cohorts such that the greatest gains occurred in tumors having the lowest purity. Specifically tumors™ total mutation ratio (the number of mutations detected by UNCeqRMETA over UNCeqRDNA) had significant negative correlation with tumor purity in both lung and breast cancer (A). Mutation gains were largest among tumors with purity <40%. In addition tumors™ average difference in mutation signal between RNA and DNA (the mean difference of RNA MAF to DNA MAF across all expressed UNCeqRMETA mutations) also had significant negative correlation with tumor purity both in lung and breast cancer (B). Therefore tumors with low purity had the largest RNA-seq mutation signal and gained the most new mutations after incorporation of RNA-seq evidence. . Tumor purity effects on mutation detection. Lines summarize breast and lung triplet cohorts displaying total mutation ratios (A) or mean mutant allele fraction difference within expressed mutations (B) among tumors binned by tumor purity quintile and plotted at midpoint. Pearson's correlation tests compared the association of mutation ratio and MAF associations among triplet cohort tumors (P). MAF distributions from two exemplar low purity tumors™ mutations (C and D). Diagonal lines indicate equal MAF in DNA-WES and RNA-seq with mutations above the diagonal having greater MAF in RNA below the diagonal greater MAF in DNA. Unexpressed mutations are marked along the horizontal axes in (C and D). Examples of low purity tumors with large mutation gains include a low purity breast tumor that had 1.8 total mutation ratio and a mean 0.18 difference in mutation signal among expressed mutations. Two of this tumor's mutations with much larger signal in RNA than DNA occurred in PIK3CA (p.H1047R) and GATA3 (p.S412fs) (C). These mutations occur in major mutational hotspots (47) and are also characteristic molecular drivers for the Luminal A expression subtype (648) of which this tumor is a member. Incorporation of RNA-seq evidence was essential to identify these two driving mutations; e.g. there was only 1 DNA read with the PIK3CA mutation but 29 mutant reads in RNA-seq (). An example lung tumor had a 1.2 total mutation ratio and an average 0.22 difference in mutation signal among expressed mutations including CDKN2A (p.H98P) and TP53 (p.R273H) which exhibited very large RNA MAF (at 100 and 84%) relative to DNA MAF (at 43 and 46%) (D). These PIK3CA GATA3 and TP53 mutations were not detected by earlier studies utilizing DNA-WES alone (46) emphasizing the advantage of RNA integration. "

Lung_Cancer

"However the production and administration of these tailor-made DC vaccines are costly and labor-intensive [5]. As a next-step in the development of DC vaccines we designed a recombinant protein that contains a Mycobacterium tuberculosis heat shock protein 70 (MTBHsp70) fused to a single chain variable fragment (scFv) derived from human B cells that targets mesothelin. Mesothelin (MSLN) is a validated immunotherapy target that is highly overexpressed on the surface of common epithelial cancers including ovarian cancers epithelial malignant mesotheliomas ductal pancreatic adenocarcinomas and lung adenocarcinomas while expressed at relatively low levels only in mesothelial cells lining the pleura pericardium and peritoneum in healthy individuals [6-9]. Several therapeutic agents targeting MSLN are evaluated in preclinical and clinical studies such as the recombinant immunotoxin SS1P [9-11]. In our fusion protein the anti-MSLN scFv moiety was originally isolated from a yeast-display human scFv library [12] and demonstrated the ability to recognize both membrane-bound and soluble MSLNs and inhibit CA125/MSLN-dependent cell adhesion [13-15]. The recombinant MTBHsp70 protein provides immunostimulatory functions including the activation of monocytes and DCs to produce CC-chemokines that attract antigen processing and presenting DCs macrophages and effector T and B cells enhanced DC aggregation and maturation [1617] induction of the cytotoxic activity of natural killer cells [18] and improved cross-priming of T cells which is dependent on DCs [19]. The capabilities of MTBHsp70 as a potent immune adjuvant have been well characterized in cancer models including murine models of melanoma and lymphoma [1820-24]. While in these studies proteins or peptides fused with Hsp70 used for immunizations in mice were shown to generate humoral or cellular immune responses we expect that fusion of anti-MSLN scFv and MTBHsp70 takes advantage of the immune-activating action of MTBHsp70 and the tumor-targeting activity of the scFv which will yield anti-tumor responses against the broadest profile of tumor antigens. We evaluated the therapeutic efficacy of this MSLN-targeted fusion protein in syngeneic mouse models of ovarian cancer and mesothelioma and examined its mechanism of action in in vitro and in vivo cross-presentation assay systems. These studies demonstrate that this bifunctional fusion protein significantly enhances survival and slows tumor growth through the augmentation of tumor-specific cell-mediated immune responses. Results Expression of scFvMTBHsp70 fusion protein and MTBHsp70 The structure of scFvMTBHsp70 is shown in Figure 1A. VH and VL from anti-MSLN P4 scFv [13] are linked using a (G4S)3 linker and fused to full length MTBHsp70 with a (G4S)3 linker in between. As shown in Figure 1B only one protein band was observed with a molecular weight of approximately 100 kDa for scFvMTBHsp70 and one protein band with a molecular weight of 70 kDa for MTBHsp70 which match the expected molecular weights of these specific proteins. Endotoxin contamination levels in scFvMTBHsp70 and MTBHsp70 were found to be very low at less than 50 EU per mg of protein. Structure and analysis of scFvMTBHsp70 fusion protein. A anti-MSLN VH and VL are linked with a (G4S)3 linker and fused to full length MTBHsp70 with a (G4S)3 linker. B RAPIDstain based on Coomassie dye following purification and hIgG-Fc tag removal of MTBHsp70 and scFvMTBHsp70. C BR5FVB1 ovarian cancer cells and 40L mesothelioma cells were incubated with 40 ?g/ml scFvMTBHsp70 or 26 ?g/ml MTBHsp70 (blue line) or without either protein (solid) followed by anti-MTBHsp70 (IgG2a) biotinylated anti-IgG2a and Streptavidin-APC and then analyzed by flow cytometry. To confirm that the scFv portion of the fusion protein binds to MSLN on the surface of tumor cells scFvMTBHsp70 or MTBHsp70 was preincubated with 12 ?g/ml recombinant human MSLN for 30 min (red line) before being added to the cells. Data are representative of three independent experiments in duplicate tubes. D Median fluorescence intensity (MFI) values of cells stained with scFvMTBHsp70 or MTBHsp70 normalized to cells stained without either protein. Data are expressed as means?±?SEM in arbitrary units. P values were determined using One-Way ANOVA followed by Turkey™s multiple comparison tests. *p?<?0.05; **p?<?0.01;ns non-significant. E scFvMTBHsp70 binds with peritoneal mesothelial cells at a low level compared to ovarian cancer and mesothelioma cells. Binding of the fusion protein is at very low or undetectable levels on PBLs and splenocytes. Thick line with incubation of scFvMTBHsp70; solid without incubation of scFvMTBHsp70. Data are representative of three independent experiments. scFvMTBHsp70 binds to BR5FVB1 ovarian cancer cells and 40L mesothelioma cells through the interaction of scFv with MSLN on the surface of tumor cells Binding of scFvMTBHsp70 or MTBHsp70 to BR5FVB1 ovarian cancer cells or 40L mesothelioma cells as determined by flow cytometry is shown in Figure 1C and D. Binding of scFvMTBHsp70 to MSLN-expressing tumor cells was almost completely inhibited by preincubation of scFvMTBHsp70 with recombinant human MSLN. Although MTBHsp70 also binds to these MSLN-expressing tumor cells the level of binding is not significantly different from background (p?=?0.187 for BR5FVB1 cells and p?=?0.086 for 40L cells). Furthermore the binding of MTBHsp70 to cancer cells cannot be blocked by recombinant MSLN. These data support the view that binding of scFvMTBHsp70 to these tumor cells occurred via the interaction of the scFv portion of the fusion protein with MSLN on the surface of tumor cells. Binding of these proteins with 40L mesothelioma cells was further compared using fluorescence microscopy. scFvMTBHsp70 shows significantly stronger binding intensity as compared to MTBHsp70 (Additional file 1: Figure S1A and B). In order to determine if scFvMTBHsp70 also binds to normal tissue in addition to tumor cells we incubated the fusion protein with peripheral blood leukocytes (PBLs) splenocytes or peritoneal mesothelial cells from healthy FVB/NJ mice and stained the cells using the same method as was used for staining tumor cells. As shown in Figure 1E scFvMTBHsp70 binds with peritoneal mesothelial cells at a low level compared to ovarian cancer and mesothelioma cells. Binding of the fusion protein is at very low or undetectable levels on PBLs and splenocytes. Since scFvMTBHsp70 may potentially target peritoneal mesothelial cells we also explored whether it could induce inflammation in peritoneal mesothelial tissues. We injected na¯ve mice with saline scFvMTBHsp70 or MTBHsp70 plus P4 scFv at the same doses as those used for tumor therapy described in Method sacrificed the mice 7 days post final treatments and examined haematoxylin and eosin (H&E) stained sections prepared from abdominal and intestinal peritoneum. Light microscopic examination revealed no evidence of inflammation and no infiltration of inflammatory cells such as macrophages or granulocytic cells around the mesothelial cells lining the abdominal and intestinal peritoneum of the actively treated or control animals. Representative microscopic images are shown in Additional file 2: Figure S2. scFvMTBHsp70 significantly prolongs ascites-free survival and overall survival in ovarian cancer- or mesothelioma-bearing mice To determine whether scFvMTBHsp70 can prolong survival in tumor-bearing mice we first evaluated the protein in a syngeneic mouse model of papillary ovarian cancer using immune-competent FVB/NJ mice. As shown in Figure 2A scFvMTBHsp70 prolonged both ascites-free and overall survival time compared with saline or the equimolar mixture of MTBHsp70 plus P4 scFv. To further support the efficacy of this fusion protein in prolonging survival in MSLN-expressing tumor-bearing mice we evaluated this protein in a second syngeneic mouse model of mesothelioma using immune-competent C57BL/6 mice. Animals treated with scFvMTBHsp70 showed significantly prolonged ascites-free and overall survival time compared with saline- or MTBHsp70 plus P4 scFv- treated mice (Figure 2B). A and B Kaplan-Meier survival curves of tumor-bearing mice following treatment with scFvMTBHsp70 control proteins or normal saline. A In a syngeneic mouse model of papillary ovarian cancer in immune-competent FVB/NJ mice scFvMTBHsp70 prolonged ascites-free survival time compared with saline (n?=?10 per group representative of two independent experiments; median survival (Med. sur.)?=?47 days vs. 37.5 days) or the mixture of MTBHsp70 plus P4 scFv (Med. sur. = 39 days). scFvMTBHsp70 also prolonged overall survival time in the mice compared with saline (Med. sur. = 51.5 days vs. 43 days) or the mixture of MTBHsp70 plus P4 scFv (Med. sur. = 43 days). B In a syngeneic mouse model of mesothelioma in immune-competent C57BL/6 mice the fusion protein prolonged ascites-free survival time compared with saline-treated mice (n?=?20 per group pooled from two independent experiments; Med. sur. = 28 days vs. 26 days) or the mixture of MTBHsp70 plus P4 scFv (Med. sur. = 27 days). The fusion protein also prolonged overall survival time compared with saline (Med. sur. = 36 days vs. 31 days). P values were determined using the log-rank test. *p?<?0.05; **p?<?0.01; ***p?<?0.001. scFvMTBHsp70 enhances anti-tumor CD8+ T-cell responses in ovarian tumor-bearing mice To investigate whether the anti-tumor effects of scFvMTBHsp70 was associated with anti-tumor effector CD8+ T-cell responses we re-stimulated splenocytes from ovarian tumor-bearing FVB mice that received different treatments with the CD8+ T-cell Her2/neu epitope or MSLN Ld1 as a negative control ex vivo and analyzed the cells for production of IFN? and Granzyme B using flow cytometry. We previously showed that Her2/neu is expressed by BR5FVB1 cells [25]. Ld1 is an in-house designed H2d-restricted MSLN peptide that did not induce ovarian cancer specific T-cell response in H-2q FVB mice. We demonstrated significantly greater anti-Her2/neu CD8+ T-cell responses in splenocytes from scFvMTBHsp70-treated mice compared to mice treated with saline or a simple mixture of MTBHsp70 plus P4 scFv as measured by IFN? and Granzyme B production by CD8+ T cells (Figure 3A and B). This indicates that scFvMTBHsp70 enhances anti-tumor specific CD8+ T-cell responses in ovarian tumor-bearing mice. However no significant difference was seen in the number of tumor-infiltrating CD8+ T cells and no tumor-infiltrating Foxp3+ T cells were seen in tumors from mice in different treatment groups indicating that scFvMTBHsp70 may improve effector cell function rather than the number of intratumoral CD8+ T cells (Additional file 3: Figure S3A and B). Figure 3 Anti-tumor specific CD8+ T-cell functions in tumor-bearing mice following different treatments. A Splenocytes harvested from mice treated with scFvMTBHsp70 fusion protein equimolar mixture of MTBHsp70 plus P4 scFv or saline (n = 10 per group) were re-stimulated with Her2/neu peptide or MSLN Ld1 peptide. Results are reported as the difference between nonstimulated (media alone) and stimulated cells and expressed as the frequency of parent CD3+CD8+ cells. P values were determined using One-Way ANOVA followed by Dunnett™s multiple comparison tests. B Representative flow data are presented. C In vivo CD8+ T-cell depletion study. FVB/NJ mice were injected i.p. with anti-CD8 mAb or an isotype-matched irrelevant rat IgG2a and were treated with scFvMTBHsp70 or saline as described in the methods. CD8+ T-cell depletion significantly and negatively impacted ascites-free survival in the scFvMTBHsp70 treated BR5FVB1 tumor-bearing animals compared to non depleted actively treated (n = 10 per group representative of two independent experiments; Med. sur. = 32.5 days vs. 48 days) animals. After CD8+ T cells depletion scFvMTBHsp70 treatment did not delay onset of disease (clinically evident ascites) compared with saline (Med. sur. = 32.5 days vs. 31.5 days; p = 0.5938). P values were determined using log-rank test. *p< 0.05; **p < 0.01 ***p < 0.001. scFvMTBHsp70 is able to prime an adaptive tumor-specific immune response that has an absolute requirement for tumor-specific CD8+ T cells To determine whether CD8+ T cells play a major role in the protective anti-tumor effects observed in mice treated with scFvMTBHsp70 we conducted in vivo CD8+ T-cell depletion experiments using monoclonal antibodies. The absence of circulating CD8+ cells in peripheral blood following depletion was confirmed by flow cytometry (Additional file 4: Figure S4A and B). As shown in Figure 3C CD8+ T-cell depletion significantly and negatively impacted ascites-free survival in the scFvMTBHsp70-treated BR5FVB1 tumor-bearing animals compared to non-depleted actively-treated animals. Following CD8+ T-cell depletion scFvMTBHsp70 treatment did not delay onset of disease (clinically evident ascites) compared to saline treatment. Therefore our data suggest that the priming of an adaptive tumor-specific immune response by scFvMTBHsp70 treatment is chiefly mediated by tumor-specific CD8+ T cells. scFvMTBHsp70 stimulates maturation of murine bone marrow-derived dendritic cells In order to investigate immunological mechanisms involved in the scFvMTBHsp70-enhanced anti-tumor immune response we first examined if the scFvMTBHsp70 or MTBHsp70 proteins used in our study could stimulate maturation of bone marrow-derived dendritic cells (BMDCs) as shown in previous studies [1617]. We stimulated CD11c+ BMDCs with 2 ?g/ml of scFvMTBHsp70 or an equimolar amount of MTBHsp70 (1.3 ?g/ml). 1 ?g/ml lipopolysaccharide (LPS) was used as positive control. To determine whether the BMDC maturation was attributable to LPS contamination of the recombinant proteins used in this study we also incubated BMDCs with 0.1 ng/ml LPS which was the equivalent amount of endotoxin found in 2 ?g/ml scFvMTBHsp70. After a 24 h-incubation both scFvMTBHsp70 and MTBHsp70 induced DC maturation indicated by an increase in the expression of CD40 CD80 CD86 and MHC class II molecules in comparison to the control cultures in medium. The increased expression of these DC maturation markers were comparable to those on cells stimulated with 1 ?g/ml LPS. The contamination control showed that addition of 0.1 ng/ml LPS did not replicate the effects of scFvMTBHsp70 or MTBHsp70 allowing us to discriminate the scFvMTBHsp70- or MTBHsp70-specific effects from effects of LPS (Figure 4A and B). Figure 4 scFvMTBHsp70 induces DC maturation and promotes antigen presentation and cross-presentation. A CD11c+ BMDCs isolated form FVB/NJ mice were incubated for 24 h with 2 ?g/ml scFvMTBHsp70 1.3 ?g/ml MTBHsp70 1 ?g/ml LPS as positive control or 0.1 ng/ml LPS as contamination control (thick lines) or medium only (solid) stained for CD11c CD40 CD80 CD86 and MHC II and analyzed by flow cytometry. Histograms were gated on CD11c+ DCs. Data are representative of three independent experiments in duplicate wells. B Median fluorescence intensity (MFI) of LPS- or protein-stimulated BMDCs normalized to MFI of BMDCs maintained in medium. Data are expressed as means?±?SEM in arbitrary units. P values were determined using One-Way ANOVA followed by Dunnett™s multiple comparison tests. C BMDCs cultured from FVB/NJ mice were pulsed with BR5FVB1 cells alone (Column a) or BR5FVB1 cells pre-complexed with MTBHsp70 (Column b) or scFvMTBHsp70 (Column c) and then incubated with BR5FVB1 tumor cell-primed T cells. Intracellular granzyme B and IFN? expressions in CD3+CD4+ and CD3+CD8+ T cells were analyzed by flow cytometry. Data from three independent experiments in duplicate wells are pooled and analyzed using One-Way ANOVA followed by Turkey™s multiple comparison tests. Data are presented as mean?±?SEM. D Representative flow data are presented. E scFvMTBHsp70 enhanced tumor cell immunogenicity in vivo. Results are reported as the difference between nonstimulated (media alone) and stimulated cells and expressed as the frequency of parent CD3+CD4+ or CD3+CD8+ cells. P values were determined using One-Way ANOVA followed by Turkey™s multiple comparison tests. *p?<?0.05; **p?<?0.01; ***p?<?0.001; ****p?<?0.0001. The scFvMTBHsp70 fusion protein increases tumor antigen presentation and cross-presentation by DC in vitro In the current study we demonstrated that splenic CD8+ T cells from scFvMTBHsp70-treated tumor-bearing mice could produce cytokines upon specific tumor antigen stimulation ex vivo which was associated with their antitumor therapeutic efficacy in vivo. To determine whether scFvMTBHsp70 promotes tumor specific T-cell responses by enhancing antigen presentation and cross-presentation by antigen presenting cells we co-cultured BR5FVB1 tumor cell-primed T cells with DCs that had been pulsed with BR5FVB1 tumor cells in the presence of scFv-MTBHsp70 MTBHsp70 or PBS. The scFvMTBHsp70/tumor cell-pulsed DCs induced significantly higher production of IFN-? and Granzyme B from both CD4+ and CD8+ tumor cell-primed T cells as compared with MTBHsp70 or PBS indicating that scFvMTBHsp70 enhances tumor antigen presentation and cross-presentation by DCs (Figure 4C and D). scFvMTBHsp70 enhances tumor cell immunogenicity in vivo Having demonstrated in vitro that scFvMTBHsp70 enhances tumor antigen presentation and cross-presentation by DCs we next explored whether scFvMTBHsp70 enhances tumor antigen presentation and cross-presentation by DCs and consequently enhances tumor cell immunogenicity in vivo. It has been demonstrated that the high density of DCs at dermal sites facilitates the capture of tumor antigens and that local inflammation induces DC maturation and migration into draining lymph nodes where they present antigens to na¯ve T cells generating a tumor specific immune response [26]. We primed FVB mice with an intradermal (i.d.) injection of mitomycin C-treated BR5FVB1 tumor cells followed by a booster i.d. injection of BR5FVB1 tumor cells with or without scFvMTBHsp70 or MTBhsp70. After 20 days we dissociated skin-draining lymph nodes and re-stimulated lymph node lymphocytes with Her2/neu peptides mitomycin C-treated BR5FVB1 tumor cells or BR5FVB1 tumor cell lysate and performed flow cytometric analysis for the presence of Granzyme B-generating CD4+ and CD8+ T cells. As shown in Figure 4E we demonstrated that Granzyme B-generating CD4+ and CD8+ T cells were significantly enhanced in mice that were immunized with scFv-MTBHsp70-bound tumor cells as compared to those in the mice immunized with tumor cells alone MTBHsp70-bound tumor cells or saline. Discussion We have developed a novel protein-based immunotherapy consisting of a fusion of an anti-MSLN scFv of human origin and recombinant mycobacterial heat shock protein 70 that has the ability to adjuvant significant T-cell responses against specific tumor antigens. P4 scFv directed against MSLN a surface antigen overexpressed on several types of tumor cells is used as a means of targeting the immunotherapeutic agent. We have demonstrated that this bifunctional fusion protein effectively binds BR5FVB1 ovarian cancer cells or 40L mesothelioma cells through the interaction of scFv with MSLN on the surface of tumor cells. We found that the fusion protein significantly prolonged survival time in syngeneic mouse models of papillary ovarian cancer and malignant mesothelioma. Treatment with the fusion protein induced significant tumor-specific CD8+ T-cell immune responses in the splenocytes of ovarian tumor-bearing mice. Furthermore in vivo CD8+ T-cell depletion studies demonstrated that this protective antitumor effect is mainly mediated by tumor-specific CD8+ T cells. Treatment using a mixture of MTBHsp70 plus P4 scFv for ovarian tumor or malignant mesothelioma-bearing mice did not increase survival or enhance tumor-specific immune responses suggesting that only through fusion of the two elements is the immune system effectively activated. We also demonstrated that this approach does not induce inflammation in the abdominal or intestinal mesothelial tissues as a result of a bystander interaction with MSLN on normal mesothelial cells. Several properties of MTBHsp70 appear in this study to contribute to the generation of tumor-specific CD4+ and CD8+ T-cell immune responses. First it induces maturation of DCs. Although several previous studies suggested that MTBHsp70 had pro-inflammatory properties only when contaminated with LPS [2728] other studies have decisively demonstrated that MTBHsp70 alone while not LPS promotes DC maturation and innate immune responses [161729]. In our study we used a fusion protein generated from a mammalian cell expression system ensuring a minimal amount of LPS contamination. We also incubated DCs with the same amount of LPS as that found in the fusion protein and failed to replicate the effects observed with the fusion protein supporting the view that maturation of DCs can be attributed to the fusion protein rather than LPS. Secondly MTBHsp70 is capable of delivering epitopes for enhanced processing and MHC-I presentation by DCs to na¯ve CD8+ T cells a process known as cross-presentation [30]. Mycobacterial Hsp70 fusion proteins have been shown to elicit both CD4+ and CD8+ T-cell responses although priming of CD8+ T cells does not appear to require CD4+ T cells [3132]. We demonstrated in this study that the MSLN-targeted fusion protein elicited significant tumor-specific CD8+ T-cell immune responses in ovarian cancer-bearing mice and this adaptive antitumor response has an absolute requirement for tumor-specific CD8+ T cells. Although at the dosing schedule used in these studies tumor-specific T-cell responses did not eventually lead to rejection of the established tumors they significantly prolonged survival time in tumor-bearing mice. DCs are believed to play a pivotal role in the initiation and programming of tumor-specific T-cell responses and are becoming an essential target in efforts to generate therapeutic immunity against cancer [33]. Two main approaches are currently under consideration for providing DCs with tumor-specific antigens. One approach is to culture patient-derived DCs ex vivo with an adjuvant that induces DC maturation in the presence of tumor specific antigens followed by adoptive transfer into the patient [33]. This approach is fraught with technical and practical difficulties such as selection of a suitable antigenic target inappropriate maturation state of selected DCs and the difficulty of generating a sufficient number of DCs ex vivo. In addition a number of investigators have recently reported that ex vivo-derived DC vaccines have an insignificant role in the direct priming of T cells in vivo[33-35]. An alternative approach to generate tumor-specific antigen bearing DCs is to induce them to take up tumor-specific antigens in vivo. It has been shown that in vivo specific targeting of tumor antigens to DCs improves the induction of antigen-specific CD4+ and CD8+ T-cell immunity. In these studies an agonistic anti-CD40 monoclonal antibody was used to mature DCs and eliminate antigen-specific tolerance [36-39]. MTBHsp70 has also been shown to stimulate inflammation and DC maturation via an interaction with CD40 receptors on both DCs and monocytes thus acting as an alternative ligand to CD40L [2940]. In our study we showed the fusion protein up-regulates surface expression of phenotypic markers of DC maturation. Interestingly in addition to CD80 CD86 and MHC class II molecules the expression of CD40 is also enhanced indicating a possible positive feedback loop involving CD40 signaling components. Beyond promoting DC maturation the scFvMTBHsp70 fusion protein also targets tumor cells towards the matured DCs. We propose that binding of the fusion protein with both tumor cells and DCs improves phagocytosis of parts of tumor cells by DCs and therefore any tumor antigen can be processed and loaded on both MHC class II and MHC class I molecules and presented to CD4+ and CD8+ T cells. This could explain the observed augmentation of tumor antigen presentation and cross-presentation brought about by the fusion protein in vitro. This may also explain the observed increased anti-Her2/neu CD8+ T-cell responses in the scFvMTBHsp70-treated ovarian tumor bearing mice although Her2/neu is not directly targeted. We recapitulated these in vitro findings in an in vivo tumor cell immunogenicity study. We used the fusion protein to activate and mature DCs in the skin such as Langerhans cells. These DCs then captured tumor cells or tumor cell fragments through the connection established by the fusion protein and migrated to the draining lymphoid organs where they presented tumor antigens to na¯ve T cells. T cells recovered from the draining lymph node showed significantly enhanced responses to stimulation with a range of tumor antigens. Conclusion Our study provides preclinical evidence that supports a protein-based immunotherapy that induces anti-tumor immune responses which normally require dendritic cell-based approaches. The MSLN-targeted MTBHsp70 fusion protein binds MSLN on tumor cells recruits and activates APCs including DCs loads DCs in vivo with the broadest profile of naturally processed tumor antigens promotes tumor antigen presentation and cross-presentation and enhances tumor specific CD4+ and CD8+ T-cell responses (Figure 5). Our study supports the continued exploration of this novel fusion protein alone or in combination with immune checkpoint inhibitors following conventional surgical reduction and chemotherapy for MSLN-expressing cancers. This new approach could significantly increase time to recurrence and survival in humans with ovarian cancer and mesothelioma where effective second line treatment options are very limited. Figure 5 A schematic model showing that the scFvMTBHsp70 fusion protein binds with MSLN on tumor cells and activates antigen presenting cells (APCs) thus promoting uptake of tumor cells or tumor cell fragments and promoting tumor antigen presentation and cross-presentation as well as adjuvanting tumor specific CD4 + and CD8 + T-cell responses. Methods Production of proteins The plasmid pQE30-MTBhsp70 that encodes full length MTBHsp70 was a generous gift from Dr. Peter Sveshnikov (Moscow Medical Academy Russia). The plasmid pTOR2-scFv that encodes an scFv fragment specific to MSLN and the recombinant P4 scFv protein [13] generated and purified from yeast were generous gifts from Dr. Nathalie Scholler (Penn Ovarian Cancer Research Center University of Pennsylvania). The DNA fragment corresponding to a 15 amino acid linker (GGGGSGGGGSGGGGS) was connected to the scFv at its C-terminal using an overlap PCR approach. The PCR product scFv-linker was subcloned into pQE30-MTBhsp70 at the N-terminal of MTBhsp70. The DNA fragment for scFvMTBhsp70 was PCR amplified and cloned into pPMY5 (Promab) downstream of a human IgG1 Fc domain and separated from the Fc region by the signal cleavage sequence for Tobacco Etch Virus protease (TEV enzyme). scFvMTBHsp70 the MSLN-targeted fusion protein was generated from HEK293 cells and purified using Protein G resin (Pierce). The Fc region of the Protein G eluted protein was then cleaved from the fusion protein by TEV enzyme (Promab) digestion. MTBHsp70 was generated using the same expression system. The production and purification of these two proteins was accomplished by Promab Biotechnologies Inc. at Richmond CA. After purification and hIgG-Fc tag removal the integrity of scFv-MTBHsp70 and MTBHsp70 were determined by SDS-PAGE followed by staining with RAPIDstain (G-Bioscience). Endotoxin contamination levels in scFvMTBHsp70 and MTBHsp70 were determined by Limulus Amebocyte Lysate Assay (LAL-assay Cambrex). Cells The BR5FVB1 ovarian cancer cells a kind gift from Dr. Orsulic in Women™s Cancer Research Institute at Cedars-Sinai Medical Center [41] or 40L mesothelioma cells a kind gift from Dr. Kane in Department of Pathology and Laboratory Medicine at Brown University [42] were maintained at 37°C in DMEM with 2 mmol/L L-glutamine 10 units/ml penicillin 10 ?g/ml streptomycin and 10% fetal bovine serum in humidified atmosphere with 5% CO2. Cells were cultured until 80% confluent and harvested with enzyme-free cell-dissociation buffer (Gibco) for in vitro tumor cell binding assays and cross-presentation studies or harvested with Trypsin EDTA (Mediatech) for animal injections. Mouse PBLs were obtained from FVB mice via tail vein bleeds after lysis of erythrocytes using M-lyse buffer (R&D systems). Small pieces of parietal peritoneal membrane were taken from the mice and digested in enzyme-free cell-dissociation buffer to obtain mouse peritoneal mesothelial cells. To test whether scFvMTBHsp70 or MTBHsp70 binds to the MSLN-expressing tumor cells or non-cancerous cells we incubated BR5FVB1 ovarian tumor cells 40L mesothelioma cells or normal cells from FVB mice including PBLs splenocytes and peritoneal mesothelial cells with 40 ?g/ml scFvMTBHsp70 or 26 ?g/ml MTBHsp70 followed by anti-MTBHsp70 (IgG2a) (Biodesign International) biotinylated anti-IgG2a (BD Bioscience) and Streptavidin-APC (BioLegend) and then analyzed the tumor cells by flow cytometry. As controls cells were incubated with the reagents described above except scFvMTBHsp70 or MTBHsp70. To confirm that scFv portion of the fusion protein binds to MSLN on the surface of tumor cells scFvMTBHsp70 or MTBHsp70 was preincubated with 12 ?g/ml of recombinant human MSLN (R&D Systems) for 30 min before adding to the cells. For fluorescence microscopy cells were cultured on coverslips until 50% confluent stained with 10 ?g/ml scFvMTBHsp70 or 6.5 ?g/ml MTBHsp70 followed by mouse anti-MTBHsp70 (1:500 dilution) and Donkey anti-mouse Alexa Fluor 594 (Invitrogen 1:500 dilution). Cells were observed using a Nikon Eclipse TiE fluorescence microscope. In some experiments tumor cells were treated with 20 ?g/ml mitomycin C at a concentration of 5 — 106/ml for 1 h in a 37°C water bath and washed with complete medium at least 3 times before use. Animal models and tumor treatment Ovarian cancer was established by i.p. injection of syngeneic cancer cells BR5FVB1 (107 cells per mouse) into 6-week-old female FVB/NJ mice as previously described [25]. All mice were purchased from Jackson laboratories. Intraperitoneal mesotheliomas were established by i.p. injection of syngeneic 40L cells (2?—?106 per mouse) into 6-week-old male C57BL/6 mice as previously described [42]. Mice with ovarian tumors were treated 7 days after BR5FVB1 tumor cell inoculation with i.p. injections of scFvMTBHsp70 (2 ?g per mouse) normal saline or an equimolar mixture of MTBHsp70 plus P4 scFv. This was followed by "

Lung_Cancer

" Materials and Methods We examined the anti-tumor effect of Ad-REIC on 25 NSCLC cell lines in vitro and A549 cells in vivo. Two of these cell lines were artificially established as EGFR-tyrosine kinase inhibitor (TKI) resistant sublines. Results Ad-REIC-treatment inhibited the cell viability by 40% or more in 13 (52%) of the 25 cell lines at multiplicity of infection (MOI) of 20 (20 MOI). These cell lines were regarded as being highly sensitive cells. The cell viability of a non-malignant immortalized cell line OUMS-24 was not inhibited at 200 MOI of Ad-REIC. The effects of Ad-REIC on EGFR-TKI resistant sublines were equivalent to those in the parental cell lines. Here we demonstrated that Ad-REIC treatment activated c-Jun N-terminal kinase (JNK) in NSCLC cell lines indicating the induction of ER stress with GRP78/BiP (GRP78) up-regulation and resulting in apoptosis. A single intratumoral injection of Ad-REIC significantly inhibited the tumorigenic growth of A549 cells in vivo. As predictive factors of sensitivity for Ad-REIC treatment in NSCLC we examined the expression status of GRP78 and coxsackievirus and adenovirus receptor (CAR). We found that the combination of the GRP78 and CAR expressional statuses may be used as a predictive factor for Ad-REIC sensitivity in NSCLC cells. Conclusion Ad-REIC induced JNK activation and subsequent apoptosis in NSCLC cells. Our study indicated that Ad-REIC has therapeutic potential against NSCLC and that the expression statuses of GRP78 and CAR may predict a potential therapeutic benefit of Ad-REIC. No current funding sources for this study. Introduction Lung cancer is the most common cause of death from cancer worldwide and the metastatic form is a major factor leading to mortality [1]. There are two major histological subtypes of lung cancer: non-small cell lung cancer (NSCLC) and small cell lung cancer. Recent intensive studies have identified causative molecular alterations that have directly led to the development of new therapeutic strategies and have improved patient prognosis [2]. For example mutations of the epidermal growth factor receptor gene (EGFR) are found in approximately 30% of NSCLCs especially in lung adenocarcinomas and EGFR-tyrosine kinase inhibitors (TKIs) are particularly effective in these tumors [3] [4]. More recently crizotinib has been shown to be effective for NSCLCs with an EML4-ALK fusion gene [5] [6]. However the number of patients with these alterations is limited and little improvement in prognosis has been obtained in NSCLCs without these drug-sensitive alterations. Furthermore acquired resistance eventually occurs in the majority of EGFR-mutant tumors which had previously responded to EGFR-TKI after an average of 10 months of treatment [7]. Thus a new therapeutic modality is needed to improve the clinical outcome of patients with lung cancer. REIC/Dkk-3 a member of the Dickkopf (Dkk) gene family is originally found in immortalized cells and has been reported to be a tumor suppressor; its expression is significantly down-regulated in a broad range of cancer cell types including lung cancer [8]. The heatmap image of messenger RNA (mRNA) expression of REIC/Dkk-3 gene from the UCSC Cancer Genome Browse which is freely available public database (://genome-cancer.ucsc.edu/) (we downloaded the data on July 16 2013) showed that REIC/Dkk-3 gene expression was reduced in majority of examined samples of both lung adenocarcinomas and squamous cell carcinomas compared with normal lung tissues (Figure S1). In addition it could be confirmed from a public database that expression of REIC/Dkk-3 was also low in many NSCLC cell lines (Gene Expression Omnibus repository [http://www.ncbi.nlm.nih.gov/geo GEO accession GSE4824]). REIC/Dkk-3 is known to interfere with Wnt signaling via Wnt receptors [9] [10] and was previously reported to play a distinct role in the induction of apoptosis and the inhibition of metastasis [11] [12]. The induction of apoptosis in cancer cells is mainly caused by endoplasmic reticulum (ER) stress induced by the overproduction of REIC/Dkk-3 in the cells. ER stress triggers the activation of c-Jun N-terminal kinase (JNK) which is a critical event in apoptosis induced by the overproduction of REIC/Dkk-3 using an adenovirus vector (Ad-REIC) [11] [13]. In our previous studies we found that Ad-REIC had a therapeutic effect on various types of human cancer including the prostate testis pleura and breast carcinomas [11] [13]“[15]. Ad-REIC infection and REIC/Dkk-3 protein are also known to up-regulate the anti-tumor immunosystem [16]. Based on preclinical data a clinical trial using Ad-REIC for human prostate cancer has been ongoing in Japan and the USA (NCT01197209). In this study we investigated the therapeutic effect of Ad-REIC on NSCLC cells in vitro and in vivo. We also examined factors related to the sensitivity of cell lines to Ad-REIC as a step toward the development of customized Ad-REIC therapy for patients with NSCLC. Materials and Methods Ethics Statement This study was carried out in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. The protocol was approved by the Animal Care and Use Committee of Okayama University (Permit Number: OKU-2012-549). All surgery was performed under ketamine and xylazine anesthesia and all efforts were made to minimize suffering. Cell lines Sixteen cell lines of human lung adenocarcinoma 3 squamous cell carcinoma 3 large cell carcinoma 1 adenosquamous cell carcinoma 2 EGFR-TKI-resistant sublines from HCC827 and PC-9 cells (HCC827-GR-high2 and RPC-9) the human mesothelioma cell line MSTO-211H (211H) and the normal human fibroblast cell line OUMS-24 were used in this study (). The details of cell lines used in this study are described in Method S1. The HCC827-GR-high2 and RPC-9 cell lines were established as described previously [17] [18]. OUMS-24 was established at our institution [19]. .0087900.t001 Characteristics and the inhibition rate of cell viability on NSCLC cell lines. Cell lines Histological subtypes Genetic alterations Inhibition rate (%) GRP78/Actin ratio (Low/High) CAR/Actin ratio (Low/High) Category 20 MOI 100 MOI 200 MOI H2009 AD KRAS mut 60 - - 0.13 (Low) 0.73 (High) A H2228 AD EML4-ALK fusion 60 - - 0.27 (High) 0.70 (High) B HCC827 AD EGFR mut 56 - - 0.25 (High) 0.66 (High) B HCC827-GR-high2 AD EGFR mut 55 - - 0.12 (Low) 2.12 (High) A H2087 AD BRAF mut 55 - - 0.14 (Low) 1.22 (High) A HCC4006 AD EGFR mut 54 - - 0.15 (Low) 0.60 (High) A HCC4011 AD EGFR mut 54 - - 0.22 (Low) 0.13 (Low) B H522 AD W/t 50 - - 0.27 (High) 1.55 (High) B H157 SQ KRAS mut 50 - - 0.13 (Low) 0.98 (High) A A549 AD KRAS mut 49 - - 0.07 (Low) 0.55 (High) A H838 AD W/t 47 - - 0.10 (Low) 1.33 (High) A H1299 LC NRAS mut 47 - - 0.08 (Low) 0.68 (High) A H661 LC W/t 40 - - 0.42 (High) 1.89 (High) B H1819 AD HER2 amp 23 46 63 0.46 (High) 1.55 (High) B H1993 AD W/t 22 32 40 0.69 (High) 0.09 (Low) C H441 AD KRAS mutation 18 49 61 0.21 (Low) 0.17 (Low) B H2170 SQ W/t 18 28 42 0.65 (High) 0.09 (Low) C HCC15 SQ HER4 mut 17 21 43 0.18 (Low) 0.12 (Low) B H460 LC KRAS PIK3CA mut 17 57 78 0.98 (High) 0.10 (Low) C PC-9 AD EGFR mut 16 24 55 0.20 (Low) 0.16 (Low) B H1975 AD EGFR mut 10 45 63 0.41 (High) 0.19 (Low) C HCC366 ADSQ W/t 8 42 54 0.39 (High) 0.08 (Low) C RPC-9 AD EGFR mut 4 15 40 0.24 (Low) 0.16 (Low) B H358 AD KRAS mut 6 59 73 0.57 (High) 1.21 (High) B H3255 AD EGFR mut 3 16 40 0.54 (High) 0.59 (High) B 211H MM - 5 13 46 - - - OUMS-24 NHF - 5 0 0 - - - NSCLC non-small cell lung cancer; AD adenocarcinoma; SQ squamous cell carcinoma; LC large cell carcinoma; ADSQ adeno-squamous cell carcinoma; MM malignant mesothelioma; NHF normal human fibroblast; mut mutation; W/t. wild type; MOI multiplicity of infection. Adenovirus vector carrying REIC/Dkk-3 REIC/Dkk-3 was overexpressed using an adenovirus (Ad-REIC) that we have previously generated [11]. A full-length cDNA of REIC/Dkk-3 was integrated into a cosmid vector pAxCAwt and transferred into an adenovirus vector by the COS-TPC method (Takara Bio Shiga Japan). An adenovirus vector carrying LacZ gene (Ad-LacZ) was also used as control [11]. Cell viability assay Cells were plated in 96-well plates at a density of 1.5×103 cells/well at 48 h after infection with Ad-LacZ or Ad-REIC at a multiplicity of infection (MOI) of 20100 or 200 MOI. Cell viability was evaluated 3 days later using an MTS assay with CellTiter 96 Aqueous One Solution Reagent (Promega Madison WI). Apoptosis assay To examine the in vitro induction of apoptosis after treatment we seeded the cells in 6-well plates and incubated them for 24 h. The cells were treated with Ad-LacZ or Ad-REIC at 20 MOI in serum-free medium (500 µL) for 2 h; the medium was then exchanged for fresh complete medium (2 mL). After an additional 48 h of incubation Hoechst 33342 dye (Sigma-Aldrich St. Louis MO) was added to the medium at a concentration of 2 µg/mL and the cells were incubated in the dark for 10 min. Hoechst 33342 is an intercalating dye that allows the determination of variations in the total chromatin quantity and the degree of chromatin condensation [15]. Using fluorescence microscopy we identified apoptotic cells by the presence of highly condensed or fragmented nuclei. Apoptotic cells were counted in 5 different fields under microscopic observation. Western blot analysis The detailed protocol for the Western blot analysis is described in Method S1. It was performed under conventional conditions using the following antibodies: rabbit anti-human REIC/Dkk-3 antibody raised in our laboratory [11]; rabbit anti-human GRP78/BiP (GRP78) (ab21685; Abcam Cambridge MA); rabbit anti-human SAPK/JNK (#9252) and rabbit anti-human phospho-SAPK/JNK (Thr183/Tyr185; #9251) (Cell Signaling Technology Beverly MA); rabbit anti-human coxsackievirus and adenovirus receptor (CAR) (HPA030411; Atlas antibodies Stockholm Sweden); and mouse anti-actin (MAB1501; Millipore Billerica MA). The following secondary antibodies were used: goat anti-rabbit or anti-mouse IgG-conjugated horseradish peroxidase (Santa Cruz Biotechnology Santa Cruz CA). To detect the specific signals the membranes were examined using ECL plus Western Blotting Detection Reagents (Amersham Biosciences UK Limited Buckinghamshire UK). In addition the band intensities for GRP78 CAR and actin representing their expression levels were measured using ImageQuant TL software (GE Healthcare Bioscience) and quantified by GRP78 or CAR/actin ratio. Tumor growth assay in vivo A549 cells (5×106 in 50 µL of phosphate buffered saline [PBS]) mixed with 50 µL of Matrigel (BD Biosciences San Jose CA) were subcutaneously injected into the right flank of adult female BALB/c nu/nu mice (CLEA Japan Tokyo Japan). The tumor volume was calculated using the empirical formula V?=?1/2×[(the shortest diameter)2×(the longest diameter)]. When the tumors had reached approximately 50“100 mm3 mice (n?=?15) were randomly divided into 3 treatment groups: (a) PBS; (b) Ad-LacZ; and (c) Ad-REIC. Viruses (1×109 pfu) in 100 µL of serum-free medium were administered intratumorally. At the end of experiments mice were sacrificed after 24-days after the viral injection and tumors were harvested measured and photographed. Statistical analyses All data were analyzed using STATA ver.12 (STATA Corp. College Station TX). Fisher's exact test was applied when appropriate. For a comparison of induction of apoptosis between Ad-REIC-treated and Ad-LacZ-treated A549 cells a Cochran-Mantel-Haenszel statistics was applied for comparing. Repeated measurement ANOVA was applied for the comparison of xenotransplanted NSCLC tumor sizes among PBS Ad-LacZ and Ad-REIC. P<0.05 was considered significant. All tests were two-sided. Results Effect of Ad-REIC on NSCLC cell lines We examined the inhibition of cell viability using Ad-REIC and an MTS assay. In 13 (52%) of 25 NSCLC cell lines Ad-REIC treatment at 20 MOI inhibited the cell viability (40%“60% inhibition) compared with Ad-LacZ treatment ( Figure 1). These cell lines were regarded as highly sensitive to Ad-REIC. In contrast 12 cell lines (48%) were not inhibited by Ad-REIC treatment at 20 MOI and were regarded as resistant cells. OUMS-24 was not inhibited at 20 or 200 MOI of Ad-REIC. Of note Ad-REIC treatment at 100 and 200 MOI improved the inhibition of cell viability (100 MOI: 15%“59% inhibition 200 MOI: 40%“78% inhibition) compared with Ad-LacZ treatment (). Thus we defined 20 MOI as a low MOI value and 200 MOI as a high MOI value. For comparison Ad-REIC treatment was also performed in the human mesothelioma cell line 211H which we previously reported to be Ad-REIC-sensitive [14]. The 211H was not inhibited at 20 MOI but was inhibited at 200 MOI of Ad-REIC (). The known molecular characteristics of each cell line are shown in . The 25 NSCLC cell lines consisted of 8 EGFR-mutant 6 KRAS-mutant 1 HER4-mutant 1 NRAS-mutant 1 PIK3CA-mutant 1 EML4-ALK fusion 1 HER2-amplified and 6 cell lines without gene alterations listed. Nine of the 17 EGFR-wild type cell lines were sensitive to Ad-REIC. HCC827 and its resistant subline HCC827-GR-high2 showed a similar degree of sensitivity to Ad-REIC. No trend in molecular genotype was seen between the sensitive and non-sensitive cell lines. These results suggested that the effect of Ad-REIC does not depend on a known molecular genotype. .0087900.g001 Figure 1 Sensitivity and predictive factors of sensitivity for Ad-REIC treatment in 25 NSCLC cell lines. The inhibition rates of 25 NSCLC cell lines transfected with Ad-REIC compared to Ad-LacZ are shown as black bar in 20 MOI and white bar in 200 MOI. Thirteen cell lines with over 40% inhibition rate in 20 MOI are defined as highly sensitive and 12 cell lines with lower inhibition rate in 20 MOI are defined as resistant. All the resistant cell lines shows over 40% inhibition rate in 200 MOI. The cell lines are classified into 3 categories based on the GRP and CAR protein expression level as follows; category A (low GRP/high CAR) category B (low GRP/low CAR or high GRP/high CAR) category C (high GRP/low CAR). All 8 highly sensitive cell lines were included in category A and all 5 resistant cell lines were included in category C. Sq; squamous cell carcinoma AD; adenocarcinoma LC; large cell carcinoma ADSQ; adenosquamous cell carcinoma MM; malignant mesothelioma NHF; normal human fibroblast. Hoechst 33342 staining was performed in A549 cells to examine the induction of apoptosis. Apoptotic cells were observed in Ad-REIC-treated A549 cells (Figure 2a). The mean rate of apoptosis was 22% and it was significantly (p<0.001 by Cochran-Mantel-Haenszel test) increased in comparison with the control Ad-LacZ treatment. .0087900.g002 Figure 2 Ad-REIC induced JNK activation and subsequent apoptosis in NSCLC cells. (a) Induction of apoptosis after in vitro Ad-REIC treatment as examined in A549 cells using Hoechst 33342 staining. The upper panel indicates the appearance of apoptotic cells after Ad-REIC treatment. The lower panel shows the apoptotic rate of A549 cells after the indicated treatment. A total of 5 different fields were examined under a microscope to determine the apoptotic rate. A significant difference was observed (*p<0.001) between the Ad-LacZ and the Ad-REIC treatment. (bar: 100 µm) (b) Western blot analysis for proteins involved in signal transduction triggered by Ad-REIC. Cells were harvested at 48 h after transfection with Ad-LacZ or Ad-REIC at 20 MOI. (c) H460 cells which are resistant to adenovirus transduction were harvested at 48 h after transfection with Ad-LacZ or Ad-REIC at 20100 and 200 MOI. The effect of recombinant REIC/Dkk-3 protein on NSCLC cell lines was examined in 7 randomly selected cell lines (NCI-H522 NCI-H611 NCI-H1299 NCI-H1819 NCI-H2009 PC-9 and A549). The MTS assay showed that REIC/Dkk-3 protein did not affect cell viability in the examined cell lines when administered at a concentration ranging from 1 to 200 µg/mL (data not shown). Expression of GRP78 and CAR in response to Ad-REIC therapy As predictive factors of Ad-REIC sensitivity in NSCLC we examined the expressions of GRP78 and CAR; these expression statuses were correlated with the inhibition of cell viability by Ad-REIC in 13 cell lines. A previous study reported that the overexpression of GRP78 inhibited ER-stress which may be oppositely correlated with the effect of Ad-REIC. CAR expression is tightly associated with the efficacy of adenovirus infection which may be positively correlated with the effect of Ad-REIC. Western blotting was performed and the expression level was quantified as shown in and Figure 1. The median (range) of GRP78 and CAR expressions were 0.24 (0.075“0.98) and 0.60 (0.080“2.1) respectively. Based on these data cells with a GRP78 expression level more than 0.25 were defined as High CRP78 expression while those with a GRP78 less than 0.24 were defined as Low GRP78 expression. Regarding the CAR 15 cell lines significantly high level of CAR expression (over 0.50) were defined as High CAR expression while 10 cell lines those with significantly low level of CAR expression (under 0.20) were defined as Low CAR expression. GRP78 expression was low in 8 of the 13 Ad-REIC-sensitive cells (62%) and in 4 of the 12 Ad-REIC-resistant cells (33%). CAR expression was high in 12 of the 13 Ad-REIC-sensitive cells (92%) and in 3 of the 12 Ad-REIC-resistant cells (25%). Next we classified the cell lines into three categories based on the GRP78 and CAR expression statuses; cells with a Low GRP78/High CAR expression were classified as Category A those with Low GRP78/Low CAR or High GRP78/High CAR expression were classified as Category B and those with High GRP78/Low CAR expression were classified as Category C. The high sensitive cell rates were 100% in Category A (8 out of 8 95% confidence interval [CI]: 63“100) 42% in Category B (5 out of 12 95% CI: 15“72) and 0% in Category C (0 out of 5 95% CI: 0“52) (Table 2). The categories were significantly associated with the sensitivity to Ad-REIC treatment (p<0.01). .0087900.t002 Table 2 Ad-REIC sensitivity and categories based on predictive factors. (n) Category A (8) Category B (12) Category C (5) Highly sensitive (13) 8 5 0 Resistant in 20 MOI (12) 0 7 5 JNK and GRP78 expression in NSCLC cell lines treated with Ad-REIC A western blotting analysis demonstrated the significant expression of REIC/Dkk-3 protein in 14 NSCLC cell lines treated with Ad-REIC. In 9 cell lines infected with 20 MOI Ad-REIC treatment resulted in the phosphorylation of JNK and the up-regulation of GRP78 (Figure 2b). In the other 8 cell lines which were relatively resistant to Ad-REIC the activation of JNK and GRP78 were observed at higher MOI values (100 and 200 MOI) (Figure 2c). Effect of Ad-REIC on NSCLC tumors in a xenotransplantation model We investigated the effect of Ad-REIC on the growth of A549 cells in vivo. One week after transplantation when the tumor volume reached 50 to 100 mm3 1×109 plaque-forming units of Ad-REIC or Ad-LacZ in 100 µL of PBS or 100 µL of PBS alone were injected intratumorally. The tumors grew progressively in the PBS and Ad-LacZ treatment groups during the subsequent 24-day observation period. In contrast the tumor growth in the Ad-REIC treatment group was significantly (p<0.001 by repeated measurement ANOVA) suppressed during the observation period (Figure 3ab). .0087900.g003 Figure 3 Anti-tumor effect of Ad-REIC treatment on A549 tumor growth in vivo. (a) The mean volume of the subcutaneous xenograft tumors was calculated for 5 mice in each group. A significant difference was observed between the results of Ad-REIC and Ad-LacZ treatment (*p<0.001 by repeated measurement of ANOVA). (b) Appearance of the tumors at the time of sacrifice after treatment with PBS Ad-LacZ and Ad-REIC. Discussion In the present study we found that Ad-REIC was directly effective in more than half of the NSCLC cell lines that were examined independent of its known driver alterations such as EGFR and KRAS mutations. An animal xenograft model also showed the therapeutic effect of Ad-REIC. The anti-tumor effect of Ad-REIC depends on ER-stress-mediated JNK activation loaded by the overproduction of REIC/Dkk-3 protein resulting in the induction of apoptosis [14] [20]. The activation of JNK which is an essential step in the induction of ER stress and apoptosis by Ad-REIC was observed at 20 MOI in NSCLC cell lines. On the other hand the anti-tumor effect of recombinant REIC/Dkk-3 protein was not observed as in other types of cancers that were previously examined. Originally REIC/Dkk-3 was identified as a secretory protein and was assumed to exert a physiological function but its cell surface receptor and its role as a secretory protein have not been identified. We defined 20 MOI as a low MOI value and 200 MOI as a high MOI value because the normal human fibroblast cell line OUMS-24 was not inhibited at 20 or 200 MOI of Ad-REIC whereas malignant cell lines were inhibited when the MOI value was elevated to 100 and 200 MOI in cell lines in which Ad-REIC had been ineffective at 20 MOI. In NSCLC Ad-REIC was effective at a low MOI value in more than half of the cell lines that were tested. Considering the result that 211H was inhibited only at a high MOI value Ad-REIC might be more effective in NSCLC than in mesothelioma. Patient selection based on the molecular characteristics of tumor cells is an important theme for maximizing the therapeutic benefit and minimizing adverse effects. For this purpose we focused on the GRP78 expression and CAR expression levels. GRP78 is a member of the Hsp70 family which serves as an ER stress-signaling regulator [21]. A previous study showed that the overexpression of GRP78 conferred resistance to a wide variety of chemotherapeutic agents in various kinds of cells [22]. We also showed that the acquired resistance clone of PC-3 cells to Ad-REIC established after repeated exposure to Ad-REIC exhibited a high expression level of GRP78 compared with parental PC-3 cells [13]. Theoretically Ad-REIC should be effective for tumor cells defined as Category A and not as effective for those defined as Category C. Although sensitive cells in Category B were identified all 8 cells in Category A responded to Ad-REIC treatment. These results suggested that the expression statuses of GRP78 and CAR in tumors might be useful as biomarkers for customized Ad-REIC therapy in NSCLC while further confirmation is needed by a large scaled investigation using various kinds of cell lines. As a recent topic of lung cancer treatment EGFR-TKIs have been shown to be effective for the treatment of EGFR-mutant NSCLCs. However acquired resistance to EGFR-TKIs after TKI treatment is a problem that needs to be overcome. In the current study our results showed that the effect of Ad-REIC against acquired EGFR-TKI-resistant cells was equal to that against the parental cells suggesting that Ad-REIC may be useful after the acquisition of resistance to EGFR-TKIs. Although adenovirus vectors carrying appropriate tumor suppressor genes such as REIC/Dkk-3 have great potential for cancer gene therapy they do not exhibit target specificity and therefore may also infect normal cells in the vicinity of cancer cells. The authors reported that the infection of normal human fibroblasts (NHF) with Ad-REIC did not cause the apoptosis of NHF itself but instead induced the production of interleukin (IL)-7. When Ad-REIC-infected NHF were mixed with untreated cancer cells and the mixture was transplanted into mice the growth of the cancer cells was significantly suppressed suggesting an indirect tumor-suppressive effect of Ad-REIC mediated by IL-7 [20]. These findings show that the mis-targeted infection of cancer stroma cells by Ad-REIC activates the immune system through the production of IL-7. In addition the authors reported that REIC/Dkk-3 protein played a cytokine-like role in monocyte differentiation into dendritic-cell-like features in vitro and that the infiltration of CD11c- and CD8-positive (dendritic and killer T cell markers respectively) cells was observed within the treated tumors in vivo. In the experiment using an orthotopic prostate tumor model with pre-established lung metastasis the number of metastatic lung tumors significantly decreased after the injection of Ad-REIC at the primary tumor site in addition to the inhibition of the growth of orthotopic prostate tumors suggesting that anti-cancer immune up-regulation by Ad-REIC treatment in primary tumor sites triggered anti-tumor effects even at distant tumor site [16]. These facts strongly suggest that REIC/Dkk-3 shows an indirect anti-tumor effect through the anti-tumor immune system that is an important factor in the treatment of metastatic disease. Because Ad-REIC has both direct and indirect effects on cancer therapy it may become a powerful therapeutic option as a œone-bullet two-arms anti-cancer agent especially for NSCLCs which often metastasize to other organs. In regards to clinical usage because our data suggest that CAR and GRP78 expression statuses in tumor cells predict the responsiveness of Ad-REIC treatment Ad-REIC treatment should be preferentially performed for patients who are categorized as high sensitive group in early phase of treatment with low dose Ad-REIC. For patients whose tumor cells reveal intermediate or poor effectiveness with low dose Ad-REIC it should be late phase in their treatment with high dose Ad-REIC. For these patients cost effectiveness for treatment and clinical outcome should be carefully considered. As for administration strategy local administration might be preferable rather than systemic administration to minimize the adverse effect in clinical situations. We previously confirmed in mouse model that Ad-REIC could be widely distributed in the bodies after intratumoral local administration and local administration was effective not only directly but also indirectly through the immune system effect [16] [23]. In addition intrapleural local administration could be another administration strategy for the patients with malignant pleural effusions. It has been reported that the intrapleural administration of adenoviral-mediated gene therapy is a useful approach for the generation of anti-tumor immune responses in malignant mesothelioma and metastatic pleural effusion in several clinical trials [24] [25]. In conclusion we demonstrated that Ad-REIC induced JNK activation and subsequent apoptosis in NSCLC cells irrespective of the type of known molecular alterations or the sensitivity to EGFR-TKI. The present study suggests that Ad-REIC has a therapeutic potential for NSCLC and the expression statuses of GRP78 and CAR may be a predictor of Ad-REIC therapy. Supporting Information Figure S1 The heatmap image of mRNA expression of REIC/Dkk-3 gene. The mRNA expression level of REIC/Dkk-3 gene was obtained from the UCSC Cancer Genome Browse which is freely available public database (://genome-cancer.ucsc.edu/) (we downloaded the data on July 16 2013) showed that REIC/Dkk-3 gene expression was reduced in majority of examined samples of both (a) lung adenocarcinomas and (b) squamous cell carcinomas compared with normal lung tissues. (PDF) Click here for additional data file. Method S1 Supporting information for cell lines and Western blot analysis. (DOC) Click here for additional data file. References 1 JemalA SiegelR WardE HaoY XuJ et al (2009) Cancer statistics 2009. CA Cancer J Clin59: 225“24919474385 2 LarsenJE CasconeT GerberDE HeymachJV MinnaJD (2011) Targeted therapies for lung cancer: clinical experience and novel agents. Cancer J17: 512“52722157296 3 ShigematsuH LinL TakahashiT NomuraM SuzukiM et al (2005) Clinical and biological features associated with epidermal growth factor receptor gene mutations in lung cancers. J Natl Cancer Inst97: 339“34615741570 4 Tokumo M Toyooka S Kiura K Shigematsu H Tomii K et al. (2005) The relationship between epidermal growth factor receptor mutations and clinicopathologic features in non-small cell lung cancers. Clin Cancer Res. 5 KwakEL BangYJ CamidgeDR ShawAT SolomonB et al (2010) Anaplastic lymphoma kinase inhibition in non-small-cell lung cancer. N Engl J Med363: 1693“170320979469 6 ShawAT YeapBY SolomonBJ RielyGJ GainorJ et al (2011) Effect of crizotinib on overall survival in patients with advanced non-small-cell lung cancer harbouring ALK gene rearrangement: a retrospective analysis. Lancet Oncol12: 1004“101221933749 7 OxnardGR JanjigianYY ArcilaME SimaCS KassSL et al (2011) Maintained sensitivity to EGFR tyrosine kinase inhibitors in EGFR-mutant lung cancer recurring after adjuvant erlotinib or gefitinib. Clin Cancer Res17: 6322“632821831955 8 TsujiT MiyazakiM SakaguchiM InoueY NambaM (2000) A REIC gene shows down-regulation in human immortalized cells and human tumor-derived cell lines. Biochem Biophys Res Commun268: 20“2410652205 9 KrupnikVE SharpJD JiangC RobisonK ChickeringTW et al (1999) Functional and structural diversity of the human Dickkopf gene family. Gene238: 301“31310570958 10 MaoB WuW DavidsonG MarholdJ LiM et al (2002) Kremen proteins are Dickkopf receptors that regulate Wnt/beta-catenin signalling. Nature417: 664“66712050670 11 AbarzuaF SakaguchiM TakaishiM NasuY KuroseK et al (2005) Adenovirus-mediated overexpression of REIC/Dkk-3 selectively induces apoptosis in human prostate cancer cells through activation of c-Jun-NH2-kinase. Cancer Res65: 9617“962216266978 12 EdamuraK NasuY TakaishiM KobayashiT AbarzuaF et al (2007) Adenovirus-mediated REIC/Dkk-3 gene transfer inhibits tumor growth and metastasis in an orthotopic prostate cancer model. Cancer Gene Ther14: 765“77217599093 13 TanimotoR AbarzuaF SakaguchiM TakaishiM NasuY et al (2007) REIC/Dkk-3 as a potential gene therapeutic agent against human testicular cancer. Int J Mol Med19: 363“36817273781 14 KashiwakuraY OchiaiK WatanabeM AbarzuaF SakaguchiM et al (2008) Down-regulation of inhibition of differentiation-1 via activation of activating transcription factor 3 and Smad regulates REIC/Dickkopf-3-induced apoptosis. Cancer Res68: 8333“834118922905 15 KawasakiK WatanabeM SakaguchiM OgasawaraY OchiaiK et al (2009) REIC/Dkk-3 overexpression downregulates P-glycoprotein in multidrug-resistant MCF7/ADR cells and induces apoptosis in breast cancer. Cancer Gene Ther16: 65“7218654608 16 WatanabeM KashiwakuraY HuangP OchiaiK FutamiJ et al (2009) Immunological aspects of REIC/Dkk-3 in monocyte differentiation and tumor regression. Int J Oncol34: 657“66319212670 17 ShienK ToyookaS YamamotoH SohJ JidaM et al (2013) Acquired Resistance to EGFR Inhibitors Is Associated with a Manifestation of Stem Cell-like Properties in Cancer Cells. Cancer Res73: 3051“306123542356 18 KobayashiN"

Lung_Cancer

"atment groups.For each subgroupthe sum of the statistics along with the summary OR is represented by the middle of the solid diamonds.A test of heterogeneity between the trials within a subgroup is given below the summary statistics. Publication bias Publication bias might exist when nonsignificant findings remain unpublishedthus artificially inflating the apparent magnitude of an effect.The funnel plots of the study are shown in .The funnel plots of the 1-year survival rate following VATS and thoracotomy for the treatment of metastatic lung cancer showed asymmetry which suggested that there was some publication bias. .0085329.g007 Funnel plot of the outcome of 1-year survival rate. Discussion Many tumors can metastasize to the lungand colorectal and breast tumors are the most common primary tumors[9].Pulmonary resection has been shown to be beneficial for patients with resectable and isolated pulmonary metastases[10]. Traditional open thoracotomy and VATS are two principally different surgical methods for pulmonary metastasectomy.The selection of an approach depends more on the theoretical knowledge and personal experience of the surgeon than on the evidence. Over the past two decades several studies have demonstrated the benefits of VATS that included less postoperative pain shorter hospital stays a smaller degree of immunosuppression and enhanced recovery and the ability to tolerate adjuvant therapy[11]“[13]. Whether the long-term advantages are comparable to those of open thoracotomy is not well documented. The major deficiency of the VATS approach is that nodules might be undetected by VATS that might be detected by manual palpation during thoracotomy; such missing nodules are not imaged on a preoperative CT scan. The VATS approach has long been controversial because VATS does not consistently detect all the metastases and it is recognized that complete resection remains a major determining factor of survival [14].The detection rate of HRCT for pulmonary metastases is 78“84%[15]“[17].Kayton[18]found that 35% of the pathologically verified metastases were missed by CT. In the International Registry of Lung Metastases study of 5206 patients the 5-year survival rate was 36% for complete resection compared with 13% incomplete resectoin[19]. It is not certain whether the nodule imaged on a CT scan and resected by VATS is the correct one [14]. Those who disagree with the use of VATS hypothesize that VATS-related recurrence is commonly observed including port-site recurrence and resection stump recurrence[20]. Johnstone reported 23 cases of port-site chest wall recurrence related to VATS[21]. They hypothesized that the thoracoscopic approach should only be used in patients with a solitary lesion and when resection is requried for diagnostic purposes. The surgeons who favor the VATS approach advocate that VATS minimizes pain and trauma to the patients and that the VATS group might have an improved tolerance of chemotherapy which would likely ensure delivery of planned post-resection adjuvant therapy without a reduction in dosage or delay. The standard surgical procedure for pulmonary metastases is wedge resection that usually does not require manipulation of the pulmonary hilum which is appropriate for the VATS approach.They hypothesiezd that a lesion overlooked by CT but detected by palpation might not result in a survival gain[22] [23] and may be partially compensated for by carefully follow-up.Flores[24] hypothesized that the VATS group might demonstrate a great number of metachronous tumors over time;however the metachronous lesions in each group was similar. Our work suggests that thoracoscopic resection of metastatic lung cancer is a safe and curative procedure with 13 and 5-year survival rates comparable to those of thoracotomy. Patients with metastatic lung cancer are likely to relapse in the lung and after lung metastasectomy by VATS patients might benefit from a second metastasectomy. We hypothesize that earlier chemotherapy and radiation are essential to maximizing survival. Our study might be subject to pretreatment selection bias because most of the patients selected for open thoracotomy had multiple lesions and high risk and were not suitable for treatment with VATS.The missing lesions perhaps skewed the data more toward VATS as an equivalent procedure. We were also interested in the recurrence of cancerand the disease-free survival rates were evaluated. This study demonstrates a similar 1-year disease-free survival rate;however the 3-year disease-free survival rate is inferior for three reasons. First unrelated cancer deaths were included in our analysis of the 13 and 5-year overall survival which might account for VATS having a comparable overall survival rate but an inferior disease-free survival rate. Secondthe patients in the VATS group might have lesions that are missed and there are more likely to relapse in the lung leading to the inferior 3-year disease-free survival rate.Third some of our included studies were in the early period of VATS development when the technology was immature and some of the complications can now be prevented with more experience. Schaeff[25] reported 23 cases of port-site recurrence associated with VATS that occurred before 1998.The number of cases studied was small and the observation period was limitied. Spiral computed tomography has a far higher detection rate today than it did 20 years ago;so small lesions can be accurately localized before surgery[26] which ensures the success of VATS. With advances in imaging technology palpaiton during open thoracotomy is becoming less important.The latest VATS technology has a high-definition resolution and the flexible-tip thoracoscope enables complete inspection of the pleural cavity.These advancements ensure that VATS is an ideal method for patients with a solitary and relatively small peripheral lesions.Tamas[27] hypothesizes that palpation is necessary in a therapeutic metastasectomy as opposed to a diagnostic procedure.Whether patients with multiple lesions should be treated with open thoracotomy or VATS is controversial. This study is the first meta-analysis of the oncological outcome of thoracoscopic surgery for the treatment of metastatic lung cancer. In our work we observed that VATS might be a promising treatment for metastatic lung cancer. No randomized trials existing to guide doctors in the field of metastatic lung cancer currently. A prospective randomized study of the different surgical strategies is needed. Limitation No randomized controlled trials existing to comparing VATS with thoracotomy have been conducted. Heterogeneity was observed between the sample size and the years covered. Most studies are limited to small observational studies and single-institution case series. For these reasonsthere are only a total of 546 patients were included in the two groups for a study period spans more than a decade. Two of the studies comprise almost 65% of the patients and one study has only 20 patients; there are potential sources of bias in our work.Additional randomized controlled trials in the studies we accessed would have increased the strength of our results.There is a bias for the English language. Conclusion In our meta-analysis we found that for patients with metastatic lung cancer comparing VATS with thoracotomy showed almost equivalent survival rates. The VATS can not replace open thoracotomy completely. Further study is neededand a large multicenter randomized trial comparing VATS and thoracotomy would be ideal. Supporting Information Checklist S1 PRISMA Checklist. (DOC) Click here for additional data file. References 1 RuschVW (2010) Pulmonary metastasectomy: a moving target. J Thorac Oncol5: S130“13120502246 2 CassonAG PutnamJB NatarajanG JohnstonDA MountainC et al (1992) Five-year survival after pulmonary metastasectomy for adult soft tissue sarcoma. Cancer69: 662“6681730117 3 van HalterenHK van GeelAN HartAA ZoetmulderFA (1995) Pulmonary resection for metastases of colorectal origin. Chest107: 1526“15317781341 4 KandiolerD KromerE TuchlerH EndA MullerMR et al (1998) Long-term results after repeated surgical removal of pulmonary metastases. Ann Thorac Surg65: 909“9129564899 5 McCormackPM BainsMS BeggCB BurtME DowneyRJ et al (1996) Role of video-assisted thoracic surgery in the treatment of pulmonary metastases: results of a prospective trial. Ann Thorac Surg62: 213“216 discussion 216“217.8678645 6 SaishoS NakataM SawadaS YamashitaM SaekiH et al (2009) Evaluation of video-assisted thoracoscopic surgery for pulmonary metastases: 11-years of experience. Surg Endosc23: 55“6118437482 7 CerfolioRJ BryantAS McCartyTP MinnichDJ (2011) A prospective study to determine the incidence of non-imaged malignant pulmonary nodules in patients who undergo metastasectomy by thoracotomy with lung palpation. Ann Thorac Surg91: 1696“1700 discussion 1700“1691.21619965 8 DownsSH BlackN (1998) The feasibility of creating a checklist for the assessment of the methodological quality both of randomised and non-randomised studies of health care interventions. J Epidemiol Community Health52: 377“3849764259 9 KondoH OkumuraT OhdeY NakagawaK (2005) Surgical treatment for metastatic malignancies. Pulmonary metastasis: indications and outcomes. Int J Clin Oncol10: 81“8515864692 10 PorterGA CantorSB WalshGL RuschVW LeungDH et al (2004) Cost-effectiveness of pulmonary resection and systemic chemotherapy in the management of metastatic soft tissue sarcoma: a combined analysis from the University of Texas M. D. Anderson and Memorial Sloan-Kettering Cancer Centers. J Thorac Cardiovasc Surg127: 1366“137215115994 11 PetersenRP PhamD BurfeindWR HanishSI TolozaEM et al (2007) Thoracoscopic lobectomy facilitates the delivery of chemotherapy after resection for lung cancer. Ann Thorac Surg83: 1245“1249 discussion 1250.17383320 12 PaulS AltorkiNK ShengS LeePC HarpoleDH et al (2010) Thoracoscopic lobectomy is associated with lower morbidity than open lobectomy: a propensity-matched analysis from the STS database. J Thorac Cardiovasc Surg139: 366“37820106398 13 WhitsonBA GrothSS DuvalSJ SwansonSJ MaddausMA (2008) Surgery for early-stage non-small cell lung cancer: a systematic review of the video-assisted thoracoscopic surgery versus thoracotomy approaches to lobectomy. Ann Thorac Surg86: 2008“2016 discussion 2016“2008.19022040 14 EckardtJ LichtPB (2012) Thoracoscopic versus open pulmonary metastasectomy: a prospective sequentially controlled study. Chest142: 1598“160222677347 15 AmbrogiV PaciM PompeoE MineoTC (2000) Transxiphoid video-assisted pulmonary metastasectomy: relevance of helical computed tomography occult lesions. Ann Thorac Surg70: 1847“185211156082 16 MargaritoraS PorziellaV D'AndrilliA CesarioA GalettaD et al (2002) Pulmonary metastases: can accurate radiological evaluation avoid thoracotomic approach? Eur J Cardiothorac Surg21: 1111“111412048094 17 ParsonsAM DetterbeckFC ParkerLA (2004) Accuracy of helical CT in the detection of pulmonary metastases: is intraoperative palpation still necessary? Ann Thorac Surg78: 1910“1916 discussion 1916“1918.15561000 18 KaytonML HuvosAG CasherJ AbramsonSJ RosenNS et al (2006) Computed tomographic scan of the chest underestimates the number of metastatic lesions in osteosarcoma. J Pediatr Surg41: 200“206 discussion 200“206.16410133 19 Long-term results of lung metastasectomy: prognostic analyses based on 5206 cases. The International Registry of Lung Metastases. J Thorac Cardiovasc Surg113: 37“499011700 20 MutsaertsEL ZoetmulderFA RutgersEJ (2001) Port site metastasis as a complication of thoracoscopic metastatectomy. Eur J Surg Oncol27: 327“32811373113 21 JohnstonePA RohdeDC SwartzSE FetterJE WexnerSD (1996) Port site recurrences after laparoscopic and thoracoscopic procedures in malignancy. J Clin Oncol14: 1950“19568656265 22 TreasureT (2007) Pulmonary metastasectomy: a common practice based on weak evidence. Ann R Coll Surg Engl89: 744“74817999813 23 RothJA PassHI WesleyMN WhiteD PutnamJB et al (1986) Comparison of median sternotomy and thoracotomy for resection of pulmonary metastases in patients with adult soft-tissue sarcomas. Ann Thorac Surg42: 134“1383741009 24 FloresRM IhekweazuUN RizkN DycocoJ BainsMS et al (2011) Patterns of recurrence and incidence of second primary tumors after lobectomy by means of video-assisted thoracoscopic surgery (VATS) versus thoracotomy for lung cancer. J Thorac Cardiovasc Surg141: 59“6421055770 25 SchaeffB PaolucciV ThomopoulosJ (1998) Port site recurrences after laparoscopic surgery. A review. Dig Surg15: 124“1349845574 26 ChenYR YeowKM LeeJY SuIH ChuSY et al (2007) CT-guided hook wire localization of subpleural lung lesions for video-assisted thoracoscopic surgery (VATS). J Formos Med Assoc106: 911“91818063512 27 MolnarTF GebitekinC TurnaA (2010) What are the considerations in the surgical approach in pulmonary metastasectomy? J Thorac Oncol5: S140“14420502249 28 NakajimaJ TakamotoS TanakaM TakeuchiE MurakawaT et al (2001) Thoracoscopic surgery and conventional open thoracotomy in metastatic lung cancer. Surg Endosc15: 849“85311443456 29 MutsaertsEL ZoetmulderFA MeijerS BaasP HartAA et al (2002) Long term survival of thoracoscopic metastasectomy vs metastasectomy by thoracotomy in patients with a solitary pulmonary lesion. Eur J Surg Oncol28: 864“86812477479 30 NakasA KlimatsidasMN EntwisleJ Martin-UcarAE WallerDA (2009) Video-assisted versus open pulmonary metastasectomy: the surgeon's finger or the radiologist's eye? Eur J Cardiothorac Surg36: 469“47419464921 31 CarballoM MaishMS JaroszewskiDE HolmesCE (2009) Video-assisted thoracic surgery (VATS) as a safe alternative for the resection of pulmonary metastases: a retrospective cohort study. J Cardiothorac Surg4: 1319239710 32 GossotD RaduC GirardP Le CesneA BonvalotS et al (2009) Resection of pulmonary metastases from sarcoma: can some patients benefit from a less invasive approach? Ann Thorac Surg87: 238“24319101304 33 ChaoYK ChangHC WuYC LiuYH HsiehMJ et al (2012) Management of lung metastases from colorectal cancer: video-assisted thoracoscopic surgery versus thoracotomy”a case-matched study. Thorac Cardiovasc Surg60: 398“40422228090 101150042 30118 Mol Cancer Res Mol. Cancer Res. Molecular cancer research : MCR 1541-7786 1557-3125 24202705 3946989 10.1158/1541-7786.MCR-13-0300 NIHMS538386 Article œNEDD9 Depletion Leads to MMP14 Inactivation by TIMP2 and Prevents Invasion and Metastasis. McLaughlin Sarah L. 5 * Ice Ryan J. 5 * Rajulapati Anuradha 5 Kozyulina Polina Y. 1 Livengood Ryan H. 4 Kozyreva Varvara K. 5 Loskutov Yuriy V. 5 Culp Mark V. 3 Weed Scott A. 2 5 Ivanov Alexey V. 1 5 Pugacheva Elena N. 1 5 # 1Department of Biochemistry West Virginia University School of Medicine Morgantown WV 26506 2Department of Neurobiology and Anatomy West Virginia University School of Medicine Morgantown WV 26506 3Department of Statistics West Virginia University School of Medicine Morgantown WV 26506 4Department of Pathology West Virginia University School of Medicine Morgantown WV 26506 5Mary Babb Randolph Cancer Center West Virginia University School of Medicine Morgantown WV 26506 #Corresponding author: Elena N. Pugacheva Mailing address: Department of Biochemistry and Mary Babb Randolph Cancer Center PO Box 9142 1 Medical Center Drive West Virginia University School of Medicine Morgantown WV 26506. Phone: (304) 293-5295; Fax: (304) 293-4667; epugacheva@hsc.wvu.edu S.L. McLaughlin* and R. J. Ice* contributed equally to this work. 17 12 2013 07 11 2013 1 2014 01 1 2015 12 1 69 81 The scaffolding protein NEDD9 is an established pro-metastatic marker in several cancers. Nevertheless the molecular mechanisms of NEDD9 driven metastasis in cancers remain ill defined. Here using a comprehensive breast cancer (BCa) tissue microarray it was show that increased levels of NEDD9 protein significantly correlated with the transition from carcinoma in situ to invasive carcinoma. Similarly it was shown that NEDD9 overexpression is a hallmark of highly invasive BCa cells. Moreover NEDD9 expression is crucial for the protease-dependent mesenchymal invasion of cancer cells at the primary site but not at the metastatic site. Depletion of NEDD9 is sufficient to suppress invasion of tumor cells in vitro and in vivo leading to decreased circulating tumor cells (CTCs) and lung metastases in xenograft models. Mechanistically NEDD9 localized to invasive pseudopods and was required for local matrix degradation. Depletion of NEDD9 impaired invasion of cancer cells through inactivation of membrane-bound matrix metalloproteinase MMP14 by excess TIMP2 on the cell surface. Inactivation of MMP14 is accompanied by reduced collagenolytic activity of soluble metalloproteinases MMP2 and MMP9. Re-expression of NEDD9 is sufficient to restore the activity of MMP14 and the invasive properties of BCa cells in vitro and in vivo. Collectively these findings uncover critical steps in NEDD9-dependent invasion of BCa cells. Implications This study provides a mechanistic basis for potential therapeutic interventions to prevent metastasis. NEDD9 invasion metastasis breast cancer MMP14 Int J Occup Environ Health Int J Occup Environ Health OEH International Journal of Occupational and Environmental health 1077-3525 2049-3967 Maney Publishing Suite 1C Joseph's Well Hanover Walk Leeds LS3 1AB UK 24999846 4090870 2014_1 10.1179/1077352514Z.000000000104 Original Article Dust diseases and the legacy of corporate manipulation of science and law Dust diseases Egilman David 1 Bird Tess 2 Lee Caroline 2 1 Department of Community Health Brown University Attleboro MA USA 2 Never Again Consulting Attleboro MA USA Correspondence to: David Egilman 8 North Main Street Suite 404 Attleboro MA 02703 USA. Email: degilman@egilman.com 4 2014 20 2 115 125 © W. S. Maney & Son Ltd 2014 2014 Background: The dust diseases silicosis and asbestosis were the first occupational diseases to have widespread impact on workers. Knowledge that asbestos and silica were hazardous to health became public several decades after the industry knew of the health concerns. This delay was largely influenced by the interests of Metropolitan Life Insurance Company (MetLife) and other asbestos mining and product manufacturing companies. Objectives: To understand the ongoing corporate influence on the science and politics of asbestos and silica exposure including litigation defense strategies related to historical manipulation of science. Methods: We examined previously secret corporate documents depositions and trial testimony produced in litigation; as well as published literature. Results: Our analysis indicates that companies that used and produced asbestos have continued and intensified their efforts to alter the asbestos“cancer literature and utilize dust-exposure standards to avoid liability and regulation. Organizations of asbestos product manufacturers delayed the reduction of permissible asbestos exposures by covering up the link between asbestos and cancer. Once the decline of the asbestos industry in the US became inevitable the companies and their lawyers designed the state of the art (SOA) defense to protect themselves in litigation and to maintain sales to developing countries. Conclusions: Asbestos product companies would like the public to believe that there was a legitimate debate surrounding the dangers of asbestos during the twentieth century particularly regarding the link to cancer which delayed adequate regulation. The asbestos“cancer link was not a legitimate contestation of science; rather the companies directly manipulated the scientific literature. There is evidence that industry manipulation of scientific literature remains a continuing problem today resulting in inadequate regulation and compensation and perpetuating otherwise preventable worker and consumer injuries and deaths. asbestos mesothelioma state-of-the-art corporate corruption MetLife industry knowledge 9421547 4136 Hum Pathol Hum. Pathol. Human pathology 0046-8177 1532-8392 24746212 4271837 10.1016/j.humpath.2014.01.003 NIHMS648391 Article Y-chromosome status identification suggests a recipient origin of posttransplant non“small cell lung carcinomas: chromogenic in situ hybridization analysis??? Chen Wei MD PhD a Brodsky Sergey V. MD PhD a Zhao Weiqiang MD PhD a Otterson Gregory A. MD b Villalona-Calero Miguel MD b Satoskar Anjali A. MD a Hasan Ayesha MD b Pelletier Ronald MD c Ivanov Iouri MD PhD a Ross Patrick MD PhD c Nadasdy Tibor MD a Shilo Konstantin MD a * aDepartment of Pathology The Ohio State University Wexner Medical Center Columbus OH 43210 bDepartment of Medicine The Ohio State University Wexner Medical Center Columbus OH 43210 cDepartment of Surgery The Ohio State University Wexner Medical Center Columbus OH 43210 *Corresponding author. Department of Pathology The Ohio State University Wexner Medical Center E412 Doan Hall 450 West 10th Ave Columbus OH 43210. Konstantin.Shilo@OSUMC.edu (K. Shilo) 13 12 2014 23 1 2014 5 2014 19 12 2014 45 5 1065 1070 © 2014 Elsevier Inc. All rights reserved. 2014 Summary Owing to the need of lifelong immunosuppression solid-organ transplant recipients are known to have an increased risk of posttransplant malignancies including lung cancer. Posttransplant neoplastic transformation of donor-derived cells giving rise to hematopoietic malignancies Kaposi sarcoma and basal cell carcinoma in nongraft tissues has been reported. The goal of this study was to assess the cell origin (donor versus recipient derived) of posttransplant non“small cell lung carcinomas (NSCLCs) in kidney and heart transplant recipients. An institutional database search identified 2557 kidney and heart transplant recipients in 8 consecutive years. Among this cohort 20 (0.8%) renal and 18 (0.7%) heart transplant recipients developed NSCLC. The study cohort comprised 6 of 38 NSCLCs arising in donor-recipient sex-mismatched transplant patients. The tumor cell origin was evaluated by chromogenic in situ hybridization with Y-chromosome probe on formalin-fixed paraffin-embedded tissues. Y-chromosome was identified in 97% ± 1% (range from 92% to 99%) of all types of nucleated cells in male control tissues. In all 5 NSCLCs from male recipients of female donor organ Y-chromosome was identified in 97% ± 2% (range from 92% to 100%) of tumor cells statistically equivalent to normal control (P < .001). No Y-chromosome was identified in NSCLC cells from a female recipient of male kidney. These findings suggest a recipient derivation of NSCLC arising in kidney and heart transplant recipients. A combination of histologic evaluation and chromogenic in situ hybridization with Y-chromosome analysis allows reliable determination of tissue origin in sex-mismatched solid-organ transplant recipients and may aid in management of posttransplant malignancy in such cases. Post“solid-organ transplantation lung cancer Chromogenic in situ hybridization for Y-chromosome 15030100R 648 Ann Thorac Surg Ann. Thorac. Surg. The Annals of thoracic surgery 0003-4975 1552-6259 24576597 4008142 10.1016/j.athoracsur.2013.12.043 NIHMS571118 Article Accuracy of FDG-PET within the clinical practice of the ACOSOG Z4031 trial to diagnose clinical stage I NSCLC Grogan Eric L. MD MPH a b c Deppen Stephen A. MA MS PhD b c * Ballman Karla V. f Andrade Gabriela M. b Verdial Francys C. b Aldrich Melinda C. b d Chen Chiu L. e Decker Paul A. f Harpole David H. MD g Cerfolio Rrobert J. MD h Keenan Robert J. MD i Jones David R. MD j D™Amico Thomas A. MD g Shrager Joseph B. MD k Meyers Bryan F. MD l Putnam Joe B. Jr. MD a b aVeterans Affairs Medical Center Nashville TN bDepartment of Thoracic Surgery; Department of Medicine Vanderbilt University Medical Center Nashville TN cInstitute for Medicine and Public Health Vanderbilt University Medical Center Nashville TN dDivision of Epidemiology Vanderbilt University Medical Center Nashville TN eCenter for Quantitative Sciences Vanderbilt University Medical Center Nashville TN fDivision of Biomedical Statistics and Informatics Mayo Clinic Rochester MN gDepartment of Surgery Duke University Durham NC hDepartment of Surgery University of Alabama Birmingham AL iDepartment of Surgery Allegheny General Hospital Pittsburgh PA jDepartment of Surgery University of Virginia Charlottesville VA kDepartment of Surgery Stanford University Stanford CA lDepartment of Surgery Washington University St. Louis MO Corresponding Author/Request for Reprints: Eric Grogan M.D. M.P.H. Department of Thoracic Surgery 609 Oxford House 1313 21st Ave. South Nashville TN 37232 Phone: 615-322-0064 Fax: 615-343-9194 eric.grogan@vanderbilt.edu * Equal shared co-first author 23 4 2014 25 2 2014 4 2014 01 4 2015 97 4 1142 1148 © 2014 The Society of Thoracic Surgeons. Published by Elsevier Inc. All rights reserved. 2014 Background Fluoro-deoxyglucose positron emission tomography (FDG-PET) is recommended for diagnosis and staging of NSCLC. Meta-analyses of FDG-PET diagnostic accuracy demonstrated sensitivity and specificity of 96% and 78% respectively but were performed in select centers introducing potential bias. This study evaluates the accuracy of FDG-PET to diagnose NSCLC and examines differences across enrolling sites in the national ACOSOG Z4031 trial. Methods 959 eligible patients with clinical stage I (cT1-2N0M0) known or suspected NSCLC were enrolled between 2004 and 2006 in the Z4031 trial and 682 had a baseline FDG-PET. Final diagnosis was determined by pathological examination. FDG-PET avidity was categorized into four levels based on radiologist description or reported maximum standard uptake value (SUV). FDG-PET diagnostic accuracy was calculated for the entire cohort. Accuracy differences based on preoperative size and by enrolling site were examined. Results Preoperative FDG-PET results were available for 682 participants enrolled at 51 sites in 39 cities. Lung cancer prevalence was 83%. FDG-PET sensitivity was 82% (95% CI: 79“85) and specificity was 31% (95% CI: 23%“40%). Positive and negative predictive values were 85% and 26% respectively. Accuracy improved with lesion size. Of 80 false positive scans 69% were granulomas. False negative scans occurred in 101 patients with adenocarcinoma being the most frequent (64%) and eleven were ?10mm. The sensitivity varied from 68% to 91% (p=0.03) and the specificity ranged from 15% to 44% (p=0.72) across cities with > 25 participants. Conclusions In a national surgical population with clinical stage I NSCLC FDG-PET to diagnose lung cancer performed poorly compared to published studies. Tumour Biol Tumour Biol Tumour Biology 1010-4283 1423-0380 Springer Netherlands Dordrecht 24510347 4053595 1674 10.1007/s13277-014-1674-x Research Article The diagnostic and prognostic value of serum human kallikrein-related peptidases 11 in non-small cell lung cancer Xu Chun-Hua Zhang Yu Yu Li-Ke +86-25-8372-8558 +86-25-83728558 yulike_doctor@163.com Department of Respiratory Medicine Nanjing Chest Hospital 215 Guangzhou Road Nanjing 210029 China Nanjing Clinical Center of Respiratory Diseases Nanjing China 9 2 2014 9 2 2014 6 2014 35 6 5199 5203 6 12 2013 22 1 2014 © The Author(s) 2014 Open Access This article is distributed under the terms of the Creative Commons Attribution License which permits any use distribution and reproduction in any medium provided the original author(s) and the source are credited. The aim of this study was to explore the diagnostic and prognostic value of serum human kallikrein-related peptidases 11 (KLK11) level in non-small cell lung cancer (NSCLC). Serum specimens from 138 patients w"

Lung_Cancer

"Tumor tissue nonmalignant lung tissue and peripheral blood samples were obtained from III-4. The proband™s mother (II-4) also had multiple lung adenocarcinomas and tumor and nonmalignant lung tissue samples were available. The proband™s father (II-5) and sister (III-5) were both unaffected and peripheral blood samples were obtained from these individuals. Some family members who were not considered as critical for this study were excluded from the pedigree chart to preserve confidentiality. Whole-exome sequencing was performed for individuals II-4 II-5 III-4 and III-5. After obtaining permission from the Institutional Review Board at Okayama University Hospital and informed consent from the patients and other family members we performed a whole-exome sequencing study. Tumor DNA samples from II-4 tumor and peripheral blood DNA samples from III-4 and peripheral blood DNA samples from two unaffected family members (II-5 and III-5) were used for the analysis. The candidate germline alterations were restricted to 29 variants by comparing the whole-exome sequencing results between the patients and the unaffected family members. Among them we focused on a point mutation in the human epidermal growth factor receptor 2 (HER2/neu) gene (NM_004448 G660D GGC to GAC) which was located in exon 17 encoding the transmembrane domain of HER2 (Supplementary Tables 1“3). This alteration was confirmed by direct sequencing (A). We also confirmed that there was no copy number gain of HER2 in the examined tumors based on the degree of read-depth in the whole-exome sequencing results. Of note no mutations in genes known to cause lung cancers were detected for tumors from III-4 and II-4. . DNA and amino acid sequences in the transmembrane domain of HER2. A) Direct Sanger sequencing of the proband (III-4) her affected mother (II-4) and her unaffected sister (III-5). The results indicated that G660D was a germline mutation. B) Direct sequencing of a sporadic lung adenocarcinoma with a HER2 V659E mutation. V659E was found to be of somatic origin based on the sequencing results of the peritumoral lung tissue from the same specimen. All the sequence variants were confirmed by independent polymerase chain reaction amplifications and were sequenced in both directions. C) Interspecies conservation of the transmembrane domain of HER2 (UCSC Genome Browser http://genome.ucsc.edu accessed September 12 2013). The yellow highlight indicates the N-terminal glycine zipper motif Thr652-X3-Ser656-X3-Gly660 a tandem variant of a GG4-like motif of human HER2. Codons 659 and 660 in human HER2 are highly conserved among the listed vertebrate species (shown in red). X. tropicalis = Xenopus tropicalis. We considered that somatic mutations in the HER2 transmembrane domain might act as driver mutations in lung cancer. Hence we sequenced exon 17 of the HER2 in the tumor samples of 315 sporadic non“small cell lung cancer patients of which 253 were adenocarcinomas. Although the HER2 G660D mutation was not detected a novel nonsynonymous mutation V659E (GTT to GAA) next to codon 660 was identified in one of these patients. This patient was histologically diagnosed as nonmucinous adenocarcinoma in situ and the patient had neither smoking history nor apparent family history of lung cancer. This V659E mutation was certainly a somatic mutation because it was not identified in the peritumoral lung tissue of the same patient (B). The alignment of HER2 amino acid sequences showed high conservation of valine 659 and glycine 660 among vertebrates (C). HER2 somatic mutations have been reported in 2% to 4% of lung adenocarcinomas (5“7). However all reported mutations were restricted to its tyrosine kinase domain (67). According to the cBioPortal for Cancer Genomics (http://www.cbioportal./public-portal/ accessed September 12 2013) the same genetic mutation in the HER2 has not been reported in any type of cancer. Interestingly a previous study reported that a mutation in the transmembrane domain (V664E) of the rat neu gene which corresponds to V659E in its human homolog HER2 induced oncogenic transformation (8). In addition in vivo experiments showed that the HER2 V659E mutation contributed to the stability of HER2 dimers resulting in the dysregulated receptor activation and subsequent cell transformation (910). Furthermore the novel mutations were located within the glycine zipper motif Thr652-X3-Ser656-X3-Gly660 a tandem variant of the GG4-like motif at the N-terminal portion of the transmembrane domain which was critically related to the dimerization of HER2 (C) (911). Accordingly we performed a functional analysis of the mutant HER2 proteins. We found that the degradation of HER2 protein after the administration of cycloheximide was slower in G660D and V659E mutants as compared with wild-type (Supplementary A) indicating the higher stability of the mutant proteins than wild-type protein. In addition results of a phospho-mitogen“activated protein kinase array indicated the activation of Akt and p38? (data not shown). Indeed Akt is known to be activated by HER2 by phosphatidylinositol 3-kinase and leads to increased cell growth and survival (1213). Also the activation of p38 was shown to contribute to the viability of lung adenocarcinoma cells derived from never or light smokers (1415). A western blot analysis for Akt and p38 successfully confirmed the upregulation of both phospho-Akt and phospho-p38 expression in the mutant HER2 transfectants (Supplementary B). Because the G660D alteration in HER2 might have been the cause of the lung cancer in the pedigree studied we investigated whether familial aggregation of cancer in other ans could be seen in this pedigree. We found that II-1 and II-6 developed renal and gastric cancers respectively; however both of them also had lung cancer. The reason why other types of clinically apparent malignances were rarely found in this pedigree is unclear. The G660D germline mutation may be tolerated in ans other than the lung. This study had some limitations. First the carcinogenic potential of the HER2 mutation at the transmembrane domain should be confirmed in other models such as transgenic mice. Second the rarity of these mutations in sporadic lung cancers may be the limitation for generalizability to other cases even if targeting therapies for similar types of HER2 mutation were developed. In we identified a novel germline mutation in the transmembrane domain of the HER2 in familial lung adenocarcinomas. Somatic mutation in the HER2 transmembrane domain may be a possible cause of sporadic lung adenocarcinomas. Funding This study was supported by a Grant-in Aid for Scientific Research from the Ministry of Education Culture Sports Science and Technology of Japan (25293302 to ST). H. Yamamoto J. Soh S. Miyoshi and S. Toyooka conceived the project. K. Higasa M. Sakaguchi K. Shien and K. Ichimura performed the experiments. H. Yamamoto J. Soh M. Furukawa S. Hashida N. Takigawa K. Kiura K. Tsukuda and S. Toyooka collected the samples and assisted with the experiments. H. Yamamoto K. Higasa K. Shien and K. Matsuo analyzed the data. H. Yamamoto K. Higasa M. Sakaguchi F. Matsuda and S. Toyooka prepared the manuscript with input from the other authors. S. Miyoshi F. Matsuda and S. Toyooka supervised the project. The authors declared no conflicts of interest. References 1. BellDWGoreIOkimotoRA Inherited susceptibility to lung cancer may be associated with the T790M drug resistance mutation in EGFR. Nat Genet. 2005;37(12):1315“131616258541 2. IkedaKNomoriHMoriTSasakiJKobayashiT Novel germline mutation: EGFR V843I in patient with multiple lung adenocarcinomas and family members with lung cancer. Ann Thorac Surg. 2008;85(4):1430“143218355544 3. OhtsukaKOhnishiHKuraiD Familial lung adenocarcinoma caused by the EGFR V843I germ-line mutation. J Clin Oncol."

Lung_Cancer

"This may be the reason why this pathway is universally aberrant in all the LUAD samples we assessed. Our analysis of this pathway in other cancer types demonstrated less of a role for this pathway suggesting that it is more LUAD specific. We believe that the common disruption of this pathway is a novel discovery as this pathway consisting of 17 genes has not been reported as an indicator of LUAD in any of the studies we acquired datasets from (GSE10082 GSE7670 GSE10072) nor in a literature search with key words.4 SWe have proposed personalized extensions to ORA- and FCS-based pathway analysis by introducing the concept of comparing an individual tumor with many normal samples. Exploratory analyses of our methods with previously published survival pathway signatures reproduced the correct survival outcomes. We have also demonstrated that using nRef improves the validation rate. Unbiased clustering with iPASs revealed sample clustering which is indicative of the cancer differentiation status of LUAD and of different survival outcomes. Clustering also identifies pathway characteristics from patients displaying common up- or downregulations and subgroup-specific deregulations.Pathways that are commonly deregulated across all cancer patients may be useful in identifying cancer from unknown samples. We explored the pathway-based identification of cancer with ˜amino acid synthesis and interconversion and transamination™ pathway which is commonly upregulated in LUAD patients. Validation using independent datasets demonstrated that this pathway is useful in classifying LUAD and normal lung samples.Based on our results we conclude that individualized pathway scores using nRef can provide a sensitive measure of a patient™s clinical features and can be useful for identifying cancer.In our empirical study Average Z performed best in highlighting pathway aberrance and in further revealing clinical importance. It had the best statistical power when identifying a previously known survival-related pathway and the best averaged validation rate for LUAD and colon cancer. In the pathway-based identification of cancer the Mahalanobis method performed best.An important clinical aspect of our methods is that it enables the interpretation of a cancer case in a single patient even if matched normal tissue data from the same individual are unavailable. Accumulated information of normal tissues from a data repository will take the place of data unavailable for a specific individual. As the data repository is growing rapidly it is expected that more ˜nRef™ data will be available for many diseases in the near future. We hope that our proposed approach can help in the personalized interpretation of tumor data and can be a useful tool in the upcoming era of data-based personalized medicine.Although we have shown our results in microarray platform our method is applicable to different RNA expression platforms including next-generation sequencer. Our method is also supportive of various pathway resources such as KEGG NCI cancer pathway and Biocarta provided in the gmt format. The R code for our methods along with nRefs of LUAD and colon cancer used in our study is available at http://bibs.snu.ac.kr/ipas. Supplementary Material Supplementary Data ACKNOWLEDGEMENT The authors thank Jaehoon Lee and Sungyoung Lee for discussion. Funding: This work was supported by the National Research Foundation of Korea (NRF) grant (2012R1A3A2026438) and by the Bio & Medical Technology Development Program of the NRF grant (2013M3A9C4078158). Conflict of interest: none declared. REFERENCES Bandres E A gene signature of 8 genes could identify the risk of recurrence and progression in Dukes' B colon cancer patients Oncol. Rep. 2007 17 1089 1094 17390049 Barletta JA Prognostic significance of grading in lung adenocarcinoma Cancer 2010 116 659 669 20014400 Barrett T NCBI GEO: archive for functional genomics data sets”update Nucleic Acids Res. 2012 41 D991 D995 23193258 Barrier A Stage II colon cancer prognosis prediction by tumor gene expression profiling J. Clin. Oncol. 2006 24 4685 4691 16966692 Barrier A Prognosis of stage II colon cancer by non-neoplastic mucosa gene expression profiling Oncogene 2007 26 2642 2648 17043639 Beer DG Gene-expression profiles predict survival of patients with lung adenocarcinoma Nat. Med. 2002 8 816 824 12118244 Bolstad BM A comparison of normalization methods for high density oligonucleotide array data based on variance and bias Bioinformatics 2003 19 185 193 12538238 Breitling R Iterative Group Analysis (iGA): a simple tool to enhance sensitivity and facilitate interpretation of microarray experiments BMC Bioinformatics 2004 5 34 15050037 Bryant CM Clinically relevant characterization of lung adenocarcinoma subtypes based on cellular pathways: an international validation study PLoS One 2010 5 e11712 20661423 Croft D Reactome: a database of reactions pathways and biological processes Nucleic Acids Res. 2011 39 D691 D697 21067998 Dancey JE The genetic basis for cancer treatment decisions Cell 2012 148 409 420 22304912 Drier Y Pathway-based personalized analysis of cancer Proc. Natl Acad. Sci. USA 2013 110 6388 6393 23547110 Eschrich S Molecular staging for survival prediction of colorectal cancer patients J. Clin. Oncol. 2005 23 3526 3535 15908663 Hou J Gene expression-based classification of non-small cell lung carcinomas and survival prediction PLoS One 2010 5 e10312 20421987 Irizarry RA Exploration normalization and summaries of high density oligonucleotide array probe level data Biostatistics 2003 4 249 264 12925520 Jones SJ Evolution of an adenocarcinoma in response to selection by targeted kinase inhibitors Genome Biol. 2010 11 R82 20696054 Khatri P Ten years of pathway analysis: current approaches and outstanding challenges PLoS Comput. Biol. 2012 8 e1002375 22383865 Kopetz S Abbruzzese JL Barriers to integrating gene profiling for stage ii colon cancer Clin. Cancer Res. 2009 15 7451 7452 19996205 Landi MT Gene expression signature of cigarette smoking and its role in lung adenocarcinoma development and survival PLoS One 2008 3 e1651 18297132 Lee ES Prediction of recurrence-free survival in postoperative non-small cell lung cancer patients by using an integrated model of clinical information and gene expression Clin. Cancer Res. 2008 14 7397 7404 19010856 Lin YH Multiple gene expression classifiers from different array platforms predict poor prognosis of colorectal cancer Clin. Cancer Res. 2007 13 498 507 17255271 Lu TP Integrated analyses of copy number variations and gene expression in lung adenocarcinoma PLoS One 2011 6 e24829 21935476 Marisa L Gene expression classification of colon cancer into molecular subtypes: characterization validation and prognostic value PLoS Med. 2013 10 e1001453 23700391 Munoz-Pinedo C Cancer metabolism: current perspectives and future directions Cell Death Dis. 2012 3 e248 22237205 Smith JJ Experimentally derived metastasis gene expression profile predicts recurrence and death in patients with colon cancer Gastroenterology 2010 138 958 968 19914252 Su LJ Selection of DDX5 as a novel internal control for Q-RT-PCR from microarray data using a block bootstrap re-sampling scheme BMC Genomics 2007 8 140 17540040 Subramanian A Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles Proc. Natl Acad. Sci. USA 2005 102 15545 15550 16199517 Tian L Discovering statistically significant pathways in expression profiling studies Proc. Natl Acad. Sci. USA 2005 102 13544 13549 16174746 Vaske CJ Inference of patient-specific pathway activities from multi-dimensional cancer genomics data using PARADIGM Bioinformatics 2010 26 i237 i245 20529912 Wang Y Gene expression profiles and molecular markers to predict recurrence of Dukes' B colon cancer J. Clin. Oncol. 2004 22 1564 1571 15051756 Am J Respir Cell Mol Biol Am. J. Respir. Cell Mol. Biol ajrcmb American Journal of Respiratory Cell and Molecular Biology 1044-1549 1535-4989 American Thoracic Society 23980547 3930939 2013-0314TR 10.1165/rcmb.2013-0314TR Translational Review The Role of Vimentin Intermediate Filaments in the Progression of Lung Cancer Kidd Martha E. 1 2 Shumaker Dale K. 2 Ridge Karen M. 2 1Department of Biomedical Engineering Northwestern University Evanston Illinois; and 2Division of Pulmonary and Critical Care Medicine Northwestern University Feinberg School of Medicine Chicago Illinois Correspondence and requests for reprints should be addressed to Karen M. Ridge Ph.D. Division of Pulmonary and Critical Care Medicine Northwestern University Feinberg School of Medicine 240 East Huron Street McGaw M328 Chicago IL 60611. E-mail: kridge@northwestern.edu 1 2014 1 2014 50 1 1 6 08 7 2013 30 7 2013 Copyright © 2014 by the American Thoracic Society 2014 There is an accumulation of evidence in the literature demonstrating the integral role of vimentin intermediate filaments (IFs) in the progression of lung cancers. Vimentin IF proteins have been implicated in many aspects of cancer initiation and progression including tumorigenesis epithelial-to-mesenchymal transition (EMT) and the metastatic spread of cancer. Specifically vimentin IFs have been recognized as an essential component regulating EMT major signal transduction pathways involved in EMT and tumor progression cell migration and invasion the positioning and anchorage of organelles such as mitochondria and cell“cell and cell“substrate adhesion. In tumorgenesis vimentin forms a complex with 14-3-3 and beclin 1 to inhibit autophagy via an AKT-dependent mechanism. Vimentin is a canonical marker of EMT and recent evidence has shown it to be an important regulator of cellular motility. Transcriptional regulation of vimentin through hypoxia-inducible factor-1 may be a potential driver of EMT. Finally vimentin regulates 14-3-3 complexes and controls various intracellular signaling and cell cycle control pathways by depleting the availability of free 14-3-3. There are many exciting advances in our understanding of the complex role of vimentin IFs in cancer pointing to the key role vimentin IFs may play in tumor progression. Keywords epithelial-to-mesenchymal transition invadopodia lung cancer metastatic cascade vimentin 8711562 6325 Oncogene Oncogene Oncogene 0950-9232 1476-5594 23752194 3839253 10.1038/onc.2013.208 NIHMS490151 Article ARF Inhibits the Growth and Malignant Progression of Non-Small Cell Lung Carcinoma Busch Stephanie E 1 2 Moser Russell D 1 Gurley Kay E 1 Kelly-Spratt Karen S 1 Liggitt H Denny 3 Kemp Christopher J 1 1Division of Human Biology Fred Hutchinson Cancer Research Center Seattle Washington 98109 2Molecular and Cellular Biology Graduate Program University of Washington Seattle Washington 98195 3Department of Comparative Medicine University of Washington Seattle Washington 98195 Corresponding author: Christopher J. Kemp Ph.D. Fred Hutchinson Cancer Research Center 1100 Fairview Ave N Mail Stop C1-015 Seattle WA 98109. cjkemp@fhcrc.org. Phone: (206) 667-4252. Fax: (206) 667-5815 11 7 2013 10 6 2013 15 5 2014 15 5 2015 33 20 2665 2673 Non-small cell lung carcinoma (NSCLC) is among the deadliest of human cancers. The CDKN2A locus which houses the INK4a and ARF tumor suppressor genes is frequently altered in NSCLC. However the specific role of ARF in pulmonary tumorigenesis remains unclear. KRAS and other oncogenes induce the expression of ARF thus stabilizing p53 activity and arresting cell proliferation. To address the role of ARF in Kras-driven NSCLC we compared the susceptibility of NIH/Ola strain wild-type and Arf knockout mice to urethane-induced lung carcinogenesis. Lung tumor size malignancy and associated morbidity were significantly increased in Arf?/? compared to Arf+/+ animals at 25 weeks post-induction. Pulmonary tumors from Arf knockout mice exhibited increased cell proliferation and DNA damage compared to wild-type. A subgroup of tumors in Arf?/? animals presented as dedifferentiated and metastatic with many characteristics of pulmonary sarcomatoid carcinoma a neoplasm previously undocumented in mouse models. Our finding of a role for ARF in NSCLC is consistent with the observation that benign adenomas from Arf+/+ mice robustly expressed ARF while ARF expression was markedly reduced in malignant adenocarcinomas. ARF expression also frequently co-localized with expression of p21CIP1 a transcriptional target of p53 arguing that ARF induces the p53 checkpoint to arrest cell proliferation in vivo. Together these findings demonstrate that induction of ARF is an early response in lung tumorigenesis that mounts a strong barrier against tumor growth and malignant progression. p19Arf p14ARF ethyl carbamate metastasis J Transl Med J Transl Med Journal of Translational Medicine 1479-5876 BioMed Central 24726028 3996904 1479-5876-12-98 10.1186/1479-5876-12-98 Research Thymidylate synthase polymorphisms in genomic DNA as clinical outcome predictors in a European population of advanced non-small cell lung cancer patients receiving pemetrexed Arévalo Estefanía 1 e.arevalo-vazquez@hotmail.com Castañón Eduardo 1 ecastanon@unav.es López Inés 2 milopez@unav.es Salgado Josefa 3 jsalgadog@unav.es Collado Víctor 2 v.d.collado@gmail.com Santisteban Marta 1 msantisteb@unav.es Rodríguez-Ruiz María 4 mrruiz@unav.es Martín Patricia 1 pmromano@unav.es Zubiri Leire 4 lzubiri@unav.es Patiño-García Ana 3 apatigar@unav.es Rolfo Christian 5 christian.rolfo@uza.be Gil-Bazo Ignacio 1 2 igbazo@unav.es 1Department of Oncology Clínica Universidad de Navarra 31008 Pamplona Spain 2Division of Oncology Center for Applied Medical Research (CIMA) 31008 Pamplona Spain 3Laboratory of Clinical Genetics Clínica Universidad de Navarra 31008 Pamplona Spain 4Department of Radiation Oncology Clínica Universidad de Navarra 31008 Pamplona Spain 5Oncology Department Antwerp University Hospital UZA 2650 Edegem Belgium 2014 14 4 2014 12 98 98 3 11 2013 7 4 2014 Copyright © 2014 Arévalo et al.; licensee BioMed Central Ltd. 2014 Arévalo et al.; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0) which permits unrestricted use distribution and reproduction in any medium provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article unless otherwise stated. Background We studied whether thymidylate synthase (TS) genotype has an independent prognostic/predictive impact on a European population of advanced non-small cell lung cancer (NSCLC) patients receiving pemetrexed. Methods Twenty-five patients treated with pemetrexed-based regimens were included. Genomic DNA was isolated prior to treatment. The variable number of tandem repeat (VNTR) polymorphisms the G >?C single nucleotide polymorphisms (SNP) and the TS 6-bp insertion/deletion (6/6) in the 3? untranslated region (UTR) polymorphisms were analyzed and correlated with overall response rate (ORR) progression-free survival (PFS) overall-survival (OS) and toxicity. Results The genotype +6/+6 predicted a higher ORR among active/former smokers compared to +6/-6 genotype (100% vs. 50%; p =?0.085). Overall the 3R/3R genotype predicted a higher ORR (100%) over the rest VNTR polymorphisms (p =?0.055). The presence of 3R/3R genotype significantly correlated with a superior ORR in patients without EGFR activating mutations (100%) compared to 2R/2R 2R/3R and 3R/4R genotype (77.8% 33.3% and 0% respectively; p =?0.017). After a median follow-up of 21 months a trend towards a better PFS although not significant was found among subjects showing 3R/3R polymorphisms (p =?0.089). A significantly superior OS was found in patients showing 3R/3R genotype rather than other VNTR polymorphisms (p =?0.019). No significant correlation with the toxicity was observed. Conclusion In our series 3R/3R polymorphism correlated with a superior OS. Also this polymorphism when associated to wild type EGFR was related to a higher ORR to pemetrexed. Toxicity was not significantly correlated with a specific TS genotype. Thymidylate synthase Polymorphisms Epidermal growth factor receptor Predictive factors Prognostic factors Non-small cell lung cancer Background Lung cancer represents the most frequent cause of cancer deaths. More than 225000 new cases were diagnosed during 2012 only in the United States of America accounting for approximately 160000 annual deaths [12]. More than 50% of the patients diagnosed with non-small cell lung cancer (NSCLC) present advanced disease (stage III and IV) at onset. The most common histology is adenocarcinoma representing approximately 80% of all cases [3]. Pemetrexed is a multitargeted antifolate drug and one of the latest active drugs against NSCLC [4] approved for the first-line [5] (in combination with cisplatin) [6] and second-line treatment (monotherapy) of patients with non-squamous histology [7]. More recently pemetrexed gained approval for its use as a single-agent maintenance therapy [8] after response/stabilization to four cycles of a platinum doublet with or without pemetrexed. Thymidylate synthase (TS) is the main biological target of antifolate drugs such as pemetrexed or 5-fluorouracil. Different studies have evaluated the correlation between tumor TS expression and TS genotype and the prognosis of patients with different cancer types treated with antifolates [9-11]. In NSCLC constitutive expression of TS is lower in tumors with adenocarcinoma histology than among those with squamous differentiation [12]. This finding could possibly explain the higher efficacy of the drug among non-squamous histology patients. The potential predictive role of TS polymorphisms in NSCLC has never been studied in a European population. In addition how differential TS genotypes may impact on the outcome of patients depending on their smoking status or with Epidermal Growth Factor Receptor (EGFR) activating mutations tumors is to be determined. Finally although the toxicity profile described in most patients receiving pemetrexed in combination or as a single agent is usually favorable there are several reported cases of fundamentally dermatological hematological and potentially serious renal toxicities even when the recommended vitamin prophylaxis guidelines have been followed [13-15]. "

Lung_Cancer

"Silent lunch and tea break 7. Taking care of yourself - Sitting meditation ending in choiceless awareness - Exercise on taking care of yourself by examining how to improve balance in life - Meditation without CD - Yoga or walking meditation - Reflect on training - 3-min breathing space 8. The rest of your life - Bodyscan - Reflection on training - Further sources of information - Short sitting meditation - Maintaining practice Outcome measures Primary outcome measure Psychological distress The primary outcome measure is the total score on the HADS [39-41] which is developed to measure psychological distress in somatic patient populations. It consists of a 7-item anxiety (HADS-A) and 7-item depression (HADS-D) subscale. The HADS shows good psychometric properties in the general medical population including oncology patients [42]. Internal consistency as measured with Cronbach™s ? varied from .84 to .90 [4042].Test-retest reliability was good as Pearson™s r > .80 were obtained [4043]. Though the cut-off scores of the HADS vary among populations [44] in lung cancer patients they have found to be <8 versus ?8 on the HADS-A or HADS-D [45]. The HADS has been shown to be highly correlated with the Beck Depression Inventory [42]. It has previously been used in intervention studies of mindfulness and shown to be sensitive to change (e.g. [46]). Secondary outcome measures Quality of life (only for patients) The European anisation for Research and Treatment of Cancer (EORTC) Core Quality of Life Questionnaire (QLQ-C30) [47] is included along with the supplemental Lung Cancer questionnaire module (QLQ-LC13) [48]. The QLQ-C30 is designed to use in clinical trials on physical treatments for cancer patients. It incorporates five functional scales (physical role cognitive emotional social) three symptom scales (fatigue pain nausea and vomiting) a global health and quality of life scale and an array of single-item symptom measures. After revisions in the role functioning global health and physical functioning scale internal consistency of the subscales varied between .65 and .94 except for the cognitive functioning scale with ? varying from .56 to .63 [474950]. Test-retest reliability varied from .63 to .86 [51]. The lung cancer questionnaire module is designed to supplement the core questionnaire and comprises specific symptoms associated with lung cancer (coughing haemoptysis dyspnoea pain) and side-effects from conventional chemo- and radiotherapy (hair loss neuropathy sore mouth dysphagia). While the multi-item dyspnoea scale showed high internal consistency the pain subscale did not. When combined with the dyspnoea and pain items of the core questionnaire both the dyspnoea (? = .86) and pain (? = .71) subscale showed high internal consistency. Since the QLQ-C30 and QLQ-LC13 are mainly focused on physical symptoms we added the items Social Interaction and Alertness Behavior of the Sickness Impact Profile (SIP) [52]. Internal consistency was .94 and test-retest reliability was .92. The SIP correlated with self-assessed sickness and dysfunction [52]. Caregiver appraisal (only for partners) We use the 9-item Self-Perceived Pressure from Informal Care (SPPIC) [53] to assess the extent to which caregiving is experienced as burdensome. To also measure positive aspects of caregiving the 9-item subscale Care-Derived Self-Esteem of the Caregiver Reaction Assessment (CRA-SE) [54] is included. Internal consistency of the SPPIC was .79 and of the CRA-SE was .73. The SPPIC and CRA-SE were unrelated to each other [55]. Relationship quality To measure relationship satisfaction we included the 10-item Satisfaction subscale of the Investment Model Scale (IMS-S) [56]. The IMS-S starts with 5 items that measure concrete examplars of satisfaction to enhance the comprehensibility of the global items which are utilized to form the construct. Internal consistency varied from .79 to .95 and the IMS-S was related to the Dyadic Adjustment Scale. Also the Mutual Interpersonal Sensitivity scale (MIS) [57] is included to measure communication between partners about the cancer. It contains 18 items and is divided into two scales: open communication and avoiding negative thoughts about the cancer. Spirituality is measured with the Spiritual Attitude and Involvement List (SAIL) [58] and consists of 26 items divided into the subscales meaningfulness trust acceptance caring for others connectedness with nature transcendent experiences and spiritual activities. The internal consistency varied from .74 to .88 and test-retest reliability varied from .77 to .92. All subscales except for connectedness with nature were related with the Functional Assessment of Chronic Illness Therapy “ Spiritual Well-Being Scale. Costs (only for patients) The cost-effectiveness evaluation is carried out from a societal perspective considering direct as well as indirect health costs. Data on costs are collected prospectively using a diary in which participants register a) health care utilization: the type of care and its duration and b) cancer-related absence from work. Unit cost estimates are derived from the national manual for cost prices in the health care sector [59]. Costs of reduced ability to work are estimated using the friction costs method which results in a more realistic estimate than the human capital approach [60]. Treatment costs of MBSR are calculated using activity-based-costing methods thus measuring actual resources (time of therapist time of patients facilities) used. All unit cost prices are adjusted to 2013 prices. Unit cost estimates are combined with resource utilization data to obtain a net cost per patient over the entire follow-up period. Process measures Mindfulness skills are examined with the 39-item Five Facet Mindfulness Questionnaire (FFMQ) [6162]. The FFMQ is based on an exploratory factor analysis of five mindfulness measures which allowed items from different instruments to form factors providing an empirical integration of these independent attempts to operationalize mindfulness. This led to the following five subscales: observing describing acting with awareness non-judging of inner experience and non-reactivity to inner experience. Internal consistency varied from .72 to .93 among the different subscales. Most subscales were related to meditation experience Psychological Well-Being scales and psychological symptoms including the Brief Symptom Inventory [61]. FFMQ is sensitive to change in mindfulness-based interventions and is found to mediate the relationship between mindfulness practice and improvements in psychological symptoms (e.g. [63]). Self-compassion is assessed with the Self Compassion Scale (SCS) [6465] which has 26 items and is divided into six subscales: self-kindness versus self-judgment common humanity versus isolation and mindfulness versus over-identification. Internal consistency of the different subscales varied from .75 to .81 and test-retest reliability varied from .80 to .93. SCS correlated moderately with self-esteem measures including the Rosenberg Self-Esteem Scale. Furthermore whereas the self-esteem measures correlated significantly with the Narcissistic Personality Inventory the SCS was unrelated to narcissism [64]. SCS is sensitive to change through mindfulness-based interventions and is found to mediate MBCT™s treatment effects [66]. To measure rumination we administered the extended version of the Ruminative Response Scale (RRS-EXT) [67] Raes and Hermans: The revised version of the Dutch Ruminative Response Scale unpublished instrument]. The RRS-EXT contains 26 items in which a more adaptive thinking style (i.e. reflection) is distinguished from a more maladaptive one (i.e. brooding). Internal consistency varied from .72 to .77 and test-retest reliability varied from .60 to .62 for the brooding and reflection subscales. The concept of rumination seems to be sensitive to change through mindfulness-based interventions and has been shown to mediate the effect of MBSR on depressive symptoms in oncology patients [68]. The psychological stress reaction is measured with the 15-item Impact of Event Scale (IES) [6970] which assesses two categories of responses: intrusive experiences and avoidance of thoughts and images associated with the event. Internal consistency varied from .65 to .92 [71] and test-retest reliability varied from .79 to .87 among the subscales [69]. IES correlated with anxiety and depression subscales of the General Health Questionaire. Adherence to MBSR is assessed during the entire study period with a calendar on which participants in the MBSR condition fill out on a daily basis whether they adhere to the mindfulness exercises: either formal practice (e.g. meditation exercise like the bodyscan) informal practice (e.g. activity with awareness) or no exercise. Adherence to MBSR has been shown to mediate the effects of MBCT on depressive symptoms [72]. Statistical analysis plan Sample size To determine the required sample size first the sample size was calculated that would be needed for a simple t-test and subsequently it was corrected for clustering repeated measurements and baseline. A two-sided t-test on the total HADS score [3940] (i.e. our primary outcome measure examining psychological distress (HADS-total) anxiety symptoms (HADS-A) and depressive symptoms (HADS-D)) would require 64 participants in each group to have 80% power to detect a medium-sized difference (effect size = 0.5) with alpha = 0.05. To correct for clustering we multiplied this sample size of 64 with the design factor (1 + (n ? 1) * ICC) where n denotes the cluster size and where ICC denotes the intra-cluster correlation. In our study the treatment groups will consist of 14 people of whom about 7 will be patients. With n = 7 and an estimated ICC = 0.01. [72] the correction factor equals 1.06. To correct for repeated measurements and the use of the baseline measurement as a covariate we multiplied the required sample size by the design factor 1+?/2??02 where ? denotes the correlation between the post-treatment HADS measurements and ?0 denotes the correlation between the baseline HADS with the post-treatment HADS measurements. With ? = 0.8 and ? = 0.5 as conservative estimates the second design factor equals 0.65. Consequently after correction for clustering and covariates we arrived at a required sample size of 0.65 * 1.06 * 64 = 44 patients per arm. So 88 patients with lung cancer would be required for the study. Based on our pilot study [van den Hurk Schellekens Molema Speckens and van der Drift in preparation] we expect a 20% drop-out rate. Therefore we intend to include 110 patients and 110 partners. Primary analyses The samples of lung cancer patients and partners will be analyzed separately. Baseline characteristics of the population will be compared between MBSR and control group to ensure that key variables were evenly distributed by randomization. First analyses will be based on the intention-to-treat approach. Next we will perform per-protocol analyses with the treatment-adherent sample (i.e. in the MBSR condition participants have to attend at least four of the eight MBSR sessions [73] and in the TAU condition participants do not attend a mindfulness-based programme). We will use linear mixed models to analyze all outcome variables (i.e. psychological distress quality of life (only for patient) caregiver appraisal (only for partner) relationship quality and spirituality) with treatment as fixed factor baseline measurement as covariate and a random intercept based on MBSR group. This procedure will use all observed data in our analyses. In addition Cohen™s d effect size [74] will be reported based on the difference between the group means on baseline and follow-up scores divided by the pooled standard deviation at baseline and follow-up. Secondary analyses Cost effectiveness The quality of life measures (i.e. QLQ-C30; QLQ-LC13) will be used to calculate Quality of Adjusted Life Years (QALYs) for each individual. Costs and effects (in terms of QALYs) will be combined in the incremental cost-effectiveness ratio (ICER). The ICER expresses cost-effectiveness in terms of incremental costs per QALY gained. To estimate confidence intervals for the mean of the ICER a non-parametric bootstrapping method will be used performing 1000 replications of the original data. In order to express the implications of the cost-effectiveness results more clearly a cost-acceptability curve will be constructed. In case of dominance a full cost analysis will be conducted to estimate the mean savings per patient per year. Mediation analyses To examine the possible underlying mechanisms of change in MBSR mediation analyses will be conducted. Only the data of the treatment-adherent sample will be included in these analyses. By means of a multiple mediation model suggested by Preacher and Hayes [75] we will test the mediating effect of mindfulness skills self-compassion rumination and adherence to MBSR on psychological distress quality of life (only in patients) caregiver appraisal (only in partners) relationship quality and spirituality. Discussion In the last ten years MBSR has not only proven to be a feasible and acceptable intervention in cancer patients [76] but it also seems to be effective in reducing psychological distress [30]. However the generalization of these results is limited because most participants were female patients with breast cancer. A large part of lung cancer patients already have advanced cancer at time of diagnosis and are confronted with a poor prognosis and low health status. Consequently they more often report psychological distress than patients with other diagnoses of cancer [89]. Hence it is not yet clear whether MBSR is a feasible acceptable and effective intervention in patients with lung cancer. Moreover little is known about the effectiveness of MBSR in partners of cancer patients [30] though they also often report psychological distress. Our pilot study of 19 lung cancer patients and 16 partners participating in an MBSR course provides preliminary evidence that MBSR is feasible and acceptable in this population (van den Hurk Schellekens Molema Speckens and van der Drift in preparation). The current trial will answer the question whether MBSR is effective in patients with lung cancer and their partners. We started enrolment of participants in February 2012. At the moment we think recruiting a sufficient number of patients and partners will be a challenge due to rapidly fluctuating health status and sudden changes in cancer treatment [77]. The main reasons for declining participation in patients is ˜being too ill™ or that it is ˜too much of a burden during chemo and/or radiotherapy™. Furthermore no perceived need or motivation for the training is commonly mentioned. Among partners participation is highly depending on whether the patient is willing to participate. Although partners can take part separately partners who are interested do often not participate when the patients decline participation. Considering the difficulty of studying lung cancer patients and their partners [77] our trial will offer valuable information on whether MBSR as one of the few available psychosocial care programmes contributes to the alleviation of their psychological distress. Abbreviations MBSR: Mindfulness-based stress reduction; RCT: Randomized controlled trial; RUNMC: Radboud University Nijmegen Medical Centre; MBCT: Mindfulness-based cognitive therapy; MMSE: Mini mental state examination; DT: Distress thermometer; HADS: Hospital anxiety and depression scale; QLQ-C30: Quality of life “ cancer; QLQ-LC13: Quality of life “ lung cancer; SIP: Sickness impact profile; SPPIC: Self-perceived pressure from informal care; CRA-SE: Caregiver reaction assessment “ care-derived self-esteem; IMS-S: Investment model scale-satisfaction; MIS: Mutuality and interpersonal sensitivity; SAIL: Spiritual attitude and involvement list; FFMQ: Five facet mindfulness questionnaire; SCS: Self-compassion scale; RRS-EXT: Rumination response scale “ extended version; IES: Impact of event scale. Competing interests The authors declare that they have no competing interests. Authors™ contributions All authors contributed to the design of the study. AS MD and JP are the principal investigators of the study. MS drafted the paper which was modified and supplemented by all other authors. DH MS and MD are involved in recruiting participants while MS and DH take care of the logistics of the study and data collection. RD contributed specifically to the statistical analysis plan and WW contributed specifically to the design of the cost-effectiveness evaluation. All authors read and approved the final manuscript. Pre-publication history The pre-publication history for this paper can be accessed here: http://www.biomedcentral.com/1471-2407/14/3/prepub Acknowledgements This research is funded by Foundation Alpe d™HuZes and the Dutch Cancer Society (Grant number KUN 2011“5077 awarded to Prof. dr. Anne E. M. Speckens Dr. Miep A. van der Drift and Prof. dr. Judith B. Prins). Jemal A Bray F Center MM Ferlay J Ward E Forman D Global cancer statistics CA Cancer J Clin 2011 61 2 69 90 10.3322/caac.20107 21296855 Akechi T Okamura H Nishiwaki Y Uchitomi Y Psychiatric disorders and associated and predictive factors in patients with unresectable nonsmall cell lung carcinoma: a longitudinal study Cancer 2001 92 10 2609 2622 10.1002/1097-0142(20011115)92:10<2609::AID-CNCR1614>3.0.CO;2-K 11745196 Uchitomi Y Mikami I Kugaya A Akizuki N Nagai K Nishiwaki Y Akechi T Okamura H Depression after successful treatment for nonsmall cell lung carcinoma: a 3-month follow-up study Cancer 2000 89 5 1172 1179 10.1002/1097-0142(20000901)89:5<1172::AID-CNCR27>3.0.CO;2-U 10964348 Montazeri A Milroy R Hole D McEwen J Gillis CR Anxiety and depression in patients with lung cancer before and after diagnosis: findings from a population in Glasgow Scotland J Epidemiol Community Health 1998 52 3 203 204 10.1136/jech.52.3.203 9616429 Hyodo I Eguchi K Takigawa N Segawa Y Hosokawa Y Kamejima K Inoue R Psychological impact of informed consent in hospitalized cancer patients: a sequential study of anxiety and depression using the Hospital Anxiety and Depression scale Support Care Cancer 1999 7 6 396 399 10.1007/s005200050299 10541981 Turner NJ Muers MF Haward RA Mulley GP Psychological distress and concerns of elderly patients treated with palliative radiotherapy for lung cancer Psychooncology 2007 16 8 707 713 10.1002/pon.1109 17115458 Hopwood P Stephens RJ Depression in patients with lung cancer: prevalence and risk factors derived from quality-of-life data J Clin Oncol 2000 18 4 893 903 10673533 Zabora J Brintzenhofeszoc K Curbow B Hooker C Piantadosi S The prevalence of psychological distress by cancer site Psychooncology 2001 10 1 19 28 10.1002/1099-1611(200101/02)10:1<19::AID-PON501>3.0.CO;2-6 11180574 Carlson LE Angen M Cullum J Goodey E Koopmans J Lamont L MacRae JH Martin M Pelletier G Robinson J High levels of untreated distress and fatigue in cancer patients Br J Cancer 2004 90 12 2297 2304 15162149 Temel JS Greer JA Muzikansky A Gallagher ER Admane S Jackson VA Dahlin CM Blinderman CD Jacobsen J Pirl WF Early Palliative Care for Patients with Metastatic Non-Small-Cell Lung Cancer N Engl J Med 2010 363 8 733 742 10.1056/NEJMoa1000678 20818875 Abernethy AD Chang HT Seidlitz L Evinger JS Duberstein PR Religious coping and depression among spouses of people with lung cancer Psychosomatics 2002 43 6 456 463 10.1176/appi.psy.43.6.456 12444228 Thielemann PA Conner NE Social support as a mediator of depression in caregivers of patients with end-stage disease "

Lung_Cancer

"requires an intraoperative fluoroscopy to confirm an adequate excision as well as lead to increased radiation exposure (10-13). The use of mixture has been reported to make up for the weakness of marking materials. For example the problem of dye diffusion has led to attempts to use a mixture of dye with various materials such as cyanoacrylate adhesive or collagen or autologous blood (14-16). However they have not been widely used for localization due to difficulties in making and manipulation. Lipiodol and methylene blue are commonly used materials for localization (17-20). We hypothesized that lipiodol reduces the spread of methylene blue and provides additional localization opportunities by its radio-opacity. The use of a mixture of lipidol and methylene blue (MLM) for a percutaneous injection material requires a high success rate for appropriate localization and a low complication rate. To our knowledge there have been no reports that evaluate the availability of MLM as a percutaneous injection material in human lungs. This study compared MLM with methylene blue as a percutaneous injection material for pulmonary localization in rabbit lungs. MATERIALS AND METHODS Animal preparation This study was performed after approval by the Institutional Animal Care and Use Committee (IACUC) in Seoul National University Hospital biomedical research institute (IACUC approval No. 11-0356). Twenty-four adult New Zealand White rabbits were used. We recorded their weight before the procedures. The animals were randomly divided into two groups: Group A (n=12) and Group B (n=12) each sacrificed at about 6 hr and 24 hr after percutaneous injections respectively (Fig. 1). Six hours after percutaneous injections were same day operations of the preoperative localization; and 24 hr after percutaneous injections were next day operations of the preoperative localization. The injection of each material was done in all 24 subjects because we injected methylene blue and MLM at two different lung sites for each subject. Percutaneous injection materials: mixture of lipiodol and methylene blue versus methylene blue A pilot study was performed to decide the optimal amount of materials for percutaneous injections. Methylene blue (1% 100 mg/mL TERA Pharmaceuticals Buena Park CA USA) of 0.3 to 0.9 mL was used for human lung localization in previous studies by Wicky et al. (18) and Vandoni et al. (19). In the pilot study with rabbit lungs we injected 0.1 mL and 0.05 mL of methylene blue and MLM in four subjects. We found that staining was extensive (more than half height of one lobe) with 0.1 mL and localized (about 1 cm of staining diameter) with 0.05 mL for both methylene blue and MLM. Extensive dispersion made it difficult to find exact injecting sites; subsequently 0.05 mL of methylene blue was administered. We made variable mix ratios of lipiodol and methylene blue in vitro; 1:1 1:2 1:3 1:4 and 1:5 in order to find an appropriate mixing ratio of lipiodol (480 mg Iodine/mL Andre Guerbet Aulnay-sous-Bois France) and methylene blue. The separation of two materials occurred instantly after mechanical blending to the fat-soluble character of lipiodol and the water-soluble character of methylene blue. A higher concentration of lipiodol in MLM resulted in increased uneven blending and rapid separation. A mixture with a 1:6 (or lower) mixing ratio contained a minimal amount of lipiodol and it might make it difficult to be detected on the fluoroscopy; subsequently we decided that 1:5 was an appropriate mixing ratio for injection. A total of 0.06 mL of MLM (0.01 mL of lipiodol plus 0.05 mL of methylene blue) was administrated in each subject to avoid the effect of different volumes of methylene blue to the diffusion extent of the materials. CT guided percutaneous injections Percutaneous injection was performed with computed tomography (CT) guidance (Discovery CT750 HD; GE Healthcare Waukesha WI USA). We performed pre-procedural CT scans in order to determine an appropriate skin entry site for the successful placement of a needle in the desired location. The desired location was the basal portion of both caudal lobes around the mid-scapula line. We tried to situate the needle tip at 5 mm depth from the visceral pleura and avoid passing through the pulmonary vessels. We placed the needle of 20 gauze and 3.5 cm length in the lung parenchyma after marking the appropriate skin entry site. The parameters of CT used in our study were: tube voltage of 120 kV tube current of 25 mA slice thickness of 2 mm thickness and gantry rotation speed of 350 milliseconds. We connected 1 mL syringe to the needle hub and retracted the syringe piston to confirm that no blood was aspirated after the needle tip was accurately located within the desired location. We then injected the materials and immediately removed the needle. On the procedural CT scan we measured the distance from the skin-entry to the needle tip and the depth from visceral pleura to the needle tip. A post-procedural CT scan identified procedure-related complications that included the leakage of injecting materials and pneumothorax; in addition we recorded the extent shape and density of radio-opacity of MLM after injection. The extent of MLM was defined as a maximum diameter of the radio-opacities. The shape of radio-opacity was categorized into 3 groups (small faint nodular scattered nodular and discrete compact nodular). We recorded the injection time to measure the time interval between injection and sacrifice. Fluoroscopic examinations A successful localization of lipiodol was determined by fluoroscopic examination; subsequently we evaluated the radio-opacity of MLM using the fluoroscopy X-ray unit (BV Pulsera; Philips Medical Systems Best The Netherlands) at the immediate post-procedure session and the follow up session at 6 hr in Group A and 24 hr in Group B. The parameters of fluoroscopy were: tube voltage of 59 kV and tube current of 946 mA. We obtained anteroposterior fluoroscopic images of the thorax of the rabbit with a 17 cm of field of view. A radio-opaque ruler of 5 cm was located near the rabbit in order to estimate the exact size of lipiodol opacity. We recorded the time of the fluoroscopic examinations and the radiographic findings of MLM (size and shape of the radio-opacity). Evaluation of the staining and radio-opacity We assessed the directly visible staining on the freshly excised lung surface and radio-opacity of MLM on the fluoroscopic examinations using 4-point scoring in order to compare the localization ability of MLM and methylene blue as a percutaneous injection material. A blind reviewer who was unaware of the injection materials assessed the staining ability. In order to evaluate the staining ability the blind reader reviewed the photographic images of the freshly excised lung specimens obtained before formalin fixations and rated the staining by 4-point scores: 0=non-visualization of staining 1=inappropriate; extensive dispersion made it difficult to find accurate injecting locations 2=acceptable; available to estimate injecting locations in spite of the dispersion and 3=excellent definitely localized staining (Fig. 2). The maximum diameter of the staining extent on the lung surface was measured. We calculated and compared scores and extent of staining between two materials. For the fluoroscopic findings the radio-opacity of MLM was evaluated using 4-point scoring: 0=no detectable radio-opacity 1=inappropriate minimally increased opacity 2=acceptable low density of increased opacity 3=excellent compact nodular increased opacity (Fig. 3). We compared the average scores of initial and follow up fluoroscopic examinations. We considered a score of 0 or 1 as inappropriate and a score of 2 or 3 as appropriate for localization for both staining and radio-opacity. We compared the number of appropriate or excellent localization between MLM and methylene blue. Sacrifice and histopathologic examinations Both freshly excised entire lungs were used as final specimens. The lung tissues were fixed in 10% neutral formalin embedded in paraffin and cut into 5 µm thick slices after we took photographs to record staining on the lung surface. We made 4 axial slices that covered the center of the staining. The slices were subjected to hematoxylin-eosin (H-E) stain to the evaluate lung parenchymal change. We evaluated the presence or absence of neutrophil infiltration vasculitis necrosis hemorrhage and foam cell in alveolus. The extent of each histopathologic finding was estimated using visual grading scores as 0 (no) 1 (focal) or 2 (diffuse). Localized parenchymal change (<50% of total area) surrounded by normal lung was defined as focal. Extensive lung parenchymal change (?50% of total area) that replaced normal lung was defined as diffuse. An experienced pathologist with eight years of experience reviewed all slices. The overall severity of the lung parenchymal change was defined as a total score by adding visual grading scores for each histopathologic finding. We compared the overall severity score between MLM and methylene blue as well as between Group A and Group B. Statistical analysis All data are expressed as mean±standard deviation (SD) unless otherwise stated. Comparisons of the average scores were performed by two-tailed unpaired Student's t-test or Mann-Whitney test. We used a Fisher's exact test to compare the number of subjects in the subgroups. Linear by linear association evaluated the association of the extent of lung parenchymal change and materials or groups. Null hypotheses of no difference were rejected if the P values were less than 0.05. The statistical analysis was performed with commercially available statistical software IBM SPSS Statistics version 20.0 (IBM Corp. in Armonk NY USA). RESULTS Subject characteristics procedural records time interval of injection and examinations Among the 24 subjects included in our study successful CT-guided percutaneous injections into the desired location of the lung were achieved in 21 subjects (11 in Group A and 10 in Group B). Three subjects died during anesthesia. Mean weight was 3.2±0.2 kg for Group A and 3.3±0.2 kg for Group B. Injection depth from visceral pleura to needle tip was 0.4±0.1 cm (range: 0.3-0.6 cm) for MLM and 0.4±0.1 cm (range: 0.3-0.7 cm) for methylene blue (P=0.43). Distance from skin to needle tip was 2.8±0.6 cm (range: 2.1-5.0 cm) for MLM and 2.8±0.3 cm (range: 2.2-3.5 cm) for methylene blue (P=0.83). Of 42 CT-guided percutaneous injections total number of procedure related complications was 10 (24%) including 7 leakage (all in MLM) and 3 pneumothorax (2 in MLM 1 in methylene blue). The complication rate in MLM was significantly higher than methylene blue (43% vs 5%) (P=0.004). On post-procedural CT images the extent of the radio-opacity of MLM was 1.3±0.4 cm (range: 0.7-2.0 cm) for Group A and 0.6±0.3 cm (range: 0.3-1.1 cm) for Group B. Discrete compact nodular opacity was achieved in 15 subjects (72%) scattered nodular opacities in 3 (14%) and small faint opacity in 3 (14%) (Fig. 4). The average value of radio-opacity of MLM was 1415±856 HU (range: 307-2768 HU). The interval between injection and sacrifice was 7.9±0.1 hr (range: 7.8-8.0 hr) for Group A and 23.5±0.1 hr (range: 23.4-23.7 hr) for Group B. Time from injection to initial and follow up fluoroscopy was 3.4±0.5 hr (range: 2.5-4.2 hr) and 6.8±0.4 hr (range: 6.3-7.7 hr) for Group A and 1.5±0.4 hr (range: 0.9-2.1 hr) and 22.6±0.4 hr (range: 21.9-23.2 hr) for Group B respectively. Scores and extent of staining and radio-opacity Table 1 demonstrates the staining extent and localization ability of MLM and methylene blue. In total groups the staining extent of MLM was significant smaller than methylene blue (0.6 cm vs 1.0 cm P<0.001). MLM showed a significantly higher staining ability score than methylene blue (2.8 vs 2.2 P=0.010). Radio-opacity in the initial fluoroscopy was not significantly different from the follow up (2.0 vs 1.9 P=0.49). Table 2 showed the number of subjects in each score of localization ability of staining or radio-opacity. In Group A appropriate staining was 100% for both MLM and methylene blue. In Group B appropriate staining was 90% for MLM and 70% for methylene blue. Appropriate staining of MLM was not significantly different from that of methylene blue (95% vs 86% P=0.61); "

Lung_Cancer

"This is obtained by specifying C as an (L ? ?0 + 1)-dimensional vector of 1's with v? = 1. More sophisticated models with splines or other functions such as those illustrated in publications cited in only require the application of different bases for deriving C but are nevertheless represented by 3). 2.2. Extension to nonlinear exposure“response relationships The extension to the nonlinear case presents further complexities as anticipated earlier. The model in (1) can be extended by defining an additional exposure“response function f(x) to express the potentially nonlinear exposure“response curve along the dimension of the predictor. An intuitive generalization of (1) is: (4) with f(x) as the standard exposure“response function. However the function f(x) · w(?) in 4) previously proposed 1119 is not easily represented as a linear combination of basis variables and generates models that are not linear in their parameters and thus require ad hoc optimization routines. More importantly this representation is based on the strong assumption of independency between f(x) and w(?) namely that the exposure“response shape is the same at each lag ? and vice versa that the lag structure is the same at each value of x. This assumption can be relaxed by expressing s(xt) as a truly bivariate function with the more flexible representation: (5) Here the bidimensional function f · w(x?) is defined as the exposure“lag“response function and models simultaneously the exposure“response curve along x and lag“response curve along ? namely an exposure“lag“response surface. Differently from 4) the exposure“lag“response function in 5) can be expressed as a linear combination of basis variables and related parameters through a special tensor product. As anticipated earlier Armstrong 23 proposed the same approach for time series data within the DLNM framework generalizing this tensor product parameterization through the concept of cross-basis. Specifically two sets of basis functions are independently chosen to represent f(x) and w(?) respectively. The cross-basis is the bidimensional space of functions obtained by the combination of the two sets integrated over the lag dimension and represents the core of DLNMs. The algebraic representation has been previously presented 24 and a revised version is proposed here. Briefly the simpler lag-basis for DLMs in 3) can be extended by choosing an additional basis with dimension vx for representing f(x). The application of the related basis functions to the vector of exposure history qxt obtained by 2) generates a (L ? ?0 + 1) — vx matrix Rxt. Let Axt be: (6) with 1v as a v-dimensional vector of 1's and C defined in 3). The cross-basis function s(xt;?) can be defined as (7) In this case the dimension of the cross-basis is determined by the product of the dimensions of the bases for the two spaces and the association is expressed through vx · v? values W and related parameters ?. The cross-basis function s(xt) represents the integral of f · w(x?) over the interval [?0L] cumulating the contributions of events representing the exposure history. In spite of the relatively complex algebraic form the definition of cross-basis and the specification of DLNMs only amount to the choice of the bases for the functions f(x) and w(?). These can be independently selected between several options such as splines linear threshold or piecewise constant (step) functions. The DLNM modeling class comprises the simpler DLMs from Section 2.1. For example the bidimensional exposure“lag“response function f · w(x?) in 5) reduces to a non-linear function for un-weighted cumulative exposure f(x) · c when w(?) is a constant function c and to the lag“response function x · w(?) in (1) when f(x) is simply an linear function of the untransformed x. The model proposed by Berhane and colleagues 20 can be written in the form of 6)“7) when both f(x) and w(?) are cubic B-splines. 2.3. Estimation and prediction Although the lag-basis and cross-basis functions in (1)“(3) and (5)“(7) involve a nonstandard parameterization in terms of exposure histories DLMs and DLNMs do not require specialized estimation procedures. The association is entirely expressed by the vx — v? parameters ? of the cross-basis values W. The computation of the exposure history in (2) can be extended to all N observations with x measured at time t producing an N — (L ? ?0 + 1) matrix of exposure histories Q. The matrix of transformed variables W in (3) and (7) is consequently derived. This matrix can be included in the design matrix of standard regression models to estimate the parameters ?. In the completely parametric development proposed here the number of coefficients vx — v? represents the degrees of freedom (df) used to model the association. Inference on the parameters ? and interpretation of the estimated association is aided by the prediction of specific risk measures. For simpler DLMs that assume a linear exposure“response relationship this step reduces to the computation of a series of estimated risk contributions at lag ?p with ?0 ? ?p ? L and the associated (co)variance matrix . The series of risk contributions is provided by (8) with Cp obtained from the vector of lag ?p used for prediction by applying the same basis functions for w(?) used for estimation. These estimated risk contributions compose the lag“response curve and can be interpreted using either a forward or backward perspective. Namely represents the risk contribution at time t + ?p in the future from a unit increase in exposure x at time t or the contribution from a unit increase in exposure x occurring at time t ? ?p in the past to a given risk measured at time t. The estimated risk contributions associated with different exposure increases are easily derived. The equations in (8) only apply to DLMs with lag-bases as defined in (3). For DLNMs the association is allowed to vary nonlinearly in the space of x. Moreover the specification in (5)“(7) allows the lag-response curve to change depending on the level of the exposure. The prediction of risk contributions corresponding to a specific exposure intensity xp at lag ?p involves a more complex procedure. First let be the (L ? ?0 + 1)-dimensional vector of exposure history with constant exposure xp. The related matrices and are derived from (6) substituting qxt and C with and Cp by applying the same two sets of basis functions for f · w(x?) chosen for estimation. The exposure-specific risk contributions and associated (co)variance matrix are provided by (9) The estimated risk contributions may be interpreted as a lag-response curve similar to in (8) but this time associated with a specific exposure level xp instead of a unit increase. These measures may be used to define a grid of predicted risk contributions defined within the ranges of the exposure x and the lag ? thus obtaining a bi-dimensional representation of the association. From this grid besides above it is also possible to derive the vector of lag-specific risk contributions expressing the exposure-response curve for lag ?p. As noted in Section 2.2 the truly bivariate definition of (7) allows both the lag-response curve and exposure-response curve defined by and respectively to change depending on the specific exposure and lag values xp and ?p. The grid is interpreted as a risk surface along x and ? representing the exposure“lag“response. In addition predictions in (8)“(9) may be extended to a generic exposure history qh. Substituting it into in (9) provides the vector of lag-specific risk contributions for each exposure that occurred within the lag period. The overall cumulative effect of such exposure history with associated (co)variance matrix may be computed with: (10) The Equation (10) can be used to estimate the predicted cumulative risk for a given pattern of exposure qh. This method can also be applied to investigate how the risk progressively evolves along an exposure profile computing the cumulative risk at each time associated with the time-varying exposure history qh. 2.4. "

Lung_Cancer

"disease? and treatment?related symptoms; pharmacokinetics (PK); pre? and posttreatment concentrations of the extracellular domains of HER2 and EGFR in serum; and genetic variation in HER family and KRAS genes from free tumor DNA in blood. This trial was conducted in compliance with the Declaration of Helsinki and with the International Conference on Harmonization Good Clinical Practice Guidelines protocol and was approved by the Institutional Review Boards and/or Independent Ethics Committees at each of the participating investigational centers. All patients provided written informed consent prior to study participation. Evaluation of Antitumor Activity Evaluation of antitumor activity per RECIST version 1.012 was by investigator review. Tumor assessments were performed at baseline and at the end of every even?numbered cycle or when progressive disease was suspected. Evaluation of Safety and Tolerability Safety and tolerability were assessed by standard methods from initiation of study treatment until??28 days after the last dose of study drug. Adverse events (AEs) were graded by National Cancer Institute Common Terminology Criteria for Adverse Events version 3.0. Pharmacokinetic Analyses Biomarker Determination and Pharmacodynamic Analyses Blood samples for PK analyses were collected up to 24 hours after dose on day 1 of cycle 1 before dose on days 27 and 14 of cycle 1 and day 1 of cycle 2. PK parameters for dacomitinib including the maximum concentration (Cmax) the time to Cmax (Tmax) and the area under the plasma concentration curve from 0 to 24 hours (AUC0?24) were analyzed using a noncompartmental approach. Tumor tissue from new biopsies obtained at enrollment or archival samples (which may have been pre? or post?erlotinib) was analyzed for EGFR and KRAS gene mutation status using Qiagen Scorpion ARMS (Amplified Refractory Mutation System) allele?specific polymerase chain reaction assay; HER2 mutation status was determined by DNA sequencing. EGFR and HER2 gene amplification were assessed by fluorescence in situ hybridization. EGFR amplification was defined as?>15 copies of EGFR gene signals in?>10% of analyzed cells; HER2 amplification was defined as a HER2 gene/centromere of chromosome 17 ratio of?>2. Blood samples for biomarker analysis were collected at baseline and prior to dosing on day 1 of each cycle. Concentrations of HER2 and EGFR extracellular domains were determined by enzyme?linked immunosorbent assay. Patient?Reported Outcomes PROs of HRQoL disease symptoms specific to lung cancer and side effects of treatment were assessed using the 30?question European anisation for Research and Treatment of Cancer Quality of Life Questionnaire core module (EORTC QLQ?C30)13 which includes functional symptom side effects and global health status scales and the 13?item Lung Cancer symptom?specific module (QLQ?LC13).14 The impact of dacomitinib on patients' skin condition was assessed using the 10?item Dermatology Life Quality Index (DLQI) questionnaire. Statistical Design and Analyses The trial used a Fleming single?stage design for each patient population (adenocarcinoma and nonadenocarcinoma respectively). The primary objective of this study was to test the null hypothesis (H0) at the 0.05 significance level with 80% power that the objective response rate (ORR) in patients with adenocarcinoma did not exceed 5%. At the end of the study if there were at least 6 objective responders in 44 response?evaluable patients then the null hypothesis would be rejected demonstrating that treatment with dacomitinib is associated with a true response rate that exceeds 5%. A secondary objective was to test the H0 at the 0.05 significance level with 80% power that the ORR in patients with nonadenocarcinoma did not exceed 1%. At least 2 objective responders among 22 response?evaluable patients were required to reject the null hypothesis and conclude that treatment with dacomitinib demonstrates a true response rate that exceeds 1%. Target enrollment of 49 and 25 patients with adenocarcinoma and nonadenocarcinoma respectively was required and accounted for a rate of nonevaluability for response of up to 10%. Baseline characteristics PFS PFS6M OS OS6M and OS12M were evaluated in the intent?to?treat population safety in the as?treated population and response was assessed in response?evaluable patients. Results Patient Characteristics and Disposition Sixty?six patients were enrolled between April 2008 and November 2009 50 with adenocarcinoma and 16 with nonadenocarcinoma. Patient disposition is shown in Fig. 1. Enrollment of the nonadenocarcinoma arm was closed prior to reaching the planned target of 25 due to few nonadenocarcinoma patients identified with prior erlotinib treatment. Patient characteristics are summarized in . The majority of patients had received 2 or 3 prior treatment regimens (n?=?26 [39%] each). In addition to erlotinib prior EGFR?directed therapies comprised gefitinib (n?=?4) cetuximab (n?=?3) and neratinib (n?=?1). Fifty?five percent of the enrolled population were current or former smokers. Wild?type KRAS NSCLC was either directly confirmed (n?=?54) or assumed from a known EGFR mutation (n?=?12; EGFR mutation status was known for a total of 26 patients). Mutation and gene amplification data were collected from EGFR and HER2 according to availability of sufficient tissue for analysis (). Six patients had EGFR T790M resistance mutation identified after treatment with erlotinib (Supporting ; see online supporting information). T790M status was unknown in 54 patients who had biopsies taken prior to progression on erlotinib. Overall 74% of patients started dacomitinib within 3 months of discontinuing erlotinib. Of the 26 patients who had EGFR?mutant tumors at baseline the interval from discontinuing erlotinib to starting dacomitinib ranged from 15 to 544 days with 69% starting dacomitinib within 3 months of discontinuing erlotinib. Study flow diagram shows patient disposition and analysis populations. image Patient Baseline Characteristics Characteristic Adenocarcinoma (n?=?50) Nonadenocarcinoma (n?=?16)e Total (N?=?66) Median age years (range) 60 (37?79) 61 (50?84) 60 (37?84) Sex n (%) Male 15 (30.0) 14 (87.5) 29 (43.9) Female 35 (70.0) 2 (12.5) 37 (56.1) Race n (%) Caucasian 35 (70.0) 11 (68.8) 46 (69.7) Asian 12 (24.0) 2 (12.5) 14 (21.2) Other 3 (6.0) 3 (18.8) 6 (9.1) Smoking status n (%) Never?smoker 27 (54.0) 3 (18.8) 30 (45.5) Current smoker 1 (2.0) 2 (12.5) 3 (4.5) Exsmoker 22 (44.0) 11 (68.8) 33 (50.0) ECOG performance status n (%) 0 18 (36.0) 5 (31.3) 23 (34.8) 1 27 (54.0) 8 (50.0) 35 (53.0) 2 5 (10.0) 3 (18.8) 8 (12.1) Prior treatment regimens n (%) 1 regimena 4 (8.0) 1 (6.3) 5 (7.6) 2 regimens 18 (36.0) 8 (50.0) 26 (39.4) 3 regimens 19 (38.0) 7 (43.8) 26 (39.4) >3 regimensb 9 (18.0) 0 9 (13.6) Mutational status n (%) KRAS WT or EGFR sensitizing mutation 50 (100.0) 16 (100.0) 66 (100.0) KRAS WT 39 (78.0) 15 (93.8) 54 (81.8) KRAS unknown 11 (22.0) 1 (6.3) 12 (18.2) EGFR WT 10 (20.0) 13 (81.3) 23 (34.8) EGFR sensitizing mutation 24 (48.0) 2 (12.5) 26 (39.4) Exon 19 or 21 18 (75.0) 1 (50.0) 19 (73.1) Other 6 (25.0) 1 (50.0) 7 (26.9) EGFR unknown 16 (32.0) 1 (6.3) 17 (25.8) EGFR T790M secondary resistance mutation 6 (12.0)c 0 6 (9.1)c T790M unknown 39 (78.0) 15 (93.8) 54 (81.8) HER2 mutation 0 0 0 HER2 WT 29 (58.0) 13 (81.3) 42 (63.6) HER2 mutation unknown 21 (42.0) 3 (18.8) 24 (36.4) HER2 amplification positive 2 (4.0) 1 (6.3) 3 (4.5) HER2 amplification negative 22 (44.0) 11 (68.8) 33 (50.0) HER2 amplification unknown 26 (52.0) 4 (25.0) 30 (45.5) Prior EGFR?directed treatment n (%) Erlotinib 50 (100.0) 16 (100.0) 66 (100.0) Gefitinib 3 (6.0) 1 (6.3) 4 (6.1) Neratinibd 1 (2.0) 0 1 (1.5) Cetuximabd 2 (4.0) 1 (6.3) 3 (4.5) Response to immediately prior EGFR?directed treatment n (%) CR 1 (2.0) 0 1 (1.5) PR 13 (26.0) 0 13 (19.7) SD 21 (42.0) 5 (31.3) 26 (39.4) PD 9 (18.0) 10 (62.5) 19 (28.8) Unknown 6 (12.0) 1 (6.25) 7 (10.6) Abbreviations: CR complete response; ECOG Eastern Cooperative Oncology Group; EGFR epidermal growth factor receptor; PD progressive disease; PR partial response; SD stable disease. a Four patients in Arm A and 1 patient in Arm B had prior systemic treatment and prior erlotinib entered as 1 regimen. b Patients with >3 prior regimens includes patients with neoadjuvant and/or adjuvant therapies and/or investigational treatment regimen(s). c T790M status was derived from archival biopsies for 4 patients and fresh baseline biopsies for 2 patients. Three of the 4 patients with T790M status ascertained from an archival biopsy initiated dacomitinib more than 90 days after discontinuing from erlotinib. d Patients previously treated with investigational EGFR?directed therapies were eligible to participate in the study and did not represent protocol deviations provided the study sponsor provided written agreement. e Squamous n?=?12. Efficacy Best Overall Response In the overall population the ORR for response?evaluable patients was 5.2% (3 partial responses [PRs] of durations 1224 and 66 weeks). The ORR for patients with adenocarcinoma was 4.8% (2 PRs; 1?sided P?=?.372). For patients with nonadenocarcinoma the ORR was 6.3% (1 PR). The 25 response?evaluable patients with EGFR mutation?positive tumors (from both arms) achieved an ORR of 8% (2 PRs) and 17 (68%) achieved a BOR of stable disease (SD)??6 weeks (Table 2). Further details of the patients with PRs are presented in Supporting Table 2. Six patients had known EGFR T790M; of these 3 had SD??6 weeks (912 and 12 weeks respectively) and 3 had progressive disease (PD). Table 2 Summary of Best Overall Response Per RECIST by Investigator Assessment PFS and OS Adenocarcinoma Arm A Nonadenocarcinoma Arm B Total Overall Patient Population No. of patients evaluable n 42 16 58 Objective response (CR?+?PR) n (%) [95% exact CI]a 2 (5) [1?16] 1 (6) [0?30] 3 (5) [1?14] P valueb 0.372 0.149 – Clinical benefit (CR?+?PR?+?SD???24 weeks) n (%) [95% exact CI]a 10 (24) [12?40] 3 (19) [4?46] 13 (22.4) [13?35] Duration of response weeks 24c 66d 12e NA No. of patients enrolled n 50 16 66 No. of PFS eventsf n (%) 40 (80) 14 (88) 54 (82) PFS weeks [95% CI] 12 [8?20] 11 [6?18] 12 [9?19] PFS6M % [95% CI] 24 [12?38] 8 [1?30] 20 [11?32] No. of deaths n (%) 33 (66) 14 (88) 47 (71) OS weeks [95% CI] 45 [29?73] 27 [10?36] 37 [28?57] OS6M % [95% CI] 72 [57?82] 50 [25?71] 66 [53?76] OS12M% [95% CI] 46 [31?60] 22 [6?45] 40 [28?52] Patients With EGFR?Mutant Tumors No. of patients evaluable n 23 2 25 Objective response (CR?+?PR) n (%) [95% exact CI]a 2g (9) [1?28] 0 2g (8) [1?26] Clinical benefit (CR?+?PR?+?SD ?24 weeks) n (%) [95% exact CI]a 7 (30) [13?53] 0 7 (28) [12?49] No. of patients n 24 2 26 No. of PFS eventsf n (%) 19 (79) 2 (100) 21 (81) PFS weeks [95% CI] 18 [6?30] 21 [17?24] 18 [9?29] PFS6M % [95% CI] 36 [16?57] – 32 [14?52] No. of deaths n (%) 17 (71) 1 (50) 18 (69) OS weeks [95% CI] 59 [42?76] – [24 –] 57 [42?75] OS6M % [95% CI] 83 [62?93] 50 [1?91] 81 [60?92] OS12M % [95% CI] 61 [38?77] – 59 [37?76] Patients With EGFR Wild?Type Tumors No. of patients evaluable n 7 13 20 Objective response (CR?+?PR) n (%) [95% exact CI]a 0 [0?41] 1h (8) [0?36] 1h (5) [0?25] Clinical benefit (CR?+?PR?+?SD ?24 weeks) n (%) [95% exact CI]"

Lung_Cancer

"This led to the following five subscales: observing describing acting with awareness non-judging of inner experience and non-reactivity to inner experience. Internal consistency varied from .72 to .93 among the different subscales. Most subscales were related to meditation experience Psychological Well-Being scales and psychological symptoms including the Brief Symptom Inventory [61]. FFMQ is sensitive to change in mindfulness-based interventions and is found to mediate the relationship between mindfulness practice and improvements in psychological symptoms (e.g. [63]). Self-compassion is assessed with the Self Compassion Scale (SCS) [6465] which has 26 items and is divided into six subscales: self-kindness versus self-judgment common humanity versus isolation and mindfulness versus over-identification. Internal consistency of the different subscales varied from .75 to .81 and test-retest reliability varied from .80 to .93. SCS correlated moderately with self-esteem measures including the Rosenberg Self-Esteem Scale. Furthermore whereas the self-esteem measures correlated significantly with the Narcissistic Personality Inventory the SCS was unrelated to narcissism [64]. SCS is sensitive to change through mindfulness-based interventions and is found to mediate MBCT™s treatment effects [66]. To measure rumination we administered the extended version of the Ruminative Response Scale (RRS-EXT) [67] Raes and Hermans: The revised version of the Dutch Ruminative Response Scale unpublished instrument]. The RRS-EXT contains 26 items in which a more adaptive thinking style (i.e. reflection) is distinguished from a more maladaptive one (i.e. brooding). Internal consistency varied from .72 to .77 and test-retest reliability varied from .60 to .62 for the brooding and reflection subscales. The concept of rumination seems to be sensitive to change through mindfulness-based interventions and has been shown to mediate the effect of MBSR on depressive symptoms in oncology patients [68]. The psychological stress reaction is measured with the 15-item Impact of Event Scale (IES) [6970] which assesses two categories of responses: intrusive experiences and avoidance of thoughts and images associated with the event. Internal consistency varied from .65 to .92 [71] and test-retest reliability varied from .79 to .87 among the subscales [69]. IES correlated with anxiety and depression subscales of the General Health Questionaire. Adherence to MBSR is assessed during the entire study period with a calendar on which participants in the MBSR condition fill out on a daily basis whether they adhere to the mindfulness exercises: either formal practice (e.g. meditation exercise like the bodyscan) informal practice (e.g. activity with awareness) or no exercise. Adherence to MBSR has been shown to mediate the effects of MBCT on depressive symptoms [72]. Statistical analysis plan Sample size To determine the required sample size first the sample size was calculated that would be needed for a simple t-test and subsequently it was corrected for clustering repeated measurements and baseline. A two-sided t-test on the total HADS score [3940] (i.e. our primary outcome measure examining psychological distress (HADS-total) anxiety symptoms (HADS-A) and depressive symptoms (HADS-D)) would require 64 participants in each group to have 80% power to detect a medium-sized difference (effect size = 0.5) with alpha = 0.05. To correct for clustering we multiplied this sample size of 64 with the design factor (1 + (n ? 1) * ICC) where n denotes the cluster size and where ICC denotes the intra-cluster correlation. In our study the treatment groups will consist of 14 people of whom about 7 will be patients. With n = 7 and an estimated ICC = 0.01. [72] the correction factor equals 1.06. To correct for repeated measurements and the use of the baseline measurement as a covariate we multiplied the required sample size by the design factor 1+?/2??02 where ? denotes the correlation between the post-treatment HADS measurements and ?0 denotes the correlation between the baseline HADS with the post-treatment HADS measurements. With ? = 0.8 and ? = 0.5 as conservative estimates the second design factor equals 0.65. Consequently after correction for clustering and covariates we arrived at a required sample size of 0.65 * 1.06 * 64 = 44 patients per arm. So 88 patients with lung cancer would be required for the study. Based on our pilot study [van den Hurk Schellekens Molema Speckens and van der Drift in preparation] we expect a 20% drop-out rate. Therefore we intend to include 110 patients and 110 partners. Primary analyses The samples of lung cancer patients and partners will be analyzed separately. Baseline characteristics of the population will be compared between MBSR and control group to ensure that key variables were evenly distributed by randomization. First analyses will be based on the intention-to-treat approach. Next we will perform per-protocol analyses with the treatment-adherent sample (i.e. in the MBSR condition participants have to attend at least four of the eight MBSR sessions [73] and in the TAU condition participants do not attend a mindfulness-based programme). We will use linear mixed models to analyze all outcome variables (i.e. psychological distress quality of life (only for patient) caregiver appraisal (only for partner) relationship quality and spirituality) with treatment as fixed factor baseline measurement as covariate and a random intercept based on MBSR group. This procedure will use all observed data in our analyses. In addition Cohen™s d effect size [74] will be reported based on the difference between the group means on baseline and follow-up scores divided by the pooled standard deviation at baseline and follow-up. Secondary analyses Cost effectiveness The quality of life measures (i.e. QLQ-C30; QLQ-LC13) will be used to calculate Quality of Adjusted Life Years (QALYs) for each individual. Costs and effects (in terms of QALYs) will be combined in the incremental cost-effectiveness ratio (ICER). The ICER expresses cost-effectiveness in terms of incremental costs per QALY gained. To estimate confidence intervals for the mean of the ICER a non-parametric bootstrapping method will be used performing 1000 replications of the original data. In order to express the implications of the cost-effectiveness results more clearly a cost-acceptability curve will be constructed. In case of dominance a full cost analysis will be conducted to estimate the mean savings per patient per year. Mediation analyses To examine the possible underlying mechanisms of change in MBSR mediation analyses will be conducted. Only the data of the treatment-adherent sample will be included in these analyses. By means of a multiple mediation model suggested by Preacher and Hayes [75] we will test the mediating effect of mindfulness skills self-compassion rumination and adherence to MBSR on psychological distress quality of life (only in patients) caregiver appraisal (only in partners) relationship quality and spirituality. Discussion In the last ten years MBSR has not only proven to be a feasible and acceptable intervention in cancer patients [76] but it also seems to be effective in reducing psychological distress [30]. However the generalization of these results is limited because most participants were female patients with breast cancer. A large part of lung cancer patients already have advanced cancer at time of diagnosis and are confronted with a poor prognosis and low health status. Consequently they more often report psychological distress than patients with other diagnoses of cancer [89]. Hence it is not yet clear whether MBSR is a feasible acceptable and effective intervention in patients with lung cancer. Moreover little is known about the effectiveness of MBSR in partners of cancer patients [30] though they also often report psychological distress. Our pilot study of 19 lung cancer patients and 16 partners participating in an MBSR course provides preliminary evidence that MBSR is feasible and acceptable in this population (van den Hurk Schellekens Molema Speckens and van der Drift in preparation). The current trial will answer the question whether MBSR is effective in patients with lung cancer and their partners. We started enrolment of participants in February 2012. At the moment we think recruiting a sufficient number of patients and partners will be a challenge due to rapidly fluctuating health status and sudden changes in cancer treatment [77]. The main reasons for declining participation in patients is ˜being too ill™ or that it is ˜too much of a burden during chemo and/or radiotherapy™. Furthermore no perceived need or motivation for the training is commonly mentioned. Among partners participation is highly depending on whether the patient is willing to participate. Although partners can take part separately partners who are interested do often not participate when the patients decline participation. Considering the difficulty of studying lung cancer patients and their partners [77] our trial will offer valuable information on whether MBSR as one of the few available psychosocial care programmes contributes to the alleviation of their psychological distress"

Lung_Cancer

"These findings may have important therapeutic implications. Pancreatic cancer is one of the deadliest human malignancies. A striking feature of pancreatic cancer is that activating Kras mutations are found in ?90% of cases. However apart from a restricted population of cells expressing pancreatic and duodenal homeobox 1 (PDX1) most pancreatic cells are refractory to Kras-driven transformation. In the present study we sought to determine which subsets of PDX1+ cells may be responsible for tumor growth. Using the Lox-Stop-Lox“KrasG12D genetic mouse model of pancreatic carcinogenesis we isolated a population of KrasG12D-expressing PDX1+ cells with an inherent capacity to metastasize. This population of cells bears the surface phenotype of EpCAM+CD24+CD44+CD133“SCA1? and is closer in its properties to stem-like cells than to more mature cell types. We further demonstrate that the tumorigenic capacity of PDX1+ cells is limited becoming progressively lost as the cells acquire a mature phenotype. These data are consistent with the hypothesis that the adult pancreas harbors a dormant progenitor cell population that is capable of initiating tumor growth under conditions of oncogenic stimulation. We present evidence that constitutive activation of the mitogen-activated protein kinase (MAPK/ERK) signaling and stabilization of the MYC protein are the two main driving forces behind the development of pancreatic cancer cells with stem-cell“like properties and high metastatic potential. Our results suggest that pancreatic cells bearing Kras mutation can be induced to differentiate into quasi-normal cells with suppressed tumorigenicity by selective inhibition of the MAPK/ERK/MYC signaling cascade. pancreatic ductal adenocarcinoma cell of origin Chest Chest chest Chest Chest 0012-3692 1931-3543 American College of Chest Physicians 25117058 4188148 chest.14-0477 10.1378/chest.14-0477 Original Research Critical Care Aggressiveness of Intensive Care Use Among Patients With Lung Cancer in the Surveillance Epidemiology and End Results-Medicare Registry ICU Use Among Elderly Patients With Lung Cancer Cooke Colin R. MD Feemster Laura C. MD Wiener Renda Soylemez MD O™Neil Maya E. PhD Slatore Christopher G. MD From the Division of Pulmonary and Critical Care Medicine (Dr Cooke) Center for Healthcare Outcomes and Policy Institute for Healthcare Innovation and Policy Michigan Center for Integrative Research in Critical Care University of Michigan Ann Arbor MI; the Division of Pulmonary and Critical Care Medicine (Dr Feemster) VA Puget Sound Healthcare System and University of Washington School of Medicine Seattle WA; Boston University School of Medicine (Dr Wiener) Boston MA; Edith Nourse Rogers Memorial VA Hospital (Dr Wiener) Bedford MA; Health Services Research and Development (Drs O™Neil and Slatore) and Section of Pulmonary and Critical Care Medicine (Dr Slatore) Portland VA Medical Center; and the Division of Pulmonary and Critical Care Medicine (Dr Slatore) Department of Medicine Oregon Health and Science University Portland OR. CORRESPONDENCE TO: Colin R. Cooke MD University of Michigan Center for Healthcare Outcomes and Policy 2800 Plymouth Rd Bldg 16 Room 127W Ann Arbor MI 48109; e-mail: cookecrumich.edu 10 2014 19 6 2014 1 10 2015 146 4 916 923 25 2 2014 14 5 2014 2014 AMERICAN COLLEGE OF CHEST PHYSICIANS 2014 BACKGROUND: Approximately 65% of elderly patients with lung cancer who are admitted to the ICU will die within 6 months. Efforts to improve end-of-life care for this population must first understand the patient factors that underlie admission to the ICU. METHODS: We performed a retrospective cohort study examining all fee-for-service inpatient claims in the Surveillance Epidemiology and End Results (SEER)-Medicare registry for elderly patients (aged > 65 years) who had received a diagnosis of lung cancer between 1992 and 2005 and who were hospitalized for reasons other than resection of their lung cancer. We calculated yearly rates of ICU admission per 1000 hospitalizations via room and board codes or International Classification of Diseases Ninth Revision Clinical Modification and diagnosis-related group codes for mechanical ventilation stratified the rates by receipt of mechanical ventilation and ICU type (medical/surgical/cardiac vs intermediate) and compared these rates over time. RESULTS: A total of 175756 patients with lung cancer in SEER were hospitalized for a reason other than surgical resection of their tumor during the study period49373 (28%) of whom had at least one ICU stay. The rate of ICU admissions per 1000 hospitalizations increased over the study period from 140.7 in 1992 to 201.7 in 2005 (P < .001). The majority of the increase in ICU admissions (per 1000 hospitalizations) between 1992 and 2005 occurred among patients who were not mechanically ventilated (118.2 to 173.3 P < .001) and among those who were in intermediate ICUs (20.0 to 61.9 P < .001) but increased only moderately in medical/surgical/cardiac units (120.7 to 139.9 P < .001). S: ICU admission for patients with lung cancer increased over time mostly among patients without mechanical ventilation who were largely cared for in intermediate ICUs. Cell Death Dis Cell Death Dis Cell Death & Disease 2041-4889 Nature Publishing Group 24481441 4040650 cddis2013550 10.1038/cddis.2013.550 Original Ibuprofen enhances the anticancer activity of cisplatin in lung cancer cells by inhibiting the heat shock protein 70 Ibuprofen and cisplatin-mediated apoptosis Endo H 1 2 Yano M 1 2 * Okumura Y 1 Kido H 1 1Division of Enzyme Chemistry Institute for Enzyme Research The University of Tokushima Tokushima Japan 2Department of Nutrition School of Human Cultures The University of Shiga Prefecture Shiga Japan *Department of Nutrition School of Human Cultures The University of Shiga Prefecture Hikone Shiga 522-8533 Japan. Tel: +81 749 28 8441; E-mail: yano.mshc.usp.ac.jp 01 2014 30 01 2014 1 1 2014 5 1 e1027 25 06 2013 27 11 2013 10 12 2013 Copyright 2014 Macmillan Publishers Limited 2014 Macmillan Publishers Limited This work is licensed under a Creative Commons Attribution-NonCommercial-NoDerivs 3.0 Unported License. To view a copy of this license visit http://creativecommons./licenses/by-nc-nd/3.0/ Hsp70 is often overexpressed in cancer cells and the selective cellular survival advantage that it confers may contribute to the process of tumour formation. Thus the pharmacological manipulation of Hsp70 levels in cancer cells may be an effective means of preventing the progression of tumours. We found that the downregulation of Hsp70 by ibuprofen in vitro enhances the antitumoural activity of cisplatin in lung cancer. Ibuprofen prominently suppressed the expression of Hsp70 in A549 cells derived from lung adenocarcinoma and sensitized them to cisplatin in association with an increase in the mitochondrial apoptotic cascade whereas ibuprofen alone did not induce cell death. The cisplatin-dependent events occurring up- and downstream of mitochondrial disruption were accelerated by treatment with ibuprofen. The increase in cisplatin-induced apoptosis caused by the depletion of Hsp70 by RNA interference is evidence that the increased apoptosis by ibuprofen is mediated by its effect on Hsp70. Our observations indicate that the suppression of Hsp70 by ibuprofen mediates the sensitivity to cisplatin by enhancing apoptosis at several stages of the mitochondrial cascade. Ibuprofen therefore is a potential therapeutic agent that might allow lowering the doses of cisplatin and limiting the many challenge associated with its toxicity and development of drug resistance. Hsp70 apoptosis ibuprofen The human Hsp70 family includes ?8 highly homologous members that differ from each other by their intracellular localization and expression patterns.1 Among them the major stress-inducible Hsp70 (also called Hsp72) has an essential role in cell survival under stressful conditions. Compared with its normal counterpart Hsp70 is often overexpressed in various cancer cells and is suspected to contribute to the development of tumours.2 3 Indeed the expression of Hsp70 in certain cancer types has been correlated with poor prognosis and resistance to chemotherapy.45 6 Tumour cells often express several proteins that when abnormally elevated render the tumour resistant to apoptosis.7 Previous studies have confirmed not only that Hsp70 is cytoprotective but also that it interferes effectively with cell death induced by a wide variety of stimuli including several cancer-related stresses. Hsp70 is a potent inhibitor of the stress-activated kinase pathway and apparently blocks apoptotic signals via interactions with JNK Ask1 and SEK1.8910 11 Hsp70 is also a negative regulator of the mitochondrial pathway of apoptosis. Much of the focus on the antiapoptotic function of Hsp70 has been on events that occur after the disruption of the mitochondria. Hsp70 prevents the recruitment of procaspase-9 to the apoptosome and its functional complex formation by direct interaction with apoptotic protease-activating factor 1 (Apaf-1).12 13 Furthermore Hsp70 inhibits the activation of caspase-3 and the cleavage of caspase-3 targets such as ICAD and GATA-1.14 15 On the other hand recent studies have reported that Hsp70 can prevent apoptosis upstream of the mitochondria by inhibiting events which ultimately permeabilize the mitochondrial outer membrane such as the activation of Bax.16 17 As a result of the inhibition by Hsp70 of the apoptosis induced by several anticancer drugs as well as by other stimuli we hypothesized that cancer cells would be sensitized to the induction of apoptosis by the neutralization of Hsp70. Hsp70 has been indeed targeted with pharmaceuticals such as triptolide quercetin and KNK437 which downregulate its expression.1819 20 Although they have prevented the progression of various cancer cells in vitro and in vivo21 22 the optimal clinical use of these small Hsp70 inhibitors singly or combined with other chemotherapeutics remains a challenge. Our overall objective was to pharmacologically control the levels of Hsp70 and increase the effectiveness of anticancer drugs. Several experimental and epidemiologic studies and clinical trials have observed a powerful chemopreventive activity exerted by nonsteroidal anti-inflammatory drugs (NSAIDs).23 24 The anti-carcinogenic properties of NSAID have been attributed to their inhibition of cyclooxygenase (COX) enzymes. However much higher doses of NSAID are needed to obtain an antitumoural effect than to inhibit COX25 suggesting that they also act via COX-independent mechanisms. On the other hand NSAIDs such as aspirin salicylate and sulindac sulphide inhibit the proliferation of cells and induce apoptosis in various cancer cell lines which is considered an important component of their antitumoural activity and increased sensitization of cancer cells to anticancer drugs.262728 29 There is currently interest in the ability of NSAID to directly lower the levels of antiapoptotic molecules such as the Bcl-2 family30 and 14-3-3 protein31 which inhibits the intrinsic mitochondria-dependent apoptosis in various cancer cells. Therefore the NSAID-induced dysfunction of antiapoptotic proteins prompted us to examine whether other antiapoptotic molecules including Hsp70 might also be targets in the prevention of tumour progression by NSAID. In this study we show that ibuprofen is a potent inhibitor of Hsp70 which significantly suppresses its expression by depleting heat shock factor 1 (HSF1) in lung adenocarcinoma-derived A549 cells. The downregulation of Hsp70 by ibuprofen sensitized the cells to cisplatin which was associated with the enhancement of cisplatin-induced apoptotic signalling. Ibuprofen did not only facilitate postmitochondrial events including the activation of cisplatin-induced caspase-9 but also the activation of Bax causing the release of cytochrome c. Besides the demonstration of a similar increase in the sensitivity of A549 cells to cisplatin conferred by Hsp70 knockdown and ibuprofen these observations indicate that ibuprofen accelerates cisplatin-mediated apoptosis at multiple steps of the mitochondrial apoptotic pathway via the inhibition of Hsp70. We conclude that ibuprofen is a potential chemotherapeutic agent which might enable (a) the use of lower less toxic does of cisplatin and (b) the design of a new combination treatment of lung cancer. Results Ibuprofen suppresses the expression of Hsp70 in lung adenocarcinoma cells To define the role of Hsp70 in promoting the formation of tumours we first examined its expression in human lung cancer cell lines. Compared with BEAS-2B a human non-malignant bronchial epithelial cell line the expression levels of Hsp70 in lung cancer cells such as A549 and H358 adenocarcinoma were notably higher (Figure 1a). As in previous studies which showed an increased expression of Hsp70 in various types of human cancers including breast pancreas and colon we found that Hsp70 is also dysregulated in lung cancer cells. In this study we screened conventional NSAID in search of a new pharmacologic inhibitor which neutralizes Hsp70 as they induce apoptosis in cancer cells by selectively downregulating antiapoptotic proteins. The expression of Hsp70 after the exposure of A549 cells to various NSAID in non-toxic concentrations was analyzed by immunoblot. Ibuprofen in a 400-?M concentration decreased the expression of Hsp70 by 23% in comparison with untreated cells whereas other NSAID had no effect (Table 1). Figure 1b shows the decrease in Hsp70 protein and mRNA levels in A549 cells after treatment with various concentrations of ibuprofen versus no apparent decreases in Hsc70 and Actin. Ibuprofen also decreased the expression of Hsp70 in H358 a human lung adenocarcinoma cell line in a dose-dependent manner (Figure 1c). These results suggest that ibuprofen decreases the expression of Hsp70 in various lung cancer cell lines. Ibuprofen enhances the apoptosis induced by cisplatin by suppressing Hsp70 As ibuprofen prominently inhibited the expression of Hsp70 we next examined its effect on the proliferation of cancer cells. We observed no significant change in the viability of A549 and H358 cells after the exposure to ?800??M concentrations of ibuprofen alone which downregulates Hsp70 (Figure 2a) while the exposure to 1.0?mM concentration of ibuprofen caused cell death. Combined these observations indicate that the downregulation of stress-inducible Hsp70 was insufficient to cause the death of A549 and H358 cells. There is evidence that the inhibition of anti-apoptotic molecules such as Hsp70 increases the sensitivity of tumour cells to anticancer drugs thus improving the outcomes of chemotherapy. To study the therapeutic potential of ibuprofen we examined whether its antitumoural effects are synergistic with those of cisplatin widely used in the treatment of lung adenocarcinoma. When we measured the survival of A549 (top of Figure 2b) and H358 (bottom of Figure 2b) cells exposed to increasing concentrations of cisplatin incubated in presence versus absence of ibuprofen the latter prominently magnified the apoptosis induced by cisplatin a synergistic effect confirmed by terminal deoxynucleotidyl transferase-mediated dUTP nick and labelling (TUNEL) staining (Figure 2c). To ascertain the effects conferred by the expression of Hsp70 on cell death while excluding all effects of ibuprofen unrelated to Hsp70 we weakened the expression of Hsp70 by RNA interference (RNAi) (Figure 2d) and measured its effects on the apoptosis induced by cisplatin. The inhibition of Hsp70 decreased the viability of cisplatin-treated cells by approximately 20% (Figure 2e). Transfections with scrambled siRNA serving as a control showed no increase in cell death mediated by cisplatin. Cisplatin had no effect on the expression of Hsp70 (Figure 2g). We quantified the number of apoptotic cells in ibuprofen- and/or cisplatin-treated cultures using the CF488A-annexin V methods. Although cisplatin alone induced apoptosis in 10.2% of A549 cells the co-treatment with ibuprofen increased the percentage of apoptotic cells to 34.0% (Figure 2f). These observations suggest that ibuprofen sensitizes A549 cells to cisplatin by decreasing the expression of Hsp70. Ibuprofen decreases the expression of Hsp70 via transcriptional inactivation The reverse transcriptase-polymerase chain reaction (RT-PCR) analysis described earlier revealed a decrease in RNA level following treatment with ibuprofen suggesting that the expression of Hsp70 can be downregulated at the transcriptional level. After the recently discovered inhibition by its antagonists of the transcription of Hsp70 in cancer cells by blockade of the activation of HSF118 20 (which is often upregulated and constitutively activated in tumour formation) we studied the effects of ibuprofen on HSF1 in A549 cells. We first performed a ChIP assay to explore whether the inhibitory effect of ibuprofen is at the level of HSF1 DNA binding. As expected we found an unequivocal association between HSF1 and the Hsp70 gene promoter containing the HSE site in ibuprofen-untreated cells (Figure 3a). It is noteworthy that ibuprofen eliminated this binding (Figure 3a) suggesting that it inhibits the expression of Hsp70 via the action of HSF1. This also suggests that ibuprofen blocks the binding of HSF1 chromatin or the steps which precede in several processes needed to activate HSF1. Therefore we broadened our analysis to examine the effect of ibuprofen on the expression of HSF1. Compared with unexposed control cells the HSF1 mRNA level was significantly lower in cells exposed to ibuprofen (bottom of Figure 3b). Consistent with its effect on the expression of mRNA ibuprofen also decreased the expression of HSF1 protein in a dose-dependent fashion (top of Figure 3b). To confirm the inhibition of HSF1-mediated Hsp70 by ibuprofen we lowered the amounts of HSF1 present in A549 cells by RNAi and studied its effect on the expression of Hsp70. The treatment of cells with HSF1 dsRNA decreased the Hsp70 level compared with that measured in cells untreated with dsRNA (Figure 3c). Ibuprofen decreased the expression of HSF1 by 16% in comparison with untreated cells whereas other NSAID had no effect (Table 2). Overall these observations indicate that ibuprofen inhibited the expression of Hsp70 by depleting the HSF1 in A549 cells. Ibuprofen accelerates the mitochondrial apoptotic process induced by cisplatin Several studies have found that mitochondria might be a direct and important target of cisplatin in sensitive cells.32 33 We studied the effects of ibuprofen on the depolarization of mitochondrial membranes and the cytochrome c release induced by cisplatin. A549 cells with or without cisplatin were incubated in absence or presence of ibuprofen and stained with JC-1. Treatment with cisplatin and ibuprofen lowered the mitochondrial membrane potential manifest by an attenuated red and an enhanced green mitochondrial fluorescence (Figure 4a lower right panel) compared with that observed with cisplatin alone (Figure 4a upper right panel) while control (Figure 4a upper left panel) or ibuprofen alone (Figure 4a lower left panel) produced the red-dotted staining pattern of polarized mitochondria. The intensity of green mitochondrial fluorescence in cisplatin-treated cells is significantly increased (36.56 to 55.56%) by the co-treatment with ibuprofen. Ibuprofen also promoted the release of cytochrome c from the mitochondria induced by cisplatin (Figure 4b). These findings unequivocally indicated that in A549 cells ibuprofen enhanced the mitochondria-dependent apoptosis caused by cisplatin. Ibuprofen increases the activation of Bax induced by cisplatin The translocation of the pro-apoptotic protein Bax to the mitochondria is closely associated with the apoptosis induced by cisplatin. To explore the mechanisms by which ibuprofen promotes the apoptosis mediated by mitochondria in response to cisplatin we examined whether it was due to its ability to stimulate the translocation of Bax by cisplatin. We first monitored conformational changes in Bax as indicators of its activation. Western blot analysis of the immunoprecipitates with a conformation specific anti-Bax (6A7) antibody which only recognizes the active form revealed the presence of active Bax in A549 cells treated with cisplatin (Figure 5a lane 4) although not in untreated cells (Figure 5a lanes 1 and 2). Further exposure of the cisplatin-treated cells to ibuprofen caused a 1.5-fold increase in active Bax compared with incubation with cisplatin alone (Figure 5a lane 3). When we analyzed the effects conferred by ibuprofen on the translocation of Bax to mitochondria in cisplatin-treated cells we observed an approximately 1.3-fold increase in the amount of translocated Bax (Figure 5b). To exclude an effect of ibuprofen unrelated to the inhibition of Hsp70 we performed RNAi for a selective knock-down of Hsp70 and we studied its effects on the activation of Bax. Consistent with the earlier data presented for ibuprofen the depletion of Hsp70 increased the activation of Bax in cisplatin-treated cells although its extent was greater with Hsp70 RNAi than with ibuprofen (Figure 5c). These observations confirmed that (a) ibuprofen promotes the activation of Bax dependent on cisplatin and its translocation to the mitochondria in A549 cells and (b) its mechanism of action is mediated by the inhibition of Hsp70. Ibuprofen facilitates events occurring upstream and downstream of mitochondrial disruption in cisplatin-mediated apoptosis Previous studies have shown that Hsp70 can inhibit apoptosis by acting downstream of the mitochondria.121314 15 Hsp70 interacts directly with Apaf-1 to prevent the formation of cytochrome c-mediated apoptosome and subsequent activation of caspase-9. To examine whether ibuprofen also influences the downstream mitochondrial events we measured its effects on the cleavage of procaspase-9 in the apoptosis mediated by cisplatin. With an anti-active caspase-9 antibody fully processed caspase-9 was predominantly identified in cisplatin-treated A549 cells (Figure 6a lane 3) over untreated cells (Figure 6a lanes 1 and 2). It is noteworthy that treatment with ibuprofen increased >4-fold the amount of active caspase-9 in cells treated with cisplatin compared with cells incubated with cisplatin alone (Figure 6a lane 4). As as reported earlier the highest increases in the activation of Bax and release of cytochrome c by ibuprofen were <2-fold these observations suggest that ibuprofen also facilitates the post mitochondrial process taking place between the release of cytochrome c and the activation of caspase-9. To verify that this is a specific effect we studied the effect of Hsp70 knock-down on the activation of caspase-9 mediated by cisplatin. The caspase-9 activity in cells depleted of Hsp70 with cisplatin was fourfold greater than in control (scrambled) siRNA-treated cells (Figure 6b). We obtained similar results when we measured the activity of caspase-9 in cells treated with ibuprofen (Figure 6c) or siRNA against Hsp70 (Figure 6d) by a fluorometric assay using a synthetic substrate. Overall these observations confirmed unambiguously that ibuprofen intensified the apoptosis induced by cisplatin by its effects on the events occurring downstream of the mitochondria by inhibiting Hsp70 although whether it stimulated the formation of apoptosome (essential for the recruitment of procaspase-9) remains to be determined. We conclude that ibuprofen promotes the apoptosis induced by cisplatin at multiple stages of the mitochondrial cascade by attenuating the expression of Hsp70 in A549 cells. Discussion We found that compared with non-malignant bronchial epithelial cells human lung cancer cells overexpressed Hsp70. This is an important observation as targeting the expression or function of Hsp70 has been suggested as an effective treatment strategy in several cancers based on the hypothesis that higher levels of Hsp70 protect against cell death and increase the survival rate against modalities used in chemotherapy.11 15 In fact it is well documented that the expression of Hsp70 is significantly increased in cancer tissues and/or serums obtained from patients with non-small cell lung cancer (NSCLC)34353637 38 and its overexpression correlates with poor prognosis in NSCLC.36 Several reports have indicated that functionally related small molecules that inhibit Hsp70 decrease the viability of colo-rectal or pancreatic cancer cells by promoting apoptosis via the downregulation of Hsp70 and may be a promising new class of cancer chemotherapeutics.1921 22 We showed that ibuprofen a relatively non-toxic and widely used NSAID significantly decreased the expression of Hsp70 in lung adenocarcinoma cell lines. We also clearly demonstrated that the inhibitory mechanisms of ibuprofen on Hsp70 are due to a decrease in HSF1 expression. Although the fundamental mechanism behind the reduction in HSF-1 expression is unknown a previous study has indicated that the nuclear factor 1 family member NFIX which codes for site-specific DNA-binding proteins known to have multiple roles in replication signal transduction and transcription exerts a transcriptional repressive effect on the expression of HSF1 in cancer cells.39 Whether NFIX is indeed involved in the inhibition of HSF1 expression evoked by ibuprofen is applicable in further studies. To the best of our knowledge this is the first study of the inhibitory effects of NSAID on the cellular expression of Hsp70. In addition we showed that ibuprofen does not influence the cell viability without additional stimuli unlike its maximal effect on the expression of Hsp70. The lack of inhibitory efficacy of ibuprofen against tumours is consistent with a previous study which showed that low-dose ibuprofen did not induce apoptosis in mouse and human colorectal cancer cell lines.29 Similar observations were made following RNAi of Hsp70 suggesting that the attenuation of Hsp70 per se is insufficient to cause the death of A549 and perhaps other cells. It has been shown that the knockdown of Hsp70 has no effect on the viability of several cancer cell lines although sensitized them to anticancer drugs.40 41 Therefore the therapeutic potential of ibuprofen combined with chemotherapeutic agents needs to be explored. Cisplatin is one of most effective chemotherapeutic drugs against NSCLCs.42 It is noteworthy that damage to DNA caused by cisplatin enables apoptosis involving mitochondrial pathways which is negatively regulated by Hsp70. As ibuprofen prominently suppressed the expression of Hsp70 in A549 and H358 cells we examined the possible synergistic activity of ibuprofen and cisplatin against cancer. As expected ibuprofen potentiated synergistically the anti-proliferative effect of cisplatin in A549 and H358 cells. Despite its potent antitumoural properties the therapeutic use of cisplatin in oncology is seriously limited by dose-dependent adverse effects and frequent development of drug resistance.43 Therefore our findings may make useful contributions toward the development of new and less toxic chemotherapy against NSCLCs. We also examined the molecular mechanisms of these synergistic properties of ibuprofen. Hsp70 protects cells against mitochondria-dependent apoptosis at different levels although the precise mechanism remains hypothetical because of regular contradictory descriptions of Hsp70 function. Earlier reports have shown a protective effect of Hsp70 against cellular apoptosis by inhibition of the apoptosome function a protein complex comprising Apaf-1 and cytochrome c.12 13 However recent reports have questioned this repression of apoptosis downstream of the mitochondrial membrane permeabilization."

Lung_Cancer

"Adenocarcinoma including cases with bronchioloalveolar carcinoma. Expression of miR-182 and correlations miR-182 was homogenously expressed mainly in the cytoplasm of tumor cells. There was also some unspecific nuclear staining (). The scoring was based on cytoplasmic staining. There was no staining of stromal cells except for weak nuclear staining of some fibroblasts. We tested correlations between miR-182 and angiogenic and hypoxia molecular markers. We found significant correlations between miR-182 and FGF2 (r?=??0.147; P?=?0.010) HIF2? (r?=?0.115; P?=?0.047) and MMP-7 (r?=?0.172; P?=?0.003). Univariate analysis As shown in the clinicopathological variables performance status (P?=?0.016) histology (P?=?0.028) tumor differentiation (P?<?0.001) surgical procedure (P?=?0.007) pathological stage (P?<?0.001) tumor status (P?<?0.001) nodal status (P?<?0.001) and vascular infiltration (P?=?0.001) were significant prognostic indicators for DSS. The results from the univariate analyses on miR-182 are presented in and Figures 2 and 3. In the whole cohort there was a tendency towards a better prognosis for those with tumors overexpressing miR-182 (P?=?0.062 ). In subgroup analyses patients with stage II disease had a significantly improved prognosis if they overexpressed miR-182 (P?=?0.003 E). In the histological subgroup SCC high tumor cell miR-182 expression was associated with superior prognosis when compared to low expression (P?=?0.042 A) while for large cell carcinomas the trend was opposite (C). miR-182 in tumor cells and stroma as predictors for disease-specific survival in NSCLC patients (univariate analysis; log-rank test) and results of Cox regression analysis summarizing significant independent prognostic factors Characteristics Pts (n) Pts (%) Median survival (months) 5-year survival (%) Univariate (P) Multi-variate (P) HR (95% CI) Total (n?=?335) 0.062 0.098 0.73 ??Low 190 57 98 55 (0.50-1.06) ??High 115 34 NR 62 ??Missing 30 9 Pathological stage Stage I (n?=?143) 0.97 NE NE ??Low 87 61 190 73 ??High 56 39 NR 73 Stage II (n?=?127) 0.003 0.020 0.50 ??Low 80 63 33 39 0.28-0.90 ??High 47 37 NR 63 Stage III (n?=?35) 0.69 NE NE ??Low 23 66 23 39 ??High 12 34 15 17 Histology ??SCC (n?=?172) 0.042 0.048 0.57 ??Low 104 60 NR 58 0.33-0.99 ??High 68 40 NR 74 AC (n?=?106) 0.316 NE NE ??Low 69 65 47 45 ??High 37 35 57 50 LCC (n?=?27) 0.285 NE NE ??Low 17 63 NR 80 ??High 10 37 58 39 Statistically significant results in bold font. Abbreviations:NR not reached PS performance status SCC squamous cell carcinoma AC adenocarcinoma LCC large-cell carcinoma NE not entered due to insignificance. Adenocarcinoma including cases with bronchioloalveolar carcinoma. Disease-specific survival curves according to tumor cell expression of miR-182 in the whole cohort of patients. Disease-specific survival curves according to tumor cell expression of A) miR-182 in SCC B) miR-182 in AC C) miR-182 in LCC D) miR-182 in stage I patients E) miR-182 in stage II patients F) miR-182 in stage III patients. Multivariate analysis In the total cohort performance status (P?=?0.008) histology (P?=?0.001) tumor differentiation (P?=?0.007) tumor status (P?=?0.007) nodal status (P?=?0.022) and vascular infiltration (P?=?0.004) all were independent prognostic factors. Results of the multivariate analysis for miR-182 expression are presented in . Examining the total material high miR-182 expression tended towards an independent association with a better prognosis (HR 0.73 CI 95% 0.50-1.06 P?=?0.098). Among stage II patients however high tumor cell expression of miR-182 was an independent positive prognostic factor (HR 0.50 CI 95% 0.28-0.90 P?=?0.020). Also in SCC patients with a high miR-182 expression had an independent favorable outcome (HR 0.57 CI 95% 0.33-0.99 P?=?0.048). Co-expression of miR-182 with FGF2 and MMP-7 Among markers examined for correlations with miR-182 FGF2 and MMP-7 showed the strongest correlations. We assessed the co-expression combinations between miR-182 and FGF2 and MMP-7 respectively. The co-expression of low miR-182/high FGF2 was associated with poor survival (P?=?0.017) as shown in A. The combination showed an independently significant adverse prognosis compared to high miR-182/low FGF2 (HR 1.92 P?=?0.015 ). Patients expressing high miR-182/high MMP-7 had a better survival than other combinations (P?=?0.036 B). In the multivariate analyses high miR-182/high MMP-7 showed an independently better prognosis than low miR-182/low MMP-7 (HR 0.49 P?=?0.015 ). In the SCC subgroup we found an even bigger difference between these groups both in univariate and multivariate analyses (C ). Disease-specific survival curves according to tumor cell co-expression of miR-182 and A) FGF2 in the whole cohort of patients B) MMP-7 in the whole cohort of patients C) MMP-7 in SCC and D) MMP-7 in AC. Results of Cox regression analysis summarizing co-expressions of miR-182 with FGF2 and MMP-7 respectively Hazard ratio 95% CI P Co-expression of miR-182/FGF2 0.021 ??High miR-182/low FGF2 1.00 ??High miR-182/high FGF2 and low miR-182/low FGF2 1.26 0.74-2.13 0.39 ??Low miR-182/high FGF2 1.92 1.14-3.24 0.015 Co-expression of miR-182/MMP-7 0.032 ??Low miR-182/low MMP-7 1.00 ??Low miR-182/high MMP-7 and high miR-182/low MMP-7 0.71 0.48-1.05 0.086 ??High miR-182/high MMP-7 0.49 0.27-0.87 0.015 Co-expression of miR-182/MMP-7 squamous cell carcinoma 0.040 ??Low miR-182/low MMP-7 1.00"

Lung_Cancer

"The protocol was approved by the Institutional Review Boards at each participating institution. Informed consent was obtained from each patient. Study design This is a single arm open label multicentre phase II study (ClinicalTrials.gov identifier: NCT00794417). Patients received the three-drug combination intravenously on day 1 of every 21 days with ziv-aflibercept (6?mg?kg?1) first followed by pemetrexed (500?mg?m?2) and cisplatin (75?mg?m?2). Premedications consisted of folic acid vitamin B12 and dexamethasone as a prophylactic measure to reduce pemetrexed-related toxicities and standard anti-emetics. Patients could receive up to six cycles of combination therapy. For patients who completed the combined chemotherapy maintenance ziv-aflibercept every 21 days was to continue until disease progression intolerable toxicity or withdrawal from the study. End points and assessments The two co-primary end points were objective response rate (ORR) and PFS. The ORR was defined as the proportion of patients with complete response plus partial response (CR+PR). The PFS was defined as the time interval from the first dose of combination chemotherapy to tumour progression or death whichever occurred first. Secondary variables were the determination of the adverse events (AEs) pharmacokinetics (PK) and pharmacodynamic profiles (including anti-ziv-aflibercept antibody and hematopoiesis). Pharmacokinetic end points included the area under the concentration curve maximum concentration (Cmax) clearance and terminal half-life (t1/2). Tumour imaging (CT or MRI) was performed at screening on day 21 (±7 days) of every even numbered cycle (every 6 weeks) and when disease progression was suspected. Responses were assessed using RECIST version 1.0 (Therasse et al 2000). Safety and tolerability were assessed at baseline and at least every 21 days as evaluated by AEs and changes in laboratory parameters graded according to the Common Terminology Criteria for Adverse Events (CTCAE) version 3.0 (National Cancer Institute 2006). Ziv-aflibercept (free or bound to VEGF) in plasma samples was quantified using a validated direct enzyme-linked immunosorbent assay. A validated non-quantitative titre-based bridging assay was used to detect anti-ziv-aflibercept antibodies in serum samples. Correlative studies The exploratory objective of the correlative studies was to evaluate changes in erythropoiesis in response to VEGF inhibition. It was hypothesised that VEGF inhibition would result in an increase in haemoglobin via increased hepatic erythropoietin production. Statistical analysis Statistical testing was done to determine whether the ORR was larger than 20% or whether the PFS was greater than 4.5 months. Exact test (one-sided) was used to test the null hypothesis that ORR was ?20% versus the alternative hypothesis that ORR was ?35%. Assuming type I error was not >2.5% a sample of 72 patients would provide >80% power to test the hypothesis using exact binomial test. The calculated sample size of 72 patients would also provide >90% power to test the null hypothesis that median PFS was ?4.5 months versus the alternative hypothesis that PFS was ?6.5 months at one-sided alpha of 2.5% using one sample log-rank test. Safety data were to be summarised. Concentrations of free ziv-aflibercept and adjusted bound ziv-aflibercept: VEGF complex were to be summarised every 21 days over the duration of the study by nominal time point. Noncompartmental parameters were calculated using WinNonlin (version 5.3 Pharsight Corporation Mountain View CA USA) and model 202 (constant infusion) using nominal time points after a single dose of ziv-aflibercept. The noncompartmental analysis was performed over the dosing interval 21 days following the first dose. All analyses used statistical software SAS (version 9.1.3 Cary NC USA). Results Patients This study was closed prematurely because of three confirmed and two suspected but unconfirmed cases of reversible posterior leukoencephalopathy syndrome (RPLS). A total of 42 patients were enrolled from 17 participating sites across the United States and Canada between January 2009 and December 2010. summarises the patient demographics. Median age was 61.5 years; 55% were male 86% were Caucasian and 50% had ECOG PS of 0. Safety evaluation Treatment exposure and dose modifications All 42 patients received at least one dose of each of the three study drugs with a median of 92 days of treatment (range 21“288 days). Twenty-seven (64%) patients completed four or more cycles of the combination treatment. A median of 4.5 (range 1“6) cycles of pemetrexed and 4 (range 1“6) cycles of cisplatin were administered. The median dose intensity was 163.9 (range 110.1“175.5)?mg?m?2 per week for pemetrexed and 24.6 (range 15.3“26.3)?mg?m?2 per week for cisplatin. The delivered dose intensities were 98.3% for pemetrexed and 98.5% for cisplatin. Seventeen (40%) completed six or more cycles of ziv-aflibercept. The median dose intensity of ziv-aflibercept was 1.97?mg?kg?1 per week close to the planned intensity of 2?mg?kg?1 per week. Reasons for treatment discontinuation were disease progression (33%) AEs (33%) and others (34% including withdrawal of consent and investigator request). Seventeen patients had at least one cycle delayed. Eleven patients (26%) had at least 1 dose modification of ziv-aflibercept 6 (14%) of pemetrexed and 11 of cisplatin. Adverse events Thirty-five patients (83%) experienced a treatment-emergent adverse event (TEAE) of grade 3 or 4 (3/4) and 16 patients (38%) experienced a serious TEAE. The most common TEAEs were nausea (69%) fatigue (67%) and hypertension (57%). Hypertension neutropaenia and hypokalaemia were the most common grade 3/4 TEAEs in 36%0.14 and 10% of patients respectively. summarised the most common TEAEs. Thirty-nine patients (93%) experienced at least one haematologic abnormality with grade 3/4 in eight patients (19%) mostly neutropaenia. Every patient experienced at least one abnormal chemistry value with grade 3/4 in 15 (36%) most commonly hyponatraemia. Seven patients (17%) died before clinical cutoff of the study. Five died due to disease progression and two due to TEAEs: 1 pneumonia and 1 sepsis. Neurological toxicities Between 26 September 2010 and 30 December2010 five patients experienced neurological symptoms including altered mental status in four slurred speech in one seizure in two and headache in four patients. Three patients had a brain MRI that was consistent with RPLS (B). Brain MRI was negative for RPLS in two other patients. The three patients diagnosed with RPLS were all Caucasian women aged 3851 and 72 years respectively. One of the three patients with RPLS entered the study with a history of hypertension. All three patients experienced elevated BP and two patients had reduced CrCL during the therapy: one patient's CrCL decreased by 45% from baseline (141 to 78?ml?min?1) after one cycle and the other's decreased by 20% (64 to 51?ml?min?1) after four cycles. They were diagnosed with RPLS after one two and five cycles of ziv-aflibercept respectively. Two patients recovered from RPLS and one died due to disease progression before RPLS resolution. Pharmacokinetic information was available for two of the three RPLS patients and for one suspected case: systemic concentrations of free ziv-aflibercept were within the range of other patients in the treatment cohort. In the phase I study using the same regimen (N=18) five patients experienced a mild neurocognitive disturbance but no RPLS was diagnosed (Diaz-Padilla et al 2012). Rare cases of RPLS have been observed in the ziv-aflibercept clinical development programme but the rate observed in this study (3 out of 42=7%) was much higher than previously reported (i.e. 0.5% of 3795 patients treated with ziv-aflibercept as monotherapy or in combination with chemotherapy ZALTRAP product insert). As a result this study was permanently closed to enrolment. Patients who remained on study were re-consented with updated safety information regarding RPLS in addition to continued close monitoring."

Lung_Cancer

"reads in RNA-seq but only a few mutant reads in DNA-WES such as the example Luminal A tumor with a single DNA mutant read in the PIK3CA hotspot. This study's results support that RNA sequencing could be beneficial when added to DNA sequencing in clinical settings. Future studies could explore alternative ways to integrate DNA and RNA sequencing beyond UNCeqRMETA which is the first method of this kind. UNCeqRMETA applied the same quality filters for DNA and RNA and potentially different filters could be beneficial. UNCeqRMETA includes a basic indel realignment and integrated DNA and RNA reassembly could potentially be beneficial. Different statistical modeling could further advance the performance displayed by UNCeqRMETA over DNA only based methods. Balancing sensitivity and specificity is important in applying and developing mutation detectors. Receiver operating characteristic curve analysis such as that presented in this study enables assessment of sensitivity and specificity tradeoffs between alternate models. Integrated RNA-seq and DNA-WES mutation detection is important because it boosts sensitivity in low purity tumors in therapeutically-relevant genes and in driver genes relative to DNA-only detection. Integrated mutation detection could also enable more inclusive cohort profiling studies that censor tumors based on purity and could lead to more comprehensive characterizations of cancer genomes. In integrating DNA-WES and RNA-seq by UNCeqRMETA increases mutation detection performance and was extremely beneficial for low purity tumors. AVAILABILITY UNCeqR software is available at http://lbg.med.unc.edu/tools/unceqr. UNCeqR mutation detections for the lung and breast cohorts are available at ://tcga-data-secure.nci.nih.gov/tcgafiles/tcga4yeo/tumor/ and http://lbg.med.unc.edu/tools/unceqr. SUPPLEMENTARY DATASupplementary Data are available at NAR Online. SUPPLEMENTARY DATA FUNDING National Cancer Institute [F32CA142039 to M.D.W. Breast SPORE P50-CA058223 to C.M.P.]; National Institutes of Health [U24 CA143848 to C.M.P. D.N.H and U24 CA143848-02S1 to C.M.P. D.N.H.]. Funding for open access charge: National Institutes of Health. Conflict of interest statement. M.D.W. was a consultant for GeneCentric Diagnostics and Cancer Therapeutics Innovation Group. C.M.P. is an equity stock holder and Board of Director Member of BioClassifier LLC and GeneCentric Diagnostics. D.N.H. is equity stock holder and Board of Director Member GeneCentric Diagnostics. REFERENCES 1. Stratton M.R. Campbell P.J. Futreal P.A. The cancer genome Nature 2009 458 719 724 19360079 2. Roychowdhury S. Iyer M.K. Robinson D.R. Lonigro R.J. Wu Y.M. Cao X. Kalyana-Sundaram S. Sam L. Balbin O.A. Quist M.J. Personalized oncology through integrative high-throughput sequencing: a pilot study Sci. Transl. Med. 2011 3 111ra121 3. Korf B.R. Rehm H.L. New approaches to molecular diagnosis JAMA 2013 309 1511 1521 23571590 4. The Cancer Genome Atlas Research Network Comprehensive genomic characterization of squamous cell lung cancers Nature 2012 489 519 525 22960745 5. Wilkerson M.D. Yin X. Walter V. Zhao N. Cabanski C.R. Hayward M.C. Miller C.R. Socinski M.A. Parsons A.M. Thorne L.B. Differential pathogenesis of lung adenocarcinoma subtypes involving sequence mutations copy number chromosomal instability and methylation PLoS One 2012 7 e36530 22590557 6. The Cancer Genome Atlas Research Network Comprehensive molecular portraits of human breast tumours Nature 2012 490 61 70 23000897 7. The Cancer Genome Atlas Research Network Comprehensive molecular characterization of clear cell renal cell carcinoma Nature 2013 499 43 49 23792563 8. Meyerson M. Gabriel S. Getz G. Advances in understanding cancer genomes through second-generation sequencing Nat. Rev. Genet. 2010 11 685 696 20847746 9. Cibulskis K. Lawrence M.S. Carter S.L. Sivachenko A. Jaffe D. Sougnez C. Gabriel S. Meyerson M. Lander E.S. Getz G. Sensitive detection of somatic point mutations in impure and heterogeneous cancer samples Nat. Biotechnol. 2013 31 213 219 23396013 10. Kim S.Y. Speed T.P. Comparing somatic mutation-callers: Beyond Venn diagrams BMC Bioinformatics 2013 14 189 23758877 11. Ku C.S. Wu M. Cooper D.N. Naidoo N. Pawitan Y. Pang B. Iacopetta B. Soong R. Exome versus transcriptome sequencing in identifying coding region variants Expert Rev. Mol. Diagn. 2012 12 241 251 22468815 12. Carter S.L. Cibulskis K. Helman E. McKenna A. Shen H. Zack T. Laird P.W. Onofrio R.C. Winckler W. Weir B.A. Absolute quantification of somatic DNA alterations in human cancer Nat. Biotechnol. 2012 30 413 421 22544022 13. Goya R. Sun M.G. Morin R.D. Leung G. Ha G. Wiegand K.C. Senz J. Crisan A. Marra M.A. Hirst M. SNVMix: predicting single nucleotide variants from next-generation sequencing of tumors Bioinformatics 2010 26 730 736 20130035 14. Koboldt D.C. Chen K. Wylie T. Larson D.E. McLellan M.D. Mardis E.R. Weinstock G.M. Wilson R.K. Ding L. VarScan: variant detection in massively parallel sequencing of individual and pooled samples Bioinformatics 2009 25 2283 2285 19542151 15. Koboldt D.C. Zhang Q. Larson D.E. Shen D. McLellan M.D. Lin L. Miller C.A. Mardis E.R. Ding L. Wilson R.K. VarScan 2: somatic mutation and copy number alteration discovery in cancer by exome sequencing Genome Res. 2012 22 568 576 22300766 16. Larson D.E. Harris C.C. Chen K. Koboldt D.C. Abbott T.E. Dooling D.J. Ley T.J. Mardis E.R. Wilson R.K. Ding L. SomaticSniper: identification of somatic point mutations in whole genome sequencing data Bioinformatics 2012 28 311 317 22155872 17. Saunders C.T. Wong W.S. Swamy S. Becq J. Murray L.J. Cheetham R.K. Strelka: accurate somatic small-variant calling from sequenced tumor-normal sample pairs Bioinformatics 2012 28 1811 1817 22581179 18. Bamshad M.J. Ng S.B. Bigham A.W. Tabor H.K. Emond M.J. Nickerson D.A. Shendure J. Exome sequencing as a tool for Mendelian disease gene discovery Nat. Rev. Genet. 2011 12 745 755 21946919 19. Kolata G. Treatment for Leukemia Glimpses of the Future New York Times 2012 20. Wang Z. Gerstein M. Snyder M. RNA-Seq: a revolutionary tool for transcriptomics Nat. Rev. Genet. 2009 10 57 63 19015660 21. Cirulli E.T. Singh A. Shianna K.V. Ge D. Smith J.P. Maia J.M. Heinzen E.L. Goedert J.J. Goldstein D.B. Screening the human exome: a comparison of whole genome and whole transcriptome sequencing Genome Biol. 2010 11 R57 20598109 22. Xu X. Zhu K. Liu F. Wang Y. Shen J. Jin J. Wang Z. Chen L. Li J. Xu M. Identification of somatic mutations in human prostate cancer by RNA-Seq Gene 2013 519 343 347 23434521 23. Kridel R. Meissner B. Rogic S. Boyle M. Telenius A. Woolcock B. Gunawardana J. Jenkins C. Cochrane C. Ben-Neriah S. Whole transcriptome sequencing reveals recurrent NOTCH1 mutations in mantle cell lymphoma Blood 2012 119 1963 1971 22210878 24. Shah S.P. Kobel M. Senz J. Morin R.D. Clarke B.A. Wiegand K.C. Leung G. Zayed A. Mehl E. Kalloger S.E. Mutation of FOXL2 in granulosa-cell tumors of the ovary N. Engl. J. Med. 2009 360 2719 2729 19516027 25. Chandrasekharappa S.C. Lach F.P. Kimble D.C. Kamat A. Teer J.K. Donovan F.X. Flynn E. Sen S.K. Thongthip S. Sanborn E. Massively parallel sequencing aCGH and RNA-Seq technologies provide a comprehensive molecular diagnosis of Fanconi anemia Blood 2013 121 e138 e148 23613520 26. Miller A.C. Obholzer N.D. Shah A.N. Megason S.G. Moens C.B. RNA-seq-based mapping and candidate identification of mutations from forward genetic screens Genome Res. 2013 23 679 686 23299976 27. Hill J.T. Demarest B.L. Bisgrove B.W. Gorsi B. Su Y.C. Yost H.J. MMAPPR: mutation mapping analysis pipeline for pooled RNA-seq Genome Res. 2013 23 687 697 23299975 28. Kleinman C.L. Majewski J. Comment on œWidespread RNA and DNA sequence differences in the human transcriptome Science 2012 335 1302 author reply 1302 22422962 29. Lin W. Piskol R. Tan M.H. Li J.B. Comment on œWidespread RNA and DNA sequence differences in the human transcriptome Science 2012 335 1302 author reply 1302 22422964 30. Pickrell J.K. Gilad Y. Pritchard J.K. Comment on œWidespread RNA and DNA sequence differences in the human transcriptome Science 2012 335 1302 author reply 1302 22422963 31. Li H. Handsaker B. Wysoker A. Fennell T. Ruan J. Homer N. Marth G. Abecasis G. Durbin R. The sequence alignment/map format and SAMtools Bioinformatics 2009 25 2078 2079 19505943 32. Wang K. Singh D. Zeng Z. Coleman S.J. Huang Y. Savich G.L. He X. Mieczkowski P. Grimm S.A. Perou C.M. MapSplice: accurate mapping of RNA-seq reads for splice junction discovery Nucleic Acids Res. 2010 38 e178 20802226 33. Li H. Durbin R. Fast and accurate short read alignment with Burrows-Wheeler transform Bioinformatics 2009 25 1754 1760 19451168 34. Kleinman C.L. Adoue V. Majewski J. RNA editing of protein sequences: a rare event in human transcriptomes RNA 2012 18 1586 1596 22832026 35. Nemlich Y. Greenberg E. Ortenberg R. Besser M.J. Barshack I. Jacob-Hirsch J. Jacoby E. Eyal E. Rivkin L. Prieto V.G. MicroRNA-mediated loss of ADAR1 in metastatic melanoma promotes tumor growth J. Clin. Investig. 2013 123 2703 2718 23728176 36. Stouffer S.A. Suchman E.A. DeVinney L.C. Star S.A. Williams R.M. Studies in Social Pyschology in World War II 1949 Princeton New Jersey Princeton University Press 37. Mosteller F. Bush R. Llindzey G. Handbook of Social Pyschology 1954 Cambridge MA Addison-Wesley 289 334 38. Zaykin D.V. Optimally weighted Z-test is a powerful method for combining probabilities in meta-analysis J. Evol. Biol. 2011 24 1836 1841 21605215 39. Yee T. The {VGAM} package R News 2008 8 28 39 40. Karolchik D. Barber G.P. Casper J. Clawson H. Cline M.S. Diekhans M. Dreszer T.R. Fujita P.A. Guruvadoo L. Haeussler M. The UCSC genome browser database: 2014 update Nucleic Acids Res. 2014 42 D764 D770 24270787 41. Cabanski C.R. Wilkerson M.D. Soloway M. Parker J.S. Liu J. Prins J.F. Marron J.S. Perou C.M. Hayes D.N. BlackOPs: increasing confidence in variant detection through mappability filtering Nucleic Acids Res. 2013 41 e178 23935067 42. Wang K. Li M. Hakonarson H. ANNOVAR: functional annotation of genetic variants from high-throughput sequencing data Nucleic Acids Res. 2010 38 e164 20601685 43. Robinson J.T. Thorvaldsdottir H. Winckler W. Guttman M. Lander E.S. Getz G. Mesirov J.P. Integrative genomics viewer Nat. Biotechnol. 2011 29 24 26 21221095 44. Witten I.H. Frank E. Data Mining : Practical Machine Learning Tools and Techniques 2005 2nd edn Amsterdam; Boston MA Morgan Kaufman 45. Roberts N.D. Kortschak R.D. Parker W.T. Schreiber A.W. Branford S. Scott H.S. Glonek G. Adelson D.L. A comparative analysis of algorithms for somatic SNV detection in cancer Bioinformatics 2013 29 2223 2230 23842810 46. Iggo R. Gatter K. Bartek J. Lane D. Harris A.L. Increased expression of mutant forms of p53 oncogene in primary lung cancer Lancet 1990 335 675 679 1969059 47. Forbes S.A. Bindal N. Bamford S. Cole C. Kok C.Y. Beare D. Jia M. Shepherd R. Leung K. Menzies A. COSMIC: mining complete cancer genomes in the Catalogue of Somatic Mutations in Cancer Nucleic Acids Res. 2011 39 D945 950 20952405 48. Perou C.M. Sorlie T. Eisen M.B. van de Rijn M. Jeffrey S.S. Rees C.A. Pollack J.R. Ross D.T. Johnsen H. Akslen L.A. Molecular portraits of human breast tumours Nature 2000 406 747 752 10963602 49. Futreal P.A. Coin L. Marshall M. Down T. Hubbard T. Wooster R. Rahman N. Stratton M.R. A census of human cancer genes Nat. Rev. Cancer 2004 4 177 183 14993899 50. Wilkerson M.D. Yin X. Hoadley K.A. Liu Y. Hayward M.C. Cabanski C.R. Muldrew K. Miller C.R. Randell S.H. Socinski M.A. Lung squamous cell carcinoma mRNA expression subtypes are reproducible clinically important and correspond to normal cell types Clin. Cancer Res. 2010 16 4864 4875 20643781 51. Liao R.G. Jung J. Tchaicha J. Wilkerson M.D. Sivachenko A. Beauchamp E.M. Liu Q. Pugh T.J. Pedamallu C.S. Hayes D.N. Inhibitor-sensitive FGFR2 and FGFR3 mutations in lung squamous cell carcinoma Cancer Res. 2013 73 5195 5205 23786770 52. Bose R. Kavuri S.M. Searleman A.C. Shen W. Shen D. Koboldt D.C. Monsey J. Goel N. Aronson A.B. Li S. Activating HER2 mutations in HER2 gene amplification negative breast cancer Cancer Discov. 2013 3 224 237 23220880 Interact Cardiovasc Thorac Surg Interact Cardiovasc Thorac Surg icvts icvtsurg Interactive Cardiovascular and Thoracic Surgery 1569-9293 1569-9285 Oxford University Press 24130089 3867036 10.1093/icvts/ivt419 ivt419 New Ideas Thoracic Comparison of local tissue damage: monopolar cutter versus Nd:YAG laser for lung parenchyma resection. An experimental study Kirschbaum Andreas a * Braun Steve b Rexin Peter c Bartsch Detlef K. a Seyfer Perla b aVisceral Thoracic and Vascular Surgery Clinic University Hospital Giessen and Marburg GmbH Marburg Germany bClinic of Diagnostic and Interventional Radiology University Hospital Giessen and Marburg Marburg Germany cInstitute of Pathology University Hospital Giessen and Marburg Marburg Germany *Corresponding author: Visceral Thoracic and Vascular Surgery Clinic University Hospital Giessen and Marburg GmbH Baldingerstraße 35033 Marburg Germany. Tel: +49-6421-5862561; fax: +49-6421-5866593; e-mail: akirschb@med.uni-marburg.de (A. Kirschbaum). 1 2014 14 10 2013 18 1 1 6 26 4 2013 17 7 2013 19 8 2013 © The Author 2013. Published by Oxford University Press on behalf of the European Association for Cardio-Thoracic Surgery. All rights reserved. 2013 OBJECTIVES Lung metastases are non-anatomically resected while sparing as much parenchyma as possible. For this purpose a few surgeons use the Nd:YAG Laser LIMAX® 120 whereas the majority of surgeons use a monopolar cutter like the MAXIUM®. The aim of this experimental study was to investigate which instrument causes less lung-tissue damage at the same power output. METHODS These experiments were conducted on left lungs (n = 6) taken from freshly slaughtered pigs. The laser and the monopolar cutter were fixed in a hydraulic mover. The laser was focused at a distance of 3 cm to the lung tissue and the monopolar cutter was fixed in pressure-free contact with the lung surface. Both instruments were manoeuvred at a speed of 5 10 and 20 mm/s in a straight line at an output of 100 watts over the lung surface. The lung lesions that ensued were then examined macro- and microscopically. The same procedures were repeated at a distance of 1 cm creating parallel lesions in order to analyse the lung tissue in between the lesions for thermal damage. In addition two implanted capsules in the lung tissue simulating a lung nodule were resected with either the laser or the monopolar cutter. The resection surfaces were then examined by magnetic resonance imaging and histology for tissue damage. Finally we created a 2-cm wide mark on the lung surface to test the resection capacity of both instruments within 1 min. RESULTS The laser created sharply delineated lesions with a vaporization and coagulation zone without thermal damage of the surrounding lung tissue. With lowering the working speed each zone was extended. At a working speed of 10 mm/s the mean vaporization depth using the laser was 1.74 ± 0.1 mm and the mean coagulation depth was 1.55 ± 0.09 mm. At the same working speed the monopolar cutter demonstrated a greater cutting effect (mean vaporization depth 2.7 ± 0.11 mm; P < 0.001) without leaving much coagulation on the resection surface (mean coagulation depth 1.25 ± 0.1 mm; P = 0.002). In contrast to the laser the monopolar cutter caused thermal damage of the adjacent lung tissue. The adjacent tissue injury was detected in histological examination as well as in the MRI findings. Adjacent lung tissue after lung metastasectomy using the monopolar cutter was hyper-intensive in T2-weighted MR imaging indicating a severe tissue damage. No significant changes in signal intensity were observed in T2-weighted imaging of the adjacent lung tissue after using the laser for lung resection. One minute of laser applied at a 100-watt output penetrated a lung surface area of 3.8 ± 0.4 cm2 compared with 4.8 ± 0.6 cm2 of surface after application of the monopolar cutter (P = 0.001). CONCLUSIONS The monopolar cutter possesses indeed a greater cutting capacity than the laser but it also causes more adjacent tissue injury. Thus laser resection might be preferred for lung metastasectomy. Electrosurgical scalpel Laser Lung metastases Lung resection Tissue damage BMC Urol BMC Urol BMC "

Lung_Cancer

"MBSR is an 8-week group-based training consisting of meditation practices such as the bodyscan gentle yoga sitting and walking meditation. By repeatedly bringing attention back to the current experience participants gradually learn to disengage from dysfunctional thoughts and directly experience the emotions and bodily sensations of the present moment. MBSR aims to provide participants with the ability to step back from ruminating about the past or worrying about the future and simply allow experiences to unfold [2829]. A recent meta-analysis [30] of 13 nonrandomized studies and 9 randomized controlled trials (RCT) concluded there is positive evidence for the use of mindfulness-based interventions in reducing psychological distress in cancer patients. Among the RCT™s a reduction in symptom severity was found for both anxiety and depression corresponding to moderate pooled controlled effect sizes (Hedges™s g = 0.37 and Hedges™s g = 0.44 respectively) [30]. Though mindfulness-based interventions seem to be effective the authors note that across studies the majority of participants were women (85%) and diagnosed with breast cancer (77%). Compared to breast cancer patients patients with lung cancer are more often male older and have a poorer prognosis. Furthermore of these 22 studies only one study included the partners of the patients showing that partners also benefit from the MBSR training [31]. This is quite surprising since partners of cancer patients also report high levels of distress [32]. Aims The aim of the Mindfulness for Lung Oncology Nijmegen (MILON) study is to examine the effectiveness of MBSR compared to TAU in reducing psychological distress in patients with lung cancer and their partners. We hypothesize that patients in the MBSR group will report a lower level of psychological distress (i.e. anxiety and depressive symptoms) higher levels of quality of life quality of relationship and spirituality than those in the TAU group. Medical and societal costs will be lower in the MBSR versus TAU group. We expect partners in the MBSR group to report a lower level of psychological distress and higher levels of caregiver appraisal relationship quality and spirituality than their counterparts in the TAU group. With regard to the working mechanisms of the MBSR programme we will examine changes in mindfulness skills self-compassion rumination intrusion avoidance and adherence to MBSR. Methods/Design Study design The design of the ˜MILON™ study is a parallel group randomized controlled trial with an embedded process study. Participants are randomized between MBSR and TAU. The study protocol has been approved by our ethical review board (CMO Arnhem-Nijmegen) and registered under number 2011“519. Participants and procedure Patients and partners are recruited at the outpatient clinic of the Department of Pulmonary Diseases Radboud University Nijmegen Medical Centre (RUNMC) by a nurse practitioner and the attending physician. Patients and partners are invited to participate together but both are welcome to participate on their own if they do not have a partner or their partner is not willing to participate. Patients and/or partners who are interested are provided with an information leaflet. If they are willing to participate they are invited for a research interview in which in- and exclusion criteria are assessed and informed consent is taken. At other participating hospitals (Department of Pulmonary Diseases Canisius-Wilhelmina Hospital Nijmegen; Department of Pulmonary Medicine Rijnstate Arnhem; Department of Oncology Elkerliek Hospital Helmond; Department of Pulmonary Medicine Jeroen Bosch Hospital; Department of Pulmonary Diseases Maas hospital Pantein Boxmeer) patients and their partners will be sent a letter with the invitation to participate in the study. One week later the researcher calls the patients to answer possible questions and asks whether the patient and partner are interested in participation. If so they are invited for a research interview at the RUNMC. Eligibility We include patients and/or partners of patients who are (a) diagnosed with cytologically or histologically proven non-small cell lung cancer or small cell lung cancer and (b) have received or are still under treatment. Exclusion criteria for both patient and partner include: (a) being under 18 years of age (b) not being able to understand or use the Dutch language (c) former participation in MBSR or Mindfulness-Based Cognitive Therapy (MBCT) (d) current and regular treatment by psychologist or psychiatrist (e) current participation in other psychosocial programme and (f) physical or cognitive (<26 on the Mini-Mental State Examination (MMSE)) impairments hampering participation in MBSR training or completion of questionnaires. Baseline Patients and partners are interviewed to obtain demographics and clinical characteristics after which they are screened for cognitive impairments with the MMSE [33]. After that baseline questionnaires including the Distress Thermometer (DT) [3435] are administered followed by randomization. shows the assessment instruments and time points at which the questionnaires are administered to patients and partners. Measurements and corresponding time points for patient and partner Measure Target T0 T1 T2 pt pr pt pr pt pr MMSE Cognitive impairments x x DT General distress x x HADS Psychological distress x x x x x x QLQ-C30 Quality of life x x x QLQ-LC13 Quality of life x x x SIP Impact of sickness x x x SPPIC Caregiver burden x x x CRA-SE Caregiver self-esteem x x x IMS-S Relationship satisfaction x x x x x x MIS Communication about cancer x x x x x x SAIL Spirituality x x x x x x FFMQ Mindfulness skills x x x x x x SCS Self-compassion x x x x x x RRS-EXT Rumination x x x x x x IES Psychological stress reaction x x x x x x Diary Health care use work absence Monthly during study period for pt Calendar Mindfulness adherence Monthly during study period for pt and pr Note. T0 = Baseline measurement; T1 = Post-intervention measurement; T2= 3-month follow-up measurement; pt = Patient; pr = Partner; MMSE = Mini Mental State Examination; DT = Distress Thermometer; HADS = Hospital Anxiety and Depression Scale; QLQ-C30 = Quality of Life “ Cancer; QLQ-LC13 = Quality of Life “ Lung Cancer; SIP = Sickness Impact Profile; SPPIC = Self-Perceived Pressure from Informal Care; CRA-SE = Caregiver Reaction Assessment “ Care-Derived Self-Esteem; IMS-S = Investment Model Scale-Satisfaction; MIS = Mutuality and Interpersonal Sensitivity; SAIL = Spiritual Attitude and Involvement List; FFMQ = Five Facet Mindfulness Questionnaire; SCS = Self-Compassion Scale; RRS-EXT = Rumination Response Scale “ Extended Version; IES = Impact of Event Scale. Randomization Randomization is stratified according to setting and minimized for (a) stage of disease (curative versus palliative) (b) baseline level of anxiety and depressive symptoms (anxiety or depression subscale score of Hospital Anxiety and Depression Scale (HADS) <8 versus ?8) (c) treatment during MBSR (no treatment versus chemo- and/or radiotherapy) and (d) participation (patient alone versus partner alone versus patient and partner together). Randomization is computerized using a randomization website specifically designed for this study on which the researcher can fill out the required data. The researcher communicates treatment allocation to the nurse practitioner who informs the patient and/or partner. Follow-up assessments Follow-up assessments take place post intervention and at three-month follow-up. Participants who have access to the internet and have an email address receive the questionnaires online. If not they receive the questionnaires on paper along with a reply envelope. In case of drop-out the researcher tries to contact the participant by phone to complete a minimum set of outcome measures and to identify the main reason for drop-out. Intervention The MBSR curriculum used is primarily based on the Mindfulness-Based Stress Reduction programme as developed by Kabat-Zinn [28] but contains some elements of the MBCT programme by Segal Williams and Teasdale [29] like psycho-education on the interrelatedness of feelings and thoughts. Moreover some modifications have been made to make the intervention more suitable for patients with lung cancer and their partners such as psycho-education about grief [36]. In addition a mindful communication exercise in which partners talk with each other about the cancer was added. The programme consists of 8 weekly 2.5-hour sessions a silent day between session six and seven and home practice assignments of about 45 minutes 6 days per week. Participants receive a set of CDs with guided mindfulness meditation exercises for home practice and a folder with information and home practice instructions for the forthcoming week. Table 2 shows the content of the MBSR programme per session. The MBSR courses are taught by mindfulness teachers with extensive training in MBSR. They all fulfil the advanced criteria of the Center for Mindfulness of the University of Massachusetts Medical School [37] and maintain a regular personal meditation practice. Teachers were trained supervised and assessed to ensure their competency levels met the qualification criteria to instruct the MBSR classes. During the trial teachers will receive weekly supervision and a number of sessions will be videotaped to evaluate competence and adherence with the Mindfulness-Based Interventions “ Teaching Assessment Criteria [38]. Table 2 Content of MBSR programme per session Theme of session Meditation exercise Didactic teaching Homework 1. Automatic pilot - Bodyscan - Intention of participating - Bodyscan - Raisin exercise - Eating one meal mindfully - Attention for routine activity 2. Mindfulness of the breath - Bodyscan - Imagery exercise to demonstrate relationship between thoughtsand feelings - Bodyscan - Sitting mediation with focus on breath - Attention for breath - Awareness of pleasant events - Attention for routine activity 3. Observing limits - Yoga while lying down - Seeing exercise to demonstrate difference between observation and interpretation - Bodyscan or yoga - 3-min breathing space - Sitting meditation - Awareness of unpleasant events - 3-min breathing space 4. Opening up to distress - Sitting mediation with focus on breath body and sound - Interrelatedness of feelings thoughts and bodily sensations - Bodyscan or yoga - Sitting meditation - 3-min breathing space - Psychoeducation about grief - Awareness of stress reactions - 3-min breathing space 5. Responding to distress - Sitting mediation with focus on breath body sound thoughts difficulty - Reacting versus responding - Meditation by choice - Coping with grief - Awareness of reaction in difficult situation - Walking meditation - Awareness of communication difficulties - 3-min breathing space - 3-min breathing space 6. Mindful communication - Yoga in standing position - Mindful communication exercise about effect of lung cancer with their own partner - Sitting meditation or yoga - 3-min breathing space - Awareness of communication - 3-min breathing space during stress Silent day - Varying meditation exercises"

Lung_Cancer

"DNA methylation is an early event in bronchial carcinogenesis and increased DNA methyltransferase (DNMT)1 protein expression is a crucial step in the oncogenic transformation of epithelia. Here we investigate the role of class I histone deacetylases (HDACs) 1“3 in the stabilization of DNMT1 protein and as a potential therapeutic target for lung cancer chemoprevention. Long-term exposure of immortalized bronchial epithelial cells (HBEC-3KT) to low doses of tobacco-related carcinogens led to oncogenic transformation increased HDAC expression cell cycle independent increased DNMT1 stability and DNA hypermethylation. Overexpression of HDACs was associated with increased DNMT1 stability and knockdown of HDACs reduced DNMT1 protein levels and induced DNMT1 acetylation. This suggests a causal relationship among increased class I HDACs levels upregulation of DNMT1 protein and subsequent promoter hypermethylation. Targeting of class I HDACs with valproic acid (VPA) was associated with reduced HDAC expression and a profound reduction of DNMT1 protein level. Treatment of transformed bronchial epithelial cells with VPA resulted in reduced colony formation demethylation of the aberrantly methylated SFRP2 promoter and de-repression of SFRP2 transcription. These data suggest that inhibition of HDAC activity may reverse or prevent carcinogen induced transformation. Finally immunohistochemistry on human lung cancer specimens revealed a significant increase in DNMT1 HDAC1 HDAC2 and HDAC3 expression supporting our hypotheses that class I HDACs are mediators of DNMT1 stability. In summary our study provides evidence for an important role of class I HDACs in controlling the stability of DNMT1 and suggests that HDAC inhibition could be an attractive approach for lung cancer chemoprevention. Respir Res Respir. Res Respiratory Research 1465-9921 1465-993X BioMed Central 24405663 3893562 1465-9921-15-2 10.1186/1465-9921-15-2 Research Increased methylation of lung cancer-associated genes in sputum DNA of former smokers with chronic mucous hypersecretion Bruse Shannon 1 sbruselrri. Petersen Hans 1 hpetersenlrri. Weissfeld Joel 2 jweissfeldupms.edu Picchi Maria 1 mpicchilrri. Willink Randall 1 rwillinklrri. Do Kieu 1 kdolrri. Siegfried Jill 2 siegfriedjmupmc.edu Belinsky Steven A 1 sbelinskylrri. Tesfaigzi Yohannes 1 ytesfaiglrri. 1Lovelace Respiratory Research Institute Albuquerque NM Mexico 2Department of Pharmacology & Chemical Biology Hillman Cancer Center of the University of Pittsburgh Medical Center Pittsburgh PA USA 2014 9 1 2014 15 1 2 2 12 9 2013 18 12 2013 Copyright 2014 Bruse et al.; licensee BioMed Central Ltd. 2014 Bruse et al.; licensee BioMed Central Ltd. This is an Open Access distributed under the terms of the Creative Commons Attribution License ( http://creativecommons./licenses/by/2.0) which permits unrestricted use distribution and reproduction in any medium provided the original work is properly cited. The Creative Commons Public Domain Dedication waiver ( http://creativecommons./publicdomain/zero/1.0/) applies to the data made available in this unless otherwise stated. Background Chronic mucous hypersecretion (CMH) contributes to COPD exacerbations and increased risk for lung cancer. Because methylation of gene promoters in sputum has been shown to be associated with lung cancer risk we tested whether such methylation was more common in persons with CMH. Methods Eleven genes commonly silenced by promoter methylation in lung cancer and associated with cancer risk were selected. Methylation specific PCR (MSP) was used to profile the sputum of 900 individuals in the Lovelace Smokers Cohort (LSC). Replication was performed in 490 individuals from the Pittsburgh Lung Screening Study (PLuSS). Results CMH was significantly associated with an overall increased number of methylated genes with SULF2 methylation demonstrating the most consistent association. The association between SULF2 methylation and CMH was significantly increased in males but not in females both in the LSC and PLuSS (OR?=?2.72 95% CI?=?1.51-4.91 p?=?0.001 and OR?=?2.97 95% CI?=?1.48-5.95 p?=?0.002 respectively). Further the association between methylation and CMH was more pronounced among 139 male former smokers with persistent CMH compared to current smokers (SULF2; OR?=?3.65 95% CI?=?1.59-8.37 p?=?0.002). Conclusions These findings demonstrate that especially male former smokers with persistent CMH have markedly increased promoter methylation of lung cancer risk genes and potentially could be at increased risk for lung cancer. Methylation of gene promoters Persistent cough and phlegm Sputum DNA Former smoker Lung cancer genes Background Chronic obstructive pulmonary disorder (COPD) is predicted to become the third leading cause of death worldwide by 2020 [1]. Prevalence is increasing both in developing and developed countries as a result of tobacco consumption [23] environmental exposures such as pollution and biomass fuel smoke [45] and the growing elderly population [6]. Clinically COPD is defined by the presence of poorly reversible airflow obstruction although this definition simplifies the complex causes and manifestations of the disease [7]. Chronic mucous hypersecretion (CMH) characterized by persistent mucous cell metaplasia in the epithelial layer and submucosal glands of the respiratory tract is a clinically important COPD phenotype [8]. CMH leads to worse respiratory symptoms greater susceptibility to respiratory infections more frequent COPD exacerbations and increased risk of mortality [9-14]. Numerous publications and two recent meta-analyses have determined that prior CMH significantly increases the risk for later lung cancer [1516]. While smoking clearly contributes to both diseases analyses controlling for smoking have demonstrated that the association between lung cancer and prior CMH is at least partially independent of smoking [1516]. It is therefore plausible that CMH and lung cancer have some shared molecular pathology. Previous case“control studies of incident lung cancer assessing the same genes as in the current study demonstrated that promoter methylation of these genes is associated with lung cancer risk [1718]. The goal of this study was to determine whether there was any association between CMH and prevalence of methylation of promoters in lung cancer-predictive genes in sputum DNA of smokers. Therefore methylation specific PCR (MSP) was used to assess promoter methylation of eleven genes in sputum samples of smokers from the Lovelace Smokers Cohort (LSC). Replication was performed in smokers from the Pittsburgh Lung Screening Study (PLuSS). Methods Study populations This study is approved by the Western Institutional Review Board (Olympia WA; #20031684) and all subjects signed informed consent for their participation. The catchment area for the LSC was the Albuquerque NM metropolitan area comprising a population of approximately 850000 persons. Inclusion criteria for entry into the current study were age 40 to 75 years current or former cigarette smoking (with a minimum of 10 pack-years) upon entry into the study and ability to understand English. The LSC disproportionately enrolled women ever-smokers to study the susceptibility to the development of smoking-related lung diseases since women are underrepresented in most such studies in the United States. Detailed characteristics of the LSC have been described elsewhere [1920]. From the LSC cohort 311 non-Hispanic white (NHW) individuals meeting the criteria for CMH were included along with 589 NHW current or former smoking controls. Current and former smoking was assessed by self-report at baseline concurrent with sputum sampling. Former smokers are those who have stopped smoking for at least 2 years prior to self-report. Study participants for the replication cohort were from the Pittsburgh Lung Screening Study (PLuSS) a volunteer cohort established to investigate lung cancer biomarkers in an at-risk population of smokers which has previously been described [2122]. From the total cohort (n?=?3638) 490 NHW individuals (183 men and 307 women) had information allowing classification with respect to chronic mucous hypersecretion and had provided sputum for DNA isolation. Spirometric testing procedures have previously been described for both the PLuSS and the LSC [1921]. Because a unifying definition for CMH was not available in both cohorts two criteria were used to define CMH: In the LSC CMH was defined as present in participants that had self-reported cough productive of phlegm for at least 3 months per year for at least 2 consecutive years (ie. the standard definition of chronic bronchitis). In the PLuSS CMH was defined as self-reported cough productive of phlegm as assessed by both a first and second questionnaire (with a median questionnaire interval of 3.5 years) and self-reported cough producing phlegm for œmost days a week or œseveral days a week in the past year as assessed by the second questionnaire. Methylation specific PCR Nested MSP assays were used to detect methylation of cytosines at cytosine-phosphate-guanine sites in DNA recovered from the sputum samples as previously described [2324]. We studied the promoter methylation of a panel of eleven tumor suppressor genes with previously identified roles in predicting lung cancer risk [1718]. These genes included PCDH-20 (Protocadherin); SULF-2 (6-O-endosulfatase 2); GATA binding protein-4 and ?5 transcription factors; PAX-5? and PAX-5? (paired box protein transcription factors); p16; MGMT (O (6)-methylguanine-DNA methyltransferase); DAPK (Death-associated protein kinase); DAL-1 (Differentially expressed in adenocarcinoma of the lung); and JPH-3 (Junctophilin). Methylation by this technique was scored positive or negative as previously described [18]. Statistical analysis Chi-square and Fisher™s exact tests were used for the univariate analyses of categorical variables while two-sample t-tests and Kruskal-Wallis tests were used for continuous variables. For multivariable analyses of CMH logistic regression was performed. Predictors included gene specific methylation prevalence and also total methylation (continuous variable representing the sum of genes methylated within an individual). Additional predictors included age education (dichotomized as at least high school or less than high school education) COPD status sex pack-years smoking and current smoking status. When the LSC and PLuSS were combined for analyses adjustment for cohort was included. Model fitting iterations were performed with the R package glmulti using the small sample size corrected Akiake information criterion to determine best-fitting models [25]. All statistical analyses were performed in R version 2.12.0 or SAS version 9.2. Results CMH is associated with higher prevalence of gene promoter methylation in smokers The initial study was conducted in 900 NHW current and former smokers from the LSC with available sputum methylation data. At time of sputum collection there were 311 smokers with and 589 smokers without CMH. In unadjusted analysis prevalence of SULF2 methylation was significantly higher in those with CMH than without CMH (39 % and 30 % respectively p?<?0.01 Table 1). A replication study was performed in the PLuSS comprised of 140 smokers with and 350 smokers without CMH and in unadjusted analysis prevalence of SULF2 methylation was significantly higher in those with CMH than those without CMH (40 % and 26 % respectively p?<?0.01 Table 2). Table 1 Select variables by CMH status in the LSC LSC Total CMH No CMH n?=? 900 (100.0) n?=? 311 (100.0) n?=? 589 (100.0) Characteristic n or mean (%) or (SD) n or mean (%) or (SD) n or mean (%) or (SD) p value Female 673 (74.8) 222 (71.3) 451 (76.6) 0.088 Baseline age 55.9 (9.6) 55.1 (9.8) 56.3 (9.4) 0.067 Education?>?= HS* 663 (73.7) 207 (66.6) 456 (77.4) <0.001 Obese 278 (30.9) 93 (29.9) 185 (31.4) 0.642 Pack years 41.1 (20.9) 44.2 (21.8) 39.5 (20.2) 0.001 Baseline smoker 494 (55.6) 236 (76.4) 258 (44.6) <.0001 Baseline COPD 281 (31.2) 123 (39.6) 158 (26.8) <.0001 Total methylation 2.47 (2.12) 2.66 (2.22) 2.37 (2.06) 0.057 PCDH20 333 (37.0) 125 (40.2) 208 (35.3) 0.149 SULF2 299 (33.2) 122 (39.2) 177 (30.1) 0.005 GATA4 348 (38.7) 125 (40.2) 223 (37.9) 0.495 PAX5A 138 (15.3) 46 (14.8) 92 (15.6) 0.743 p16 154 (17.1) 61 (19.6) 93 (15.8) 0.147 MGMT 249 (27.7) 87 (28.0) 162 (27.5) 0.881 DAPK 153 (17.0) 54 (17.4) 99 (16.8) 0.833 GATA5 152 (16.9) 55 (17.7) 97 (16.5) 0.643 PAX5B 90 (10.0) 30 (9.7) 60 (10.2) 0.797 DAL1 71 (7.9) 27 (8.7) 44 (7.4) 0.521 JPH3 229 (25.4) 91 (29.3) 138 (23.4) 0.056 *High school. Table 2 Select variables by CMH status in the PLuSS PLuSS Total CMH No CMH n?=? 490 (100.0) n?=? 140 (100.0) n ?=?350 (100.0) Characteristic n or mean (%) or (SD) n or mean (%) or (SD) n or mean (%) or (SD) p value Female 307 (62.7) 90 (64.3) 217 (62.0) 0.637 Baseline age 60.3 (6.4) 59.5 (6.1) 60.6 (6.5) 0.075 Education?>?= HS* 474 (96.7) 134 (95.7) 340 (97.1) 0.422 Obese 158 (32.2) 45 (32.1) 113 (32.3) 0.976 Pack Years 55.9 (20.1) 59 (19.1) 54.6 (20.4) 0.029 Baseline smoker 335 (68.4) 113 (80.7) 222 (63.4) <0.001 Baseline COPD 238 (48.6) 81 (57.9) 157 (44.9) 0.009 Total methylation 2 (1.84) 2.26 (2.04) 1.9 (1.75) 0.052 PCDH20 135 (27.6) 47 (33.6) 88 (25.1) 0.059 SULF2 147 (30.0) 56 (40.0) 91 (26.0) 0.002 GATA4 166 (33.9) 47 (33.6) 119 (34.0) 0.928 PAX5A 68 (13.9) 23 (16.4) 45 (12.9) 0.302 p16 92 (18.8) 32 (22.9) 60 (17.1) 0.143 MGMT 123 (25.1) 34 (24.3) 89 (25.4) 0.792 DAPK 75 (15.3) 21 (15.0) 54 (15.4) 0.905 GATA5 64 (13.1) 18 (12.9) 46 (13.1) 0.932 PAX5B 33 (6.7) 9 (6.4) 24 (6.9) 0.864 DAL1 37 (7.6) 14 (10.0) 23 (6.6) 0.194 JPH3 41 (8.4) 15 (10.7) 26 (7.4) 0.235 *High school. In adjusted analysis in the LSC total methylation (defined as the cumulative prevalence of methylation for all 11 genes; see Methods) was significantly higher in smokers with CMH as was methylation prevalence of SULF2 JPH3 and PCDH20 (p?<?0.05 all analyses) (Table 3). Similarly adjusted analysis in the PLuSS showed that total methylation was significantly higher in those with CMH as was methylation prevalence of SULF2 p16 and PCDH20 (p?<?0.05 all analyses) (Table 3). Table 3 Odds ratios for CMH in adjusted* analyses LSC n?=? 900 PLuSS n?=? 490 Combined n?=? 1390 Exposure variable OR (95 % CL) p value OR (95 % CL) p value OR (95 % CL) p value Total methylation 1.09*** (1.02 1.17) 0.014 1.15 (1.03 1.29) 0.014 1.11 (1.04 1.18) 0.001** SULF2 1.68 (1.23 2.30) 0.001** 2.14 (1.38 3.31) 0.001** 1.79 (1.39 2.31) <.0001** p16 1.43 (0.97 2.11) 0.067 1.69 (1.01 2.83) 0.045 1.54 (1.14 2.10) 0.006 JPH3 1.45 (1.04 2.03) 0.031 1.70 (0.83 3.48) 0.149 1.53 (1.13 2.08) 0.006 PCDH20 1.40 (1.03 1.90) 0.033 1.73 (1.10 2.73) 0.018 1.47 (1.14 1.90) 0.003** Each row represents a separate adjusted model. LSC: CMH (n?=?311) and no CMH (n?=?589); PLuSS CMH (n?=?140) and no CMH (n?=?350). *Additional adjustors include age sex education COPD current smoking pack years and cohort (for combined analysis); CMH as outcome. **Bonferroni adjusted significance threshold is p?<?0.0042. ***Represents the odds ratio increase for each additional gene methylated. Analyses combining the two cohorts were also performed. In both unadjusted (Additional file 1: Table S1) and adjusted (Table 3) analysis in the combined cohorts total methylation was higher in those with CMH than in those with an absence of CMH as was methylation prevalence of SULF2 JPH3 p16 and PCDH20 (p?<?0.01 all analyses). Additional factors associated with CMH were younger age less education having COPD greater pack years and current smoking (p?<?0.01 all analyses Additional file 1: Table S1). Additional modeling was performed that included two-way interaction terms for baseline COPD pack years and methylation total or individual gene for the combined cohort of LSC and PLuSS cohorts. These interaction terms were not significant for total methylation Sulf-2 or PCDH20 each of which showed significant association with CMH within the LSC the PluSS cohort and the combination of both cohorts. These findings suggest methylation is an independent risk for CMH. The association between CMH and gene promoter methylation is stronger in males Univariate analysis revealed factors that were associated with higher methylation prevalence which include male sex (p?<?0.001) (Additional file 1: Table S2). Because of the observed sex differences in methylation prevalence sex stratified analyses were performed in males and females. Total methylation was significantly associated with CMH in males in both the LSC and PLuSS cohorts (p?<?0.01 both analyses) and when analysis was performed for the combined cohort (p?<?0.001) (Table 4). When individual genes were analyzed in males SULF2 p16 and JPH3 were significantly associated in the LSC (p?<?0.05 all analyses) while SULF2 and PCDH20 were significant in the PLuSS (p?<?0.05). In the combined cohort the prevalence of SULF2 JPH3 PCDH20 and p16 methylation were all significantly higher in males with CMH compared to males without CMH (p?<?0.05 all analyses). Although the number of female participants was higher for both cohorts in females no significant associations were found for the individual cohort analyses although higher SULF2 methylation prevalence was observed in analysis of the combined cohorts (p?<?0.05). Table 4 Odds ratios for CMH in sex stratified adjusted* analyses Males LSC n ?=?227 PLuSS n ?=?183 Combined n?=? 410 Exposure variable OR (95?% CL) p value OR (95?% CL) p value OR (95?% CL) p value Total methylation 1.23 (1.07 1.41) 0.004** 1.28 (1.07 1.54) 0.008 1.23 (1.11 1.37) <.0001** SULF2 2.72 (1.51 4.91) 0.001** 2.97 (1.48 5.95) 0.002** 2.73 (1.75 4.25) <.0001** p16 2.08 (1.01 4.28) 0.048 1.66 (0.71 3.89) 0.246 1.88 (1.09 3.23) 0.023 JPH3 2.64 (1.43 4.87) 0.002** 2.70 (0.96 7.59) 0.059 2.66 (1.58 4.48) <.0001** PCDH20 1.68 (0.94 2.98) 0.079 2.29 (1.15 4.53) 0.018 1.89 (1.22 2.93) 0.004** Females LSC n?=? 673 PLuSS n?=? 307 Combined n?=? 980 Exposure variable OR (95?% CL) p value OR (95?% CL) p value OR (95?% CL) p value Total methylation 1.04 (0.96 1.14) 0.324 1.08 (0.93 1.25) 0.322 1.05 (0.98 1.13) 0.188 SULF2 1.41 (0.97 2.05) 0.074 1.72 (0.96 3.07) 0.066 1.47 (1.07 2.01) 0.016 p16 1.25 (0.79 1.99) 0.342 1.76 (0.91 3.40) 0.091 1.41 (0.97 2.05) 0.073 JPH3 1.07 (0.71 1.62) 0.748 1.20 (0.42 3.39) 0.736 1.10 (0.75 1.62) 0.634 PCDH20 1.33 (0.92 1.93) 0.126 1.35 (0.72 2.52) 0.346 1.34 (0.97 1.83) 0.073 Each row represents a separate adjusted model. *Additional adjustors include age education COPD current smoking pack years and cohort (for combined analysis); CMH as outcome."

Lung_Cancer

"However it remains to be elucidated whether NME2-mediated alteration of nucleosomal reanization possesses any unique features of the histone modification language (involving specific enzyme complexes and histone chaperones) that could be essential in mitigating metastasis. SUPPLEMENTARY DATASupplementary Data are available at NAR Online. SUPPLEMENTARY DATA Research Fellowship from CSIR (V.Y. A.B. and A.K.) UGC (R.K.T.) and ICMR (R.H. and A.S.) is acknowledged. The ˜CSIR“Mayo Clinic Collaboration for Innovation and Translational Research™ is acknowledged for helping to initiate the collaboration with Eric Wieben's group. Lung lysates were kindly provided by I. Boldogh from UTMB Galveston TX 77555 USA. We thank Vani Brahmachari (ACBR India) for helping us with mononucleosome preparation and other members of the Chowdhury lab especially Parashar Dhapola for stimulating discussions and suggestions. We also thank Munia Ganguli (CSIR-IGIB) for careful reading and editing of the manuscript.   The authors wish it to be known that in their opinion the first two authors should be regarded as Joint First Authors. FUNDING Council of Scientific and Industrial Research Project MLP1203 and Wellcome Trust/Department of Biotechnology India Alliance (DBT) [500127/Z/09/Z to S.C.]. Funding for open access charge: Wellcome Trust/DBT India Alliance grant no. [500127/Z/09/Z to S.C.]. Senior Research Fellowship from Wellcome Trust/ Department of Biotechnology India Alliance [500127/Z/09/Z to S.C.]; National Institutes of Health [CA129537 and CA154320 to T.K.P.]. Conflict of interest statement. None declared. REFERENCES 1. Hay E.D. The mesenchymal cell its role in the embryo and the remarkable signaling mechanisms that create it Dev. Dyn. 2005 233 706 720 15937929 2. Koerber R.T. Rhee H.S. Jiang C. Pugh B.F. Interaction of transcriptional regulators with specific nucleosomes across the Saccharomyces genome Mol.Cell 2009 35 889 902 19782036 3. Fidler I.J. The pathogenesis of cancer metastasis: the ˜seed and soil™ hypothesis revisited Nat. Rev. Cancer 2003 3 453 458 12778135 4. Hanahan D. Weinberg R.A. Hallmarks of cancer: the next generation Cell 2011 144 646 674 21376230 5. Sethi N. Kang Y. Unravelling the complexity of metastasis”molecular understanding and targeted therapies Nat. Rev. Cancer 2011 11 735 748 21941285 6. Jiang C. Pugh B.F. Nucleosome positioning and gene regulation: advances through genomics Nat. Rev. Genet. 2009 10 161 172 19204718 7. Barski A. Cuddapah S. Cui K. Roh T.Y. Schones D.E. Wang Z. Wei G. Chepelev I. Zhao K. High-resolution profiling of histone methylations in the human genome Cell 2007 129 823 837 17512414 8. Liu C.L. Kaplan T. Kim M. Buratowski S. Schreiber S.L. Friedman N. Rando O.J. Single-nucleosome mapping of histone modifications in S. cerevisiae PLoS Biol. 2005 3 e328 16122352 9. Zhang L. Ma H. Pugh B.F. Stable and dynamic nucleosome states during a meiotic developmental process Genome Res. 2011 21 875 884 21515815 10. Robinson P.J. An W. Routh A. Martino F. Chapman L. Roeder R.G. Rhodes D. 30 nm chromatin fibre decompaction requires both H4-K16 acetylation and linker histone eviction J. Mol. Biol. 2008 381 816 825 18653199 11. Routh A. Sandin S. Rhodes D. Nucleosome repeat length and linker histone stoichiometry determine chromatin fiber structure Proc. Natl. Acad. Sci. U.S.A 2008 105 8872 8877 18583476 12. Segal E. Widom J. What controls nucleosome positions Trends Genet. 2009 25 335 343 19596482 13. Bargaje R. Alam M.P. Patowary A. Sarkar M. Ali T. Gupta S. Garg M. Singh M. Purkanti R. Scaria V. Proximity of H2A.Z containing nucleosome to the transcription start site influences gene expression levels in the mammalian liver and brain Nucleic Acids Res. 2012 40 8965 8978 22821566 14. Hogan G.J. Lee C.K. Lieb J.D. Cell cycle-specified fluctuation of nucleosome occupancy at gene promoters"

Lung_Cancer

"Single agent and combination treatment protocols were well tolerated by mice with no weight loss or other signs of acute or delayed toxicity (A-C). Antitumor activity of AZD6244 and/or BEZ235 in mouse xenograft models of human tumors. Nude mice-bearing NCI-H1993 (A) NCI-H1975 (B) and NCI-H460 (C) tumors were administered 25 mg/kg AZD6244 twice daily and/or 20 mg/kg BEZ235 once daily up to 21 days. Tumors were resected from nude mice on day 21 (D). Tumor volume was measured using calipers on the indicated days. Mean?±?SD n?=?10. * P?<?0.05 vs control group. ** P?<?0.01 vs control group. Changes in body weight of mice treated with control group or AZD6244 and/or BEZ235. Nude mice-bearing NCI-H1993 (A) NCI-H1975 (B) and NCI-H460 (C) tumors were administered 25 mg/kg AZD6244 twice daily and/or 20 mg/kg BEZ235 once daily up to 21 days. Body weight was measured on the indicated days. Mean?±?SD n?=?10. Effect of MEK and PIK3/mTOR inhibitors on signaling transduction pathways in gefitinib-resistant NSCLC tumor models To assess the impact of both compounds on downstream molecules of the MEK and PI3K pathways we used Western blot analysis to observe phosphorylation status and total protein expression in tumor tissues. The results showed that p-MEK1/2 p-ERK1/2 p-AKT p-S6 and p-4E-BP1 appeared to be inhibited by AZD6244 and BEZ235 combination treatment whereas the total protein levels of MEK1/2 ERK1/2 AKT S6 and 4E-BP1 remained unchanged in each tumor model (). Western blot analysis of downstream signals also showed treatment with AZD6244 or BEZ235 inhibited the phosphorylation of ERK1/2 or AKT in all three tumor models respectively. In addition combined treatment with AZD6244 and BEZ235 showed greater inhibition of p-ERK1/2 and p-AKT than observed in control group or mice treated with each compound alone in vivo (). Interestingly the impact from both inhibitors on p-S6 and p-4E-BP1 levels was alternatively tumor model specific. For example AZD6244 and BEZ235 alone and in combination markedly inhibited p-S6 and p-4E-BP1 expression levels in NCI-H1993 tumor models compared with the minimal suppression observed in NCI-H460 tumor model (). Neither AZD6244 nor BEZ235 alone suppressed p-S6 and p-4E-BP1 in NCI-H1975 tumor model. We also found that the expression of MMP-9 was significantly inhibited by AZD6244 and BEZ235 combination treatment whereas the expression of MMP-2 was not affected by the treatment. Effects of AZD6244-BEZ235 combination therapy on PI3K/AKT and MEK/ERK pathways. All three gefitinib-resistant tumor xenograft models were treated with the AZD6244 and/or BEZ235 for 2 h on Day 21 of the efficacy study tumor tissues were then harvested to detect p-AKT (S473)/AKT p-ERK (T202/Y204)/ERK p-S6 (S240/244)/S6 and p-4E-BP1 (S65)/4E-BP1. Effect of MEK and PIK3/mTOR inhibitors on the expressions of Ki-67 and CD31 in gefitinib-resistant NSCLC tumor models To characterize the mechanism of tumor growth inhibition observed in our gefitinib-resistant NSCLC tumor models by AZD6244 and BEZ235 lung tumor tissues were assessed by evaluating Ki-67 expression using immunohistochemical analyses. We observed active cell proliferation in NCI-H1993 tumor model with a 56% proliferation index (A). Monotherapy with AZD6244 or BEZ235 slightly decreased the percentage of Ki-67-positive proliferating tumor tissues with proliferation indices of 42% and 39% respectively (A). Combined treatment with AZD6244 and BEZ235 markedly decreased the percentage of Ki-67-positive proliferating tumor tissues to 10% consistent with the marked inhibition of ERK1/2 and AKT phosphorylation. We also found the similar results in NCI-H1975 and NCI-H460 tumor models (A).To evaluate the potential antiangiogenic mechanism of AZD6244 and BEZ235 gefitinib-resistant NSCLC tumor tissues were analyzed by immunostaining for CD31 (platelet endothelial cell adhesion molecule 1). The results showed BEZ235 significantly decreased the vascular density of all three gefitinib-resistant NSCLC tumors whereas AZD6244 monotherapy had only a mildly effect upon lung tumor angiogenesis. The antiangiogenic effects AZD6244 and BEZ235 were markedly increased when they were combined (B). Effects of AZD6244 and/or BEZ235 on the expressions of Ki-67 (A) and CD31 (B) in NCI-1993 NCI-1975 and NCI-H460 xenograft models. All three gefitinib-resistant tumor xenograft models were treated with the AZD6244 and/or BEZ235 for 2 h on Day 21 of the efficacy study tumor tissues in each group were resected and immunostained with anti-Ki67 and anti-CD31 antibodies. N?=?10 * P?<?0.05 vs vehicle group. ** P?<?0.01 vs vehicle group. MEK and PIK3/mTOR inhibitors had no effect on caspase-3 8 and 9 activities in gefitinib-resistant NSCLC tumor models In order to investigate whether AZD6244 and/or BEZ235 would induce apoptosis in gefitinib-resistant NSCLC tumor models activity of caspase-3 8 and 9 were measured by the colorimetric assay. The results showed that AZD6244 and/or BEZ235 had no effect on caspase-3 8 and 9 activities in all three gefitinib-resistant NSCLC tumor models (). Effects of AZD6244 and/or BEZ235 on the activities of caspase-3 8 and 9 in NCI-1993 NCI-1975 and NCI-H460 xenograft models. All three gefitinib-resistant tumor xenograft models were treated with the AZD6244 and/or BEZ235 for 2 h on Day 21 of the efficacy study tumor tissues in each group were resected and measured by caspase colorimetric protease kits. N?=?10. Discussion Although advances have been made in cancer treatment with the development of selective molecular targeted therapies several relevant issues for their optimal and effective use remain unsolved. Recent studies have demonstrated that the EGFR-TKI gefitinib and erlotinib are associated with a high response rate and prolong progression-free survival in patients with EGFR mutant lung cancer [22]. Responders to these agents however later relapse after acquiring EGFR-TKI resistance making it urgent to develop novel therapeutic agents that can overcome acquired resistance to EGFR-TKI. Current clinical approaches to combat resistance in lung adenocarcinoma include irreversible and mutant-selective inhibitors of EGFR combination of cetuximab and afatinib [23] and combination of an EGFR inhibitor with a drug targeting a resistance pathway such as the combination of gefitinib and a MET inhibitor [24]. However alternative RTK pathways that are activated following EGFR inhibition are another area for investigation. These alternative pathways may bypass or evade inhibition of EGFR signaling thereby enabling combinations of agents to simultaneously attack multiple molecular targets for cancer growth inhibition. One potential solution to overcome multiple mechanisms of resistance is to target downstream pathways. In this study we show that the combination of a selective MEK inhibitor and a PI3K/mTOR inhibitor is effective against tumor cell lines refractory to gefitinib by three different mechanisms: an EGFR gatekeeper T790M mutation MET amplification and KRAS/PIK3CA mutation. To our knowledge this is the first report of the effects of MEK TKI with PI3K/mTOR TKI therapy in gefitinib-resistant models of NSCLC. MEK is a potentially relevant molecular therapeutic target since it is the activated downstream of the axis RAS/RAF proteins and in turn activates ERK to induce cell proliferation. Therefore several selective MEK inhibitors have been developed [25] and more than ten MEK inhibitors have entered early clinical trial evaluation [26]. Unfortunately clinical activity as single agent has been rarely observed with MEK inhibitors in gefitinib-resistant NSCLC patients [27]. The benefit of blocking an individual pathway has been largely limited by the presence of a compensatory feedback loop between PI3K and MEK. For example inhibition of the MEK pathway results in activation of the PI3K pathway [28] and PI3K activation mediates resistance to MEK inhibition [29]. In our study in order to circumvent this compensatory feedback concurrent blockade of the two pathways has been tested and synergy in antitumor effects was detected providing the rationale for phase I clinical trials. Moreover early signs of clinical benefit have been reported in advanced cancer by a retrospective analysis on patients receiving agents that target both pathways [30]. Gatekeeper mutations the T790M mutation in EGFR associated with resistance to gefitinib [31] are common mechanisms by which tumor cells acquire resistance to molecularly targeted drugs. Although irreversible EGFR-TKIs including BIBW2992 have been developed to overcome T790M-mediated resistance to gefitinib [32] recent clinical trials have failed to show that monotherapy with irreversible EGFR-TKIs has benefits in patients with NSCLC refractory to gefitinib [33]. This may be due at least in part to the low selectivity of this class of compounds to wild-type and mutant EGFR. In addition because HGF overexpression was frequently observed in tumors with the gatekeeper T790M mutation [34] monotherapy with a mutant-selective EGFR-TKI may not be sufficient to inhibit the growth of tumors with acquired resistance to gefitinib. Our findings suggest that the combination of a MEK-TKI and a PIK3/mTOR-TKI may be effective in controlling these resistant tumors. Many KRAS-mutant cancer cells have been shown to be sensitive to MEK inhibitors [35] and KRAS mutations can be detected in up to 30% of lung cancers dependent upon histology and ethnicity [36-38] suggesting that a subset of lung cancers would likely be highly sensitive to AZD6244. Our finding that AZD6244 was effective in one distinct KRAS mutant human lung cancer NCI-H460 models supports and validates this hypothesis. Although monotherapy with AZD6244 resulted in antitumor and some antiangiogenic effects in all of our lung cancer models the antitumor effects were more apparent in the NCI-H1993 lung adenocarcinoma model. The increased antitumor efficacy observed in this model is associated with differences in the inhibitory effect of p-AKT signaling pathway in NCI-H1975 and NCI-H460 lung tumors. However additional studies are needed to elucidate this phenomenon. In this study we evaluated therapy directed against MEK and PI3K/mTOR in distinct gefitinib-resistant NSCLC xenograft models. MEK or PI3K/mTOR inhibition resulted in antitumor effects for these gefitinib-resistance NSCLC models by blocking key intracellular pathways controlling cell proliferation and survival as demonstrated both in vitro and in vivo. Surprisingly PI3K/mTOR inhibition by BEZ235 also suppressed lung tumor angiogenesis and targeted both MEK and PI3K/mTOR activation in lung tumors resulting in substantial antiangiogenic effects which may due to the significantly reduced expression of MMP-9 in tumors. "

Lung_Cancer

"The posttherapy ADC value was higher than pretherapy ADC value (P < 0.001) (). When all tumors were divided into the PR and SD groups according to the mentioned criterion it was noticed that the changes of tumor diameters on T2 images had significant difference between the SD and PR groups (P = 0.007 for longest diameter; P = 0.045 for shortest diameter) (). The pretherapy ADC value had no significant difference between the PR group and SD group (P = 0.517) (). The change of ADC value was statistically significantly higher in PR group compared with that in SD group ( ). The logistic regression model and receiver operator characteristic curve analysis showed that combination of the change of longest diameter and ADC value had a higher area under curve than any other parameter alone for evaluating treatment response in lung cancer (P < 0.01 ). When we used the change of ADC value for differentiating the PR lesion from the SD lesion the best cutoff value was 0.41 — 10?3?mm2/s the overall sensitivity specificity positive predictive value and negative predictive value were 100%0.64710.5714 and 100% respectively and the area under the receiver operator characteristic curve was 0.827. 4. Discussion The chemotherapy response was usually observed after 2 cycles of chemotherapy according to tumor size change by radiographies CT or standard MR rarely by functional imaging dynamic or diffusion weighted MR imaging or PET-CT for example [3621 24]. This study investigated whether the change of ADC value and diameters after chemotherapy could be used to evaluate early treatment response in lung cancer. The ADC value had significant increase after 1 cycle of chemotherapy compared with baseline especially in the PR group (). This result was in agreement with the results of previous studies of both lung cancer and other cancers [17 24“27]. However the current result contradicted with the result of rectal cancer research on the decrease trend of ADC values 2“4 weeks after chemotherapy. Chemotherapy-induced fibrosis might be a contributor to decrease of ADC value [28]. The difference was probably caused by disparity in fibrosis appearance and progression. The increase of ADC value was related to necrosis and reduced cell density histologically [29] while the decrease of ADC value was relevant to cytotoxic edema and fibrosis on histology [28]. From the current results the changes of ADC value were significant between the PR and SD groups () which was in agreement with the previous DWI study of lung cancer treatment response evaluation after chemotherapy [24 26] even when a different b value was used in the previous study [27]. Therefore the noninvasive DWI could be potentially used to early predict and monitor lung cancer response to chemotherapy (). This study further demonstrated that the combination of longest diameter and ADC value change had a higher diagnostic ability than any other parameter alone for evaluating treatment response in lung cancer (P < 0.01 ). The receiver operator characteristic curve showed that the combination of longest diameter change and ADC value change adds additional value for a single parameter alone to predict treatment response. The cutoff value of ADC change could predict response to chemotherapy in lung cancer with 100% sensitivity 64.71% specificity 57.14% positive predictive value 100% negative predictive value and 82.7% accuracy. Comparing with CT the MR imaging had two benefits to evaluate tumor response: first the DWI had the potential to evaluate early treatment response from the tumor inner structure change before the morphological change; second by combining the change of ADC value and tumor diameter the treatment response could be predicted with a high sensitivity and moderate specificity by using MR imaging only. For the small cell lung cancer the tumor diameter change may be significant even in the early stage of chemotherapy. But for the less sensitive non-small cell lung cancer especially on target therapy there may not be apparent anatomical changes initially even if the chemotherapeutic regime was appropriate [29]. Therefore tumor size evaluation alone had a smaller area under the curve than the combination of functional and anatomical assessment. The change of ADC value might have the potential to monitor and early predict lung cancer treatment response to chemotherapy. Furthermore the diagnostic ability increased when combined with the change of ADC value and longest diameter. In our study MR images at baseline and the end of 1 cycle of chemotherapy not only showed the tumor volume change on T2-weighted images but also provided the change of ADC value on DWI. Even through MR imaging could not be regarded as the most appropriate and a œone stop examination method to predict treatment response; it indeed provided precious information to CT. There were several limitations of this study. Firstly the sample number in our study was relatively small especially the pathological subtypes. Secondly the tumor volume pathologic types and chemotherapy regimens were nonuniform which may affect the treatment response of tumor. At last the interval between the start of chemotherapy and treatment response evaluation by DWI was relatively long. One week interval may make the advantage of ADC value change prominent. 5. Conclusions Our data suggested that the change of ADC value may be a sensitive indicator to predict early response to chemotherapy in lung cancer. Prediction ability could be improved by combining the change of ADC value and longest diameter. Acknowledgments The authors thank Rongchao Zhou for collecting part of patients. They appreciate the statistical suggestion from Ningnannan Zhang. This study was supported by Tianjin Medical University Graduate Innovation Fund. Conflict of Interests The authors declared that there was no conflict of interests regarding the publication of this paper. 1 Patz EF Jr. Pinsky P Gatsonis C Overdiagnosis in low-dose computed tomography screening for lung cancer JAMA Internal Medicine 2013 2013 6 pages 12738 2 Smith SM Campbell NC MacLeod U Factors contributing to the time taken to consult with symptoms of lung cancer: a cross-sectional study Thorax 2009 64 6 523 531 2-s2.0-67249109028 19052045 3 Gazala S Pelletier JS Storie D Johnson JA Kutsogiannis DJ Bedard EL A systematic review and meta-analysis to assess patient-peported putcomes after lung cancer surgery Scientific World Journal 2013 2013 789625 4 Sokucu SN Kocaturk C Urer N Evaluation of six patients with pulmonary carcinosarcoma with a literature review Scientific World Journal 2012 2012 167317 5 Pignon J-P Tribodet H Scagliotti GV Lung adjuvant cisplatin evaluation: a pooled analysis by the LACE collaborative group Journal of Clinical Oncology"

Lung_Cancer

"Then we need to calculate a tail probability for a heterogeneous Bernoulli process. For the calculation for gene sets with coordinate down-regulated differential expression we need to focus on the combination of different components with (j1 = 2 j2 = 2 . . . jK = 2). Then we need to change the formulas for uSi and CESS as follows: False discovery rate The concordant enrichment score given in Equation (2) is an estimated conditional probability of concordant enrichment which can be considered as the true positive probability for the gene set S. This conditional probability is closely related to the concept of false discovery rate (FDR). FDR has been widely used to evaluate the proportion of false positives among the claimed positives [6 23]. According to the discussion by McLachlan et al. [14] among the J top gene sets {S1 S2 . . . SJ} claimed significantly concordantly enriched the false discovery rate can be estimated as:3 Computational approximation Although we have derived the formula for concordant enrichment score (CES) it is usually difficult to compute it in practice: the number of possible component combinations from different genes in a given gene set is usually huge. Based on our observation most gene sets contain more than 20 genes. Since different genes have different probabilities of being concordantly up-regulated and/or down-regulated differentially expressed we cannot further simplify the formula (we need to calculate a tail probability for a heterogeneous Bernoulli process). However we can consider a simulation based approach to the approximation of CES given in Equation (2). Monte Carlo approximation Recall that the probability of event of interest uSi can be calculated for a gene XSi in a given gene set S = {XSi i = 12 . . . mS}. The simulation scheme is based on a heterogeneous Bernoulli process: For each XSi simulate a Bernoulli random variable with probability of event uSi; For the gene set S count the number R of events from different genes; Repeat the above two steps B times and report the approximated enrichment score as {number of . One related question is how large B should be set in the simulation. As we have discussed above the concordant enrichment score (CES) is closely related to the false discovery rate (FDR). Then it is reasonable to require its accuracy around the 1% level for the 95% CES level (e.g. a 95% normally approximated binomial confidence interval 0.95 ± 0.01) and B = 2000 is adequate. Therefore the Monte Carlo approximation is a feasible approach in practice. (In general if we do not have a specific CES level we can simply use an upper bound B = 10000 calculated based on the 95% normally approximated binomial confidence interval. Then the related computing burden is still practically feasible.) Results and discussion Application #1: an integrative analysis of two data sets To illustrate our method we first considered two microarray gene expression data sets collected for lung cancer studies [24 25]. The first one was collected by a research group in Boston (referred to as Boston data) and the second one was collected by a research group in Michigan (referred to as Michigan data). For an application of their Gene Set Enrichment Analysis (GSEA) method Subramanian Tamayo et al. [8] reanized these two data sets which were made freely available at http://www.broadinstitute./gsea. There were 62 and 86 patients for the Boston and Michigan data sets respectively. These patients were classified as either ""good"" or ""poor"" outcomes. Expression profiles were available for 5216 genes that were common for both data sets. To compare our analysis results with the results reported by Subramanian Tamayo et al. [8] we used an early version of gene set collection that was used by them [8]. "

Lung_Cancer