input
stringlengths 600
32.7k
| label
stringclasses 3
values |
|---|---|
"Regression analysis was performed to test the association of gene expression with methylation levels in the CHRNA5 gene and with methylation levels in PABPC4 STARD3 and SLC35A3 genes. We tested the association between lung cancer GWAS risk SNPs and gene expression using regression analysis under an additive model adjusting for age sex and PCA scores based on genome-wide SNPs. Testing for enrichment of cis-meQTLs in lung cancer GWAS We tested for enrichment in NCI lung cancer GWAS of European ancestry which included three main histologic subtypes of lung cancer (adenocarcinoma (AD) squamous cell carcinoma (SQ) small cell carcinoma (SC)) and a small number of other lung cancer subtypes. We investigated whether the identified cis-meQTL SNPs were collectively associated with lung cancer risk which was tested by examining whether the GWAS P-values for these SNPs deviated from the uniform distribution (i.e. no enrichment). Because the high linkage disequilibrium (LD) in SNPs increased variability of the enrichment statistic and caused a loss of power we first performed LD-pruning using PLINK so that no pair of remaining SNPs had a r2 ?0.8. The enrichment significance was evaluated by 10000 random permutations. The genomic control ?-values61 based on genome-wide SNPs were 1.010.995 0.977 and 1.00 for overall lung cancer AD SC and SQ respectively. Thus the type-I error rates of our enrichment tests were not inflated. The detailed procedure for testing a set of cis-meQTL SNPs is described as follows: Firstly we performed LD-pruning using PLINK so that no pair of remaining SNPs had an r2 ?0.8. Secondly we tested the association for the LD-pruned SNPs (assuming K SNPs left) in a GWAS and computed the P-values (p1?pK). We then tested whether (p1?pK) followed a uniform distribution i.e. no enrichment. Thirdly we transformed P-values into ?12 quantitles qk = F?1(1 ? pk) with F(·) being the cumulative distribution function (CDF) of ?12. We defined a statistic for testing enrichment as Q=?k=1Klog(1?f+fexp(qk/2))3562 where f is a pre-specified constant reflecting the expected proportion of SNPs associated with the disease. Because only a small proportion of SNPs may be associated with the disease we set f=0.05 for this paper. The statistical power was insensitive to the choice of f in the range of [0.01 0.1]62. Finally the significance of the test Q was evaluated by 10000 random permutations. meQTL mediation analysis We investigated whether trans associations were mediated by the methylation levels of CpG probes nearby the trans-acting SNPs. Note that this analysis was only for trans associations with cis effects i.e. the SNP was associated with at least one proximal CpG probes with p<410?5. See Fig. 2c. Suppose a SNP G cis-regulates K proximal (<500kb) CpG sites A1?AK with P<410?5 and trans-regulates a distal CpG site B. We performed a linear regression: B~?+?G +?kAk. We also computed marginal correlation coefficient cor(GB) and partial correlation coefficient cor(GB|Ak) using an R package ppcor63. A full mediation was detected if G and B were not significantly correlated after conditioning on Ak or equivalently G was not significant (p>0.01) in regression analysis B~?+?G +?kAk for any k. A partial mediation was detected if any Ak had a P<0.05/K (Bonferroni correction) in the regression analysis and |cor(GB)|?| cor(GB|A) |>0.1. An independent effect model (i.e. no mediation) was detected otherwise. Testing enrichment of meQTL SNPs in regulatory regions We obtained peak data for CTCF DNaseI H3K27me3 H3K4me3 and H3K36me of small airway epithelial cells (SAEC) from the ENCODE project and for H3K27me3 H3K4me3 and H3K9-14Ac from human alveolar epithelial cells (hAEC) from our own laboratory. A SNP is determined to be functionally related to a given mark or CTCF binding site if the SNP or any of its LD SNPs (r2 ?0.8 with LD computed using the genotype data of European population in The 1000 Genome Project) resided in any of the mark regions or CTCF binding sites. We explain our enrichment testing using CTCF as an example. We classified genome-wide SNPs into four categories: SNPs not associated with CpG probes in trans or cis (defined as control SNP set) SNPs only associated with proximal CpG probes via cis-regulation (cis-only21119 SNPs) SNPs only associated with distal CpG probes via trans-regulation (trans-only 192 SNPs) and SNPs detected with both trans and cis effects (cis+trans 277 SNPs). For SNPs in the category of cis-only trans-only and cis+trans we computed the proportion of SNPs functionally related to CTCF. To compute the enrichment of cis-meQTLs in CTCF binding sites we defined a control set of SNPs that are not associated with CpG probes via cis- or trans regulation. The selection of the control set was further complicated by the following two observations. (1) cis-meQTL SNPs tended to be more common (data now shown). (2) The probability of a SNP detected as a cis-meQTL SNP positively depended on the density of the CpG probes in the nearby region. Choosing a control set while ignoring these two factors could underestimate the proportion of functionally related SNPs in the control set and thus overestimate the enrichment for cis-meQTLs. Therefore we created 1000 sets of control SNPs with CpG probe density (measured as the number of CpG probes in the cis region of each SNP) and MAF matched with the meQTL SNP set and then averaged the proportions on the 1000 sets. The enrichment was calculated as the fold change with the proportion in the control SNP set as baseline. Next we investigated whether the enrichment was stronger for SNPs more significantly associated with CpG sites. Because we detected only a few hundred trans-meQTLs we focused this analysis on the set of cis-meQTLs. We classified cis-meQTL SNPs into five categories according to the cis-association P-values: P >10?7 (the weakest) 10?10< P ?10?7 10?15 < P ? 10?10 10?20 < P ? 10?15 and P ? 10?20 (the strongest). For each category we computed the proportion of SNPs functionally related to CTCF binding sites. meQTL SNPs affect CTCF binding We found that meQTL SNPs are strongly enriched in CTCF consensus sequences. We used SAEC data from ENCODE to test whether meQTL heterozygous SNPs directly affect CTCF binding by disrupting the CTCF recognition sites. P-values were calculated based on a binomial distribution Binom(N 0.5). Here N is the total number reads covering the SNPs. Raw sequencing data (.fasstq format) from SAEC cells were generated at the University of Washington as part of the ENCODE project and downloaded from the UCSC genome browser. Raw data was aligned to the hg19 genome using CLC genomics workbench (v 5.5.1) parsing out data with less than 80% contiguous alignment to the genome and duplicate reads in excess of 10 copies. We used the CTCFBSDB 2.0 program64 to predict whether the meQTL SNPs or their LD SNPs (r2 ? 0.8) were within CTCF peaks and then examined in SAEC whether CTCF exhibited allele-specific binding. Because common SNPs are more likely to be heterozygous we only looked for SNPs with MAF ?0.4. Here we present two such examples. Systematic investigation of all meQTL SNPs that are heterozygous in SAEC is warranted once more samples with genotypic data are available. Supplementary Material 1 Acknowledgements This study utilized the high-performance computational capabilities of the Biowulf Linux cluster at the NIH Bethesda MD (http://biowulf.nih.gov). We are grateful to the EAGLE participants and the large number of EAGLE collaborators (listed in http://dceg.cancer.gov/eagle) The Cancer Genome Atlas project for the genotype and methylation data and the ENCODE project for the regulatory region data. This work was supported by the Intramural Research Program of NIH NCI Division of Cancer Epidemiology and Genetics and in part by the Norris Comprehensive Cancer Center core grant (P30CA014089) from NCI the Trandisciplinary Research in Cancer of the Lung (TRICL) and the Genetic Associations and Mechanisms in Oncology (GAME-ON) Network (U19CA148127). AW ZW WZ and AH were also funded by the NCI NIH (HSN261200800001E). IALO and ZB were also funded by NIH grants (1 R01 HL114094 1 P30 H101258 and R37HL062569-13) Whittier Foundation and Hastings Foundation. ZB was also funded by the Ralph Edgington Chair in Medicine. CNM was funded by ACS/Canary postdoctoral fellowship (FTED-10-207-01-SIED). Author contributions M.T.L conceived the study. I.A.L.O. supervised DNA methylome analysis. J.S. performed EAGLE TCGA and ENCODE genetic analyses. C.M. performed allele-specific binding analyses. J.D. contributed to genetic analyses and performed GO analyses. J.S. P.L. I.A.L.O. and M.T.L. performed quality control analyses. A.C.P D.C. P.A.B A.W.B N.E.C. and M.T.L. conducted the EAGLE study and provided tissue samples. AW and AH prepared the tissue samples for the analyses. BZ and ZB isolated and cultured alveolar epithelial cells. T.T. and K.D.S. performed methylation normalization. Z.W. and W.W. performed LD analyses. J.S. C.M. J.D. P.L.H. M.C. D.S.L J.H. P-H.C B.S.I.C.W.Z. L.A. M.F. B.P.B. N.C M.A.T. S.J. C. I.A.L.O. M.T.L. contributed to the data interpretation. J.S. and M.T.L. wrote the manuscript. All authors participated in the discussion and reviewed the manuscript. Supplementary Information accompanies this paper at tttp://www.nature.com/Naturecommunications. " | Lung_Cancer |
" nonsmall-cell lung cancer Clin Lung Cancer 10 252 256 19632943 Patel JD Hensing TA Rademaker A Hart EM Blum MG Milton DT Bonomi PD 2009 Phase II study of pemetrexed and carboplatin plus bevacizumab with maintenance pemetrexed and bevacizumab as first-line therapy for nonsquamous nonsmall-cell lung cancer J Clin Oncol 27 3284 3289 19433684 Ramlau R Gorbunova V Ciuleanu TE Novello S Ozguroglu M Goksel T Baldotto C Bennouna J Shepherd FA Le-Guennec S Rey A Miller VA Thatcher N Scagliotti GV 2012 Aflibercept and docetaxel versus docetaxel alone after platinum failure in patients with advanced or metastatic non-small-cell lung cancer: a randomized controlled phase III trial J Clin Oncol 30 3640 3647 22965962 Reck M von Pawel J Zatloukal P Ramlau R Gorbounova V Hirsh V Leighl N Mezger J Archer V Moore N Manegold C 2009 Phase III trial of cisplatin plus gemcitabine with either placebo or bevacizumab as first-line therapy for nonsquamous non-small-cell lung cancer: AVAiL J Clin Oncol 27 1227 1234 19188680 Riess JW Logan AC Krupitskaya Y Padda S Clement-Duchene C Ganjoo K Colevas AD Pedro-Salcedo MS Kuo CJ Wakelee HA 2012 Maintenance bevacizumab is associated with increased hemoglobin in patients with advanced nonsquamous non-small cell lung cancer Cancer Invest 30 231 235 22360362 Sandler AB Gray R Perry MC Brahmer J Schiller JH Dowlati A Lilenbaum R Johnson DH 2006 Paclitaxel-carboplatin alone or with bevacizumab for non-small-cell lung cancer N Engl J Med 355 2542 2550 17167137 Scagliotti GV Parikh P von Pawel J Biesma B Vansteenkiste J Manegold C Serwatowski P Gatzemeier U Digumarti R Zukin M Lee JS Mellemgaard A Park K Patil S Rolski J Goksel T de Marinis F Simms L Sugarman KP Gandara D 2008 Phase III study comparing cisplatin plus gemcitabine with cisplatin plus pemetrexed in chemotherapy-naive patients with advanced-stage non-small-cell lung cancer J Clin Oncol 26 3543 3551 18506025 Schiller JH Harrington DP Belani CP Langer CJ Sandler AB Krook JE Zhu J Johnson DH the Eastern Cooperative Oncology Group 2002 Comparison of four chemotherapy regimens for advanced non-small-cell lung cancer N Engl J Med 346 92 98 11784875 Sher A Wu S 2011 Anti-vascular endothelial growth factor antibody bevacizumab reduced the risk of anemia associated with chemotherapyA meta-analysis Acta Oncol 50 997 1005 21554028 Sitohy B Nagy JA Jaminet S-CS Dvorak HF 2011 Tumor-surrogate blood vessel subtypes exhibit differential susceptibility to anti-VEGF therapy Cancer Res 71 7021 7028 21937680 Tam BYY Wei K Rudge JS Hoffman J Holash J Park S Yuan J Hefner C Chartier C Lee J-S Jiang S Nayak NR Kuypers FA Ma L Sundram U Wu G Garcia JA Schrier SL Maher JJ Johnson RS Yancopoulos GD Mulligan RC Kuo CJ 2006 VEGF modulates erythropoiesis through regulation of adult hepatic erythropoietin synthesis Nat Med 12 793 800 16799557 Tew WP Gordon M Murren J Dupont J Pezzulli S Aghajanian C Sabbatini P Mendelson D Schwartz L Gettinger S Psyrri A Cedarbaum JM Spriggs DR 2010 Phase 1 study of aflibercept administered subcutaneously to patients with advanced solid tumors Clin Cancer Res 16 358 366 20028764 Therasse P Arbuck SG Eisenhauer EA Wanders J Kaplan RS Rubinstein L Verweij J Van Glabbeke M van Oosterom AT Christian MC Gwyther SG 2000 New guidelines to evaluate the response to treatment in solid tumors (RECIST Guidelines) J Natl Cancer Inst 92 205 216 10655437 Van Cutsem E Tabernero J Lakomy R Prenen H Prausova J Macarulla T Ruff P van Hazel GA Moiseyenko V Ferry D McKendrick J Polikoff J Tellier A Castan R Allegra C 2012 Addition of aflibercept to fluorouracil leucovorin and irinotecan improves survival in a phase III randomized trial in patients with metastatic colorectal cancer previously treated with an oxaliplatin-based regimen J Clin Oncol 30 3499 3506 22949147 Vaughn C Zhang L Schiff D 2008 Reversible posterior leukoencephalopathy syndrome in cancer Curr Oncol Rep 10 86 91 18366965 (A) The KaplanMeier curve of PFS (N=38). Median PFS: 5 months (95% CI 4.37.1). (B) Brain MRI of a patient diagnosed with RPLS. Extensive increased T2 signal of a few scattered areas of restricted diffusion and vasogenic oedema in the frontal cortex/subcortical regions near the vertex and the parietal and occipital regions bilaterally (arrows). No focal enhancing lesions to suggest metastatic disease. Baseline demographics (N=42) Age (years) Median 61.5 Range (years) 3877 Age (years) by category N (%) <65 23 (54.8) ?65 19 (45.2) Gender N (%) Male 23 (54.8) Female 19 (45.2) Race N (%) African American 2 (4.8) Asian American 4 (9.5) Caucasian American 36 (85.7) ECOG performance status N (%) 0 21 (50.0) 1 21 (50.0) Abbreviation: ECOG=Eastern Cooperative Oncology Group. Summary of most common (>10%) TEAEs by NCI CTCAE grade (N=42) All grades N (%) Grade 3/4 N (%) Number of patients with most common TEAE with NCI grade 40 (95.2) 27 (64.3) Nausea 29 (69.0) 0 Fatigue 28 (66.7) 3 (7.1) Hypertension 24 (57.1) 15 (35.7) Constipation 21 (50.0) 0 Diarrhoea 16 (38.1) 1 (2.4) Dysgeusia 15 (35.7) 0 Stomatitis 15 (35.7) 0 Dysphonia 14 (33.3) 0 Headache 14 (33.3) 1 (2.4) Proteinuria 14 (33.3) 1 (2.4) Anorexia 13 (31.0) 0 Dehydration 12 (28.6) 3 (7.1) Dyspepsia 12 (28.6) 0 Epistaxis 11 (26.2) 0 Vomiting 10 (23.8) 0 Weight loss 10 (23.8) 0 Blood creatinine increased 8 (19.0) 0 Cough 8 (19.0) 0 Dyspnoea 7 (16.7) 1 (2.4) Hyponatraemia 7 (16.7) 2 (4.8) Neutropaenia 7 (16.7) 6 (14.3) Thrombocytopaenia 7 (16.7) 3 (7.1) Dizziness 6 (14.3) 0 Hyperglycaemia 6 (14.3) 1 (2.4) Hypokalaemia 6 (14.3) 4 (9.5) Hypomagnesaemia 6 (14.3) 0 Insomnia 6 (14.3) 0 Rhinorrhaea 6 (14.3) 0 Anaemia 5 (11.9) 2 (4.8) Dry mouth 5 (11.9) 0 Hiccups 5 (11.9) 0 Hyperkalaemia 5 (11.9) 2 (4.8) Hypocalcaemia 5 (11.9) 1 (2.4) Musculoskeletal pain 5 (11.9) 0 Oedema peripheral 5 (11.9) 0 Pain in extremity 5 (11.9) 0 Pneumonia 5 (11.9) 2 (4.8) Abbreviations: CTCAE=Common Terminology Criteria for Adverse Events; TEAE=treatment-emergent adverse events. Mean (s.d.) observed noncompartmental pharmacokinetic parameters for free ziv-aflibercept Ziv-aflibercept Parameter N Mean s.d. t 1/2 Day 7 4.62 1.46 CL l per day per kg 7 0.016 0.004 V ss l?kg?1 7 0.081 0.015 C max mg?l?1 21 104 26.2 C last mg?l?1 21 65.2 50.8 t max Day 21 0.0695 0.019 t last Day 21 7.02 9.32 AUCinf Day mg?l?1 7 402 100 MRTinf Day 7 5.35 1.28 Abbreviations: AUCinf=area under the concentration curve from time zero extrapolated to infinity; CL=clearance; Clast=last positive plasma concentration; Cmax=maximal plasma concentration; MRTinf=mean residence time extrapolated to infinity; tlast=time of the last positive plasma concentration; tmax=time required to reach maximal plasma concentration; t1/2=observed half-life; Vss=volume of distribution at steady state. PLoS One one 1932-6203 Public Library of Science San Francisco USA 24505377 3913724 PONE-D-13-49110 .0088064 Research Biology Molecular Cell Biology Signal Transduction Signaling in Selected Disciplines Oncogenic Signaling Medicine Oncology Basic Cancer Research Immune Evasion Metastasis Oxidative Damage Tumor Physiology Cancer Prevention Cancer Vaccines Cancer Treatment Gene Therapy Cancers and Neoplasms Lung and Intrathoracic Tumors Impact of p120-catenin Isoforms 1A and 3A on Epithelial Mesenchymal Transition of Lung Cancer Cells Expressing E-cadherin in Different Subcellular Locations Effect of p120ctn Isoforms on EMT of Lung Cancer Zhang Yijun 1 Zhao Yue 1 Jiang Guiyang 1 Zhang Xiupeng 1 Zhao Huanyu 1 Wu Junhua 1 Xu Ke 2 Wang Enhua 1 * 1 Department of Pathology First Affiliated Hospital and College of Basic Medical Sciences China Medical University Shenyang China 2 Department of Radiology First Affiliated Hospital of China Medical University Shenyang China Andr Frdric Editor Aix-Marseille University France * E-mail: wangehhotmail.com Competing Interests: The authors have declared that no competing interests exist. Conceived and designed the experiments: YJZ GYJ EHW. Performed the experiments: YJZ XPZ JHW. Analyzed the data: YJZ HYZ YZ. Contributed reagents/materials/analysis tools: YJZ YZ KX. Wrote the paper: YJZ KX EHW. 2014 4 2 2014 9 2 e88064 21 11 2013 6 1 2014 2014 Zhang et al This is an open-access distributed under the terms of the Creative Commons Attribution License which permits unrestricted use distribution and reproduction in any medium provided the original author and source are credited. The epithelial mesenchymal transition (EMT) is an important process in tumor development." | Lung_Cancer |
"Biochemistry Biomarkers Medicine and Health Sciences Diagnostic Medicine Gastroenterology and Hepatology Gastrointestinal Cancers Oncology Basic Cancer Research Metastasis Cancers and Neoplasms Carcinomas Adenocarcinomas Colon Adenocarcinoma Gastrointestinal Tumors Pathology and Laboratory Medicine Anatomical Pathology Surgical Pathology Molecular Pathology The Clinical Implication of Cancer-Associated Microvasculature and Fibroblast in Advanced Colorectal Cancer Patients with Synchronous or Metachronous Metastases Cancer-Associated Microenvironment in Advanced Colorectal Cancer Kwak Yoonjin 1 2 Lee Hee Eun 1 Kim Woo Ho 1 2 Kim Duck-Woo 3 Kang Sung-Bum 3 Lee Hye Seung 4 * 1 Department of Pathology Seoul National University Hospital Seoul South Korea 2 Department of Pathology Seoul National University College of Medicine Seoul South Korea 3 Department of Surgery Seoul National University Bundang Hospital Seongnam-si Gyeonggi-do South Korea 4 Department of Pathology Seoul National University Bundang Hospital Seongnam-si Gyeonggi-do South Korea Lo Anthony W. I. Editor The Chinese University of Hong Kong Hong Kong * E-mail: hye2snu.ac.kr. Competing Interests: The authors have declared that no competing interests exist. Conceived and designed the experiments: HEL WHK HSL. Performed the experiments: HEL WHK HSL. Analyzed the data: YK HEL HSL. Contributed reagents/materials/analysis tools: HEL WHK DWK SBK HSL. Wrote the paper: YK HEL WHK DWK SBK HSL. 2014 18 3 2014 9 3 e91811 11 1 2014 14 2 2014 2014 Kwak et al This is an open-access distributed under the terms of the Creative Commons Attribution License which permits unrestricted use distribution and reproduction in any medium provided the original author and source are credited. Background We aimed to evaluate the clinical significance of microvessel density (MVD) lymphatic vessel density (LVD) and cancer-associated fibroblasts (CAFs) in relation to tumor location in advanced colorectal cancer (CRC). Methods Using immunohistochemistry we examined 181 advanced CRC patients for CD31 and D2-40 to measure MVD and LVD respectively ?-smooth muscle actin (SMA) and desmin to identify CAFs and PTEN to examine genetic changes of CAFs. To evaluate the regional heterogeneity of these properties we examined tissue from four sites (the center and periphery of the primary cancer a distant metastasis and a lymph node metastasis) in each patient. Results MVD LVD and CAFs showed significant heterogeneity with respect to the tumor location. LVD was the greatest in the center of the primary cancers and the amount of CAFs was the lowest in distant metastases. In distant metastases those from the lung had higher LVD and MVD but fewer CAFs than those from the liver peritoneum or ovary. Patients with low MVD and LVD in the center of the primary cancer had worse outcomes and patients with few CAFs in distant metastases and in the primary tumor had a lower survival rate. PTEN expression in CAFs in distant metastases was lost in 11 of 181 CRC patients (6.1%) which was associated with a worse prognosis. Conclusions The microenvironment including cancer-associated microvasculature and fibroblasts is heterogeneous with respect to the tumor location in CRC patients. Therefore heterogeneity of microenvironments should be taken into account when managing CRC patients. This study was supported by grant number 03-2011-012 from the Seoul National University Bundang Hospital Research Fund. The funder had no role in study design data collection and analysis decision to publish or preparation of the manuscript. Introduction Although the mortality rates of colorectal cancer (CRC) patients have decreased in most western countries and in several developing countries in Asia advanced CRC patients who initially present with stage IV disease or those who develop distant metastases several months after diagnosis still have a lower five-year survival rate [1] [2]._ENREF_4 Recently the range of systemic chemotherapy has expanded and targeted therapy including epidermal growth factor receptor (EGFR) and vascular endothelial growth factor (VEGF) inhibitor therapies have been used in advanced CRC patients increasing patient survival [3]. However some CRC patients respond poorly to targeted therapy despite presenting positive results in targeted therapy-specific mutation studies [4]. One possible explanation for this therapeutic failure is tumor heterogeneity; several studies have reported that CRCs possess a heterogenic genotype or phenotype including KRAS p53 and BRAF [5][7]. Therefore the differing characteristics of the primary tumor site and the corresponding metastatic an need to be clarified to improve the management of CRC patients with metastatic diseases. Furthermore understanding the clinicopathological characteristics of advanced CRC is important for the development and improvement of systemic therapies. Since Paget et al. first described the cancer microenvironment by the seed and soil theory [8] there has been growing evidence that cancer-associated stroma might affect the cancer cells themselves and contribute to cancer progression [9]. The main components of the cancer microenvironment are microvasculature (microvessels and lymphatic vessels) inflammatory cells and cancer-associated fibroblasts (CAFs) [10][12]. The current method of verifying angiogenetic and lymphangiogenetic activity in cancer tissue is to assess microvessel density (MVD) and lymphatic vessel density (LVD) respectively. MVD has been proposed as a surrogate marker of cancer-associated angiogenesis to identify patients with a high risk of recurrence or those with poor prognoses for various cancers including CRC [13] [14]; however the prognostic correlation of angiogenesis in CRC is still controversial [15] [16]. Similar to angiogenesis LVD has received interest as a means of lymphatic metastasis and survival [17] [18] but its role in tumor progression is still unclear [19]. The other prominent component of stroma CAFs are consistently activated and affect many aspects of tumor initiation invasion and progression [9]. While some studies have suggested that CAFs may inhibit tumor progression [20] [21] other studies have proposed that CAFs may promote progression in prostate breast and skin cancers [22][24]. In the context of CRC Tsujino et al. have suggested that ?-smooth muscle actin (SMA)-expressing CAFs might be a useful indicator of poor prognosis. However these results were restricted to stage II and III CRCs [25]. In addition to cancer cells genetic alterations in CAFs have demonstrated including the loss of heterozygosity microsatellite instability and genetic mutations [26] [27]. Recently genetic inactivation of PTEN in CAFs was reported in breast cancer patients [28]. Trimboli et al. identified that PTEN loss in stromal fibroblasts resulted in extensive extracellular matrix remodeling and angiogenesis which characteristic of tumor progression [28]. However expression loss of PTEN and its clinical significance have not been investigated in colorectal cancer patients. The aim of this study was to investigate the characteristics of microenvironments including microvasculatures and CAFs in advanced CRC patients. Additionally we assessed the intratumoral heterogeneity in the primary tumor and the discordance between primary tumor and distant metastasis microenvironments. " | Lung_Cancer |
" Apoptosis of NSCLC A549 cells after ionizing radiation (IR). Apoptosis in anti-miR-21- (or anti-miR-NC-) transfected A549 cells combined with (or without) IR (8.0?Gy) was detected through annexin V-FITC/PI staining by flow cytometric analysis. The data represent the means ± SD of three separate experiments. Student's t-test was used to analyze the statistics (*P < 0.05). Suppression of ionizing radiation-induced phosphorylated-Akt (p-Akt) upregulation by anti-miR-21 in NSCLC A549 cells. The expression level of the phosphorylated or total Akt in A549 cells transfected with anti-miR-21 or anti-miR-NC for 48?h followed by ionizing radiation (8?Gy) with or without 10?ng/mL PI3K constituent activator IGF-1 was measured by Western blot. Representative of three independent experiments was shown. Knockdown of miR-21 promoted NSCLC A549 cells apoptosis via inactivation of PI3K-Akt pathway. Apoptosis induced by 8?Gy ionizing radiation in anti-miR-21- (or anti-miR-NC-) transfected A549 cells combined with (or without) PI3K activator IGF-1 treatment (10?ng/mL) was detected through annexin V-FITC/PI staining by flow cytometric analysis. The data represent the means ± SD of three separate experiments. Student's t-test was used to analyze the statistics (*P < 0.05). 1306016 3069 Clin Radiol Clin Radiol Clinical radiology 0009-9260 1365-229X 24857677 4105980 10.1016/j.crad.2014.03.020 NIHMS587373 Revisiting the relationship between tumour volume and diameter in advanced NSCLC patients: An exercise to maximize the utility of each measure to assess response to therapy Nishino M. a * Jackman D.M. b DiPiro P.J. a Hatabu H. a Jnne P.A. b Johnson B.E. b aDepartment of Radiology Dana-Farber Cancer Institute and Brigham and Womens Hospital 450 Brookline Ave. 75 Francis St. Boston MA 02215 USA bDepartment of Medical Oncology and Department of Medicine Dana-Farber Cancer Institute and Brigham and Womens Hospital 450 Brookline Ave. Boston MA 02215 USA *Guarantor and correspondent: M. Nishino Department of Radiology Dana-Farber Cancer Institute and Brigham and Womens Hospital 450 Brookline Ave. Boston MA 02215 USA. Tel.: +1 617 582 7163; fax: +1 617 582 8574. Mizuki_Nishinodfci.harvard.edu (M. Nishino) 30 5 2014 22 5 2014 8 2014 01 8 2015 69 8 841 848 2014 The Royal College of Radiologists. Published by Elsevier Ltd. All rights reserved. 2014 AIM To revisit the presumed relationship between tumour diameter and volume in advanced non-small-cell lung cancer (NSCLC) patients and determine whether the measured volume using volume-analysis software and its proportional changes during therapy matches with the calculated volume obtained from the presumed relationship and results in concordant response assessment. MATERIALS AND METHODS Twenty-three patients with stage IIIB/IV NSCLC with a total of 53 measurable lung lesions treated in a phase II trial of erlotinib were studied with institutional review board approval. Tumour volume and diameter were measured at baseline and at the first follow-up computed tomography (CT) examination using volume-analysis software. Using the measured diameter (2r) and the equation calculated volume was obtained as (4/3) ?r3 at baseline and at the follow-up. Percent volume change was obtained by comparing to baseline for measured and calculated volumes and response assessment was assigned. RESULTS The measured volume was significantly smaller than the calculated volume at baseline (median 11488.9 mm3 versus 17148.6 mm3; p < 0.0001) with a concordance correlation coefficient (CCC) of 0.7022. At follow-up the measured volume was once again significantly smaller than the calculated volume (median 6573.5 mm3 versus 9198.1 mm3; p = 0.0022) with a CCC of 0.7408. Response assessment by calculated versus measured volume changes had only moderate agreement (weighted ? = 0.545) with discordant assessment results in 20% (8/40) of lesions. Calculated volume based on the presumed relationship significantly differed from the measured volume in advanced NSCLC patients with only moderate concordance in response assessment indicating the limitations of presumed relationship. CMAJ CMAJ 9711805 CMAJ : Canadian Medical Association Journal 0820-3946 1488-2329 Canadian Medical Association 24638027 4016095 10.1503/cmaj.131385 186e296 Practice Five Things to Know About... Screening for lung cancer Kennedy Sean Baerlocher Mark Otto MD School of Medicine (Kennedy) McMaster University Hamilton Ont.; Department of Radiology (Baerlocher) Royal Victoria Hospital Barrie Ont. Correspondence to: Sean Kennedy sean.kennedymedportal.ca 13 5 2014 13 5 2015 186 8 E296 E296 1995-2014 Canadian Medical Association 2014 0042124 4284 Int J Cancer Int. J. Cancer International journal of cancer. Journal international du cancer 0020-7136 1097-0215 24806617 4200482 10.1002/ijc.28958 NIHMS594253 p38 MAPK inhibits breast cancer metastasis through regulation of stromal expansion Hong Bangxing 1 Li Haiyan 1 Zhang Mingjun 1 Xu Jingda 2 Lu Yong 1 Zheng Yuhuan 1 Qian Jianfei 1 Chang Jeffrey T 3 Yang Jing 2 Yi Qing 1 1Department of Cancer Biology Lerner Research Institute Cleveland Clinic Cleveland OH USA 2Department of Lymphoma and Myeloma University of Texas MD Anderson Cancer Center Houston TX USA 3Department of Integrative Biology & Pharmacology University of Texas at Houston Houston TX USA Corresponding author: Qing Yi MD PhD Department of Cancer Biology Cleveland Clinic Lerner Research Institute 9500 Euclid Avenue/NB40 Cleveland OH 44195 USA. Tel: 216-636-7532; Fax: 216-444-3164; yiqccf. 31 5 2014 16 5 2014 1 1 2015 01 1 2016 136 1 34 43 p38 MAPK signaling controls cell growth proliferation and the cell cycle under stress conditions. However the function of p38 activation in tumor metastasis is still not well understood. We report that p38 activation in breast cancer cells inhibits tumor metastasis but does not substantially modulate primary tumor growth. Stable p38 knockdown in breast cancer cells suppressed NF-?B p65 activation inhibiting miR-365 expression and resulting in increased IL-6 secretion. The inhibitory effect of p38 signaling on metastasis was mediated by suppression of mesenchymal stem cell (MSC) migration to the primary tumor and sites of metastasis where MSCs can differentiate into cancer-associated fibroblasts to promote tumor metastasis. The migration of MSCs to these sites relies on CXCR4-SDF1 signaling in the tumor microenvironment. Analysis of human primary and metastatic breast cancer tumors showed that p38 activation was inversely associated with IL-6 and vimentin expression. This study suggests that combination analysis of p38 MAPK and IL-6 signaling in patients with breast cancer may improve prognosis and treatment of metastatic breast cancer. p38 MAPK Breast cancer Metastasis microRNA IL-6 J Mol Diagn J Mol Diagn The Journal of Molecular Diagnostics : JMD 1525-1578 1943-7811 American Society for Investigative Pathology 24813172 4078366 S1525-1578(14)00074-9 10.1016/j.jmoldx.2014.03.006 Regular Detection of Gene Rearrangements in Targeted Clinical Next-Generation Sequencing Abel Haley J. ? Al-Kateb Hussam Cottrell Catherine E. Bredemeyer Andrew J. Pritchard Colin C. ¡ Grossmann Allie H. § Wallander Michelle L. ¶ Pfeifer John D. Lockwood Christina M. Duncavage Eric J. eduncavagepath.wustl.edu ? ?Department of Genetics Washington University St. Louis Missouri Department of Pathology and Immunology Washington University St. Louis Missouri ¡Department of Laboratory Medicine University of Washington Seattle Washington §Department of Pathology University of Utah and ARUP Laboratories Salt Lake City Utah ¶ARUP Institute for Clinical and Experimental Pathology Salt Lake City Utah ?Address correspondence to Eric J. Duncavage M.D. Department of Pathology and Immunology Division of Anatomic and Molecular Pathology Division of Laboratory and Genomic Medicine 660 Euclid Ave. #8118 St. Louis MO 63110. eduncavagepath.wustl.edu 1 7 2015 7 2014 16 4 405 417 6 3 2014 2014 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved. 2014 American Society for Investigative Pathology and the Association for Molecular Pathology This document may be redistributed and reused subject to certain conditions. The identification of recurrent gene rearrangements in the clinical laboratory is the cornerstone for risk stratification and treatment decisions in many malignant tumors. Studies have reported that targeted next-generation sequencing assays have the potential to identify such rearrangements; however their utility in the clinical laboratory is unknown. We examine the sensitivity and specificity of ALK and KMT2A (MLL) rearrangement detection by next-generation sequencing in the clinical laboratory. We analyzed a series of seven ALK rearranged cancers six KMT2A rearranged leukemias and 77 ALK/KMT2A rearrangementnegative cancers previously tested by fluorescence in situ hybridization (FISH). Rearrangement detection was tested using publicly available software tools including Breakdancer ClusterFAST CREST and Hydra. Using Breakdancer and ClusterFAST we detected ALK rearrangements in seven of seven FISH-positive cases and KMT2A rearrangements in six of six FISH-positive cases. Among the 77 ALK/KMT2A FISH-negative cases no false-positive identifications were made by Breakdancer or ClusterFAST. Further we identified one ALK rearranged case with a noncanonical intron 16 breakpoint which is likely to affect its response to targeted inhibitors. We report that clinically relevant chromosomal rearrangements can be detected from targeted gene panelbased next-generation sequencing with sensitivity and specificity equivalent to that of FISH while providing finer-scale information and increased efficiency for molecular oncology testing. Biomed Res Int Biomed Res Int BMRI BioMed Research International 2314-6133 2314-6141 Hindawi Publishing Corporation 24524077 3913339 10.1155/2014/485067 Research Investigating the Feasibility of Rapid MRI for Image-Guided Motion Management in Lung Cancer Radiotherapy http://orcid./0000-0002-3275-4160 Sawant Amit 1 * Keall Paul 2 Pauly Kim Butts 3 Alley Marcus 3 Vasanawala Shreyas 3 Loo Jr. Billy W. 3 Hinkle Jacob 4 Joshi Sarang 4 1University of Texas Southwestern Medical Center Dallas TX 75235 USA 2University of Sydney Sydney NSW 2006 Australia 3Stanford University Stanford CA 95305 USA 4University of Utah Salt Lake City UT 84112 USA *Amit Sawant: amit.sawantutsouthwestern.edu Academic Editor: Jack Yang 2014 12 1 2014 2014 485067 17 4 2013 6 11 2013 7 11 2013 Copyright 2014 Amit Sawant et al. 2014 This is an open access distributed under the Creative Commons Attribution License which permits unrestricted use distribution and reproduction in any medium provided the original work is properly cited. Cycle-to-cycle variations in respiratory motion can cause significant geometric and dosimetric errors in the administration of lung cancer radiation therapy. A common limitation of the current strategies for motion management is that they assume a constant reproducible respiratory cycle. In this work we investigate the feasibility of using rapid MRI for providing long-term imaging of the thorax in order to better capture cycle-to-cycle variations. Two nonsmall-cell lung cancer patients were imaged (free-breathing no extrinsic contrast and 1.5?T scanner). A balanced steady-state-free-precession (b-SSFP) sequence was used to acquire cine-2D and cine-3D (4D) images. In the case of Patient 1 (right midlobe lesion ~40?mm diameter) tumor motion was well correlated with diaphragmatic motion. In the case of Patient 2 (left upper-lobe lesion ~60?mm diameter) tumor motion was poorly correlated with diaphragmatic motion. Furthermore the motion of the tumor centroid was poorly correlated with the motion of individual points on the tumor boundary indicating significant rotation and/or deformation. These studies indicate that image quality and acquisition speed of cine-2D MRI were adequate for motion monitoring. However significant improvements are required to achieve comparable speeds for truly 4D MRI. Despite several challenges rapid MRI offers a feasible and attractive tool for noninvasive long-term motion monitoring. 1. Introduction Respiratory motion causes significant uncertainties in tumor delineation radiotherapy (RT) dose calculations and delivery particularly in the case of thoracic tumors (e.g. lung liver) [1]. The management of respiratory motion has been an active area of research over the last decade. Several investigational as well as clinically implemented respiratory motion management strategies have been described in the literature [1]. However a common limitation of most of these strategies is that they rely on image-guidance techniques that make simplifying assumptions about respiratory motion and do not adequately capture cycle-to-cycle variations which invariably occur in all patients. Modern motion-managed radiotherapy typically uses four-dimensional computed tomography (4DCT) as the tool of choice for pretreatment anatomic imaging (also termed as CT simulation or CT-sim in the literature). In this technique CT projections are acquired over several respiratory cycles from successive slabs in the body. At the same time an external surrogate (e.g. an optical marker) records the amplitude of respiration. Based on the surrogate motion trace the reconstructed slices are sorted into 610 volumes over a single respiratory average cycle where each volume represents a specific phase of respiration (inhalation through exhalation) [24]. This retrospectively reconstructed movie of a single respiratory cycle serves as the anatomical ground truth for all subsequent stages of radiotherapy (contouring treatment planning and dose delivery). It is well recognized however that respiratory motion is far more complex than can be characterized by a single average cycle. Cycle-to-cycle variations such as baseline shifts and changes in the amplitude and/or frequency of the respiratory waveform are inadequately accounted for in 4DCT-based planning and can lead to significant geometric and therefore dosimetric errors [5]. Furthermore binning CT projection data acquired over several cycles into a single cycle leads to severe image artifacts. For example Yamamoto et al. found that 45 of 50 patients had at least one artifact with mean magnitude of 11.6?mm (range: 4.456.0?mm) [6]. In a separate study Persson et al. found that 4DCT artifacts caused significant uncertainties in the delineation of the gross tumor volume (GTV) in 16 out of 19 patients [7]. Finally the equivalent dose for 4DCT is quite high (2940?mSv) about 4 times higher than that for 3DCT (310?mSv) [8]. Such high imaging dose discourages long-term monitoring and frequent imaging. Due to these limitations 4DCT-based image guidance provides an incomplete picture of respiration-induced spatial and temporal changes in the thoracic anatomy. The aim of this work is to investigate the feasibility of using rapid magnetic resonance imaging (MRI) as a nonionizing imaging modality to capture long-term and/or frequent information about respiratory motion and its effects on the movement and deformation of lung tumors and surrounding critical ans. The fundamental difference and therefore advantage of cine MRI are that unlike 4DCT the MR image (i.e. slice or volume) is acquired prospectively thereby capturing an actual instance of the patient anatomy which is closer to reality compared to an average estimate of the anatomical state that is represented by 4DCT. Prospective acquisition also enables MRI to overcome the two main challenges that limit the utility of 4DCT images namely the ability to capture cycle-to-cycle variations and elimination of binning-related image artifacts. In addition due to the fact that MRI does not involve ionizing radiation there is no dose penalty for repeated imaging (as opposed to 4DCT). The use of rapid cine-2D as well as 4D MRI for radiotherapy guidance has been previously reported in the literature. In cine-2D MRI a slice of the anatomy is selected at arbitrary orientation and imaged repeatedly in time. 4D MRI is conceptually similar except that in this case an entire volume is selected and imaged. Plathow et al. have reported cine-2D imaging of lung cancer patients at ~3 frames per second (fps) [9] and 4D imaging of malignant pleural mesothelioma patients at ~1 volume/s [10] under slow-breathing conditions using a 1.5?T scanner. Von Siebenthal et al. have reported on a 4D MR imaging technique using retrospective stacking of cine-2D slices [11]. Biederer et al. report 4D MRI of a ventilated chest phantom that uses porcine lung with embedded agarose nodules to simulate tumors [12]. More recently Cai et al. have reported a 4D MRI study of a moving phantom using a technique that uses retrospective sorting of cine-2D slices [13]. To our knowledge there has been no systematic study of rapid lung MRI in the context of image-guided radiotherapy (IGRT) motion management under realistic (prospective acquisition free-breathing human subjects) conditions. In this work we present a pilot investigation of prospective rapid cine-2D and cine-3D (commonly termed as 4D in radiotherapy and the MRI literature) MRI of two nonsmall-cell lung cancer (NSCLC) patients under free-breathing conditions without externally administered contrast. Subsequently we compute and analyze the motion trajectories of tumors and structures of interest. Our current goal is to demonstrate the feasibility and the utility of rapid MR imaging to monitor respiratory motion over multiple cycles and obtain guidance information about the motion deformation and the interplay between lung tumors and surrounding critical ans. Our long-term goal (beyond the current scope) is to use the information obtained from rapid MRI to augment and potentially correct 4DCT images. 2. Methods 2.1. Imaging of NSCLC Patients Two NSCLC patients were imaged following informed consent. Patient number 1 was a 67-year old female with an ~40?mm diameter right midlobe tumor. Patient number 2 was an 80-year old male with an ~60?mm diameter left upper-lobe tumor. Both patients were scanned on a 1.5?T scanner (GE Signa). Both patients were scanned in the supine position under free-breathing conditions and without externally administered contrast. For each patient a 4-channel cardiac coil was centered around the tumor. cine-2D time series in the coronal and sagittal planes were acquired using a balanced steady-state free precession (b-SSFP) sequence and the images were reconstructed using the vendor's in-built software. In all cases except one (Patient number 1 coronal series) half-Fourier acquisition was used in order to achieve higher imaging speed. In the case of Patient number 2 an additional 3D+t (4D) scan of a tumor-inclusive coronal slab (8 slices each 5?mm thick) was acquired using the b-SSFP sequence in the 3D mode and in conjunction with parallel imaging (acceleration = 4). The 4D images were reconstructed using the autocalibrating reconstruction for Cartesian imaging (ARC) algorithm [14]. Table 1 summarizes the image acquisition parameters for the cine-2D and the 4D acquisitions. 2.2. Motion Analysis For each time series from Table 1 the motion trajectories of the tumor and structures of interest were determined as follows. A fluid-flow-based deformable image registration previously validated for RT applications [1517] was applied to each time series to compute deformation vector fields (DVFs) across the temporal dimension. In order to reduce errors and achieve high computation speed (i.e. fewer iterations) the registration was performed in two stages-rigid registration which accounted for gross translation and affine transformations of the tumor and ans followed by deformable registration which accounted mainly for tumor and an deformation. For each time series a reference image was selected (typically at mid-inhale) and ~15 points each on the tumor boundary and the diaphragm were manually selected. Subsequently the motion trajectory of each pixel on a contour was determined from the DVFs. The validity of using diaphragmatic motion as a surrogate for tumor motion was examined by calculating the correlation between the average motion trajectory of the pixels comprising the diaphragm boundary with the average trajectory of the pixels comprising the tumor boundary. The presence of complex motion such as tumor rotation and/or deformation was tested by comparing the motion trajectory of the tumor centroid with those of the selected points on the tumor boundary. 3. Results and Discussion Figure 1 shows MR images acquired from Patient number 1 (Figures 1(a) and 1(b)) and Patient number 2 (Figures 1(c) and 1(d)). The acquisition times per image ranged from ~0.15 to 0.27?sspeeds adequate for monitoring most respiratory motion. In each case the tumor mass (indicated by an arrow) can be clearly delineated against the background of lung parenchyma. Figure 2(a) shows a frame from the 4D acquisition from Patient number 2. A surface rendered tumor-inclusive volume-of-interest in four different respiratory phases is shown in Figure 2(b). Both the tumor as well as the surrounding anatomy exhibit significant deformation from phase to phase. Figure 3 shows motion trajectories extracted from two time series one from each patient. MRI-based monitoring over multiple respiratory cycles yields some interesting observations. In the case of Patient number 1 there is little cycle-to-cycle variation in the respiratory pattern as evidenced by the motion trajectory of the diaphragm. Furthermore the motion of the tumor centroid is well correlated with the motion of the diaphragm (Figure 3(a); R2 = 0.99) indicating that in this case diaphragmatic motion is an appropriate surrogate for tumor motion. Finally the motion of individual points on the tumor boundary (i.e pixels comprising the edges of the tumor mass) is well correlated with that of the tumor centroid (Figure 3(b); R2 = 0.9 to 1.0) indicating the absence of any significant rotation or deformation in the tumor mass. In the case of Patient number 2 while the respiratory pattern is quite regular (as seen from the motion trajectory of the diaphragm) the motion of the tumor centroid is very poorly correlated with diaphragmatic motion (Figure 3(c); R2 = 0.16) and shows significant cycle-to-cycle variation. This behavior indicates that in this case diaphragmatic motion is a poor surrogate for tumor motion. Furthermore the motion of the tumor centroid is also relatively poorly correlated with that of individual points on the tumor boundary (Figure 3(d); R2 = 0.56 to 0.94) indicating the occurrence of significant rotation/deformation of the tumor mass. The complex motion observed in Patient number 2 is likely due to the proximity of tumor to the cardiac wall which almost touches the edge of the tumor (Figure 1(c)) and serves as a second actuator of motion (the first being the diaphragm). These results demonstrate that the current clinical practice of using the motion of the diaphragm (or external or internal surrogates for diaphragmatic motion) has significant limitations when the tumor mass is located in the proximity of other moving structures. The goal of this work was to demonstrate the feasibility and the potential advantages of using rapid MRI as a pretreatment image-guidance tool for lung RT. These early results from rapid MRI of NSCLC patients show that for guidance-quality imaging the inherent contrast presented by the tumor mass and critical structures against the signal-poor lung parenchyma enables us to sacrifice SNR in order to achieve adequate acquisition speed to capture respiratory motion. Furthermore in the case of Patient number 2 we observe that through long-term prospective MR imaging one can capture spatiotemporal effects that are not captured by 4DCT. This is due to the fact that 4DCT projections are sorted using an external surrogate for diaphragmatic motion thereby implicitly assuming that a perfect correlation exists between diaphragmatic motion and tumor motion. The choice of a 1.5?T scanner for this work was motivated by the fact that several lung motion investigations have been performed at this field strength [12 18]. Observer studies comparing 1.5?T and 3?T scanners for lung MRI show that there is no significant difference in overall image quality [19 20] suggesting that the expected benefits of higher SNR at 3?T are somewhat mitigated due to the accompanying increase in susceptibility artifacts. Furthermore at this initial stage we chose to use existing coils and sequences. As seen from the results while this strategy was adequate for cine-2D imaging very large improvements in acquisition speed are required for truly 4D MRI. This is evidenced by the fact that even with the use of parallel acceleration = 4 the acquisition time for the 4D time series shown in Figure 2 was ~1.5?s/volume. Thus there is much room for exploration of other rapid MRI sequences and for developing sequences specifically optimized for RT guidance. In particular we expect the largest improvements in imaging speed to come from strategies based on sparse sampling and reconstruction such as k-t Broad-use Linear Acquisition Speed-up Technique (k-t BLAST) and its parallel imaging version k-t SENSitivity Encoding (k-t SENSE). Beyond the current scope it is expected that the information obtained from rapid MRI (cine-2D or 4D) can be merged with that from 3DCT or 4DCT to create a fused pretreatment 4D image that combines the soft-tissue contrast and temporally dense information from MRI with the spatial accuracy and electron density information from CT. Admittedly this is a nontrivial problem because one has to account for MRI artifacts correct for geometric distortions of the anatomy due to the relatively narrow bore of the magnet and develop robust multimodality image registration tools. Furthermore since this was a feasibility study the patients were not asked to lie in the treatment position for the MRI scan. However for future studies which aim to fuse the MRI with CT patients will be required to do so. However if these challenges are addressed fused 4D images would provide a more realistic picture of the behavior of thoracic anatomy over multiple respiratory cycles. Such guidance would enable the development of novel 4D treatment planning paradigms that explicitly account for effects such as baseline shifts and changes in abdominal versus thoracic breathing. Finally several investigators are working on integrated MRI+linac designs [2123]. Online prospective 4D MRI would enable such systems to perform real-time monitoring and potentially real-time beam adaptation. 4. Conclusion We have investigated the feasibility of rapid MRI as a modality for image-based guidance in lung radiotherapy. While the acquisition speeds of cine-2D imaging are adequate for capturing most respiratory motion significant further improvements are required to achieve comparable speeds for truly 4D MRI acquisition. Nevertheless these early results indicate that rapid MRI offers a highly attractive noninvasive imaging tool for respiratory motion management. The ability to perform dose-free long-term monitoring over multiple respiratory cycles yields valuable information that is not currently available with 4DCT. We expect that such image-guidance will lay the groundwork for significantly better respiratory motion management in lung radiotherapy. Acknowledgments This work was partially supported by the American Association of Physicists in Medicine (AAPM) Research Seed Funding Grant 2008. Conflict of Interests The authors declare that there is no conflict of interests regarding the publishing of this paper. 1 Keall PJ Mageras GS Balter JM The management of respiratory motion in radiation oncology report of AAPM Task Group 76 Medical Physics 2006 33 10 3874 3900 2-s2.0-33749422038 17089851 2 Mageras GS Pevsner A Yorke ED Measurement of lung tumor motion using respiration-correlated CT International Journal of Radiation Oncology Biology Physics 2004 60 3 933 941 2-s2.0-4744343520 3 Keall P 4-Dimensional Computed Tomography Imaging and Treatment Planning Seminars in Radiation Oncology 2004 14 1 81 90 2-s2.0-0842306300 14752736 4 Wink NM Panknin C Solberg TD Phase versus amplitude sorting of 4D-CT data Journal of Applied Clinical Medical Physics 2006 7 1 77 85 2-s2.0-33645395992 16518319 5 Cai J Read PW Sheng K The effect of respiratory motion variability and tumor size on the accuracy of average intensity projection from four-dimensional computed tomography: an investigation based on dynamic MRI Medical Physics 2008 35 11 4974 4981 2-s2.0-54949144704 19070231 6 Yamamoto T Langner U Loo BW Jr. Shen J Keall PJ Retrospective analysis of artifacts in four-dimensional CT images of 50 abdominal and thoracic radiotherapy patients International Journal of Radiation Oncology Biology Physics 2008 72 4 1250 1258 2-s2.0-54049105620 7 Persson GF Nygaard DE Brink C Deviations in delineated GTV caused by artefacts in 4DCT Radiotherapy and Oncology 2010 96 1 61 66 2-s2.0-77953962041 20570002 8 Mori S Ko S Ishii T Nishizawa K Effective doses in four-dimensional computed tomography for lung radiotherapy planning Medical Dosimetry 2009 34 1 87 90 2-s2.0-58749115793 19181261 9 Plathow C Hof H Kuhn S Therapy monitoring using dynamic MRI: analysis of lung motion and intrathoracic tumor mobility before and after radiotherapy" | Lung_Cancer |
"Silent lunch and tea break 7. Taking care of yourself - Sitting meditation ending in choiceless awareness - Exercise on taking care of yourself by examining how to improve balance in life - Meditation without CD - Yoga or walking meditation - Reflect on training - 3-min breathing space 8. The rest of your life - Bodyscan - Reflection on training - Further sources of information - Short sitting meditation - Maintaining practice Outcome measures Primary outcome measure Psychological distress The primary outcome measure is the total score on the HADS [39-41] which is developed to measure psychological distress in somatic patient populations. It consists of a 7-item anxiety (HADS-A) and 7-item depression (HADS-D) subscale. The HADS shows good psychometric properties in the general medical population including oncology patients [42]. Internal consistency as measured with Cronbachs ? varied from .84 to .90 [4042].Test-retest reliability was good as Pearsons r > .80 were obtained [4043]. Though the cut-off scores of the HADS vary among populations [44] in lung cancer patients they have found to be <8 versus ?8 on the HADS-A or HADS-D [45]. The HADS has been shown to be highly correlated with the Beck Depression Inventory [42]. It has previously been used in intervention studies of mindfulness and shown to be sensitive to change (e.g. [46]). Secondary outcome measures Quality of life (only for patients) The European anisation for Research and Treatment of Cancer (EORTC) Core Quality of Life Questionnaire (QLQ-C30) [47] is included along with the supplemental Lung Cancer questionnaire module (QLQ-LC13) [48]. The QLQ-C30 is designed to use in clinical trials on physical treatments for cancer patients. It incorporates five functional scales (physical role cognitive emotional social) three symptom scales (fatigue pain nausea and vomiting) a global health and quality of life scale and an array of single-item symptom measures. After revisions in the role functioning global health and physical functioning scale internal consistency of the subscales varied between .65 and .94 except for the cognitive functioning scale with ? varying from .56 to .63 [474950]. Test-retest reliability varied from .63 to .86 [51]. The lung cancer questionnaire module is designed to supplement the core questionnaire and comprises specific symptoms associated with lung cancer (coughing haemoptysis dyspnoea pain) and side-effects from conventional chemo- and radiotherapy (hair loss neuropathy sore mouth dysphagia). While the multi-item dyspnoea scale showed high internal consistency the pain subscale did not. When combined with the dyspnoea and pain items of the core questionnaire both the dyspnoea (? = .86) and pain (? = .71) subscale showed high internal consistency. Since the QLQ-C30 and QLQ-LC13 are mainly focused on physical symptoms we added the items Social Interaction and Alertness Behavior of the Sickness Impact Profile (SIP) [52]. Internal consistency was .94 and test-retest reliability was .92. The SIP correlated with self-assessed sickness and dysfunction [52]. Caregiver appraisal (only for partners) We use the 9-item Self-Perceived Pressure from Informal Care (SPPIC) [53] to assess the extent to which caregiving is experienced as burdensome. To also measure positive aspects of caregiving the 9-item subscale Care-Derived Self-Esteem of the Caregiver Reaction Assessment (CRA-SE) [54] is included. Internal consistency of the SPPIC was .79 and of the CRA-SE was .73. The SPPIC and CRA-SE were unrelated to each other [55]. Relationship quality To measure relationship satisfaction we included the 10-item Satisfaction subscale of the Investment Model Scale (IMS-S) [56]. The IMS-S starts with 5 items that measure concrete examplars of satisfaction to enhance the comprehensibility of the global items which are utilized to form the construct. Internal consistency varied from .79 to .95 and the IMS-S was related to the Dyadic Adjustment Scale. Also the Mutual Interpersonal Sensitivity scale (MIS) [57] is included to measure communication between partners about the cancer. It contains 18 items and is divided into two scales: open communication and avoiding negative thoughts about the cancer. Spirituality is measured with the Spiritual Attitude and Involvement List (SAIL) [58] and consists of 26 items divided into the subscales meaningfulness trust acceptance caring for others connectedness with nature transcendent experiences and spiritual activities. The internal consistency varied from .74 to .88 and test-retest reliability varied from .77 to .92. All subscales except for connectedness with nature were related with the Functional Assessment of Chronic Illness Therapy Spiritual Well-Being Scale. Costs (only for patients) The cost-effectiveness evaluation is carried out from a societal perspective considering direct as well as indirect health costs. Data on costs are collected prospectively using a diary in which participants register a) health care utilization: the type of care and its duration and b) cancer-related absence from work. Unit cost estimates are derived from the national manual for cost prices in the health care sector [59]. Costs of reduced ability to work are estimated using the friction costs method which results in a more realistic estimate than the human capital approach [60]. Treatment costs of MBSR are calculated using activity-based-costing methods thus measuring actual resources (time of therapist time of patients facilities) used. All unit cost prices are adjusted to 2013 prices. Unit cost estimates are combined with resource utilization data to obtain a net cost per patient over the entire follow-up period. Process measures Mindfulness skills are examined with the 39-item Five Facet Mindfulness Questionnaire (FFMQ) [6162]. The FFMQ is based on an exploratory factor analysis of five mindfulness measures which allowed items from different instruments to form factors providing an empirical integration of these independent attempts to operationalize mindfulness. This led to the following five subscales: observing describing acting with awareness non-judging of inner experience and non-reactivity to inner experience. Internal consistency varied from .72 to .93 among the different subscales. Most subscales were related to meditation experience Psychological Well-Being scales and psychological symptoms including the Brief Symptom Inventory [61]. FFMQ is sensitive to change in mindfulness-based interventions and is found to mediate the relationship between mindfulness practice and improvements in psychological symptoms (e.g. [63]). Self-compassion is assessed with the Self Compassion Scale (SCS) [6465] which has 26 items and is divided into six subscales: self-kindness versus self-judgment common humanity versus isolation and mindfulness versus over-identification. Internal consistency of the different subscales varied from .75 to .81 and test-retest reliability varied from .80 to .93. SCS correlated moderately with self-esteem measures including the Rosenberg Self-Esteem Scale. Furthermore whereas the self-esteem measures correlated significantly with the Narcissistic Personality Inventory the SCS was unrelated to narcissism [64]. SCS is sensitive to change through mindfulness-based interventions and is found to mediate MBCTs treatment effects [66]. To measure rumination we administered the extended version of the Ruminative Response Scale (RRS-EXT) [67] Raes and Hermans: The revised version of the Dutch Ruminative Response Scale unpublished instrument]. The RRS-EXT contains 26 items in which a more adaptive thinking style (i.e. reflection) is distinguished from a more maladaptive one (i.e. brooding). Internal consistency varied from .72 to .77 and test-retest reliability varied from .60 to .62 for the brooding and reflection subscales. The concept of rumination seems to be sensitive to change through mindfulness-based interventions and has been shown to mediate the effect of MBSR on depressive symptoms in oncology patients [68]. The psychological stress reaction is measured with the 15-item Impact of Event Scale (IES) [6970] which assesses two categories of responses: intrusive experiences and avoidance of thoughts and images associated with the event. Internal consistency varied from .65 to .92 [71] and test-retest reliability varied from .79 to .87 among the subscales [69]. IES correlated with anxiety and depression subscales of the General Health Questionaire. Adherence to MBSR is assessed during the entire study period with a calendar on which participants in the MBSR condition fill out on a daily basis whether they adhere to the mindfulness exercises: either formal practice (e.g. meditation exercise like the bodyscan) informal practice (e.g. activity with awareness) or no exercise. Adherence to MBSR has been shown to mediate the effects of MBCT on depressive symptoms [72]. Statistical analysis plan Sample size To determine the required sample size first the sample size was calculated that would be needed for a simple t-test and subsequently it was corrected for clustering repeated measurements and baseline. A two-sided t-test on the total HADS score [3940] (i.e. our primary outcome measure examining psychological distress (HADS-total) anxiety symptoms (HADS-A) and depressive symptoms (HADS-D)) would require 64 participants in each group to have 80% power to detect a medium-sized difference (effect size = 0.5) with alpha = 0.05. To correct for clustering we multiplied this sample size of 64 with the design factor (1 + (n ? 1) * ICC) where n denotes the cluster size and where ICC denotes the intra-cluster correlation. In our study the treatment groups will consist of 14 people of whom about 7 will be patients. With n = 7 and an estimated ICC = 0.01. [72] the correction factor equals 1.06. To correct for repeated measurements and the use of the baseline measurement as a covariate we multiplied the required sample size by the design factor 1+?/2??02 where ? denotes the correlation between the post-treatment HADS measurements and ?0 denotes the correlation between the baseline HADS with the post-treatment HADS measurements. With ? = 0.8 and ? = 0.5 as conservative estimates the second design factor equals 0.65. Consequently after correction for clustering and covariates we arrived at a required sample size of 0.65 * 1.06 * 64 = 44 patients per arm. So 88 patients with lung cancer would be required for the study. Based on our pilot study [van den Hurk Schellekens Molema Speckens and van der Drift in preparation] we expect a 20% drop-out rate. Therefore we intend to include 110 patients and 110 partners. Primary analyses The samples of lung cancer patients and partners will be analyzed separately. Baseline characteristics of the population will be compared between MBSR and control group to ensure that key variables were evenly distributed by randomization. First analyses will be based on the intention-to-treat approach. Next we will perform per-protocol analyses with the treatment-adherent sample (i.e. in the MBSR condition participants have to attend at least four of the eight MBSR sessions [73] and in the TAU condition participants do not attend a mindfulness-based programme). We will use linear mixed models to analyze all outcome variables (i.e. psychological distress quality of life (only for patient) caregiver appraisal (only for partner) relationship quality and spirituality) with treatment as fixed factor baseline measurement as covariate and a random intercept based on MBSR group. This procedure will use all observed data in our analyses. In addition Cohens d effect size [74] will be reported based on the difference between the group means on baseline and follow-up scores divided by the pooled standard deviation at baseline and follow-up. Secondary analyses Cost effectiveness The quality of life measures (i.e. QLQ-C30; QLQ-LC13) will be used to calculate Quality of Adjusted Life Years (QALYs) for each individual. Costs and effects (in terms of QALYs) will be combined in the incremental cost-effectiveness ratio (ICER). The ICER expresses cost-effectiveness in terms of incremental costs per QALY gained. To estimate confidence intervals for the mean of the ICER a non-parametric bootstrapping method will be used performing 1000 replications of the original data. In order to express the implications of the cost-effectiveness results more clearly a cost-acceptability curve will be constructed. In case of dominance a full cost analysis will be conducted to estimate the mean savings per patient per year. Mediation analyses To examine the possible underlying mechanisms of change in MBSR mediation analyses will be conducted. Only the data of the treatment-adherent sample will be included in these analyses. By means of a multiple mediation model suggested by Preacher and Hayes [75] we will test the mediating effect of mindfulness skills self-compassion rumination and adherence to MBSR on psychological distress quality of life (only in patients) caregiver appraisal (only in partners) relationship quality and spirituality. Discussion In the last ten years MBSR has not only proven to be a feasible and acceptable intervention in cancer patients [76] but it also seems to be effective in reducing psychological distress [30]. However the generalization of these results is limited because most participants were female patients with breast cancer. A large part of lung cancer patients already have advanced cancer at time of diagnosis and are confronted with a poor prognosis and low health status. Consequently they more often report psychological distress than patients with other diagnoses of cancer [89]. Hence it is not yet clear whether MBSR is a feasible acceptable and effective intervention in patients with lung cancer. Moreover little is known about the effectiveness of MBSR in partners of cancer patients [30] though they also often report psychological distress. Our pilot study of 19 lung cancer patients and 16 partners participating in an MBSR course provides preliminary evidence that MBSR is feasible and acceptable in this population (van den Hurk Schellekens Molema Speckens and van der Drift in preparation). The current trial will answer the question whether MBSR is effective in patients with lung cancer and their partners. We started enrolment of participants in February 2012. At the moment we think recruiting a sufficient number of patients and partners will be a challenge due to rapidly fluctuating health status and sudden changes in cancer treatment [77]. The main reasons for declining participation in patients is being too ill or that it is too much of a burden during chemo and/or radiotherapy. Furthermore no perceived need or motivation for the training is commonly mentioned. Among partners participation is highly depending on whether the patient is willing to participate. Although partners can take part separately partners who are interested do often not participate when the patients decline participation. Considering the difficulty of studying lung cancer patients and their partners [77] our trial will offer valuable information on whether MBSR as one of the few available psychosocial care programmes contributes to the alleviation of their psychological distress. Abbreviations MBSR: Mindfulness-based stress reduction; RCT: Randomized controlled trial; RUNMC: Radboud University Nijmegen Medical Centre; MBCT: Mindfulness-based cognitive therapy; MMSE: Mini mental state examination; DT: Distress thermometer; HADS: Hospital anxiety and depression scale; QLQ-C30: Quality of life cancer; QLQ-LC13: Quality of life lung cancer; SIP: Sickness impact profile; SPPIC: Self-perceived pressure from informal care; CRA-SE: Caregiver reaction assessment care-derived self-esteem; IMS-S: Investment model scale-satisfaction; MIS: Mutuality and interpersonal sensitivity; SAIL: Spiritual attitude and involvement list; FFMQ: Five facet mindfulness questionnaire; SCS: Self-compassion scale; RRS-EXT: Rumination response scale extended version; IES: Impact of event scale. Competing interests The authors declare that they have no competing interests. Authors contributions All authors contributed to the design of the study. AS MD and JP are the principal investigators of the study. MS drafted the paper which was modified and supplemented by all other authors. DH MS and MD are involved in recruiting participants while MS and DH take care of the logistics of the study and data collection. RD contributed specifically to the statistical analysis plan and WW contributed specifically to the design of the cost-effectiveness evaluation. All authors read and approved the final manuscript. Pre-publication history The pre-publication history for this paper can be accessed here: http://www.biomedcentral.com/1471-2407/14/3/prepub Acknowledgements This research is funded by Foundation Alpe dHuZes and the Dutch Cancer Society (Grant number KUN 20115077 awarded to Prof. dr. Anne E. M. Speckens Dr. Miep A. van der Drift and Prof. dr. Judith B. Prins). Jemal A Bray F Center MM Ferlay J Ward E Forman D Global cancer statistics CA Cancer J Clin 2011 61 2 69 90 10.3322/caac.20107 21296855 Akechi T Okamura H Nishiwaki Y Uchitomi Y Psychiatric disorders and associated and predictive factors in patients with unresectable nonsmall cell lung carcinoma: a longitudinal study Cancer 2001 92 10 2609 2622 10.1002/1097-0142(20011115)92:10<2609::AID-CNCR1614>3.0.CO;2-K 11745196 Uchitomi Y Mikami I Kugaya A Akizuki N Nagai K Nishiwaki Y Akechi T Okamura H Depression after successful treatment for nonsmall cell lung carcinoma: a 3-month follow-up study Cancer 2000 89 5 1172 1179 10.1002/1097-0142(20000901)89:5<1172::AID-CNCR27>3.0.CO;2-U 10964348 Montazeri A Milroy R Hole D McEwen J Gillis CR Anxiety and depression in patients with lung cancer before and after diagnosis: findings from a population in Glasgow Scotland J Epidemiol Community Health 1998 52 3 203 204 10.1136/jech.52.3.203 9616429 Hyodo I Eguchi K Takigawa N Segawa Y Hosokawa Y Kamejima K Inoue R Psychological impact of informed consent in hospitalized cancer patients: a sequential study of anxiety and depression using the Hospital Anxiety and Depression scale Support Care Cancer 1999 7 6 396 399 10.1007/s005200050299 10541981 Turner NJ Muers MF Haward RA Mulley GP Psychological distress and concerns of elderly patients treated with palliative radiotherapy for lung cancer Psychooncology 2007 16 8 707 713 10.1002/pon.1109 17115458 Hopwood P Stephens RJ Depression in patients with lung cancer: prevalence and risk factors derived from quality-of-life data J Clin Oncol 2000 18 4 893 903 10673533 Zabora J Brintzenhofeszoc K Curbow B Hooker C Piantadosi S The prevalence of psychological distress by cancer site Psychooncology 2001 10 1 19 28 10.1002/1099-1611(200101/02)10:1<19::AID-PON501>3.0.CO;2-6 11180574 Carlson LE Angen M Cullum J Goodey E Koopmans J Lamont L MacRae JH Martin M Pelletier G Robinson J High levels of untreated distress and fatigue in cancer patients Br J Cancer 2004 90 12 2297 2304 15162149 Temel JS Greer JA Muzikansky A Gallagher ER Admane S Jackson VA Dahlin CM Blinderman CD Jacobsen J Pirl WF Early Palliative Care for Patients with Metastatic Non-Small-Cell Lung Cancer N Engl J Med 2010 363 8 733 742 10.1056/NEJMoa1000678 20818875 Abernethy AD Chang HT Seidlitz L Evinger JS Duberstein PR Religious coping and depression among spouses of people with lung cancer Psychosomatics 2002 43 6 456 463 10.1176/appi.psy.43.6.456 12444228 Thielemann PA Conner NE Social support as a mediator of depression in caregivers of patients with end-stage disease " | Lung_Cancer |
"The protein encoded by DSC3 is a calcium-dependent glycoprotein (Desmocollin 3) that is required for cell adhesion and desmosome formation. The protein encoded by PKP1 may be involved in molecular recruitment and stabilization during desmosome formation. The protein encoded by CLCA2 belongs to the calcium sensitive chloride conductance protein family. It may serve as adhesion molecule for lung metastatic cancer cells. The above four genes (DSC3 DSG3 PKP1 and CLCA2) which are associated to desmosomes were found to be up-regulated in SCC compared to the AC subtype [26]. Concretely DSG3 showed high expression in SCC while low expression in AC [26]. DSC3 was also upregulated in SCC exclusively [27] [28]. In primary lung tumors DSC3 was a potential diagnostic marker for lung squamous cell carcinoma [29]. PKP1 showed a times greater level of expression in SCCs than in ACs and normal lung and thus may be useful in histopathological diagnosis [28]. CLCA2 has been inferred to be specifically overexpressed in SCC [30]. We found that subtype AC (SCC) was present (absent) if and only if NKX2-1 was expressed. It is inferred that the expression of NKX2-1 in the specimen of AC is much higher than that of SCC. NKX2-1 which is known as thyroid transcription factor 1 (TITF-1) is a homeodomain-containing transactivating factor and it expressed in the terminal lung bronchioles and lung periphery predominantly [31]. The presence of NKX2-1 protein was prevalent in AC while in SCC NKX2-1 was absent [13]. It is in accordance with our results. Examples of gene-subtype higher logic relationships The higher logic relationships between gene pairs and SCC were selected for further analysis. Gene pairs (GPX2 ITGB8) and (GPX2 SLC2A12) were related with SCC via an AND logical relationship (higher logic relationship type ). It indicates that GPX2 ITGB8 and SLC2A12 were all expressed if the specimen was SCC. Moreover all of the genes GPX2 ITGB8 and SLC2A12 were not expressed if the specimen was AC. GPX2 was detected to have higher expression in SCC compared with AC and normal [32] [33]. We were unaware of evidence in the literature of the relationships between ITGB8 SLC2A12 and the subtypes of NSCLC. Our analysis generated several novel relationships. There are not enough evidences for higher logic relationships to distinguish the subtypes of NSCLC. Hence most of the relationships between gene pairs and the subtypes of NSCLC have not been confirmed. As the lack of knowledge about the regulation relationships between genes and subtypes the exact relationships between the common gene pairs and subtypes are deserved to be checked. Performance comparison We exacted the columns of binary probe data as well as those of phenotype profile data which correspond to the NSCLC specimens and normal specimens of GSE18842. The new binary probe data and phenotype profile data were formed by the exacted columns of binary probe data and phenotype profile data maintaining the relative positions of columns. The NSCLC and normal data comprised the new binary probe data and phenotype profile data. Application of the three methods We firstly applied the current method to the NSCLC and normal data. We set the and obtained probe-phenotype lower logic relationships. The significance and global significance of the discovered relationships were verified by statistic test. Next we applied the NMF method to the NSCLC and normal data. Rows with s were filtered from the binary probe data to ensure the feasibility of the NMF method. The rest binary probe data contained rows and columns. Because two clusters of specimens (AC and SCC) were included in the binary probe data we chose as the dimensionality reduction parameter for the NMF method. Among the obtained two metagenes the second metagene had higher expression level in almost all (i.e. ) of the NSCLC specimens while lower expression level in almost all (i.e. ) of the normal specimens. The probes within the second metagene were sorted according to their activation levels (Table S4). The first probe represented the most closely related probe to the NSCLC phenotype while the last probe represented the least closely related probe. Finally we applied the RA method to the NSCLC and normal data. We sorted the probes by the mutual information between the probe profiles and NSCLC profiles. Note that the correlations between gene pairs and phenotypes could be measured by the current method but they could not be measured by the NMF and RA methods. Hence from this point of view the current method is superior to the two earlier methods. All of the three methods could find single genes closely related with phenotypes. Hence we just identified the gene-phenotype lower logic relationships by the current method and compared the results with those obtained by the two earlier methods. Performance comparison for the three methods We selected two datasets involved the genes which are related with NSCLC. One dataset contains high frequency genes on the mRNA level detected by Huang et al. (Table S5) [9]. It was showed that these genes belonged to the top dysfunctional gene sets with good discriminating ability. We chose the dataset because it was collected from GEO with the accession number GSE18842 which was also the source of the NSCLC and normal data in this work. The other dataset contains up-/down-regulated genes found by Urgard et al. where genes are down-regulated and genes are up-regulated in NSCLC compared to the normal tissue (Table S5) [34]. A total of genes were shared by the above two datasets. Because it is hard to validate the genes included in each dataset it is reasonable to consider these genes as the truth data to estimate the performance of different methods in this work. In order to estimate the performance of the current method and compare its performance with the two earlier methods (the NMF method and the RA method) we calculated a measure: the recall rate which was the ratio of the number of detected genes in the truth data to the total number of genes in the truth data. Note that the recall rate may be biased by the incomplete nature of the truth data. Further we evaluated the classification accuracy which evaluated the discriminating ability of resulted probes. Among all of the genes detected by probes obtained by the current method genes were in the truth data. Hence the recall rate of the current method was . To compare the recall rate of the current method with those of the two earlier methods we selected the top probes obtained by the NMF method and the RA method respectively. We found and zero of the genes in the truth data have been detected by the NMF method and the RA method respectively. Hence the recall rate of NMF and RA were and respectively. The current method had higher recall rate than NMF and RA. By Fig. 1 we found that the current method achieved higher classification accuracy than the NMF method and the RA method. Additionally the average classification accuracy of our method approached to (i.e. ) which means that the probes obtained by our method has a great classification ability. In the figure each curve was steady with little fluctuation. It indicates that the classification accuracy was little sensitive to the number of probes. .0094644.g001 The recall rate of genes obtained by three methods. According to each method we rank the genes in descending order by the coefficients of genes related with phenotypes. We selecte the top genes where . The classification accuracy is calculated based on the top genes. RA NMF and U represent the relevance analysis method the non-negative matrix factorization method and the current method respectively. Biomarkers and key gene pairs Biomarkers inferred by gene-subtype lower logic relationships In previous research a total number of genes have been reported to be used to differentiate between AC and SCC and these genes are DSG3 [26] CLCA2 [30] DSC3 [27] PKP1 [28] NKX2-1 [35] GJB5 [26] KRT6B [36] SERPINB13 [36] TP63 [37] TRIM29 [38] KRT5 [28] NTRK2 [28] and DST [39]. We sorted the genes which were involved in the gene-AC/SCC lower logic relationships in descending order by their coefficients. Interestingly all of above genes were included in the top genes. It is suggested that a gene which has high uncertainty coefficient may clearly distinguish AC from SCC. To obtain a set of biomarkers we firstly selected the top ranked genes (Fig. 2). Because the molecular targets for targeted therapeutic agents play crucial roles for tumor the biomarkers for targeted therapy should have the distinct biological functions between NSCLC and normal. Next an intersection set was generated between top genes and the genes involved in gene-NSCLC lower logic relationships (the genes have been obtained in subsection Performance comparison). Finally intersect genes were regarded as the biomarkers for distinguishing " | Lung_Cancer |
"To investigate the efficacy and safety of percutaneous microwave ablation. Methods: Twenty-six rabbits with lung VX2 tumor were randomly divided into experimental and control group. In the experimental group microwave ablation guided by ultrasound or CT was performed based on location of the tumor. Enhanced CT scan was carried out immediately before and after the ablation for all animals. Two animals from each group were sacrificed immediately or 1 week after the ablation respectively and the others were followed for the rest of their lives. Results: CT scan revealed that the tumor was greatly reduced or ablated after ablation. Pathological examination immediately after ablation also confirmed the tumor reduction or ablation. The survival time of the animals in the experimental group was significantly longer than that in the control group. Conclusions: Microwave ablation is a safe and effective method for treating lung cancer in rabbits showing potential clinical applicability. Microwave ablation VX2 tumor lung cancer 9421547 4136 Hum Pathol Hum. Pathol. Human pathology 0046-8177 1532-8392 24444464 3965626 10.1016/j.humpath.2013.10.016 NIHMS537247 A PIK3CA mutation detected in plasma from a patient with synchronous primary breast and lung cancers Jelovac Danijela MD 1 * Beaver Julia A. MD 1 * Balukrishna Sasidharan MD 2 Wong Hong Yuen BS 1 Toro Patricia Valda BS 1 Cimino-Mathews Ashley MD 1 Argani Pedram MD 1 Stearns Vered MD 1 Jacobs Lisa MD 1 VanDenBerg Dustin BS 1 Kessler Jill BS 1 Jeter Stacie BS 1 Park Ben H. MD PhD 1 Wolff Antonio C. MD 1 1The Sidney Kimmel Comprehensive Cancer Center at Johns Hopkins 1650 Orleans Street Baltimore MD 21287 2Christian Medical College Vellore Tamil Nadu India 632004 * These authors contributed equally to this work 18 12 2013 31 10 2013 4 2014 01 4 2015 45 4 880 883 2013 Elsevier Inc. All rights reserved. 2013 Digital PCR is a new technology that enables detection and quantification of cancer DNA molecules from peripheral blood. Using this technique we identified mutant PIK3CA DNA in circulating plasma tumor DNA (ptDNA) from a patient with concurrent early stage breast cancer and non-small cell lung cancer. The patient underwent successful resection of both her breast and lung cancers and using standard Sanger sequencing the breast cancer was shown to harbor the identical PIK3CA mutation identified in peripheral blood. This case report highlights potential applications and concerns that can arise with the use of ptDNA in clinical oncology practice. plasma tumor DNA breast cancer lung cancer PIK3CA digital PCR Br J Cancer Br. J. Cancer British Journal of Cancer 0007-0920 1532-1827 Nature Publishing Group 24983368 4102953 bjc2014353 10.1038/bjc.2014.353 Genetics and Genomics Assessing standardization of molecular testing for non-small-cell lung cancer: results of a worldwide external quality assessment (EQA) scheme for EGFR mutation testing Worldwide external quality assessment for EGFR gene mutation testing Patton S 1 * Normanno N 2 Blackhall F 3 Murray S 4 Kerr K M 5 Dietel M 6 Filipits M 7 Benlloch S 8 Popat S 9 Stahel R 10 Thunnissen E 11 1EMQN Manchester Centre for Genomic Medicine St Mary's Hospital Manchester M13 9WL UK 2Cell Biology and Biotherapy Unit Istituto Nazionale per lo Studio e la Cura dei Tumori Fondazione Giovanni Pascale'IRCCS 80131 Naples Italy 3Christie Hospital Manchester M20 4BX UK 4Biomarker Solutions Ltd London EC1V 2NX UK 5Department of Pathology Aberdeen Royal Infirmary Aberdeen AB25 2ZN UK 6Charit Humboldt-Universitt zu Berlin Berlin 10117 Germany 7Medical University of Vienna 1010 Vienna Austria 8Pangaea Biotech USP Dexeus University Institute Barcelona 08028 Spain 9Royal Marsden Hospital London SW3 6JJ UK 10University Hospital Z¼rich CH-8091 Z¼rich Switzerland 11Department of Pathology VU University Medical Center Amsterdam 1081 HZ The Netherlands *E-mail: simon.pattoncmft.nhs.uk 15 07 2014 01 07 2014 15 7 2014 111 2 413 420 22 01 2014 19 05 2014 20 05 2014 Copyright 2014 Cancer Research UK 2014 Cancer Research UK This work is licensed under the Creative Commons Attribution-NonCommercial-Share Alike 3.0 Unported License. To view a copy of this license visit http://creativecommons./licenses/by-nc-sa/3.0/ Background: The external quality assurance (EQA) process aims at establishing laboratory performance levels. Leading European groups in the fields of EQA Pathology and Medical and Thoracic Oncology collaborated in a pilot EQA scheme for somatic epidermal growth factor receptor (EGFR) gene mutational analysis in non-small-cell lung cancer (NSCLC). Methods: EQA samples generated from cell lines mimicking clinical samples were provided to participating laboratories each with a mock clinical case. Participating laboratories performed the analysis using their usual method(s). Anonymous results were assessed and made available to all participants. Two subsequent EQA rounds followed the pilot scheme. Results: One hundred and seventeen labs from 30 countries registered and 91 returned results. Sanger sequencing and a commercial kit were the main methodologies used. The standard of genotyping was suboptimal with a significant number of genotyping errors made. Only 72 out of 91 (72%) participants passed the EQA. False-negative and -positive results were the main sources of error. The quality of reports submitted was acceptable; most were clear concise and easy to read. However some participants reported the genotyping result in the absence of any interpretation and many obscured the interpretation required for clinical care. Conclusions: Even in clinical laboratories the technical performance of genotyping in EGFR mutation testing for NSCLC can be improved evident from a high level of diagnostic errors. Robust EQA can contribute to global optimisation of EGFR testing for NSCLC patients. non-small-cell lung carcinoma EGFR gene mutations quality assessment Assessment of epidermal growth factor receptor (EGFR) mutations has become mandatory to choose the most active first-line treatment for patients with advanced non-small-cell lung cancer (NSCLC). Indeed randomized phase III clinical trials have demonstrated that first-line administration of an EGFR TKI results in a prolonged progression-free survival as compared with chemotherapy in patients carrying EGFR mutations (Mok et al 2009; Maemondo et al 2010; Mitsudomi et al 2010; Fukuoka et al 2011; Zhou et al 2011; Rosell et al 2012). These studies have also confirmed that EGFR mutations are a reliable marker that predicts sensitivity to EGFR TKIs (Mok et al 2009). Activating mutations occur in exons 18 through 21 of the TK domain of the EGFR gene and either point mutations or in-frame small deletions or insertions (Sharma et al 2007; De Luca and Normanno 2010). Although more than 250 mutations of the EGFR gene have been described to date two mutations a single point mutation in exon 21 the L858R and a series of small in-frame deletions in exon 19 account for ?90% of all EGFR mutations (Sharma et al 2007; Linardou et al 2008). EGFR mutations are strongly associated with defined clinical and pathological features: they are far more frequent in female patients as compared with male; in adenocarcinoma as compared with other histological types; in non-smokers as compared with current smokers or former smokers; and in East-Asian NSCLC patients as compared with Non-East-Asian patients (Normanno et al 2006). External quality assessment (EQA) is a system of objectively checking laboratory results by an independent external agency (van Krieken et al 2013). The main objective of an EQA programme is to establish inter-laboratory comparability. In this respect the EQA process can identify latent systematic errors in methodology that may not be revealed by a laboratory's own internal QA processes. Representatives from ETOP ESMO ESP EMQN and other leading European groups met in July 2010 to discuss a pan-European approach to EQA for EGFR mutation testing in NSCLC. In this paper we present the results of this pilot EQA scheme for EGFR testing that was completed in 2013. Materials and Methods anisation of the scheme A meeting was anised in July 2010 by ETOP and EMQN to bring together a group of professionals representing EMQN ESP ETOP ESMO and other leading European groups involved in NSCLC testing (see Supplementary Information). From this group a steering group of five individuals was formed who planned designed and assessed the results of the pilot EQA scheme. The scheme was coordinated and administered by the EMQN and three rounds were anised within a period of 18 months. The workflow of the scheme process is shown in Figure 1." | Lung_Cancer |
"Thus mathematical models that can estimate long-term cost-effectiveness of alternative strategies is a helpful technique to support economic analyses of health care resource ulitization [26] [27]. In current study a semi-Markov model along with two-parametric Weibull and Log-logistic distribution were used for measuring the time-dependency transition probabilities and calculating the direct medical costs LYGs and QALYs gained of the practice presented in the trial [15]. A cost-effectiveness evaluation was performed to analysis the economic impact of maintenance gefitinib therapy for patients with locally advanced/metastatic NSCLC with unknown EGFR mutations. Base case analyses of 1- 3- 6- and 10-year time horizon showed an unfavorable ICER of $184829 $19214 $19328 and $21308 per QALY gained respectively. OSA and PSA all revealed that the model we applied was robust to the results. Monte Carlo simulations of 1000 cases suggested that all ICERs for maintenance gefitinib therapy were higher than the recommended WTP threshold (3per-capita GDP) of cost-effectiveness guidelines from Word Health anization (WHO). There are 31 province-level administrative units in Chinese mainland the per-capita GDP of which differs significantly. In 2011 for example it ranged from $2495 in Guizhou province to $13392 in Tianjin city [31]. According to the recommended threshold of WHO [25] the WTP threshold of different province-level administrative units extended from $7485 (3$2495) to $40176 (3$13392) per QALY gained which exceeded the sensitivity range of the WTP (about $17700 to $26300) obtained from PSA of the current study. Obviously local government could take fully into account covering maintenance gefitinib treatment following first-line platinum-based chemotherapy for locally advanced/metastatic NSCLC with unknown EGFR mutations in accordance with local economic development level. Cost-effective probability for different economic level provinces displayed in could supply available information for local governments when gefitinib is approved by local governments finance before it has access to the directory of drugs for national basic medical insurance in China. .0088881.t004 The cost-effective probabilities of gefitinib arm for 31 provinces of Chinese mainland. Region Per-capita GDP ($) WTP (3Per-capita GDP $) Cost-effective Probability Mainland China 5449.71 16349 0 More affluent regionsa >8767 >26300 1.00 Guangdong 7819 23457 0.932 Liaoning 7795 23385 0.926 Fujian 7344 22032 0.717 Shandong 7273 21819 0.655 Less affluent regionsb <5900 <17700 0 a Consist of Tianjin Shanghai Beijing Jiangsu Zhejiang and Inner Mongolia. b Consist of Jilin Chongqing Hubei Hebei Shanxi Ningxia Heilongjiang Shangxi Xinjiang Hunan Qinghai Henan Hainan Jiangxi Sichuan Guangxi Anhui Tibet Gansu Yuannan and Guizhou. A number of different survival models such as Weibull Exponential Log-logistic Gompertz et al can be used to perform extrapolation according to the observed trial data [32]. It is therefore very vital to choose the justifiable extrapolation approach to ensure the associated results of economic analysis confident to decision makers. In the current study after the deviance information criterion test (reported by Jackson et al [33] to alternative models introduced by Latimer [32] we chose Weibull and Log-logistic for PFS and OS respectively instead of Weibull for extrapolating both PFS and OS curves like the previous study undertaken by Zhu J et al [23]. In addition a hazard ration (HR) of PFS was applied to derive the PFS curve for the gefitinib strategy in the previous study [23]. Latimer however in the resent published paper pointed out that the HR used may cause bias because of the requirement of the assumptionsthat is the HR was from a related model and was constant over time [34]. Obviously the bias should be considered especially if the HR impacts the results markedly. Unfortunately the HR of PFS was one of the two most influential parameters on the basis of one-way sensitivity analyses performed by Zhu J et al [23]. In view of the above cases independent parametric models were fitted to both control and experimental groups in our study. Utility of PFS played a great role in the results not only in the resent study [23] but also in the current study. Nafees et al [28] reviewed that all toxicities (diarrhoea rash nausea and vomiting neutropenia fatigue and hair loss) were related to pulling utility down significantly. Of the toxicities rash and diarrhoea were associated with maintenance gefitinib strategy as reported the clinical trial [15]. For higher accuracy we weighted the utility of PFS according to the risks of the rash and diarrhoea which were displayed in . In particularly one point revealed by one-way sensitivity analysis () should be highlighted that the price of gefitinib would be the most significant parameter that could reduce the ICER. With the gefitinib price reduction of 20% discount the ICER decreased to $16731 per QALY gained which is very close to the WTP threshold of $16349 per QALY. Therefore if the price of gefitinib decreases >20% maintenance gefitinib therapy after the standard chemotherapy in patients with locally advanced/metastatic NSCLC may be a cost-effectiveness strategy. There are some limitations in the present study. First using Weibull and Log-logistic distribution to extrapolate the survival curves beyond the time scope of the trial was an unavoidable limitation of this process. There is not enough survival data provided by the short follow-ups of the clinical trial to compare the long-term outcomes estimated by the model. Our results should be updated when long-term survival data are available. Another important limitation is that the utility weight parameters originated from the published literature that may not reflect Chinese patients trait. It is an inevitable limitation of the current analysis because utilities data are not yet available for China. Fortunately opinions from Chinese oncologists suggested that quality of life of locally advanced or metastatic NSCLC patients in China should not be of significant difference from abroad patients. " | Lung_Cancer |
"To assess DFS the disease status was monitored every 2 months for the first 6 months and subsequently every 3 months by computed tomography after enrollment and according to good medical practice. Toxicities related to the administration of chemotherapy were assessed according to the National Cancer Institute Common Terminology Criteria for Adverse Events (version 3.0; ctep.cancer.gov). DFS was defined as the time from the date of enrollment to disease recurrence or death due to any cause and estimated according to the Kaplan-Meier method. A Cox regression model was fit with the time from surgery to enrollment as a covariate to evaluate its effect on DFS. A natural log transformation was applied to the raw protein measurement data and the Pearson correlation coefficient was used to test associations. Bivariate comparison of baseline characteristics between the assigned treatment groups was performed using the Fisher exact test for categorical variables or the Student t test or Wilcoxon rank sum test for continuous variables. A multivariable logistic model to evaluate baseline factors and treatment assignment was fit using backwards selection. Median ERCC1 and RRM1 expression levels were compared with historical medians using the 1-sample Wilcoxon signed rank test. The percentage of patients with both ERCC1 ??65 and RRM1 ??40 was compared with the historical rate using a chi-square test. All statistical analyses and graphics were performed using SAS statistical software (version 9.2; SAS Institute Inc Cary NC). A significance level of 5% was used for all analyses. RESULTS Patient and Trial Characteristics To ensure an adequate sample size of eligible patients and biomarker-specific subgroups a total of 85 patients was registered between April 2 2009 and April 1 2011 from 27 participating sites. Four patients were ineligible; 3 had inadequate lymph node sampling and 1 did not have a tumor measuring ??2 cm. provides the characteristics of the 81 eligible patients. Patient Demographics and Disease Characteristics Variablesa All Patients Assigned to Chemotherapy Assigned to Observation P Refused Assignment Accepted Assignment P N = 81 N = 63 N = 18 N = 20 N = 61 Age y .37 .39 ?Median 64 63.3 68.8 67.2 63.3 ?Mean 63.5 62.9 65.5 65.2 62.9 ?Range 41.684.2 41.684.2 41.681.7 44.282.9 41.684.2 Sex .18 .61 ?Female 44 (54%) 37 (59%) 7 (39%) 12 (60%) 32 (52%) ?Male 37 (46%) 26 (41%) 11 (61%) 8 (40%) 29 (48%) Ethnicity .65 .18 ?Unknown 7 (8%) 5 (8%) 2 (11%) 0 (0%) 7 (11%) ?Non-Hispanic 74 (91%) 58 (92%) 16 (89%) 20 (100%) 54 (89%) Race .73b .75b ?African American 8 (10%) 8 (13%) 0 (0%) 2 (10%) 6 (10%) ?Asian 3 (4%) 2 (3%) 1 (6%) 0 (0%) 3 (5%) ?Pacific Islander 2 (2%) 1 (2%) 1 (6%) 0 (0%) 2 (3%) ?White 66 (81%) 52 (83%) 14 (78%) 17 (85%) 49 (80%) ?Unspecified 2 (2%) 0 (0%) 2 (11%) 1 (5%) 1 (2%) Histology .06c .60c ?Adeno 52 (64%) 44 (70%) 8 (44%) 14 (70%) 38 (62%) ?Squamous 25 (31%) 17 (27%) 8 (44%) 6 (30%) 19 (31%) ?Large 1 (1%) 1 (2%) 0 (0%) 0 (0%) 1 (2%) ?Bronchioloalveolar 1 (1%) 0 (0%) 1 (6%) 0 (0%) 1 (2%) ?Other 2 (2%) 1 (2%) 1 (6%) 0 (0%) 2 (3%) Stage of disease .16 .27 ?IA (<3 cm) 25 (31%) 22 (35%) 3 (17%) 4 (20%) 21 (34%) ?IB (?3 cm) 56 (69%) 41 (65%) 15 (83%) 16 (80%) 40 (66%) Zubrod performance status .11 1.00 ?0 44 (54%) 31 (49%) 13 (72%) 11 (55%) 33 (54%) ?1 37 (46%) 32 (51%) 5 (28%) 9 (45%) 28 (46%) Weight loss (6 mo) 1.00d .31d ?<5% 64 (79%) 49 (78%) 15 (83%) 14 (70%) 50 (82%) ?5-<10% 9 (11%) 7 (11%) 2 (11%) 3 (15%) 6 (10%) ?1020% 4 (5%) 3 (5%) 1 (6%) 2 (10%) 2 (3%) ?>20% 1 (1%) 1 (2%) 0 (0%) 0 (0%) 1 (2%) ?Unknown 3 (4%) 3 (5%) 0 (0%) 1 (5%) 2 (3%) Smoking status ?Current 33 (41%) 26 (41%) 7 (39%) 8 (40%) 25 (41%) ?Former (quit ?1 y) 39 (48%) 30 (48%) 9 (50%) 10 (50%) 29 (48%) ?Never 9 (11%) 7 (11%) 2 (11%) 1.00e 2 (10%) 7 (11%) 1.00e Abbreviation: Adeno adenocarcinoma. a All P values shown are 2-sided. b White versus all other races. c Adenocarcinoma versus all other histologies. d Weight loss <5% versus ?5%. e Derived using the Freeman-Halton exact test. The distribution of assignment to chemotherapy and observation was 63 patients (78%) and 18 patients (22%) respectively which was not significantly different (P?=?.20 Fisher exact test) from the expected rates of 70% (129 patients) and 30% (55 patients) respectively.16 Based on protein levels in these 81 patients the number of those with low ERCC1 and low RRM1 was 31 patients (38%) 22 patients had low ERCC1 and high RRM1 (27%) 10 patients had high ERCC1 and low RRM1 (12%) and 18 patients had high ERCC1 and RRM1 (22%) which is not significantly different from prior results (P?=?.14 Fisher exact test; 54 of 184 29%; 38 of 184 21%; 37 of 184 20%; and 55 of 1840.3 respectively). We investigated whether treatment arm assignment varied by patients' smoking status histology age and sex. In bivariate comparisons no statistically significant associations were found. However the multivariable logistic model found that patients with adenocarcinoma (P?=?.03) and potentially stage IA disease (P?=?.06) were more likely to be assigned to adjuvant chemotherapy (ie they were more likely to have low levels of ERCC1 RRM1 or both). One of the 18 patients assigned to observation and 19 of the 63 patients assigned to chemotherapy rejected this choice and withdrew consent. There was no statistically significant difference in patient characteristics between those who accepted and those who refused their treatment assignment (). Feasibility The trial achieved its primary feasibility objective with a treatment assignment within the prespecified timeframe in 71 of 81 patients (88%)." | Lung_Cancer |
" in Japanese families [19]. A FTSJ2 locus in the genome gene amplification and mRNA over-expression were discovered in several non-small cell lung cancer (NSCLC) tissue samples [20] and FTSJ3 was revealed to function in pre-rRNA processing [21] [22]. However little is known about these three homologs in mammals. Thus in this study we used E. coli RrmJ as a starting point to construct a phylogenetic tree containing several typological species and mammals which showed that FTSJ2 is an ortholog of RrmJ. Based on the highly conserved FTSJ2 protein sequences within mammals we established the basic characteristics of FTSJ2 and its gene expression during the heat shock response in different porcine tissues and human cancer cells. Because previous studies have shown the abnormal expression of FTSJ2 in NSCLC we further investigated the functions of FTSJ2 in cell invasion and migration using human lung adenocarcinoma and rhabdomyosarcoma cell lines. Materials and Methods Phylogenetic Analysis of the E. coli RrmJ Homologs The RrmJ domain of 39 protein sequences and the three out-group proteins fibrillarin (PDB code: 1FBN) [10] [23] vaccinia VP39 (1AV6) [24] and catechol-O- methyltransferase (1VID) [25] which are structurally and functionally similar to E. coli RrmJ were used for the construction of a phylogenetic tree. The distance matrix was calculated using the JTT model. The minimum evolution (ME) method with 1000 bootstrap replicates was performed using the MEGA5 program (www.megasoftware.net/) [26]. The nodes of the tree with a bootstrapping support of >50% are shown. Database Search for RrmJ Homologs and the Multiple Sequence Alignment BLASTp was used to search the complete protein sequences in the non-redundant (nr) database at the National Center for Biotechnology Information (NCBI) website. Fourteen proteins from humans Methanococcus jannaschii and three invertebrate species were obtained using E. coli RrmJ as a query and an E-value of <3e-08 was defined as the cut-off value. Twenty-two vertebrate proteins were found using human FTSJ1 FTSJ2 and FTSJ3 as the queries and a 50% amino acid identity was defined as the cut-off value in this search. The putative RrmJ domains of the 38 protein sequences were aligned with that of E. coli RrmJ using ClustalW and were slightly adjusted according to their predicted secondary structures which were calculated using the PORTER query (distill.ucd.ie/porter/) [27]. The Animals and the Heat Stress Treatment Twelve three-month-old female LandraceYorkshire crossbred (LYC) piglets were purchased from the Animal Industry Division of the Livestock Research Institute of the Council of Agriculture (COA) (Tainan Taiwan). The procedures used in this study were approved by the Institutional Animal Care and Use Committee (IACUC) of the COA Livestock Research Institute (Approval No. 98021). The piglets (n?=?4) were raised at 25°C and 60% humidity in animal houses which were equipped for temperature and humidity control [28] [29]. For the heat stress treatment the piglets that were raised at room temperature (25°C) were exposed to heat shock temperatures of 30°C or 35°C and maintained at 60% humidity for 1 week. The piglets were then sacrificed and tissue samples from 11 ans were isolated for total RNA extraction. Cell Culture The cancer cell lines of HepaG2 (ATCC No. HB-8065) TE671 (ATCC No. CCL-136) and A549 (ATCC No. CCL-185) were purchased from American Type Culture Collection (ATCC; Manassas VA USA). The lung adenocarcinoma CL1 sublines CL1-0 and CL1-5 were kindly provided by Dr. Jeremy J.W. Chen National Chung Hsing University Taichung Taiwan [30]. All of the cell lines were grown in Dulbeccos Modified Eagles Medium (DMEM; Invitrogen Corp. Grand Island NY USA) containing high glucose (4500 mg/L) and supplemented with 10% fetal bovine serum (FBS) at 37°C and 5% CO2. At 80% confluence the cells were subcultured at a ratio of 1?3 to 1?5 and the medium was changed every three days as described previously [31] [32]. Heat Shock Treatment of the Cells In our heat shock response analysis the cancer cells that grew at 37°C and 5% CO2 were subjected to heat shock at 42°C or 45°C and 5% CO2 for 1 hour. After this heat shock treatment the cells were transferred to 37°C for 0 3 or 6 hours and then harvested for total RNA extraction. Cell Transfection via Electroporation The 6.74-kb pCMV-hFTSJ2-IRES2-DsRed plasmid was constructed by inserting the full-length human FTSJ2 (hFTSJ2) protein coding sequence into the EcoRI restriction site of the pIRES2-DsRed2 vector (Clontech Laboratories Inc. Mountain View CA USA). The TE671 and HepG2 cell lines were transfected with this plasmid via electroporation with a BTX ECM2001 system (BTX Holliston MA USA). Briefly 6106 TE671 or 2107 HepG2 cells were suspended in 400 µL of DMEM which contained 5 µg or 50 µg of plasmid DNA respectively and then the cells were subjected to electroporation at 200 V for 4 msec or 100 V for 30 msec respectively. After electroporation the cells were grown in a culture medium containing 400 µg/mL of the antibiotic G418 for the selection of cells that were stably expressing hFTSJ2. Isolation of the Mitochondrial and Cytosolic Protein Fractions The mitochondrial and cytosolic proteins of the TE671 cell fractions were isolated using the reagent-based method of the Mitochondria Isolation Kit (Pierce Rockford IL USA) according to the manufacturers instructions. Western Blot Analysis To analyze the expression of hFTSJ2 stable expression colonies of the TE671-hFTSJ2 and HepG2-hFTSJ2 cells were collected homogenized in 300 µL of RIPA buffer (5 mM Tris-HCl [pH 7.4] 0.15 M NaCl 1% NP-40 0.25% sodium deoxycholate 5 mM EDTA [pH 8.0] and 1 mM EGTA) held on ice for 30 min and then centrifuged at 14000 rpm for 30 min. The supernatants were collected as the total protein lysate. The supernatants (20 µg) were then separated by SDS-PAGE in a 12% acrylamide gel (acryl:bis of 30?0.8) and transferred to a polyvinylidene difluoride (PVDF) membrane [33] [34]. The membrane was blocked with 5% BSA (filtered through a 0.22-µm membrane) and immunoblotted with anti-hFTSJ2 (1?1000) and anti-GAPDH (1?500) antibodies overnight at 4°C. After washing with phosphate-buffered saline containing Tween 20 (PBST) the membrane was incubated with the appropriate horseradish peroxidase-conjugated secondary antibody for 1 hour at 25°C and the protein bands were detected by enhanced chemiluminescence (PerkinElmer Waltham MA USA) and an ImageQuant LAS 4000 mini system (GE Healthcare Biosciences Pittsburgh PA USA). For immunoblotting of the mitochondrial and cytosolic protein fractions 5 µg of protein from each fraction was separated by SDS-PAGE and immunoblotted with anti-hFTSJ2 (1?1000) anti-VDAC (mitochondrial fraction control 1?1000) and/or anti-MEK-1 (cytosolic fraction control 1?1000) antibodies. Immunofluorescence Microscopy The TE671-hFTSJ2 and HepG2-hFTSJ2 cells were grown to 80% confluence in 24-well dishes. Then the cells were fixed with 4% paraformaldehyde for 20 min and permeabilized with 0.10.3% Triton X-100 for 5 min followed by three washes with PBS. The cells were blocked with horse serum for 1 hour and incubated with an anti-hFTSJ2 antibody (1?1000) overnight at 4°C and then with the appropriate fluorescein isothiocyanate (FITC)-conjugated antibody for 1 hour. The cells were counter-stained with MitoTracker Red CMXRos (Invitrogen Corp. Grand Island NY USA) to stain the mitochondria and DAPI to stain the nuclei and then mounted with glycerol. The cells were examined by laser scanning confocal fluorescence microscopy in which FITC was excited at 488 nm MitoTracker Red was excited at 580 nm and DAPI was excited at 358 nm. Real-time RT-PCR and Semi-quantitative RT-PCR The total RNA was isolated from the cell lines or the porcine tissues using the TRIzol reagent (Invitrogen Corp. Grand Island NY USA) according to the manufacturers instructions. The total RNA was treated with DNase I " | Lung_Cancer |
"The DNA (1500-ng aliquots) was resolved by electrophoresis on a 1.5% agarose gel containing 0.5 µg/mL ethidium bromide and was visualized under ultraviolet light [23]. ROS Assay The generation of ROS was assessed in Huh-7 or SMMC-7721 cells with the 2?7?-dichlorofluorescein diacetate (DCFH-DA) (Invitrogen) probe which is hydrolyzed within cells to non-fluorescent 2?7?-dichlorodihydrofluorescin (DCFH). DCFH can be oxidized to the fluorescent 2?7?-dichlorofluorescein (DCF) by hydroxyl radicals peroxynitrite and nitric oxide. Briefly Huh-7 or SMMC-7721 cells were seeded in a 96-well plate. Overnight the cells were incubated with different concentration of luteoloside for 8 h then reacted with 10 µM DCFH-DA at 37°C for 20 min. Or the cells were incubated with NAC (10 mM) H2O2 (100 µM) diamide (10 mM) or BSO (100 µM) for 4 h followed by 50 µM luteoloside for 4 h [24]. DCF was determined at ?ex?=?490 and ?em?=?520 nm on a Synergy H4 microplate reader (BioTek Winooski VT). Furthermore ROS were measured with a Leica DMI4000B inverted fluorescence (Leica Wetzlar Germany). Protein Extraction and Western Blotting The proteins were separated by SDS-PAGE and transferred to nitrocellulose membrane (Bio-Rad Hercules CA). The membrane was blocked with 5% non-fat milk and incubated with rabbit anti-LC3 polyclonal antibody (pAb) (Novus Biologicals) (2 µg/ml) rabbit anti-Beclin 1 pAb (Abcam) (3 µg/ml) rabbit anti-NLRP3 pAb (Novus Biologicals) (1?1000) rabbit anti-caspase-1 (p10) pAb (Santa Cruz Biotechnology) (1?1000) rabbit anti-IL-1? pAb (Santa Cruz Biotechnology) (1?1000) or rabbit anti-?-actin pAb (Bioworld Technology) (1?5000). The proteins were detected with enhanced chemiluminescence reagents (Pierce). Cell Proliferation Assay The cell proliferation assay was conducted as previously described by us [22]. Scratch-wound Assay Scratch-wound assay was conducted as previously described by us [22]. The migration of cells into the wound was monitored in multiple wells using a CellVoyager CV1000 confocal scanner system (Yokogawa Electronic Tokyo Japan) with an Olympus UPLSApo 102 10/0.4 Dry ?/0.17/26.5 WD 3.1 plan super apochromat objective lens. The images were acquired every 0.5 hour for 48 hours (or every hour for 72 hours). The images shown represent 0 and 48 hour (or 0 and 72 hour). In Vitro Migration and Invasion Assays Assays were performed as described previously by Yao et al [25]. Xenograft Model and Treatments Two different mouse models were used to observe in vivo effect of Luteoloside on HCC cells. For the subcutaneous model the mice (male BALB/c-nu/nu 6 weeks old) were anesthetized using 1% sodium pentobarbital (0.2 ml/20 g body weight Sigma Chemical) as described by us previously [22]. The SMMC-7721 cells (2106 cells) were suspended in 200 µl serum-free DMEM and subcutaneously injected into the right upper flank of each mouse. Two weeks after the cells were injected when tumors were observable the animals were equally divided into two groups (ten per group). The first group received only 0.2 ml of vehicle material by gavage daily and served as a control group. The second group of animals received luteoloside (2 mg/kg body weight; equivalent to a dose of 6.5 mg/m2 in patients) in vehicle respectively for 4 weeks. Body weight was measured every 4 days to adjust the drug dosage. The tumors were measured using digital calipers every 3 to 4 days after they reached a volume of 100 mm3 and tumor volumes were calculated as described: V (cm3)?=?Width2 (cm2)Length (cm)/2. At the termination of the experiment the mice were sacrificed by cervical dislocation and the tumors were weighed immediately after dissection. For lung metastasis experiments 1106 SMMC-7721 cells were suspended in 100 µl PBS and injected into the tail veins of each mouse (male BALB/c-nu/nu 6 weeks old) [26]. Then the animals were equally divided into two groups (ten per group). The first group received only 0.2 ml of vehicle material by gavage daily and served as a control group. The second group of animals received Luteoloside (2 mg/kg body weight) in vehicle respectively for 8 weeks. Body weight was measured every 4 days to adjust the drug dosage. At the termination of the experiment the mice were sacrificed by cervical dislocation and their lungs were removed and subjected to hematoxylin & eosin (H&E) staining. This study was carried out in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. The protocol was approved by the Committee on the Ethics of Animal Experiments of the University of Jiangsu Normal University (Permit Number: 13-0221). All surgery was performed under sodium pentobarbital anesthesia and all efforts were made to minimize suffering. Statistical Analysis Data are presented as means ± SEM and comparisons were made using Students t test. A probability of 0.05 or less was considered statistically significant. Results Luteoloside Inhibits the Proliferation of HCC Cells in vitro We first determined whether luteoloside inhibits the proliferation of human HCC cells. We found that luteoloside significantly inhibited cell proliferation in all six-cell lines in a dose- and time-dependent manner (Fig. 1B 1C). The results suggest that luteoloside has promising antihepatoma activity. Luteoloside Inhibits the Migration and Invasion of HCC Cells in vitro Luteoloside significantly decreased the migration of Huh-7 and SMMC-7721 cells compared with the control groups (Fig. 2A2H; Supplementary Movies 14). Transwell assays without Matrigel demonstrated that luteoloside could significantly inhibit migration of Huh-7 cells when compared with control groups (Fig. 2I 2J 2M). Transwell assays with Matrigel showed that the invasive capacities of Huh-7 cells which were treated with luteoloside were significantly inhibited compared with the control cells (Fig. 3K 3L 3N). These results indicate that luteoloside can significantly inhibit HCC cells migration and invasion in vitro. .0089961.g002 Luteoloside inhibits migration and invasion of HCC cells. The migration of cells into the wound was monitored in multiple wells using a CellVoyager CV1000 confocal scanner system. The images were acquired every 0.5 hour for 48 hours (Huh-7 cells) or every hour for 72 hours (SMMC-7721 cells) (see Supplemental Movies 14). The images shown represent 0 hour (A B E F) 48 hours (C D) and 72 hours (G H). The distance between the two edges of the scratch in the luteoloside-treated cells (D or H) was greater than that of the control (C or G). (IN) Transwell migration and invasion assays of Huh-7 cells. For the transwell migration assay 5104 cells were placed on the top chamber of each insert with the noncoated membrane. For the invasion assay 1105 cells were placed on the upper chamber of each insert coated with 150 µg Matrigel (BD Biosciences MA). Cells in both assays were trypsinized and resuspended in DMEM and 700900 µL of medium supplemented with 10% fetal bovine serum was injected into the lower chambers. Representative images are shown on the left (I J K L) and the quantification of five randomly selected fields is shown on the right (M N). The values shown are expressed as the mean ± SEM. ** P<0.01 versus non-luteoloside-treated control group. Scale bar: 100 µm. .0089961.g003 Luteoloside decreases intracellular ROS. ROS levels were measured using the ROS assay with DCFH-DA fluorescence dye. (AB) Cells were treated with luteoloside at the indicated concentration for 8 h then reacted with 10 µM DCFH-DA for 20 min. DCF fluorescence was determined on a Synergy H4 microplate reader. Cells were incubated with NAC (C) H2O2 (D) diamide (E) or BSO (F) for 4 h followed by 50 µM luteoloside for 4 h. DCF was determined on a microplate reader. (G) DCFH-DA fluorescence (green) imaging of ROS in Huh-7 cells. Scale bar: 25 µm. Luteoloside has no Apoptotic Effects on HCC Cells Huh-7 and SMMC-7721 cells were treated with luteoloside for 24 h and caspase-3/7 was measured. The results showed that caspase-3/7 activity was not significantly different between luteoloside-treated cells and control cells when added 5102050100 150 or 200 µM luteoloside respectively (Fig. S1A S1B). Similar results were obtained by analyzing changes in nuclear fragmentation (Fig. S1C) and condensation (Fig. S1D) in cells. These results indicated that luteoloside has no apoptotic effects on Huh-7 and SMMC-7721 cells. Luteoloside does not Affect Autophagy Autophagic cell death (also known as Type II programmed cell death to distinguish it from apoptosis or Type I programmed cell death) has been described as a distinct form of cell death that differs from other death mechanism such as apoptosis and necrosis. Next we investigated whether luteoloside can induce autophagy in HCC cells. Beclin 1 and LC3 (microtubule-associated protein 1A/1B-light chain 3) play a pivotal role in mammalian autophagy. Beclin 1 is involved in both the signaling pathway activating autophagy and in the initial step of autophagosome formation [27]. LC3 comprises both a soluble LC3-I and a lapidated form called LC3-II. LC3-II correlates with autophagy being recruited into autophagosomes. Various types of stressors up-regulate LC3 and promote the conjugation of its cytosolic form LC3-I to phosphatidylethanolamine to constitute the autophagosome-specific LC3-II which is so far considered the most reliable marker of autophagy [27] [28]. Huh-7 and SMMC-7721 cells were treated with luteoloside for 48 h and the levels of LC3 and Beclin 1 proteins of different treatment groups were determined. The results showed that LC3 protein level was not significantly different between luteoloside-treated cells and control cells when added 25 µM or 50 µM luteoloside respectively. Similar results were obtained by analyzing changes in levels of Beclin 1 (Fig. S2). These results indicated that luteoloside has no autophagic effects on Huh-7 and SMMC-7721 cells. Luteoloside Reduces Intracellular ROS Accumulation ROS and cellular oxidant stress have long been associated with cancer [29]. Flavonoids are well known as ROS scavengers. As luteoloside is a kind of flavonoid isolated from Chinese herb [30] we investigated whether the intracellular ROS is part of the mechanism by which luteoloside suppress the proliferation migration and invasion potential of HCC cells. We found that luteoloside could significantly decrease the ROS level of Huh-7 and SMMC-7721 cells in a dose-dependent manner (Fig. 3A 3B). N-acetyl-cysteine (NAC) is a ROS-specific inhibitor [31]. NAC was shown to be capable of suppressing the ROS production in Huh-7 and SMMC-7721 cells (Fig. 3C). When the cells were pretreated with 10 mM NAC for 4 h then treated with 50 µM luteoloside for 4 h the ROS level was significantly lower than the cells which treated with 10 mM NAC only (Huh-7 cells P?=?0.0208; SMMC-7721 cell P?=?0.0224). H2O2 diamide and BSO are all ROS inducers [4]. Treatment with 100 µM H2O2 10 mM diamide or 100 µM BSO showed similar effects resulted in an increase in ROS levels compared with control (Fig. 3D3F). The results showed that H2O2 diamide and BSO could significantly increase the ROS level of Huh-7 and SMMC-7721 cells compared the control group (Fig. 3D3F). However after a prolonged time when the cells were treated with 50 µM luteoloside for 4 h the amount of ROS could significantly decrease (Fig. 3D3F). Furthermore the ROS in Huh-7 cells were monitored using a fluorescence microscope. We also found that luteoloside could significantly decrease the ROS level of Huh-7 cells (Fig. 3G). Luteoloside Downregulates the Expression Level of NLRP3 Caspase-1 (p10) and IL-1? The NLRP3 inflammasome functions as a positive regulator of tumor cells proliferation and metastasis [17] [32]. " | Lung_Cancer |
"Surgical resections can be indicated for localized mediastinal or lung lesions. Other treatments include low-fat medium-chain triglyceride diets interferon-alpha radiation corticosteroids chemotherapy somatostatin and propranolol (2). We revealed an unusual presentation of DPL in a middle-aged asymptomatic woman. In follow-up imaging studies the extent of the disease had increased and a surgical biopsy was performed to rule out lymphangitic carcinomatosis. An awareness of the possibility of DPL even in adults is necessary. 1 Swensen SJ Hartman TE Mayo JR Colby TV Tazelaar HD M¼ller NL Diffuse pulmonary lymphangiomatosis: CT findings J Comput Assist Tomogr 1995 19 348 352 7790540 2 Yoo SH Song JS Lee JJ Lee M Hwang HS Jang SJ Diffuse pulmonary lymphangiomatosis: Pulmonary lymphatic disorder in an adult Basic Appl Pathol 2012 5 63 66 3 El Hajj L Mazi¨res J Rouquette I Mittaine M Bolduc JP Didier A Diagnostic value of bronchoscopy CT and transbronchial biopsies in diffuse pulmonary lymphangiomatosis: case report and review of the literature Clin Radiol 2005 60 921 925 16039928 4 Boland JM Tazelaar HD Colby TV Leslie KO Hartman TE Yi ES Diffuse pulmonary lymphatic disease presenting as interstitial lung disease in adulthood: report of 3 cases Am J Surg Pathol 2012 36 1548 1554 22982897 5 Du MH Ye RJ Sun KK Li JF Shen DH Wang J Diffuse pulmonary lymphangiomatosis: a case report with literature review Chin Med J (Engl) 2011 124 797 800 21518582 6 Resten A Maitre S Humbert M Rabiller A Sitbon O Capron F Pulmonary hypertension: CT of the chest in pulmonary venoocclusive disease AJR Am J Roentgenol 2004 183 65 70 15208112 7 Wittenberg KH Swensen SJ Myers JL Pulmonary involvement with Erdheim-Chester disease: radiographic and CT findings AJR Am J Roentgenol 2000 174 1327 1331 10789787 8 Copley SJ Coren M Nicholson AG Rubens MB Bush A Hansell DM Diagnostic accuracy of thin-section CT and chest radiography of pediatric interstitial lung disease AJR Am J Roentgenol 2000 174 549 554 10658741 9 Nobre LF M¼ller NL de Souza Jºnior AS Marchiori E Souza IV Congenital pulmonary lymphangiectasia: CT and pathologic findings J Thorac Imaging 2004 19 56 59 14712135 10 Tazelaar HD Kerr D Yousem SA Saldana MJ Langston C Colby TV Diffuse pulmonary lymphangiomatosis Hum Pathol 1993 24 1313 1322 8276379 Fig. 1 52-year-old woman with diffuse pulmonary lymphangiomatosis. Posteroanterior chest radiograph revealing increased interstitial markings in both lungs (A). Initial CT scan demonstrating diffuse interstitial thickening in both lungs (B C) and lymph node enlargement in right anterior diaphragmatic area (D arrow). Follow-up CT taken eight months after initial CT scan showing increased interlobular septal thickening (E F) with more prominent bronchovascular bundle thickening (arrows) and increased bilateral pleural effusion (G). Intra-operative photograph showing hypervascularity of lung surface (H). I. Hematoxylin and eosin-stained section of lesion showing proliferation of thin-walled anastomosing lymphatic vessels lined by single layer of endothelial cells lacking cytological atypia (arrows 200). J. Immunohistochemical staining with D2-40 revealing proliferative lymphatic channels (arrows 200). Summary of Previously Reported Middle-Aged Patients with Pulmonary Lymphangiomatosis 2984705R 2786 Cancer Res Cancer Res. Cancer research 0008-5472 1538-7445 24648348 4278592 10.1158/0008-5472.CAN-13-3157 EMS57520 EGFR-Mediated Chromatin Condensation Protects KRAS-Mutant Cancer Cells Against Ionizing Radiation Wang Meng 1 Kern Ashley M. 1 H¼lsk¶tter Marieke 1 Greninger Patricia 2 Singh Anurag 2 Pan Yunfeng 3 Chowdhury Dipanjan 3 Krause Mechthild 4 5 6 7 Baumann Michael 4 5 6 7 Benes Cyril H. 2 Efstathiou Jason A. 1 Settleman Jeff 2 * Willers Henning 1 * 1Department of Radiation Oncology Massachusetts General Hospital Harvard Medical School 55 Fruit Street Boston Massachusetts 02114 2Center for Cancer Research Massachusetts General Hospital Cancer Center Harvard Medical School 149 13th Street Charlestown Massachusetts 02129 3Department of Radiation Oncology Dana-Farber Cancer Institute Harvard Medical School 450 Brookline Ave Boston Massachusetts 02115 4Department of Radiation Oncology Medical Faculty and University Hospital Carl Gustav Carus Technische Universitt Dresden Dresden Germany 5OncoRay- National Center for Radiation Research in Oncology Medical Faculty and University Hospital Carl Gustav Carus Technische Universitt Dresden Helmholtz-Zentrum Dresden-Rossendorf Dresden Germany 6Institute of Radiation Oncology Helmholtz-Zentrum Dresden-Rossendorf Dresden Germany 7Cancer Consortium (DKTK) partner site Dresden and German Cancer Research Center (DKFZ) Heidelberg Germany Corresponding Author: Henning Willers M.D. Dept. of Radiation Oncology Massachusetts General Hospital 55 Fruit Street Boston MA 02114. Tel. 617-726-5184 hwillerspartners. * co-senior authors 31 3 2014 19 3 2014 15 5 2014 30 12 2014 74 10 2825 2834 Therapeutics that target the epidermal growth factor receptor (EGFR) can enhance the cytotoxic effects of ionizing radiation (IR). However predictive genomic biomarkers of this radiosensitization have remained elusive. By screening 40 non-small cell lung cancer cell (NSCLC) lines we established a surprising positive correlation between the presence of a KRAS mutation and radiosensitization by the EGFR inhibitors erlotinib and cetuximab. EGFR signaling in KRAS-mutant NSCLC cells promotes chromatin condensation in-vitro and in-vivo thereby restricting the number of DNA double-strand breaks (DSB) produced by a given dose of IR. Chromatin condensation in interphase cells is characterized by an unexpected mitosis-like co-localization of serine 10 phosphorylation and lysine 9 trimethylation on histone H3. Aurora B promotes this process in a manner that is co-dependent upon EGFR and PKC?. PKC? in addition to MEK/ERK signaling is required for the suppression of DSB-inducible premature senescence by EGFR. Blockade of autophagy results in a mutant KRAS-dependent senescence-to-apoptosis switch in cancer cells treated with IR and erlotinib. " | Lung_Cancer |
"The independent quality improvement facilitator role was seen as crucial to ensure the visits remained focussed and that the engagement with quality improvement plans was maintained. Finally the involvement of senior managers was crucial to the successful implementation of the quality improvement plans. The detailed findings from the independent evaluation of this project have been reported elsewhere (Aveling et al 2012). Discussion Lung cancer outcomes remain relatively poor and reducing unexplained variation is an attractive proposition to promote improvement. There are a number of ways that clinical teams may share best practice and innovative service delivery models however studies formally evaluating their impact are limited. To our knowledge this is the first study to formally test a national quality improvement strategy which aimed to bring the standard of all lung cancer teams to that of the best. We have demonstrated that reciprocal peer-to-peer review with supported quality improvement is both feasible and effective at stimulating local quality improvement activity but had a relatively modest and somewhat disappointing impact on process and outcome measures as measured by NLCA indicators and a new lung cancer patient experience questionnaire. The facilitated reciprocal visits represented a new and unique opportunity for all members of a lung cancer team to exchange ideas in a supported environment and to formally design then implement quality improvement plans. Nearly two-thirds of lung cancer multidisciplinary teams in England agreed to take part in the study and reassuringly baseline NLCA indicators did not differ significantly between participants and non-participants suggesting that the willingness to participate in quality improvement activity is not related to baseline performance. There were a wide range of areas identified for improvement but nearly half of the teams identified multidisciplinary team meeting effectiveness as a key issue. This is not surprising given that these meetings are pivotal in the lung cancer pathway. Live observation of each multidisciplinary team meeting followed by facilitated feedback proved to be a strong driver to improve on problems such as ensuring weekly presence of all the treatment specialists as well as more simple issues such as room layout. The need to streamline diagnostic and treatment pathways was also identified as a common problem. Recent NICE guidance on the management of lung cancer (National Institute for Health and Care Excellence 2011) recommended a paradigm shift in the diagnostic algorithm from performing multiple diagnostic and staging investigations to performing a single test that will provide both diagnostic and staging information. A number of teams within our study were able to introduce such pathways and demonstrate impressive reductions in diagnostic times and more prompt treatment. This together with more effective multidisciplinary team working may have led to the small increase in the active anti-cancer treatment rates seen within the intervention group. However an alternative explanation for the improvement is regression to the mean given that treatment rates in the intervention group were lower at baseline and overall the lack of significant improvement across the range of NLCA indicators in the intervention group was disappointing. One possible explanation for this is the challenge that some participating teams encountered converting enthusiastic quality improvement plans into tangible improvements for patients over a relatively short time period. The qualitative evaluation confirmed that participants often underestimated the time and energy required to implement and sustain change and highlighted the importance of early engagement with hospital managers to maintain momentum (Aveling et al 2012). Alternatively other national lung cancer initiatives implemented at the time of the study may have driven coexistent improvements in the control group. For example the drive to encourage all lung cancer patients to be referred for clinical nurse specialist support has subsequently been shown to increase the probability that a lung cancer patient receives active treatment. Although even small improvements in lung cancer treatment rates are very welcome it is recognised that undergoing investigation for suspected lung cancer generates high levels of patient anxiety and many patients will remain too unwell to benefit from currently available drugs. The assessment of patient experience is therefore of particular importance in lung cancer. This has proved challenging in detailed national cancer surveys owing to the advance in age poor health and short median survival of lung cancer patients. The response rate to our short questionnaire was relatively high at 4149% compared with the 2011 national survey in which only 7% of lung cancer patients responded (Department of Health 2012) but still represents the views of less than half of lung cancer patients and is a relative limitation in terms of generalisability of the results. It was reassuring to note that at entry to the study patients in the intervention group generally rated their experience as highly satisfactory. This may explain the low number of teams who specifically identified patient experience as an area for quality improvement. In terms of assessing the impact of the reciprocal peer-to-peer review visits and supported quality improvement on patient experience it is likely that this high-baseline satisfaction and the lack of patient experience data for the control group limited our ability to detect a significant change. However our results suggest that those teams with poor scores may be able to use patient experience data to promote significant improvements particularly in areas such as communication skills. Further work is required to develop a lung cancer patient experience measure that is both acceptable to patients and able to detect small but clinically important changes in experience. Although similar in name to the national cancer peer review process there are a number of important differences between the reciprocal peer-to-peer review and supported quality improvement process employed in the current study and national cancer peer review. The latter predominantly performs a quality assurance role ensuring that cancer teams meet a minimum standard via compliance with a number of process measures. Support with quality improvement is not provided and site visits are now rarely performed. The qualitative evaluation of our study highlighted the importance of an independent quality improvement facilitator to the success of the peer review visits and the subsequent implementation of the quality improvement plans. Integration of facilitated reciprocal peer-to-peer review and supported quality improvement into national cancer peer review both for lung cancer and other tumour sites is an attractive proposition and requires further study. However our results suggest that this strategy alone is unlikely to have a major impact on lung cancer treatment rates. This phenomenon is not new in lung cancer for example the introduction and NICE approval of gefitinib treatment for the first-line treatment of lung cancer in 2010 was associated with only a 1% increase in active anti-cancer treatment rates over the following year (Health and Social Care Information Centre 2012). Achieving a stepwise increase in lung cancer treatment rates and survival is likely to require a multi-targeted approach including earlier diagnosis streamlined lung cancer pathways new treatments and a reduction in unexplained variation via supported quality improvement programmes. This project was funded by a Health Foundation Closing the Gap award. (grant number: 7797/5557). Appendix I Improving lung cancer outcomes project: patient experience questionnaireWhat is this survey about? This questionnaire asks about your experience of lung cancer treatment and care at the hospital. It was developed in 2010 and it has been used by Lung Cancer Nurse Specialists in 30 hospital across participating in the Improving Lung Cancer Outcomes Project' led by the Royal College of Physicians and several other organisations. The project aims to improve the quality of services and care for people affected by lung cancer. Why should I complete the survey? We need to know your opinion of the current services and care to help improve these for people affected by lung cancer. Your participation in this survey is voluntary and your answers will be treated in confidence. If you choose not to take part in this survey it will not affect the care you receive from the NHS in any way. Please do not write your name and address anywhere on the questionnaire as this information is not required. No information you give in this questionnaire will be shared in a way that allows you to be identified. How to complete the survey and how long it will take. The questionnaire is short and will take 510?min to complete. Please try to answer every question. Please return your questionnaire even if you have not answered every question. If English is not your first language or if you if you have difficulty understanding the questions then please ask a relative or carer to help you complete the questionnaire. Questions or help? If you have any questions please contact your local lung clinical nurse specialist team. Please select one answer to each question by placing a in the appropriate box. There is space at the end of the survey for you to write any comments. This work is published under the standard license to publish agreement. After 12 months the work will become freely available and the license terms will switch to a Creative Commons Attribution-NonCommercial-Share Alike 3.0 Unported License. Abdel-Rahman M Stockton D Rachet B Hakulinen T Coleman MP 2009 What if cancer survival in Britain were the same as in Europe: how many deaths are avoidable Br J Cancer 101 (Suppl 2 S115 S124 19956155 Aveling EL Martin G Jiménez GarcÃa S Martin L Herbert G Armstrong N Dixon-Woods M Woolhouse I 2012 Reciprocal peer review for quality improvement: an ethnographic case study of the Improving Lung Cancer Outcomes Project BMJ Qual Saf 21 1034 1041 Beckett P Woolhouse I Stanley R Peake MD 2012 Exploring variations in lung cancer care across the UK-the story so far' for the National Lung Cancer Audit Clin Med 12 14 18 22372213 Department of Health2012National Cancer Patients' Experience Survey Programme 2012/13. England. Health And Social Care Information Centre2012National Lung Cancer Audit Report. Institute for Healthcare Improvement2003The Breakthrough Series: IHI's Collaborative Model for Achieving Breakthrough Improvement. Boston. Khakwani A Rich AL Powell HA Tata LJ Stanley RA Baldwin DR Duffy JP Hubbard RB 2013 Lung cancer survival in England: trends in non-small-cell lung cancer survival over the duration of the National Lung Cancer Audit Br J Cancer 109 (8 2058 2065 24052044 Kwon S Florence M Grigas P Horton M Horvath K Johnson M Jurkovich G Klamp W Peterson K Quigley T Raum W Rogers T Thirlby R Farrokhi E Flum D 2012 Creating a learning healthcare system in surgery: Washington State's Surgical Care and Outcomes Assessment Program (SCOAP) at 5 years Surgery 151 146 152 22129638 National Institute for Health and Care Excellence 2011 The Diagnosis And Treatment Of Lung Cancer (Update Of Nice Clinical Guideline 24) Clinical guidelines CG121 London UK Pronovost P Needham D Berenholtz S Sinopoli D Chu H Cosgrove S Sexton B Hyzy R Welsh R Roth G Bander J Kepros J Goeschel C 2006 An intervention to decrease catheter-related bloodstream infections in the ICU N Engl J Med 355 2725 2732 17192537 Roberts CM Stone RA Buckingham RJ Pursey NA Lowe D Potter JM 2012 A randomized trial of peer review: the UK National Chronic Obstructive Pulmonary Disease Resources and Outcomes Project: three-year evaluation J Eval Clin Pract 18 (3 599 605 21332611 Walters S Maringe C Coleman MP Peake MD Butler J Young N Bergström S Hanna L Jakobsen E Kölbeck K Sundstrøm S Engholm G Gavin A Gjerstorff ML Hatcher J Johannesen TB Linklater KM McGahan CE Steward J Tracey E Turner D Richards MA Rachet B ICBP Module 1 Working Group 2013 Lung cancer survival and stage at diagnosis in Australia Canada Denmark Norway Sweden and the UK: a population-based study 2004-2007 Thorax 68 551 564 23399908 Wise J 2010 Health atlas shows large variations in care in England BMJ 341 c6809 c6809 Figure 1 Study timelines. Figure 2 Consort diagram disposal of eligible trusts including screening randomisation and follow-up. Figure 3 Run chart showing the waiting times from the multidisciplinary team meeting to the first treatment for 10 consecutive small-cell lung cancer patients following the implementation of the quality improvement plan at one trust in the intervention group. Figure 4 Mean change in national lung cancer audit metrics from baseline (2009) to 2011. P=0.055 active treatmentintervention vs controls. Intervention n=31 trusts control n=47 trusts and non-intervention (control and non-participants combined) n=66 trusts. Abbreviations: CNS clinical nurse specialist; MDT multidisciplinary team; SCLC small-cell lung cancer. Figure 5 Total patient questionnaire scores by the multidisciplinary team in the intervention group at baseline (pre) and at the end of the study (post). A low score indicates better experience. Each symbol represents the mean score for each trust in the intervention group. The maximum possible score for the questionnaire is 11. Table 1 Quality improvement plan themes Quality improvement plan theme Number of plans Multidisciplinary team effectiveness 31 Diagnostic pathways 13 Treatment pathways 9 Access to clinical nurse specialists 8 Clinical trial recruitment 4 Patient experience 2 Table 2 Baseline (2009) national lung cancer audit indicators Control ( n =47) Intervention ( n =31) Excluded ( n =67) P -value Mean (%) s.e.m. Mean (%) s.e.m. Mean (%) s.e.m. Control vs intervention vs non-participant control vs intervention Case ascertainment 158.1 38.6 122.0 7.2 107.4 3.6 0.220 0.455 Discussed at the MDT meeting 95.2 0.7 93.7 1.7 90.9 1.9 0.155 0.370 Histological confirmation rate 75.7 1.2 76.4 1.8 78.4 1.6 0.409 0.739 Active treatment 59.5 1.2 55.9 2.2 59.5 1.5 0.305 0.131 Surgery (all cases) 13.4 0.6 13.0 0.8 14.2 0.7 0.469 0.648 SCLC (chemo) 65.1 2.2 66.5 3.9 63.3 2.7 0.746 0.733 Seen by CNS 70.3 3.8 76.6 3.2 58.3 4.2 0.007 0.243 CNS present diagnosis 44.0 3.8 49.4 5.4 38.7 3.8 0.237 0.403 Abbreviations: CNS=clinical nurse specialist; MDT=mulitdisciplinary team; SCLC=small-cell lung cancer. Data are shown as mean and s.e. proportion of patients. BMC Cancer BMC Cancer BMC Cancer 1471-2407 BioMed Central 24386906 3893473 1471-2407-14-3 10.1186/1471-2407-14-3 Study Protocol Study protocol of a randomized controlled trial comparing Mindfulness-Based Stress Reduction with treatment as usual in reducing psychological distress in patients with lung cancer and their partners: the MILON study Schellekens Melanie PJ 1 Melanie.Schellekens@radboudumc.nl van den Hurk Desiree GM 2 Desiree.vandenHurk@radboudumc.nl Prins Judith B 3 Judith.Prins@radboudumc.nl Molema Johan 2 Johan.Molema@radboudumc.nl Donders A Rogier T 4 Rogier.Donders@radboudumc.nl Woertman Willem H 4 Willem.Woertman@radboudumc.nl van der Drift Miep A 2 Miep.vanderDrift@radboudumc.nl Speckens Anne EM 1 Anne.Speckens@radboudumc.nl 1Department of Psychiatry Radboud University Nijmegen Medical Centre Nijmegen The Netherlands 2Department of Pulmonary Diseases Radboud University Nijmegen Medical Centre Nijmegen The Netherlands 3Department of Medical Psychology Radboud University Nijmegen Medical Centre Nijmegen The Netherlands 4Department of Epidemiology Biostatistics and Health Technology Assessment Radboud University Nijmegen Medical Centre Nijmegen The Netherlands 2014 3 1 2014 14 3 3 28 6 2013 19 12 2013 Copyright © 2014 Schellekens et al.; licensee BioMed Central Ltd. 2014 Schellekens et al.; licensee BioMed Central Ltd. This is an open access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0) which permits unrestricted use distribution and reproduction in any medium provided the original work is properly cited. Background Lung cancer is the leading cause of cancer death worldwide and characterized by a poor prognosis. It has a major impact on the psychological wellbeing of patients and their partners. Recently it has been shown that Mindfulness-Based Stress Reduction (MBSR) is effective in reducing anxiety and depressive symptoms in cancer patients. The generalization of these results is limited since most participants were female patients with breast cancer. Moreover only one study examined the effectiveness of MBSR in partners of cancer patients. Therefore in the present trial we study the effectiveness of MBSR versus treatment as usual (TAU) in patients with lung cancer and their partners. Methods/Design A parallel group randomized controlled trial is conducted to compare MBSR with TAU. Lung cancer patients who have received or are still under treatment and their partners are recruited. Assessments will take place at baseline post intervention and at three-month follow-up. The primary outcome is psychological distress (i.e. anxiety and depressive symptoms). Secondary outcomes are quality of life (only for patients) caregiver appraisal (only for partners) relationship quality and spirituality. In addition cost-effectiveness ratio (only in patients) and several process variables are assessed. Discussion This trial will provide information about the clinical and cost-effectiveness of MBSR compared to TAU in patients with lung cancer and their partners. Trial registration ClinicalTrials.gov NCT01494883. Mindfulness-based stress reduction Lung cancer patients Partners Psychological distress Randomized controlled trial Background With an estimated 1.4 million deaths per year lung cancer is the leading cause of death by cancer worldwide. Even with the best available treatment five-year survival is merely 16% and about 60 to 70% of patients die within the first year after diagnosis [1]. This poor prognosis is often caused by a late diagnosis as the presentation usually occurs when the lung cancer is advanced. Patients may develop burdensome symptoms like pain dyspnoea fatigue and cough and they may undergo radical treatment including surgery chemo- and radiotherapy. Not surprisingly lung cancer has a major impact on the psychological wellbeing of patients and their family. Akechi and colleagues [2] showed that 19% of patients with advanced lung cancer meets the criteria of psychiatric disorders especially depressive and adjustment disorders. Of patients who had been successfully treated for lung cancer 15% met the criteria for a minor or major depressive disorder [3]. The prevalence rate of depressive and anxiety symptoms among lung cancer patients ranges from 20 to 47% [4-7]. Compared to patients with other cancer diagnoses lung cancer patients report the highest rates of distress (43 to 58%) [89] resulting in a lower quality of life [10]. Family friends and especially partners of patients with lung cancer also have to deal with its psychological impact [11-14]. Partners not only provide emotional and practical support they also have to cope with their own concerns including the uncertainty regarding the course of the illness and the fear of losing their partner [15]. More than 50% of partners of lung cancer patients report negative emotional effects of caregiving [16]. Around 40% of partners of patients with advanced lung cancer report high levels of distress [17]. The relationship between patient and partner can also be affected by the cancer. It has been shown that some partners report a lower quality of their relationship after the diagnosis of lung cancer [18]. Though numerous studies examined the psychological distress of lung cancer patients and their partners [2-22] not much research is done on how to alleviate distress in these groups [23]. In addition the available studies on managing the psychosocial care needs of cancer patients and their families have focused on care at the very end of life (e.g. [24-26]). Recently studies have demonstrated that palliative care initiated early in treatment improves the quality of life and depressive symptoms of lung cancer patients [1027]. This stresses the importance of integrating psychosocial care for lung cancer patients and their partners early in the treatment rather than instigating it once life-prolonging therapies fail. In the past ten years MBSR has become a promising psychosocial intervention for cancer patients. Mindfulness is defined as intentionally paying attention to moment-by-moment experiences in a non-judgmental way [28]. MBSR is an 8-week group-based training consisting of meditation practices such as the bodyscan gentle yoga sitting and walking meditation. By repeatedly bringing attention back to the current experience participants gradually learn to disengage from dysfunctional thoughts and directly experience the emotions and bodily sensations of the present moment. MBSR aims to provide participants with the ability to step back from ruminating about the past or worrying about the future and simply allow experiences to unfold [2829]. A recent meta-analysis [30] of 13 nonrandomized studies and 9 randomized controlled trials (RCT) concluded there is positive evidence for the use of mindfulness-based interventions in reducing psychological distress in cancer patients. Among the RCTs a reduction in symptom severity was found for both anxiety and depression corresponding to moderate pooled controlled effect sizes (Hedgess g = 0.37 and Hedgess g = 0.44 respectively) [30]. Though mindfulness-based interventions seem to be effective the authors note that across studies the majority of participants were women (85%) and diagnosed with breast cancer (77%). Compared to breast cancer patients patients with lung cancer are more often male older and have a poorer prognosis. Furthermore of these 22 studies only one study included the partners of the patients showing that partners also benefit from the MBSR training [31]. This is quite surprising since partners of cancer patients also report high levels of distress [32]. Aims The aim of the Mindfulness for Lung Oncology Nijmegen (MILON) study is to examine the effectiveness of MBSR compared to TAU in reducing psychological distress in patients with lung cancer and their partners. We hypothesize that patients in the MBSR group will report a lower level of psychological distress (i.e. anxiety and depressive symptoms) higher levels of quality of life quality of relationship and spirituality than those in the TAU group. Medical and societal costs will be lower in the MBSR versus TAU group. We expect partners in the MBSR group to report a lower level of psychological distress and higher levels of caregiver appraisal relationship quality and spirituality than their counterparts in the TAU group. With regard to the working mechanisms of the MBSR programme we will examine changes in mindfulness skills self-compassion rumination intrusion avoidance and adherence to MBSR. Methods/Design Study design The design of the MILON study is a parallel group randomized controlled trial with an embedded process study. Participants are randomized between MBSR and TAU. The study protocol has been approved by our ethical review board (CMO Arnhem-Nijmegen) and registered under number 2011519. Participants and procedure Patients and partners are recruited at the outpatient clinic of the Department of Pulmonary Diseases Radboud University Nijmegen Medical Centre (RUNMC) by a nurse practitioner and the attending physician. Patients and partners are invited to participate together but both are welcome to participate on their own if they do not have a partner or their partner is not willing to participate. Patients and/or partners who are interested are provided with an information leaflet. If they are willing to participate they are invited for a research interview in which in- and exclusion criteria are assessed and informed consent is taken. At other participating hospitals (Department of Pulmonary Diseases Canisius-Wilhelmina Hospital Nijmegen; Department of Pulmonary Medicine Rijnstate Arnhem; Department of Oncology Elkerliek Hospital Helmond; Department of Pulmonary Medicine Jeroen Bosch Hospital; Department of Pulmonary Diseases Maas hospital Pantein Boxmeer) patients and their partners will be sent a letter with the invitation to participate in the study. One week later the researcher calls the patients to answer possible questions and asks whether the patient and partner are interested in participation. If so they are invited for a research interview at the RUNMC. Eligibility We include patients and/or partners of patients who are (a) diagnosed with cytologically or histologically proven non-small cell lung cancer or small cell lung cancer and (b) have received or are still under treatment. Exclusion criteria for both patient and partner include: (a) being under 18 years of age (b) not being able to understand or use the Dutch language (c) former participation in MBSR or Mindfulness-Based Cognitive Therapy (MBCT) (d) current and regular treatment by psychologist or psychiatrist (e) current participation in other psychosocial programme and (f) physical or cognitive (<26 on the Mini-Mental State Examination (MMSE)) impairments hampering participation in MBSR training or completion of questionnaires. Baseline Patients and partners are interviewed to obtain demographics and clinical characteristics after which they are screened for cognitive impairments with the MMSE [33]. After that baseline questionnaires including the Distress Thermometer (DT) [3435] are administered followed by randomization. Table 1 shows the assessment instruments and time points at which the questionnaires are administered to patients and partners. Table 1 Measurements and corresponding time points for patient and partner Measure Target T0 T1 T2 pt pr pt pr pt pr MMSE Cognitive impairments x x DT General distress x x HADS Psychological distress x x x x x x QLQ-C30 Quality of life x x x QLQ-LC13 Quality of life x x x SIP Impact of sickness x x x SPPIC Caregiver burden x x x CRA-SE Caregiver self-esteem x x x IMS-S Relationship satisfaction x x x x x x MIS Communication about cancer x x x x x x SAIL Spirituality x x x x x x FFMQ Mindfulness skills x x x x x x SCS Self-compassion x x x x x x RRS-EXT Rumination x x x x x x IES Psychological stress reaction x x x x x x Diary Health care use work absence Monthly during study period for pt Calendar Mindfulness adherence Monthly during study period for pt and pr Note. T0 = Baseline measurement; T1 = Post-intervention measurement; T2= 3-month follow-up measurement; pt = Patient; pr = Partner; MMSE = Mini Mental State Examination; DT = Distress Thermometer; HADS = Hospital Anxiety and Depression Scale; QLQ-C30 = Quality of Life Cancer; QLQ-LC13 = Quality of Life Lung Cancer; SIP = Sickness Impact Profile; SPPIC = Self-Perceived Pressure from Informal Care; CRA-SE = Caregiver Reaction Assessment Care-Derived Self-Esteem; IMS-S = Investment Model Scale-Satisfaction; MIS = Mutuality and Interpersonal Sensitivity; SAIL = Spiritual Attitude and Involvement List; FFMQ = Five Facet Mindfulness Questionnaire; SCS = Self-Compassion Scale; RRS-EXT = Rumination Response Scale Extended Version; IES = Impact of Event Scale. Randomization Randomization is stratified according to setting and minimized for (a) stage of disease (curative versus palliative) (b) baseline level of anxiety and depressive symptoms (anxiety or depression subscale score of Hospital Anxiety and Depression Scale (HADS) <8 versus ?8) (c) treatment during MBSR (no treatment versus chemo- and/or radiotherapy) and (d) participation (patient alone versus partner alone versus patient and partner together). Randomization is computerized using a randomization website specifically designed for this study on which the researcher can fill out the required data. The researcher communicates treatment allocation to the nurse practitioner who informs the patient and/or partner. Follow-up assessments Follow-up assessments take place post intervention and at three-month follow-up. Participants who have access to the internet and have an email address receive the questionnaires online. If not they receive the questionnaires on paper along with a reply envelope. In case of drop-out the researcher tries to contact the participant by phone to complete a minimum set of outcome measures and to identify the main reason for drop-out. Intervention The MBSR curriculum used is primarily based on the Mindfulness-Based Stress Reduction programme as developed by Kabat-Zinn [28] but contains some elements of the MBCT programme by Segal Williams and Teasdale [29] like psycho-education on the interrelatedness of feelings and thoughts. Moreover some modifications have been made to make the intervention more suitable for patients with lung cancer and their partners such as psycho-education about grief [36]. In addition a mindful communication exercise in which partners talk with each other about the cancer was added. The programme consists of 8 weekly 2.5-hour sessions a silent day between session six and seven and home practice assignments of about 45 minutes 6 days per week. Participants receive a set of CDs with guided mindfulness meditation exercises for home practice and a folder with information and home practice instructions for the forthcoming week. Table 2 shows the content of the MBSR programme per session. The MBSR courses are taught by mindfulness teachers with extensive training in MBSR. They all fulfil the advanced criteria of the Center for Mindfulness of the University of Massachusetts Medical School [37] and maintain a regular personal meditation practice. Teachers were trained supervised and assessed to ensure their competency levels met the qualification criteria to instruct the MBSR classes. During the trial teachers will receive weekly supervision and a number of sessions will be videotaped to evaluate competence and adherence with the Mindfulness-Based Interventions Teaching Assessment Criteria [38]. Table 2 Content of MBSR programme per session Theme of session Meditation exercise Didactic teaching Homework 1. Automatic pilot - Bodyscan - Intention of participating - Bodyscan - Raisin exercise - Eating one meal mindfully - Attention for routine activity 2. Mindfulness of the breath - Bodyscan - Imagery exercise to demonstrate relationship between thoughtsand feelings - Bodyscan - Sitting" | Lung_Cancer |
"The main complexity of modeling and interpreting such phenomena lies in the additional temporal dimension needed to express the association as the risk depends on both intensity and timing of past exposures. This type of dependency is defined here as exposurelagresponse association. In this contribution I illustrate a general statistical framework for such associations established through the extension of distributed lag non-linear models originally developed in time series analysis. This modeling class is based on the definition of a cross-basis obtained by the combination of two functions to flexibly model linear or nonlinear exposure-responses and the lag structure of the relationship respectively. The methodology is illustrated with an example application to cohort data and validated through a simulation study. This modeling framework generalizes to various study designs and regression models and can be applied to study the health effects of protracted exposures to environmental factors drugs or carcinogenic agents among others. 2013 The Authors. Statistics in Medicine published by John Wiley & Sons Ltd. latency distributed lag models exposurelagresponse delayed effects splines 1. Introduction In biomedical research it is commonly appreciated that an exposure event produces effects lasting well beyond the exposure period with an increase in risk occurring from few hours to many years later depending on the physiological processes linking the exposure and the health outcome. The problem is made even more complicated in the presence of protracted time-varying exposures when the health effect measured at a given time can be described as the result of multiple exposure events of different intensities sustained in the past. This phenomenon common to various research fields has been associated for example with peak 1 or chronic exposures 2 to environmental stressors drug intake 34 or occupational exposures to carcinogenic substances 5. The main complexity of modeling and interpreting such dependencies lies in the additional temporal dimension needed to express the association beyond the usual exposureresponse relationship as the risk depends on both intensity and timing of past exposures. Nonetheless the appropriate representation of the temporal pattern of risks may provide further insights on the association of interest in particular regarding the underlying pathophysiological mechanisms and prevent biases in estimates and predictions. Revising previous terminology 6 I define these dependencies as exposurelagresponse associations. In particular this issue has been debated in cancer epidemiology 79. Analytical approaches extend simple indices such as cumulative exposure in order to accommodate the temporal variation in risk because of protracted exposures. In particular the pioneering work by Thomas 106 helped develop sophisticated statistical methods on the basis of weighting past exposures through specific functions whose parameters are estimated by the data. Vacek 11 Langholz and colleagues 12 and Richardson 13 provided interesting applications in case-control studies with weights represented through simple parametric functions. The methodology was improved by Hauptmann and colleagues in a series of papers 1416 by using flexible and smooth spline functions. Sylvestre and Abrahamowicz 17 and Abrahamowicz and colleagues 18 extended the spline methods to the analysis of time-to-event data with a cohort design and presented their applications in pharmaco-epidemiology. The main limitation of the statistical techniques described in these papers is the assumption of a linear exposureresponse relationship. Models for nonlinear dependencies introduce further nontrivial complexities from both statistical and interpretational perspectives as the problem becomes inherently bidimensional. Abrahamowicz and Mackenzie 19 proposed a model for analyzing the nonlinear time-dependent effects of fixed exposures while Vacek 11 and Berhane and colleagues 20 extended this scheme to the case of protracted time-varying exposures. However the modeling techniques illustrated in these other papers still face some limitations as they are based on complex estimation routines with convergence issues and problems in producing uncertainty measures such as standard errors and confidence intervals. Interestingly equivalent approaches were previously established in time series analysis on the basis of distributed lag models (DLMs) a methodology originally formulated in econometrics 21 then applied in epidemiological research 22. These models involve the definition of a distributed lag function analogous to the weighting function described before. In particular Armstrong 23 generalized the method to distributed lag non-linear models (DLNMs) a class of models with different options for the functions applied to model nonlinearity and distributed lag effects. The theory of DLMs and DLNMs have been recently re-evaluated 24 offering a well-grounded statistical tool and a comprehensive scheme for interpretation. In this paper I aim to establish a general conceptual and statistical framework for modeling exposurelagresponse associations built upon the paradigm of DLMs and DLNMs. This modeling class extended beyond time series analysis provides a unified methodology applicable in different study designs data structures and regression models including most of the previous methods as specific cases. Also the statistical framework is defined by completely parametric functions and fitted through standard regression methods with measures of uncertainty and fit statistics easily available. The R package dlnm originally developed for time series data 25 is extended in parallel offering a easy-to-use implementation of the modeling approach. The manuscript is structured as follows. The development and algebraic definition of the modeling framework is described in Section 2. As an illustrative example in I apply the method for investigating the relationship between occupational exposure to radon and lung cancer mortality by using the data from the Colorado Plateau miners cohort. The modeling framework is then validated in a simulation study n. A final discussion is provided in. Information on data and software implementation is included in. The R code and data are included in the supporting information together with additional details making the results of the illustrative example and of the simulation study entirely reproducible. 2. Modeling framework The modeling skeleton is derived by extending the class of DLNMs beyond the time series context. This extension provides a neat algebraic representation and a comprehensive statistical definition. The focus is on a function here defined s(xt) which describes the dependency in terms of the exposure history to x evaluated at time t. The function s(xt) is commonly included in regression models in order to estimate the association while controlling for potential confounders. Although the regression model varies depending on the study design and the type of data the definition of s(xt) provided later and the related modeling framework generally apply. 2.1. Models for linear exposureresponse relationships Previous studies on the topic have defined the function s(xt) by using slightly different algebraic formulae 1026111417. Assuming a linear exposureresponse relationship a general notation can be given by (1a) (1b) (1c) In (1a) the increase in risk at time t is defined as the integral of the instantaneous exposure intensity xu over the period ?t = [t0t1] with t0 and t1 representing the times of the first and last relevant exposures. Here w(t ? u) is the weighting function previously described in which assigns weights to past exposures experienced at time t ? u on the basis of their contribution to the risk at time t. The model can be reparameterized as in (1b) where the risk is now expressed along the lag with ? ? [?0L]. Here L ? ?0 = t1 ? t0 is interpreted as the lag period over which an exposure to x is assumed to affect the risk at time t usually with ?0 = 0. This parameterization offers the advantage that the function w is now directly defined in the new dimension of lag ? and it is independent of the time axis chosen for t which may represent different time scales depending on the study design. The function w(?) termed from here on as the lagresponse function models the lagresponse curve associated with exposure x. Finally for computational purposes the integral is approximated in (1c) by a sum of terms derived by partitioning the lag interval in equally spaced discrete units and assuming the protracted exposure as a sequence of exposure events xt ? ? at lags ? = ?0 ¦ L. A statistical model for (1) can be defined by expressing the lagresponse function w(?) as a linear combination of terms obtained through basis transformation with related parameters. By using matrix notation let the vector qxt of exposure history be defined by (2) Such exposure history changes along time depending on the time t at which the vector qxt is computed. Given (2) the cumulative function s(xt) in (1) can be written using a compact and general matrix notation as (3) The (L ? ?0 + 1) à v? matrix C is obtained from the transformation of the lag vector ? = [?0 ¦ ? ¦ L]T by choosing a specific basis with dimension v? for w(?) which defines the related basis functions. In this parameterization the function s(xt) representing the integral of x · w(?) over the interval [?0L] is defined as a lagbasis function with parameters ?. Interestingly the equation in (3) is almost identical to that defining DLMs 24 Eq. (4). The different indexing in the original version reflects the specific application in time series where the data are perfectly ordered in time and the matrix Q has a structure such that qt? ? qt + 1? + 1. However this is a specific case of the general representation in (2)(3). The theory and software already developed for DLMs can be therefore extended in parallel. Alternative lagbasis functions for representing s(xt) are derived through different lagresponse functions w(?) in (1). In particular the traditional index of unweighted cumulative exposure is a specific case of (3) where reduces to with w(?) equal to a constant c. This is obtained by specifying C as an (L ? ?0 + 1)-dimensional vector of 1's with v? = 1. More sophisticated models with splines or other functions such as those illustrated in publications cited in only require the application of different bases for deriving C but are nevertheless represented by 3). 2.2. Extension to nonlinear exposureresponse relationships The extension to the nonlinear case presents further complexities as anticipated earlier. The model in (1) can be extended by defining an additional exposureresponse function f(x) to express the potentially nonlinear exposureresponse curve along the dimension of the predictor. An intuitive generalization of (1) is: (4) with f(x) as the standard exposureresponse function. However the function f(x) · w(?) in 4) previously proposed 1119 is not easily represented as a linear combination of basis variables and generates models that are not linear in their parameters and thus require ad hoc optimization routines. More importantly this representation is based on the strong assumption of independency between f(x) and w(?) namely that the exposureresponse shape is the same at each lag ? and vice versa that the lag structure is the same at each value of x. This assumption can be relaxed by expressing s(xt) as a truly bivariate function with the more flexible representation: (5) Here the bidimensional function f · w(x?) is defined as the exposurelagresponse function and models simultaneously the exposureresponse curve along x and lagresponse curve along ? namely an exposurelagresponse surface. Differently from 4) the exposurelagresponse function in 5) can be expressed as a linear combination of basis variables and related parameters through a special tensor product. As anticipated earlier Armstrong 23 proposed the same approach for time series data within the DLNM framework generalizing this tensor product parameterization through the concept of cross-basis. Specifically two sets of basis functions are independently chosen to represent f(x) and w(?) respectively. The cross-basis is the bidimensional space of functions obtained by the combination of the two sets integrated over the lag dimension and represents the core of DLNMs. The algebraic representation has been previously presented 24 and a revised version is proposed here. Briefly the simpler lag-basis for DLMs in 3) can be extended by choosing an additional basis with dimension vx for representing f(x). The application of the related basis functions to the vector of exposure history qxt obtained by 2) generates a (L ? ?0 + 1) à vx matrix Rxt. Let Axt be: (6) with 1v as a v-dimensional vector of 1's and C defined in 3). The cross-basis function s(xt;?) can be defined as (7) In this case the dimension of the cross-basis is determined by the product of the dimensions of the bases for the two spaces and the association is expressed through vx · v? values W and related parameters ?. The cross-basis function s(xt) represents the integral of f · w(x?) over the interval [?0L] cumulating the contributions of events representing the exposure history. In spite of the relatively complex algebraic form the definition of cross-basis and the specification of DLNMs only amount to the choice of the bases for the functions f(x) and w(?). These can be independently selected between several options such as splines linear threshold or piecewise constant (step) functions. The DLNM modeling class comprises the simpler DLMs from Section 2.1. For example the bidimensional exposurelagresponse function f · w(x?) in 5) reduces to a non-linear function for un-weighted cumulative exposure f(x) · c when w(?) is a constant function c and to the lagresponse function x · w(?) in (1) when f(x) is simply an linear function of the untransformed x. The model proposed by Berhane and colleagues 20 can be written in the form of 6)7) when both f(x) and w(?) are cubic B-splines. 2.3. Estimation and prediction Although the lag-basis and cross-basis functions in (1)(3) and (5)(7) involve a nonstandard parameterization in terms of exposure histories DLMs and DLNMs do not require specialized estimation procedures. The association is entirely expressed by the vx à v? parameters ? of the cross-basis values W. The computation of the exposure history in (2) can be extended to all N observations with x measured at time t producing an N à (L ? ?0 + 1) matrix of exposure histories Q. The matrix of transformed variables W in (3) and (7) is consequently derived. This matrix can be included in the design matrix of standard regression models to estimate the parameters ?. In the completely parametric development proposed here the number of coefficients vx à v? represents the degrees of freedom (df) used to model the association. Inference on the parameters ? and interpretation of the estimated association is aided by the prediction of specific risk measures. For simpler DLMs that assume a linear exposureresponse relationship this step reduces to the computation of a series of estimated risk contributions at lag ?p with ?0 ? ?p ? L and the associated (co)variance matrix . The series of risk contributions is provided by (8) with Cp obtained from the vector of lag ?p used for prediction by applying the same basis functions for w(?) used for estimation. These estimated risk contributions compose the lagresponse curve and can be interpreted using either a forward or backward perspective. Namely represents the risk contribution at time t + ?p in the future from a unit increase in exposure x at time t or the contribution from a unit increase in exposure x occurring at time t ? ?p in the past to a given risk measured at time t. The estimated risk contributions associated with different exposure increases are easily derived. The equations in (8) only apply to DLMs with lag-bases as defined in (3). For DLNMs the association is allowed to vary nonlinearly in the space of x. Moreover the specification in (5)(7) allows the lag-response curve to change depending on the level of the exposure. The prediction of risk contributions corresponding to a specific exposure intensity xp at lag ?p involves a more complex procedure. First let be the (L ? ?0 + 1)-dimensional vector of exposure history with constant exposure xp. The related matrices and are derived from (6) substituting qxt and C with and Cp by applying the same two sets of basis functions for f · w(x?) chosen for estimation. The exposure-specific risk contributions and associated (co)variance matrix are provided by (9) The estimated risk contributions may be interpreted as a lag-response curve similar to in (8) but this time associated with a specific exposure level xp instead of a unit increase. These measures may be used to define a grid of predicted risk contributions defined within the ranges of the exposure x and the lag ? thus obtaining a bi-dimensional representation of the association. From this grid besides above it is also possible to derive the vector of lag-specific risk contributions expressing the exposure-response curve for lag ?p. As noted in Section 2.2 the truly bivariate definition of (7) allows both the lag-response curve and exposure-response curve defined by and respectively to change depending on the specific exposure and lag values xp and ?p. The grid is interpreted as a risk surface along x and ? representing the exposurelagresponse. In addition predictions in (8)(9) may be extended to a generic exposure history qh. Substituting it into in (9) provides the vector of lag-specific risk contributions for each exposure that occurred within the lag period. The overall cumulative effect of such exposure history with associated (co)variance matrix may be computed with: (10) The Equation (10) can be used to estimate the predicted cumulative risk for a given pattern of exposure qh. This method can also be applied to investigate how the risk progressively evolves along an exposure profile computing the cumulative risk at each time associated with the time-varying exposure history qh. 2.4. Identifiability and constraints The tensor product structure of the cross-basis defined in (5)(7) poses some identifiability issues. In particular each of the vx basis variables in R is multiplied by each of the v? basis variables in C. If an intercept is included in f(x) the related matrix of cross-basis variables W is not of full rank and the parameters of the regression model are not identifiable even when a common intercept is not included. Therefore the cross-basis in (7) should always be defined without an intercept in the basis functions for x. Also these basis functions can be centered on a specific exposure value x0 which will represent the reference for the risk summaries computed by (8)(10). The bidimensional shape of the exposurelagresponse can be constrained to follow a prespecified pattern. In particular a priori assumptions on the lag structure can be imposed through functional constraints on the basis for the space of ?. Left and right constraints on the extremes of the supporting interval ?0L are particularly meaningful for smooth functions. A left constraint can be imposed by excluding the intercept from the basis. This step will force the lagresponse curve to predict a null risk at the beginning of the lag period. A right constraint on a B-splines basis can be produced by excluding specific basis variables as previously described for linear exposureresponse relationships 17. The constraint produces a smooth dependency which approaches a null risk at the end of the lag period. Such constraints are particularly useful in the presence of sparse data in order to limit the flexibility of the model under specific assumptions about the lagresponse curve. However biases can be introduced if these assumptions are not met. Additional information is provided in Section D1 of the supporting information. The functional constraints discussed in this section can be specified without introducing customized optimization methods for estimating the parameters ? in (3)(7). More sophisticated methods are required for example to constrain the lagresponse curve to be non-negative in the whole lag period L. These approaches have been previously proposed for linear dependencies 141718 and introduce further complexities in the bidimensional context of DLNMs. This development is not pursued here. 2.5. Model selection and inferential procedures The framework described in Sections 2.12.2 includes a fairly large number of models defined by different functions for each of the two dimensions and by different choices regarding each function such as number and location of knots in splines. This raises the issue of selecting the optimal model for describing the exposurelagresponse association. Previous studies on temporal dependencies have proposed selection procedures on the basis of profile likelihood 15 AIC 141620 or BIC 17. Simulation studies seems to indicate a better performance of AIC when compared with BIC in this context 18 a result consistent with unpublished simulations performed on time series data for DLNMs. Inference on the models illustrated in the previous sections primarily focuses on the specification of confidence intervals for the risk measures in Section 2.3 and on the definition of tests for a set of null hypotheses. Confidence intervals for lagresponse curves exposureresponse curves and cumulative risks obtained through and can be easily derived from the diagonal of the related (co)variance matrices in (8)(10) assuming a multivariate normal distribution of the estimators. Regarding hypothesis testing two null hypotheses are particularly relevant in this framework. The first one postulates a linear exposureresponse relationship namely H0 : f(x) = x. The second one assumes a constant risk namely H0 : w(?) = c. Tests on constrained models can be also defined. The assumption of independency is not easily tested as the form in (4) cannot be expressed as a model linear in its parameters. However defining general inferential procedures in this setting is not straightforward. First the null hypotheses H0 : f(x) = x and H0 : w(?) = c are not independent and an incorrect assumption about the association in one dimension may bias the test estimator for the hypothesis related to the other space as previously reported 19. In addition estimates are usually conditional on a posteriori selection of a best-fitting model based on the selection methods discussed before. Under these conditions the estimators for the (co)variance matrices in (8)(10) are likely to underestimate the true sampling (co)variance and the distribution of the test statistics may be different from that assumed unconditional on the selection procedure. This may generate undercoverage of confidence intervals and inflated type I error for tests 1727. Given these complexities a general framework for hypothesis testing embedded in the model selection procedure is not provided here. An assessment through simulations of the performance of estimators generated by AIC and BIC-selected models will be presented in. Specifically simulations will provide an empirical evaluation of the ability of the information criteria to identify the correct model between those defining the null or alternative hypotheses about linearity and constant effects and measures of performance such as bias coverage and root mean square error. 3. An application The conceptual and statistical framework of DLNMs described in extended beyond time series data is general and applicable in different study designs. As an illustrative example I propose here an application in survival analysis of time-to-event data. This represents one of the most complex settings as the temporal pattern of risk is produced by exposure histories that vary during the follow-up of each subject. Specifically the methodology is used to investigate the association between occupational exposure to radon and mortality for lung cancer. The analysis is based on data from the Colorado Plateau uranium miners cohort already used in previous methodological contributions 121520. Section A of the supporting information provides a list of the main steps to replicate the analysis in other real-life examples. 3.1. Data The cohort data used in this example were collected by the National Institute for Occupational Safety and Health. Detailed information on the cohort is given elsewhere 12. Briefly subjects were eligible to enter the cohort if they worked in mines within the Colorado Plateau area between 1950 and 1960 and provided demographic personal and occupational information during their working period. Vital status and cause of death were ascertained by linkage with different sources. The data used in this example refer to the follow-up of the cohort on December 311982 including 3347 subjects and 258 lung cancer deaths. Exposure data available in the data set include cumulative measures of radon and smoking in 5-year age intervals. The radon exposure history for each subject expressed in working-level months (WLM) was reconstructed by linking employment information with measured or predicted levels in each mine in each year. The smoking history expressed in the number of cigarettes packs à 100 was reported by each subject during his working period and assumed constant after the last reporting age. A summary of the data is provided in Table I. Table I Descriptive statistics of the Colorado Plateau uranium miners cohort. The data included here refer to the follow-up on December 31 1982. Exposure to radon is measured in working level months (WLM) while smoking is reported as packs of cigarettes/100 Full cohort Lung cancer cases N % N % Subjects 3347 100.0 258 7.7 Deaths (%) 1258 37.6 258 100.0 Ever smokers (%) 2656 79.4 238 92.2 Median Min 25th 75th Max Median Min 25th 75th Max Age at entry 34.0 15.8 25.8 44.0 80.0 41.6 18.6 34.3 48.0 63.9 Follow-up time (years) 23.9 0.1 19.6 25.5 32.5 18.3 0.3 12.9 22.0 30.8 Exposure to radon Exposure period (years) 6.7 0.1 2.7 11.8 53.0 12.8 0.1 7.8 17.6 39.5 Total cumulative exposure (WLM/year) 429.0 0.0 153.5 1016.8 10000.0 1231.9 8.0 553.7 2528.6 10000.0 Yearly exposure (WLM/year) All 60.2 0.1 26.7 122.2 3245.3 81.6 1.0 42.3 165.4 1295.7 Lag 09 52.4 0.1 23.8 102.5 2994.0 61.4 3.9 31.3 144.7 1110.8 Lag 1019 53.8 0.1 24.3 112.5 3245.3 78.3 1.0 42.9 164.0 1295.7 Lag 2029 74.0 0.1 33.0 141.7 3245.3 104.7 4.1 52.2 180.0 1295.7 Lag 3040 95.7 0.2 48.0 151.6 2994.0 104.7 5.5 60.0 175.3 860.2 Smoking Exposure period (years) 38.0 5.0 31.0 46.0 75.0 40.0 14.0 33.0 48.0 72.0 Total cumulative exposure (packs à 100) 131.6 0.4 94.5 174.5 676.3 147.4 21.8 109.5 188.1 567.2 Yearly exposure (packs à 100) 3.6 0.0 2.5 3.6 24.4 3.6 0.0 3.5 4.2 13.4 3.2. Modeling strategy For this illustrative example the analysis is performed through a Cox proportional-hazard model with time-varying covariates by using age as the time axis. Effect measures are reported as a hazard ratio (HR). The model is represented by the following: (11) where the log-hazard log [h(t)] is expressed as a sum of baseline log-hazard log [h0(t)] and contributions of additional covariates. These comprise cross-basis functions sx(xt) and sz(zt) for radon and smoking respectively as defined in (1)(7) and a linear term for calendar time u in order to control for secular trends in lung cancer risk not accounted for by the delayed effects of the two exposures. Radon is the exposure of interest and is modeled with different combinations of bases for f(x) and w(?) in the cross-basis sx(xt). Given the limited information on smoking histories in this analysis the cross-basis sz(zt) is a priori defined with a natural cubic B-spline with one knot at the median of 2.5 yearly packs à 100 for the exposureresponse and a step function with a single cut-off at lag 20 for the lag structure with lag period 240 years. However different cross-basis functions can be applied. The model spends 5 df controlling for confounders and a different amount for modeling the effect of radon depending on the chosen cross-basis sx(xt). Modeling exposurelagresponse associations in time-to-event data assumes the definition of an extended version of continuous time-varying predictors namely the varying exposure history for each subject at the ages he contributes to different risk sets 28. The lag scale is chosen as years with lag 0 identifying the exposure during the last year. The lag period is fixed at 240 assuming no effect of exposure after 40 years and in the last 2 years consistently with previous analyses. Multiple exposure histories are computed for each subject at the ages he contributed to each risk set given his exposure profile reconstructed from the 5-year periods. This step produced matrices of exposure histories Qx and Qz for radon and smoking respectively as defined in (2). These matrices are used to specify the lag-bases or cross-bases matrices Wx and Wz from (3)(7) included in the design matrix of the Cox model." | Lung_Cancer |
"progression-free survival (PFS) compared with placebo in patients from eastern Asian with locally advanced/metastatic non-small-cell lung cancer (NSCLC) after four chemotherapeutic cycles (21 days per cycle) of first-line platinum-based combination chemotherapy without disease progression. The objective of the current study was to evaluate the cost-effectiveness of maintenance gefitinib therapy after four chemotherapeutic cycles stand first-line platinum-based chemotherapy for patients with locally advanced or metastatic NSCLC with unknown EGFR mutations from a Chinese health care system perspective. Methods and Findings A semi-Markov model was designed to evaluate cost-effectiveness of the maintenance gefitinib treatment. Two-parametric Weibull and Log-logistic distribution were fitted to PFS and overall survival curves independently. One-way and probabilistic sensitivity analyses were conducted to assess the stability of the model designed. The model base-case analysis suggested that maintenance gefitinib would increase benefits in a 13 6 or 10-year time horizon with incremental $184829 $19214 $19328 and $21308 per quality-adjusted life-year (QALY) gained respectively. The most sensitive influential variable in the cost-effectiveness analysis was utility of PFS plus rash followed by utility of PFS plus diarrhoea utility of progressed disease price of gefitinib cost of follow-up treatment in progressed survival state and utility of PFS on oral therapy. The price of gefitinib is the most significant parameter that could reduce the incremental cost per QALY. Probabilistic sensitivity analysis indicated that the cost-effective probability of maintenance gefitinib was zero under the willingness-to-pay (WTP) threshold of $16349 (3per-capita gross domestic product of China). The sensitivity analyses all suggested that the model was robust. Conclusions Maintenance gefitinib following first-line platinum-based chemotherapy for patients with locally advanced/metastatic NSCLC with unknown EGFR mutations is not cost-effective. Decreasing the price of gefitinib may be a preferential choice for meeting widely treatment demands in China. This study was funded by National Natural Science Foundation of China (No.81173028) (URL: http://www.nsfc.gov.cn/Portal0/default152.htm). The funders had no role in study design data collection and analysis decision to publish or preparation of the manuscript. Introduction Lung cancer the most commonly diagnosed form of cancer is also the leading mortality cause of cancer in males [1]. Non-small-cell lung cancer (NSCLC) accounts for approximately 80% of all lung cancer cases and the majority of patients with NSCLC have locally advanced/metastatic disease when they are diagnosed with carcinoma [2] [3]. Platinum-based combination therapies are recommended as first-line chemotherapy for unselected patients with locally advanced/metastatic NSCLC [4] [5]. However the duration of them (46 chemotherapeutic cycles 21 days per cycle) are limited by cumulative toxicities and response rates (20%35%) and median overall survival (712 months) are modest [6] [7]. On the basis of previous investigations efforts to improve treatment outcome have focused on the specific goal of prolonging tumour response progression-free survival (PFS) and overall survival (OS) with well tolerated maintenance treatment in patients who have attained tumor control during first-line treatment [8][12]. Because of these trials and other findings both erlotinib and pemetrexed (for patients with histologies other than squamous cell carcinoma) have been approved by clinical guidelines as a category 2A recommendation for switch maintenance therapy and also been approved by FDA in patients without disease progression after 46 chemotherapeutic cycles of first-line therapy [4] [13] [14]. In The Lancet Oncology recently Li Zhang et al based on a double-blind randomised phase 3 trial reported that maintenance gefitinib significantly prolonged PFS compared with placebo in patients from 27 centres across China with locally/metastatic NSCLC which indicates that gefitinib should be considered as a maintenance treatment choice in eastern Asian patients [15]. Several economic studies were conducted of maintenance therapy [16][23]. Two analyses concluded that maintenance erlotinib is cost-effective versus best supportive care for locally advanced/metastatic NSCLC [16] [17]. Except for the study by Greenhalgh et al [18] the 4 other studies of maintenance pemetrexed indicated that the new therapy was not cost-effective [19][22]. The evaluation from Zhu J et al on the basis of the clinical trial suggested that the maintenance gefitinib therapy was cost-effective for locally advanced/metastatic NSCLC patients with activating EGFR mutations [23]. However it is unclear whether the new therapy is cost-effective in patients with unknown EGFR mutations after first-line platinum-based combination chemotherapy without disease progression. The objective of the current study was to evaluate the long-term cost-effectiveness (10 year time horizon) of maintenance gefitinib therapy after four chemotherapeutic cycles of stand first-line platinum-based chemotherapy for locally advanced/metastatic NSCLC patients with unknown EGFR mutations from a Chinese health care system perspective. Materials and Methods A previously constructed semi-Markov model was used to compare the long-tern impact of maintenance gefitinib treatment versus placebo after 4 chemotherapeutic cycles of first-line platinum-based chemotherapy for patients with locally advanced/metastatic NSCLC [22] on the basis of the double-blind randomised phase III trial from China by Li Zhang et al [15]. The model along with two-parametric Weibull and Log-logistic distribution were used for calculating the direct medical costs life-years gained (LYGs) and quality-adjusted life-years (QALYs) gained of the practice presented in the trial [15]. Due to the perspective of the Chinese health care system only direct medical costs related to the practice were estimated including maintenance gefitinib therapy treatment of major adverse events routine follow-up treatment for patients without progression follow-up treatment for progressive disease and terminal-phase cost. Costs in this study were estimated in US dollars (USD) corresponding to the 2011 consumer price index and assuming an average exchange rate of 1 USD to 6.45 Chinese Yuan (RMB). Utilities for the model were derived from the literature. The future costs and outcomes were discounted at 3% annually in compliance with the request of China Guidelines for Pharmacoeconomic Evaluations (version 8) [24]. Effectiveness data were stemmed from the multicentre double-blind randomised clinical trial [15] which is the only phase III trial compared maintenance gefitinib treatment in patients with locally advanced/metastatic NSCLC according to our literature search. In brief 296 patients with histological or cytological NSCLC in stage IIIb or IV between September 28 2008 and August 112009 who were 18 years or older and had a WHO performance status of 02 and more than 12 weeks life expectancy after completion of four chemotherapeutic cycles first-line platinum-based chemotherapy without disease progression were eligible for the maintenance gefitinib or placebo treatment (1?1 randomization ratio). Eligible patients continued to take either gefitinib (250 mg per day) or placebo orally until disease progression intolerable toxicity withdrawal of consent serious non-compliance with protocol or dose delay or interruption >14 days. In this report there were 40 and 39 patients were deemed know EGFR mutation status in gefitinib group and placebo group respectively. Therefore there were 108 patients and 109 patients with unknown EGFR mutation received maintenance gefitinib and placebo treatment separately. The primary endpoint of the trial was progression-free survival and the survival analysis revealed that median PFS for patients with unknown EGFR mutation was 6.0 months in gefitinib group and 2.7 months in placebo group (HR 0.40 [95% CI 0.290.54]; p<0.0001). Median OS was not significantly different between the two groups (HR 0.84 [95% CI 0.621.14]; p?=?0.26; median OS 18.7 months vs 16.9 months). The incidence of adverse events in gefitinib group was more frequent than that in placebo group (80% vs. 53%). The cumulative probabilities of serious adverse events were 7% and 3% in the maintenance gefitinib and placebo groups respectively. The model outcomes were presented as costs LYGs and QALYs from the perspective of the Chinese health care system. Sensitivity analyses of input parameters with the high/low values and various distributions were conducted to assess the stability of the model at a value of recommended willingness-to-pay (WTP) threshold of $16349 (3per-capita gross domestic product GDP) based on the cost-effectiveness guidelines of Word Health Organization (WHO) [25]. Model Structure The simplified model structure was shown in Figure 1 which comprised 3 mutually exclusive health states: PFS (entry state); progressed survival (PS state) and death. Patients move from one state to another during each Markov cycle length of 3 weeks (short enough to detect all clinically relevant events) until time horizon termination of 10-year (>95% patients died). Two-parametric Weibull survival and Log-logistic distribution analyses using R for Statistical Computing version 2.15.2 (R Foundation Wien Austria) were fitted to the PFS and OS curves respectively on the basis of survival data extracted from the published Kaplan-Meier curves [15] by using GetData Graph Digitizer software (version 2.24). Table 1 shows the Weibull and Log-logistic distribution parameters of model estimated. The estimated Weibull parameters are used to measure the time-dependency transition probabilities from PFS to PS state according to the following formula:where the ? defines the scale of the distribution the ? gives the shape the u is the Markov cycle and tu indicates that t is calculated as integer multiples of the cycle length of the model. The transition probabilities of death at current t due to the following formula:where the ? and ? are the theta and kappa from the estimated Log-logistic parameters indications of the u and the tu are the same as above. 10.1371/journal.pone.0088881.g001 Figure 1 Markov model of locally advanced/metastatic non-small-cell lung cancer. 10.1371/journal.pone.0088881.t001 Table 1 Weibull and Log-logistic parameters of model estimated for progression-free and overall survival curves respectively. Progression-free survivala Scale Mean (Range) Shape Mean (Range) Adjusted R2 Correlation Coefficient Placebo arm 0.10443 (0.04509/0.16377) 1.29221 (0.99662/1.58780) 0.9729 ?0.995165 Gefitinib arm 0.10231 (0.06622/0.13840) 0.83852 (0.71474/0.96230) 0.9782 ?0.998386 Overall survival b Theta Mean (Range) Kappa Mean (Range) Adjusted R2 Correlation Coefficient Placebo arm ?6.54311 (?7.16112/?5.92510) 2.09373 (1.89823/2.28923) 0.9855 ?0.999986 Gefitinib arm ?5.04069 (?5.53622/?4.54516) 1.54139 (1.38359/1.69919) 0.9801 ?0.999852 a R output for Weibull regression fitted to progression-free curves of locally advanced/metastatic non-small-cell lung cancer patients derived from the Phase III trial [15]. b R output for Log-logistic regression fitted to overall curves of locally advanced/metastatic non-small-cell lung cancer patients derived from the Phase III trial [15]. Medical Costs and Utilities Medical costs for each strategy (Table 2) from the perspective of Chinese health care system were based on outlining current practice [15] which reflected the effectiveness of maintenance gefitinib treatment in Chinese patients with locally advanced/metastatic NSCLC. Direct medical costs related to the practice were estimated including maintenance gefitinib therapy treatment of major adverse events routine follow-up treatment for patients without progression follow-up treatment in PS state and terminal-phase cost. Prices of gefitinib follow-up treatment cost in PS state and terminal-phase cost were obtained from our previous study in which we have calculated healthcare costs associated with the time- and health status-related treatment resources that advanced NSCLC may anticipate based on health expenditure data for 253 cases of advanced NSCLC registered at the Second Xiangya Hospital of Central South University in China between 2006 and 2010 [26]. The aggregate annual medical costs for patients in either PFS or PS state and monthly healthcare costs accumulated during the terminal 3 months were estimated and evaluated using 95% confidence intervals through bootstrapping with the R software (version 2.14.0; R Foundation Vienna Austria) [26]. According to Gefitinib Patients Assistance Program of the pharmaceutical producer in China NSCLC patients receive donations of gefitinib after six months treatment [23]. Therefore six months was applied to calculate the total cost of the maintenance drug. Routine follow-up treatment cost for patients without progression including computed tomography scan physician visit and other examinations and drugs was derived from the literature by Wu B et al [27]. Based on expert opinion only diarrhoea and other grade 3/4 adverse events were considered to estimate the costs of treatment-associated toxicity. Therefore the unit costs of diarrhoea treated and liver protected were multiplied by published rates of corresponding events to populate the model analysis (we assumed patients with grade 3/4 alanine aminotransferase aspartate aminotransferase or aminotransferases increased should receive treatment of liver protected). The unit costs of diarrhoea and liver protected were estimated according to local charges in China." | Lung_Cancer |
"Genes involved in the carcinogenetic mechanisms underlying malignant pleural mesothelioma (MPM) are still poorly characterized. So far mesothelin (MSLN) has aroused the most interest. It encodes for a membrane glycoprotein frequently over-expressed in various malignancies such as MPM and ovarian and pancreatic cancers. It has been proposed as a diagnostic and immunotherapeutic target with promising results. However an alternative therapeutic approach seems to rise whereby synthetic molecules such as antisense oligonucleotides could be used to inhibit MSLN activity. To date such a gene-level inhibition has been attempted in two studies only both on pancreatic and ovarian carcinoma cell lines with the use of silencing RNA approaches. With regard to MPM only one cell line (H2373) has been employed to study the effects of MSLN depletion. Indeed the knowledge on the role of MSLN in MPM needs expanding. Accordingly we investigated the expression of MSLN in a panel of three MPM cell lines i.e. NCI-H28 Mero-14 and IstMes2; one non-MPM cell line was used as reference (Met5A). MSLN knock-down experiments on MSLN-overexpressing cells were also performed through silencing RNA (siRNA) to verify whether previous findings could be generalized to a different set of cell cultures. In agreement with previous studies transient MSLN-silencing caused decreased proliferation rate and reduced invasive capacity and sphere formation in MSLN-overexpressing Mero-14 cells. Moreover MSLN-siRNA combined with cisplatin triggered a marked increase in apoptosis and a decrease in proliferation as compared to cells treated with each agent alone thereby suggesting a sensitizing effect of siRNA towards cisplatin. In summary our findings confirm that MSLN should be considered a key molecular target for novel gene-based targeted therapies of cancer. The work was funded by the University of Pisa (www.unipi.it) (regular badget ex 60%) and by the Fondazione Buzzi Unicem (www.buzziunicem.it). The funders had no role in study design data collection and analysis decision to publish or preparation of the manuscript. Introduction Malignant pleural mesothelioma (MPM) is a cancer of the pleural cavity triggered by asbestos exposure. Patients with MPM have a poor prognosis with overall survival typically ranging between 6 and 13 months. The carcinogenetic mechanisms underlying MPM and the genes involved are still poorly characterized although so far MSLN has aroused the most interest. The human MSLN gene encodes a ?71 kDa precursor protein of 622 amino acids. The precursor is processed by a removal of 33 N-terminal residues. Moreover the C-terminal residues departing from Ser598 are replaced with glycosyl-phosphatidyl-inositol (GPI) facilitating the anchoring of the peptide to the cell membrane. Then the precursor is cleaved at Arg295 by the endoprotease furin into a ?31 kDa soluble peptide called megakaryocyte potentiating factor (from aminoacid Ser34 to Arg286) [1] and a ?40 kDa GPI-anchored membrane-bound glycoprotein (mature mesothelin MSLN starting from Glu296) [2] [3] [4]. It was found that MSLN is present at low levels in a restricted set of normal adult tissues including the mesothelium but it is overexpressed aberrantly by several cancers such as MPM and pancreatic (PC) and ovarian carcinomas (OC) [5] [6]. Moreover a soluble form of MSLN (soluble mesothelin related peptide SMRP) is known lacking the C-terminal GPI-membrane anchor binding segment [7]. Interestingly the levels of SMRP are elevated in the sera of MPM PC or OC patients but not in patients with other types of cancer or inflammatory diseases or in healthy controls [8] [9] [10]. Unfortunately since MSLN knock-out mice did not exhibit any adverse pathology the exact function of MSLN remains unclear [11]. Recent studies highlighted the possible mechanisms by which MSLN could play an active role in cancer progression; it was shown to interact with MUC16 [12] and to activate the p38 pathway leading to the selective induction of matrix metalloproteinase (MMP)-7 [13]. MSLN could also increase cancer cell survival and proliferation via the activation of the NF-?B signaling pathway [14]. Finally it was suggested that MSLN could exert its role in the malignant transformation of human cells through the ?-catenin pathway an important molecule for the epithelial-mesenchymal transition [15]. For all these reasons MSLN was considered a good target for immunotherapeutic strategies. In fact it was used to deliver immunotoxins to specific cancer cells [16] [17] [18] [19] [20] [21] or such as for the case of the monoclonal antibody MORAb-009 to arrest cancer progression by direct inhibition (e.g. disrupting the interaction with MUC16) [22]. Although the use of monoclonal antibodies could provide several advantages (indeed MORAb-009 is currently under clinical trial) target-specific drugs or novel inhibitors (such as antisense oligonucleotides) acting at gene-level could be an alternative for complete inhibition. To date direct inhibition of mesothelin with non-immune strategies has been attempted in a very limited number of studies using silencing RNA (siRNA) approaches. One study on the Eker (Tsc2 mutant) rat model of hereditary renal cancer showed tumor growth inhibition following the use of siRNA microspheres designed against Erc which is considered the rat homologue of MSLN [23]. On human cells one study was carried out on PC cell lines AsPC-1 Capan-1 and Capan-2 [24] whereas another one was performed on cell lines from PC (Miapaca2 and Panc-1) and OC (Skov3 and Ovcar-5) [25]. Overall MSLN depletion significantly hampered proliferation and colony-forming capability. A decreased viability and invasiveness of PC and OC cell lines were also observed [25]. Moreover the expression of bcl-2 decreased whilst that of PUMA and Bax increased; at the same time the activity of caspase-3 increased. Consistently with these observations an increased apoptotic rate was observed in PC cells and the data were conversely corroborated when MSLN was ectopically over-expressed in HPAC cells a PC cell line poorly expressing MSLN [24]. With regard to MPM so far only one cell line (H2373) has been employed to study the effects of MSLN depletion [25]. Indeed the knowledge on the role of MSLN in MPM should be expanded. Accordingly we investigated the expression of MSLN in a panel of three MPM cell lines i.e. NCI-H28 Mero-14 and IstMes2; one non-MPM cell line was used as reference (Met5A). We then performed MSLN knock-down experiments in highly expressing MSLN cells through gene silencing (using silencing RNA siRNA) to verify whether previous findings could be generalized to a different set of cell cultures further corroborating the importance of MSLN in the biology of MPM. Materials and Methods Cell cultures Three mesothelioma cell lines (Mero-14 IstMes2 and NCI-H28) and one mesothelial non-MPM immortalized cell line (Met5A) were used. Mero-14 [26] and IstMes2 [27] mesothelioma cells had been kindly donated by the Istituto Tumori of Genova (National Research Council Genoa Italy). The Met5A mesothelial cells and the NCI-H28 mesothelioma cells had been purchased from the ATCC (American Type Culture Collection) and kindly donated by collaborators of the Pharmaceutical Department of the University of Pisa. Met5A Mero-14 and NCI-H28 cell lines were verified for their identity by analyzing the genetic markers reported in the certification. IstMes2 is a locally established cell line. Mero-14 and IstMes2 were cultured in DMEM medium (Lonza Basel Switzerland). The NCI-H28 cell line was grown in RPMI 1640 medium (Gibco Life Technologies Monza Italy). The Met5A cell line was grown in Medium199 with HEPES (Life Technologies Monza Italy) supplemented with 3.3 nM epidermal growth factor (EGF Life Technologies Monza Italy) 400 nM hydrocortisone (Sigma Aldrich Corp. St Louis MO USA) and 870 nM insulin (Life Technologies Monza Italy). All the cell lines were cultured with supplement of 10% fetal bovine serum (Sigma Aldrich Corp. St Louis MO USA) and 1% Pen-Strep (Lonza Basel Switzerland) and maintained at 37°C in a 5% CO2humidified atmosphere (Forma* 311 Direct Heat CO2 Incubator Thermo Scientific Waltham MA USA). RNA isolation and cDNA synthesis Total RNA was isolated from each cell line with Rneasy Mini kit (Qiagen MI Italy) according to the standard protocol. In order to remove possible contaminating genomic DNA the extracted RNA was treated with DNAse buffer (Sigma Aldrich Corp. St Louis MO USA). Concentration and purity of cleaned-up RNA were determined with a spectrophotometer (SmartSpec 3000 Bio-Rad Laboratories Hercules CA). The integrity of total RNA was verified by electrophoresis on ethidium bromide agarose gel inspecting the 18S and 28S ribosomal RNA bands. Reverse transcription (RT) was performed with the iSCRIPT cDNA Synthesis Kit using 1µg of total RNA in a final volume of 20µl (Bio-Rad Laboratories Hercules CA). Quantitative Real-Time PCR (RT-qPCR) Pre-designed TaqMan probes (Life Technologies Monza Italy) were employed. For the TaqMan assay the reaction mixture consisted of 2 µl of cDNA template 7 µl of deionized H2O 1 µl of specific TaqMan Assay probe and primer mixture and 10 µl of TaqMan® Gene Expression Master Mix (Life Technologies Monza Italy). The thermal cycling conditions were: 15 min at 95°C followed by 15 s at 95°C and 60 s at 60°C (40 cycles). TaqMan ID assays are reported in Table S1. Seven housekeeping genes GAPDH HPRT1 B2M RPLP0 TBP GUSB and PPIA were tested for stability to be used as reference. The three most stable genes (RPLP0 HPRT and TBP) were determined based on the average M and the pair-wise variation values calculated with the tool geNorm [28]. Chemicals The drugs were dissolved in DMSO at the final concentration of 10 mM. Imatinib was purchased from Cayman Chemical (Michigan USA) and used in the range of 525 µM; Gemcitabine was obtained from Sigma Aldrich Corp. (St Louis MO USA) and used in the range of 110 µM; Cisplatin kindly donated by Prof. Justin Stebbing (Imperial College London) was used in the range 125 µM. The following antibodies were used: MSLN mouse monoclonal (Santa Cruz); ?-actin mouse monoclonal (Abcam) p53 mouse monoclonal (Santa Cruz); pERK mouse polyclonal (Abcam); PARP rabbit polyclonal (Cell Signaling); pAKT rabbit polyclonal (Abcam); ERK1-2 rabbit polyclonal (Abcam); Secondary HRP (horseradish peroxidase)-conjugated goat anti-rabbit IgG and goat antimouse IgG antibodies were from GE Healthcare. The expression plasmid pcDNA3.1 encoding for MSLN (aa 360-2230) was kindly donated by Dr. Uehara (Kansai Medical University Japan); the empty vector pcDNA3.1 employed as control was donated by Dr. Giamas (Imperial College London). siRNA and plasmid transfections siMSLN-1 and-2 were purchased from Qiagen (Qiagen S.p.A Milano Italy). The AllStars Negative Control siRNA (SI03650318) was used as non-targeting control (siRNA-Ctrl). siRNA oligonucleotides were re-suspended in the provided buffer at a final stock concentration of 20 µM. siRNA transfection was performed with the HiPerfect transfection reagent (Qiagen S.p.A Milano Italy) according to the manufacturers instructions. Plasmid transfections were performed using the FuGENE® Transfection Reagent (Promega Corp. Madison Wisc. USA)" | Lung_Cancer |
".0096911.t003 Basic demographic data and environmental risk factor in lung adenocarcinoma cases and controls. Variable Cases(%) Controls(%) P value Female 242 277 Mean age (±S.D.) 55.7±11.6 56.6±11.0 0.346a Income(yuan/month) 626.5±384.0 558.1±391.4 0.066a Education Never 26(10.7) 26(9.4) 0.305 Elementary school 111(45.9) 141(50.9) Junior school 76(31.4) 69(24.9) Senior school and upwards 29(12.0) 41(14.8) Fuel smoke exposure 66(27.3) 76(27.4) 0.967b Cooking oil fume exposure 86(35.5) 70(25.3) 0.011b* Family history of cancer 26(10.7) 30(10.8) 0.975b Passive smoking exposure 141(58.3) 158(57.0) 0.778b *P<0.05. a Student's t-test was used to compare the frequency distribution of demographic variables between the cases and controls. b Peason's chi square was used to compare the frequency distribution of demographic variables fuel smoke exposure cooking oil fume exposure family history of cancer passive smoking between the cases and controls. As shown in the mean ages of lung adenocarcinoma cases and controls (mean±S.D.) were similar (P>0.05). All cases were female non-smokers. There was no significant difference in the distribution of education fuel smoke exposure family history of cancer and passive smoking status between cases and controls. However the cases were more likely than the controls to report cooking oil fume exposure (P?=?0.011). summarized the relationship between ATM rs189037 genotypes and lung adenocarcinoma risk with the stratification analysis of cooking oil fume exposure. The results indicated that in the recessive model (AA vs GA/GG) individuals carrying AA genotype had a 1.69-fold risk of lung adenocarcinoma compared with those carrying GA or AA genotype (95%CI 1.092.61 P?=?0.019). Considering the difference in the distribution of cooking oil fume exposure between cases and controls we conducted the stratification analysis. Our data revealed that AA homozygous carriers had an increased risk of lung adenocarcinoma among women who were never or seldom exposed to cooking oil fume (OR?=?1.89 95%CI 1.033.49 P?=?0.040). To well-understood the possible interaction between rs189037 polymorphism and cooking oil fumes exposure next we conducted a combined analysis. But there was no significant correlation found between this SNP and cooking oil fumes exposure. .0096911.t004 Overall association stratification analysis and combined analysis between ATM rs189037 polymorphism and lung adenocarcinoma risk. Comparison model Genotype ORc 95%CI P value Overall GG ref GA 0.89 0.591.35 0.592 AA 1.57 0.932.62 0.089 dominant modela 1.05 0.701.55 0.825 recessive modelb 1.69 1.092.61 0.019* Stratified by cooking oil fuel exposure Yes GG ref GA 0.72 0.341.54 0.395 AA 1.19 0.433.24 0.740 dominant modela 0.81 0.391.68 0.573 recessive modelb 1.48 0.623.52 0.381 No GG ref GA 0.94 0.571.56 0.811 AA 1.89 1.033.49 0.040* dominant modela 1.16 0.721.87 0.542 recessive modelb 1.97 1.183.29 0.009* Cooking oil fumes exposure-genotype combined analysis non-exposed GG ref non-exposed GA 0.91 0.551.50 0.714 non-exposed AA 1.71 0.943.09 0.078 exposed GG 1.99 0.964.12 0.063 exposed GA 1.58 0.882.82 0.127 exposed AA 2.07 0.874.93 0.099 *P<0.05. a GA+AA vs GG. b AA vs GA+GG. c the overall test was adjusted for age fuel smoke exposure cooking oil fume exposure family history of cancer and passive smoking and the stratified analysis was adjusted for age fuel smoke exposure family history of cancer and passive smoking. Discussion It is well known that smoking is the most important risk factor for lung cancer but in the past 30years the incidence and death rate of lung cancer continues to increase in women who have a low rate of smoking [26][28]. Adenocarcinoma accounts for about 40% of all lung cancer with a higher incidence in women especially in those who have never smoked. Undoubtedly female non-smokers are the ideal subjects to examine unknown yet important environmental and genetic factors of lung adenocarcinoma. Exposure to cooking oil fume fuel smoke passive smoking and occupational exposures have been implicated as possible risk factors among Chinese women mainly based on Chinese people's traditional diet habits lifestyle and social environment [29] [30]. So we designed this study to evaluate the association between genetic variant and environmental risk factors and lung adenocarcinoma in female non-smokers. To date the association between ATM rs189037 and host susceptibility to lung adenocarcinoma in Chinese female non-smokers has not been well addressed. ATM rs189037 was a common polymorphism in the promoter of ATM gene. Studies have shown that this site possibly may regulate ATM protein activity due to regulation function of promoter as shown in most genes. And specific genotypes or haplotypes of ATM may play an important role in carcinogenesis through expression regulation or alternative splicing of the ATM gene [31]. We searched through NCBI (National Center for Biotechnology Information) dbSNP database to get the allele frequency of this polymorphism. The data indicated that the frequency of wild-type allele G was 61.1% and the frequency of variant allele A was 38.9% in Chinese Han population (http://www.ncbi.nlm.nih.gov/SNP/snp_ref.cgi?rs=rs189037). In this study our results was in accordance with the data from NCBI. In 2006 Kim et al.[25] evaluated the role of ATM rs189037 in lung cancer development In Korean population for the first time. No significant association was found between this polymorphism and lung cancer risk (P>0.05). They recruited 616 lung cancer patients in which 78.4% were male and 79.6% were cigarette smokers. As cigarette smoking might modulate the risk of lung cancer in turn it could be a confounder in the association between ATM rs189037 and lung cancer risk. Besides there was no gene-environment interactions be considered in their research. In 2010 Lo et al.[23] suggested that ATM rs189037 was associated with lung cancer risk among never smokers (AA vs GG: OR?=?1.61 95%CI 1.102.35) and this association might be modified by passive smoking. Although they have eliminated the cofounding effect of cigarette smoking by conducting their study in non-smokers the risk of lung cancer among different histological types still needed to be clarified. Recently Hsia et al.[24] put their attention on the association of ATM rs189037 with lung cancer susceptibility among ever smokers. No genotype frequency difference was found between lung cancer cases and controls among ever smokers (P>0.05). After summing up the omissions of their studies and combining with the current situation that Chinese non-smoking female lung adenocarcinoma incidence and fatality rate was increasingly rising up we performed this case-control study to elucidate the association between ATM rs189037 and lung adenocarcinoma risk. To the best of our knowledge this is the first study that has investigated whether ATM rs189037 was associated with lung adenocarcinoma risk in non-smoking Han-Chinese females. Our results have shown that individuals with exposure to cooking oil fume had a 1.63-fold increased risk of developing lung adenocarcinoma (P?=?0.011). Similar significant associations were observed in our previous studies of Chinese non-smoking females. Experimental studies have presented that fumes from cooking oils could be genotoxic because of the potential carcinogenic components such as polycyclic aromatic hydrocarbons (PAHs) and benzo[a]pyrene 78-diol 910-epoxide (BPDE) which involved in inducing DNA adducts and thus made a predisposition to lung adenocarcinoma [32][34]. Besides the method of cooking and throat or eyes irritation the interviewers also asked each woman the information on cooking oil fumes exposure such as the types of cooking oils she used the frequency she used stir frying or deep frying to prepare food ventilation conditions and the use of a fume extractor. Increasing epidemiological studies have reported cooking method and types of cooking oils on lung cancer susceptibility among Chinese females. Seow et al.[35]found that women who reported that they stir fried daily had a significantly increased risk of lung cancer (OR?=?2.0 95%CI 1.03.8) and risk was enhanced for those who stir fried meat daily (OR?=?2.7 95%CI 1.35.5). The elevated lung cancer risk might be attributed to heterocyclic amines generated during frying of meats. In addition the frequency of stir frying seemed to be related with lung cancer susceptibility. Gao et al. [36]investigated the association between the frequency of stir frying and lung cancer risk in Chinese females they observed that stir frying more than 30 dishes per week was associated with high risk of lung cancer (OR?=?2.6 95%CI 1.35.0). In a case-control study in northeast China Wu-Williams et al.[37] found that women who deep fried twice per month had a 2.1-fold increased risk of developing lung cancer than those who never used deep frying method. And there was a significant trend in risk with increasing number of meals cooked by deep frying. Also this kind of correlation was found in both non-smokers and lung adenocarcinoma population. For types of cooking oils Zhong et al.[38] reported that soybean oil was most commonly used in Shanghai and the use of rapeseed oil was associated with a higher risk of lung cancer (OR?=?1.84 95%CI 1.123.03). In this study we observed that ATM rs189037 AA genotype carriers were more susceptible to lung adenocarcinoma than GA or GG genotype carriers in a recessive model. This might not give direct support for AA genotype as a risk factor for lung adenocarcinoma. But the results reflected that G allele might be a protective factor for lung adenocarcinoma. So we compared AA genotype with GA genotype and our data showed that women who were AA genotype carriers had an elevated risk of lung adenocarcinoma (OR?=?1.74 95%CI 1.102.74 P?=?0.018). In other words GA genotype might be protective for developing lung adenocarcinoma. In the stratified analysis of cooking oil fumes exposure we also found that AA genotype carriers had a predisposition to lung adenocarcinoma in women who had no exposure of cooking oil fumes (OR?=?1.89 95%CI 1.033.49). Considering that G allele might be a protective factor for lung adenocarcinoma we then compared AA genotype with GA genotype to further validate our previous results. And it turned out that in the non-exposed group women who were AA genotype carriers had a higher risk of lung adenocarcinoma than those GA genotype carriers (OR?=?1.98 95%CI 1.153.40 P?=?0.014) which was in accordance with our previous data that G allele might be a protective factor for lung adenocarcinoma. But in the combined analysis of interaction of cooking oil fumes exposure and rs189037 polymorphism no significant association was found. We have described the distribution of any possible factors such as age passive smoking status fuel smoke exposure family history of cancer between cooking oil fumes exposed group and non-exposed group that might affect the association but none of these seemed to be different between exposed group and non-exposed group (Table 5). As tumor is a multifactorial disease we could infer that there might be other risk factors playing a role in the development of lung adenocarcinoma. We tended to believe that there might be other host genetic susceptibility or unknown risk factors caused the results. .0096911.t005 Table 5 Comparisons of distribution of risk factors between cooking oil fumes exposed group and non-exposed group. Variable Exposed(%) Non-exposed(%) P value Mean age (±S.D.) 56.3±11.7 56.1±11.1 0.871a Fuel smoke exposure 44(28.2%) 98(27.0%) 0.777b Passive smoking exposure 96(61.5%) 203(55.9%) 0.235b Family history of cancer 19(12.2%) 37(10.2%) 0.504b a Student's t-test was used to compare the frequency distribution of demographic variables between the exposed group and non-exposed group. b Peason's chi square was used to compare the frequency distribution of demographic variables fuel smoke exposure family history of cancer passive smoking between the exposed group and non-exposed group. There are several limitations in the current study. First hospital-based studies are likely to include some controls with non-malignant lung diseases especially those associated with chronic inflammatory processes are suspected to have predisposing factors for lung cancer. The ORs we found may be underestimated. Second the statistical power of the study may be limited by the relatively small sample size of subjects. In addition other SNPs in ATM gene and in this pathway may be involved in the risk of lung adenocarcinoma gene-gene interaction and haplotypes may offer more clues to clarity the association between host genetic susceptibility and lung adenocarcinoma risk. But it is noteworthy that our study investigated the association between ATM rs189037 polymorphism and lung adenocarcinoma risk in a non-smoking females population for the first time. Meanwhile we explored the combined effects of cooking oil fumes exposure and ATM rs189037 polymorphism on lung adenocarcinoma risk. As our small sample size and only one SNP genotyped large-scale studies with gene-gene and gene-environment interactions in different races and population are required to validate our findings. Conclusions In summary this hospital-based case-control study showed that ATM rs189037 might be associated with the risk of lung adenocarcinoma in Chinese non-smoking females. Furthermore ATM rs189037 AA genotype might be a risk factor affecting lung adenocarcinoma among females without cooking oil fume exposure. References 1 MattsonME PollackES CullenJW (1987) What are the odds that smoking will kill you?American journal of public health77: 4254313826460 2 WeiQ ChengL HongWK SpitzMR (1996) Reduced DNA repair capacity in lung cancer patients. Cancer Res56: 410341078797573 3 SpitzMR WeiQ DongQ AmosCI WuX (2003) Genetic susceptibility to lung cancer: the role of DNA damage and repair. Cancer Epidemiol Biomarkers Prev12: 68969812917198 4 KurzEU Lees-MillerSP (2004) DNA damage-induced activation of ATM and ATM-dependent signaling pathways. DNA Repair (Amst)3: 88990015279774 5 PetriniJH StrackerTH (2003) The cellular response to DNA double-strand breaks: defining the sensors and mediators. Trends Cell Biol13: 45846212946624 6 LavinMF KozlovS (2007) ATM activation and DNA damage response. Cell Cycle6: 93194217457059 7 SavitskyK Bar-ShiraA GiladS RotmanG ZivY et al (1995) A single ataxia telangiectasia gene with a product similar to PI-3 kinase. Science268: 174917537792600 8 KastanMB LimDS (2000) The many substrates and functions of ATM. Nat Rev Mol Cell Biol1: 17918611252893 9 KastanMB BartekJ (2004) Cell-cycle checkpoints and cancer. Nature432: 31632315549093 10 TaulanM LopezE GuittardC ReneC BauxD et al (2007) First functional polymorphism in CFTR promoter that results in decreased transcriptional activity and Sp1/USF binding. Biochem Biophys Res Commun361: 77578117678620 11 SchultzJ LorenzP IbrahimSM KundtG GrossG et al (2009) The functional -443T/C osteopontin promoter polymorphism influences osteopontin gene expression in melanoma cells via binding of c-Myb transcription factor. Mol Carcinog48: 142318459127 12 MenzaghiC ParoniG De BonisC SoccioT MarucciA et al (2006) The -318 C>G single-nucleotide polymorphism in GNAI2 gene promoter region impairs transcriptional activity through specific binding of Sp1 transcription factor and is associated with high blood pressure in Caucasians from Italy. J Am Soc Nephrol17: S11511916565233 13 FreyUH HaunerH JockelKH MantheyI BrockmeyerN et al (2008) A novel promoter polymorphism in the human gene GNAS " | Lung_Cancer |
"(5.9 versus 5.4 months; p = 0.847) (Fig. 3B). The objective response rate was significantly lower in patients with uncommon EGFR mutations compared with the objective response rate in those with common EGFR mutations when treated with gefitinib (20% versus 76%; p = 0.017) (supplementary Table S2 Supplemental Digital Content 1 http://links.lww.com/JTO/A494). By contrast similar objective response rates were observed for patients with uncommon EGFR mutations and those with common EGFR mutations in the carboplatin-paclitaxel group (20% versus 32%; p = 0.336) (supplementary Table S2 Supplemental Digital Content 1 http://links.lww.com/JTO/A494). FIGURE 3. Progression-free survival curves in the gefitinib group (A) and the carboplatin-paclitaxel group (B) according to the type of epidermal growth factor receptor mutation. DISCUSSION Recent studies suggest that NSCLC patients with uncommon EGFR mutations are less responsive to EGFR-TKIs compared with patients with L858R and exon 19 deletions.920 However the efficacy of EGFR-TKIs in NSCLC patients with uncommon mutations has not been fully elucidated. We conducted a post-hoc analysis of the NEJ002 study to evaluate the effectiveness of gefitinib against NSCLC with G719X or L861Q. The NEJ002 study comparing gefitinib and standard carboplatin-paclitaxel chemotherapy as the first-line treatment for patients with EGFR mutations demonstrated no significant difference in OS between gefitinib and carboplatin-paclitaxel.6 In contrast to other phase 3 trials investigating EGFR-TKIs for patients with common EGFR mutations of exon 19 deletion and L858R the NEJ002 is the only study that included uncommon EGFR mutations of G719X and L861Q. The current study clearly demonstrated that NSCLC patients with the uncommon EGFR mutations G719X and L861Q had shorter survival than the survival of those with an exon 19 deletion or L858R mutation (Fig. 2). Our results are consistent with other clinical studies on EGFR-TKIs in patients with uncommon EGFR mutations (supplementary Table S3 Supplemental Digital Content 1 http://links.lww.com/JTO/A494). The overall response rate to EGFR-TKIs in patients with uncommon EGFR mutations was 41% which is lower than the response rate to TKIs (62%83%) of patients with common EGFR mutations.7824 In the NEJ002 study G719X included G719C and G719S. No patients harbored G719A. To investigate the effectiveness of gefitinib on each uncommon EGFR mutations we evaluated the difference in OS between patients with uncommon EGFR mutations (G719C versus G719S and G719X versus L861Q). There was no significant difference between these subgroups (data not shown). This study showed that the PFS and OS tended to be shorter among patients treated with first-line gefitinib compared with PFS and OS among those treated with first-line carboplatin-paclitaxel in the uncommon EGFR mutation group (supplementary Table S2 Supplemental Digital Content 1 http://links.lww.com/JTO/A494). We also found poor disease control rate with gefitinib in patients with uncommon mutations. Three of five patients with uncommon mutations in the gefitinib group had progressive disease. By contrast no patients with uncommon mutations had progressive disease in the carboplatin-paclitaxel group. Although the number of patients with uncommon mutations in each treatment group was small platinum-doublet therapy might be a better choice than gefitinib for first-line therapy in patients with uncommon EGFR mutations. Because some of patients with uncommon mutations showed good clinical response to gefitinib in this study and they seemed to be heterogeneous in terms of response to gefitinib administration of gefitinib should be considered for patients with uncommon mutations when disease progression was observed after first-line chemotherapy. In vitro studies have indicated that the affinity of gefitinib for EGFR proteins with uncommon EGFR mutations is lower than the affinity of gefitinib for EGFR proteins with common EGFR mutations.25 A sixfold or 14-fold higher concentration of gefitinib was required to inhibit the growth of cells expressing G719X or L861Q respectively compared with cells expressing L858R.26 These results may explain the lack of response to gefitinib in patients with uncommon EGFR mutations. The authors also examined the sensitivity of G719X and L861Q mutations to erlotinib and irreversible TKIs.27 Cells expressing G719X were less resistant to erlotinib than gefitinib in vitro; however L861Q was resistant to both erlotinib and gefitinib. In contrast to erlotinib irreversible TKIs inhibited the growth of cells with G719X or L861Q at a lower concentration than those with wild-type EGFR. Indeed Sequist et al.28 reported that the effectiveness of an irreversible pan-ErbB receptor TKI neratinib on NSCLC patients with G719X. Niratinib induced partial responses in three of four patients with G719X and the fourth had durable stable disease for 40 weeks. It may be beneficial to evaluate erlotinib as a treatment for NSCLCs with G719X and irreversible EGFR-TKIs as treatments for NSCLCs with G719X and L861Q. Because previous phase 3 trials that investigated erlotinib or irreversible TKIs for NSCLC with EGFR mutations did not include uncommon EGFR mutations further clinical studies may need to be performed.7829 Another possible strategy for the treatment of uncommon EGFR mutations is the combination of EGFR-TKIs and cytotoxic agents. Our group has undertaken a randomized phase 3 trial to compare gefitinib plus carboplatin plus pemetrexed with gefitinib monotherapy for patients with NSCLC with an exon 19 deletion or an L858R G719X or L861Q EGFR mutation (NEJ009; University Hospital Medical Information Network Clinical Trials Registry [UMIN-CTR] number UMIN000006340). The data from this study will advance the treatment of NSCLC with uncommon EGFR mutations. In our post-hoc analysis clearly demonstrated shorter survival of TKI-treated patients with uncommon EGFR mutations compared with survival of those with common EGFR mutations. Furthermore the data suggest that the first-line chemotherapy may be relatively effective for NSCLC with uncommon EGFR mutations. ACKNOWLEDGMENTS Special thanks to Hiromi Odagiri for her expert assistance with data collection and management. This study was supported by the Tokyo Cooperative Oncology Group. The first two authors contributed equally to this work. Disclosure: Dr. Yoshizawa received grants and lecture fees from AstraZeneca; Dr. Maemondo received lecture fees from AstraZeneca and Chugai; Dr. Inoue received lecture fees from AstraZeneca and Chugai; Dr. Gemma received grants and lecture fees from AstraZeneca; Dr. Hagiwara received patent fees from Mitsubishi Chemical Medience consulting fees and lecture fees from AstraZeneca; Dr. Kobayashi received grants from Novartis Nihon Kayaku Chugai Shionogi Kyowa Kirin Yakult Taiho and AstraZeneca and lecture fees from AstraZeneca Chugai and Bristol-Myers Squibb. The remaining authors declare no conflict of interest. REFERENCES 1. Kim ES Hirsh V Mok T Gefitinib versus docetaxel in previously treated non-small-cell lung cancer (INTEREST): a randomised phase III trial. Lancet 2008 372 1809 1818 19027483 2. Shepherd FA Rodrigues Pereira J Ciuleanu T National Cancer Institute of Canada Clinical Trials Group Erlotinib in previously treated non-small-cell lung cancer. N Engl J Med 2005 353 123 132 16014882 3. Lynch TJ Bell DW Sordella R Activating mutations in the epidermal growth factor receptor underlying responsiveness of non-small-cell lung cancer to gefitinib. N Engl J Med 2004 350 2129 2139 15118073 4. Paez JG EGFR mutations in lung cancer: correlation with clinical response to gefitinib therapy. Science 2004 304 1497 1500 15118125 5. Mitsudomi T Morita S Yatabe Y West Japan Oncology Group Gefitinib versus cisplatin plus docetaxel in patients with non-small-cell lung cancer harbouring mutations of the epidermal growth factor receptor (WJTOG3405): an open label randomised phase 3 trial. Lancet Oncol 2010 11 121 128 20022809 6. Maemondo M Inoue A Kobayashi K North-East Japan Study Group Gefitinib or chemotherapy for non-small-cell lung cancer with mutated EGFR. N Engl J Med 2010 362 2380 2388 20573926 7. Rosell R Carcereny E Gervais R Spanish Lung Cancer Group in Collaboration with Groupe" | Lung_Cancer |
"Basic demographic data and environmental risk factor in lung adenocarcinoma cases and controls. Variable Cases(%) Controls(%) P value Female 242 277 Mean age (±S.D.) 55.7±11.6 56.6±11.0 0.346a Income(yuan/month) 626.5±384.0 558.1±391.4 0.066a Education Never 26(10.7) 26(9.4) 0.305 Elementary school 111(45.9) 141(50.9) Junior school 76(31.4) 69(24.9) Senior school and upwards 29(12.0) 41(14.8) Fuel smoke exposure 66(27.3) 76(27.4) 0.967b Cooking oil fume exposure 86(35.5) 70(25.3) 0.011b* Family history of cancer 26(10.7) 30(10.8) 0.975b Passive smoking exposure 141(58.3) 158(57.0) 0.778b *P<0.05. a Student's t-test was used to compare the frequency distribution of demographic variables between the cases and controls. b Peason's chi square was used to compare the frequency distribution of demographic variables fuel smoke exposure cooking oil fume exposure family history of cancer passive smoking between the cases and controls. As shown in the mean ages of lung adenocarcinoma cases and controls (mean±S.D.) were similar (P>0.05). All cases were female non-smokers. There was no significant difference in the distribution of education fuel smoke exposure family history of cancer and passive smoking status between cases and controls. However the cases were more likely than the controls to report cooking oil fume exposure (P?=?0.011). summarized the relationship between ATM rs189037 genotypes and lung adenocarcinoma risk with the stratification analysis of cooking oil fume exposure. The results indicated that in the recessive model (AA vs GA/GG) individuals carrying AA genotype had a 1.69-fold risk of lung adenocarcinoma compared with those carrying GA or AA genotype (95%CI 1.092.61 P?=?0.019). Considering the difference in the distribution of cooking oil fume exposure between cases and controls we conducted the stratification analysis. Our data revealed that AA homozygous carriers had an increased risk of lung adenocarcinoma among women who were never or seldom exposed to cooking oil fume (OR?=?1.89 95%CI 1.033.49 P?=?0.040). To well-understood the possible interaction between rs189037 polymorphism and cooking oil fumes exposure next we conducted a combined analysis. But there was no significant correlation found between this SNP and cooking oil fumes exposure. .0096911.t004 Overall association stratification analysis and combined analysis between ATM rs189037 polymorphism and lung adenocarcinoma risk. Comparison model Genotype ORc 95%CI P value Overall GG ref GA 0.89 0.591.35 0.592 AA 1.57 0.932.62 0.089 dominant modela 1.05 0.701.55 0.825 recessive modelb 1.69 1.092.61 0.019* Stratified by cooking oil fuel exposure Yes GG ref GA 0.72 0.341.54 0.395 AA 1.19 0.433.24 0.740 dominant modela 0.81 0.391.68 0.573 recessive modelb 1.48 0.623.52 0.381 No GG ref GA 0.94 0.571.56 0.811 AA 1.89 1.033.49 0.040* dominant modela 1.16 0.721.87 0.542 recessive modelb 1.97 1.183.29 0.009* Cooking oil fumes exposure-genotype combined analysis non-exposed GG ref non-exposed GA 0.91 0.551.50 0.714 non-exposed AA 1.71 0.943.09 0.078 exposed GG 1.99 0.964.12 0.063 exposed GA 1.58 0.882.82 0.127 exposed AA 2.07 0.874.93 0.099 *P<0.05. a GA+AA vs GG. b AA vs GA+GG. c the overall test was adjusted for age fuel smoke exposure cooking oil fume exposure family history of cancer and passive smoking and the stratified analysis was adjusted for age fuel smoke exposure family history of cancer and passive smoking. Discussion It is well known that smoking is the most important risk factor for lung cancer but in the past 30years the incidence and death rate of lung cancer continues to increase in women who have a low rate of smoking [26][28]. Adenocarcinoma accounts for about 40% of all lung cancer with a higher incidence in women especially in those who have never smoked. Undoubtedly female non-smokers are the ideal subjects to examine unknown yet important environmental and genetic factors of lung adenocarcinoma. Exposure to cooking oil fume fuel smoke passive smoking and occupational exposures have been implicated as possible risk factors among Chinese women mainly based on Chinese people's traditional diet habits lifestyle and social environment [29] [30]. So we designed this study to evaluate the association between genetic variant and environmental risk factors and lung adenocarcinoma in female non-smokers. To date the association between ATM rs189037 and host susceptibility to lung adenocarcinoma in Chinese female non-smokers has not been well addressed. ATM rs189037 was a common polymorphism in the promoter of ATM gene. Studies have shown that this site possibly may regulate ATM protein activity due to regulation function of promoter as shown in most genes. And specific genotypes or haplotypes of ATM may play an important role in carcinogenesis through expression regulation or alternative splicing of the ATM gene [31]. We searched through NCBI (National Center for Biotechnology Information) dbSNP database to get the allele frequency of this polymorphism. The data indicated that the frequency of wild-type allele G was 61.1% and the frequency of variant allele A was 38.9% in Chinese Han population (http://www.ncbi.nlm.nih.gov/SNP/snp_ref.cgi?rs=rs189037). In this study our results was in accordance with the data from NCBI. In 2006 Kim et al.[25] evaluated the role of ATM rs189037 in lung cancer development In Korean population for the first time. No significant association was found between this polymorphism and lung cancer risk (P>0.05). They recruited 616 lung cancer patients in which 78.4% were male and 79.6% were cigarette smokers. As cigarette smoking might modulate the risk of lung cancer in turn it could be a confounder in the association between ATM rs189037 and lung cancer risk. Besides there was no gene-environment interactions be considered in their research. In 2010 Lo et al.[23] suggested that ATM rs189037 was associated with lung cancer risk among never smokers (AA vs GG: OR?=?1.61 95%CI 1.102.35) and this association might be modified by passive smoking. Although they have eliminated the cofounding effect of cigarette smoking by conducting their study in non-smokers the risk of lung cancer among different histological types still needed to be clarified. Recently Hsia et al.[24] put their attention on the association of ATM rs189037 with lung cancer susceptibility among ever smokers. No genotype frequency difference was found between lung cancer cases and controls among ever smokers (P>0.05). After summing up the omissions of their studies and combining with the current situation that Chinese non-smoking female lung adenocarcinoma incidence and fatality rate was increasingly rising up we performed this case-control study to elucidate the association between ATM rs189037 and lung adenocarcinoma risk. To the best of our knowledge this is the first study that has investigated whether ATM rs189037 was associated with lung adenocarcinoma risk in non-smoking Han-Chinese females. Our results have shown that individuals with exposure to cooking oil fume had a 1.63-fold increased risk of developing lung adenocarcinoma (P?=?0.011). Similar significant associations were observed in our previous studies of Chinese non-smoking females. Experimental studies have presented that fumes from cooking oils could be genotoxic because of the potential carcinogenic components such as polycyclic aromatic hydrocarbons (PAHs) and benzo[a]pyrene 78-diol 910-epoxide (BPDE) which involved in inducing DNA adducts and thus made a predisposition to lung adenocarcinoma [32][34]. Besides the method of cooking and throat or eyes irritation the interviewers also asked each woman the information on cooking oil fumes exposure such as the types of cooking oils she used the frequency she used stir frying or deep frying to prepare food ventilation conditions and the use of a fume extractor. Increasing epidemiological studies have reported cooking method and types of cooking oils on lung cancer susceptibility among Chinese females. Seow et al.[35]found that women who reported that they stir fried daily had a significantly increased risk of lung cancer (OR?=?2.0 95%CI 1.03.8) and risk was enhanced for those who stir fried meat daily (OR?=?2.7 95%CI 1.35.5). The elevated lung cancer risk might be attributed to heterocyclic amines generated during frying of meats. In addition the frequency of stir frying seemed to be related with lung cancer susceptibility. Gao et al. [36]investigated the association between the frequency of stir frying and lung cancer risk in Chinese females they observed that stir frying more than 30 dishes per week was associated with high risk of lung cancer (OR?=?2.6 95%CI 1.35.0). In a case-control study in northeast China Wu-Williams et al.[37] found that women who deep fried twice per month had a 2.1-fold increased risk of developing lung cancer than those who never used deep frying method. And there was a significant trend in risk with increasing number of meals cooked by deep frying. Also this kind of correlation was found in both non-smokers and lung adenocarcinoma population. For types of cooking oils Zhong et al.[38] reported that soybean oil was most commonly used in Shanghai and the use of rapeseed oil was associated with a higher risk of lung cancer (OR?=?1.84 95%CI 1.123.03). In this study we observed that ATM rs189037 AA genotype carriers were more susceptible to lung adenocarcinoma than GA or GG genotype carriers in a recessive model. This might not give direct support for AA genotype as a risk factor for lung adenocarcinoma. But the results reflected that G allele might be a protective factor for lung adenocarcinoma. So we compared AA genotype with GA genotype and our data showed that women who were AA genotype carriers had an elevated risk of lung adenocarcinoma (OR?=?1.74 95%CI 1.102.74 P?=?0.018). In other words GA genotype might be protective for developing lung adenocarcinoma. In the stratified analysis of cooking oil fumes exposure we also found that AA genotype carriers had a predisposition to lung adenocarcinoma in women who had no exposure of cooking oil fumes (OR?=?1.89 95%CI 1.033.49). Considering that G allele might be a protective factor for lung adenocarcinoma we then compared AA genotype with GA genotype to further validate our previous results. And it turned out that in the non-exposed group women who were AA genotype carriers had a higher risk of lung adenocarcinoma than those GA genotype carriers (OR?=?1.98 95%CI 1.153.40 P?=?0.014) which was in accordance with our previous data that G allele might be a protective factor for lung adenocarcinoma. But in the combined analysis of interaction of cooking oil fumes exposure and rs189037 polymorphism no significant association was found. We have described the distribution of any possible factors such as age passive smoking status fuel smoke exposure family history of cancer between cooking oil fumes exposed group and non-exposed group that might affect the association but none of these seemed to be different between exposed group and non-exposed group (Table 5). As tumor is a multifactorial disease we could infer that there might be other risk factors playing a role in the development of lung adenocarcinoma. We tended to believe that there might be other host genetic susceptibility or unknown risk factors caused the results. .0096911.t005 Table 5 Comparisons of distribution of risk factors between cooking oil fumes exposed group and non-exposed group. Variable Exposed(%) Non-exposed(%) P value Mean age (±S.D.) 56.3±11.7 56.1±11.1 0.871a Fuel smoke exposure 44(28.2%) 98(27.0%) 0.777b Passive smoking exposure 96(61.5%) 203(55.9%) 0.235b Family history of cancer 19(12.2%) 37(10.2%) 0.504b a Student's t-test was used to compare the frequency distribution of demographic variables between the exposed group and non-exposed group. b Peason's chi square was used to compare the frequency distribution of demographic variables fuel smoke exposure family history of cancer passive smoking between the exposed group and non-exposed group. There are several limitations in the current study. First hospital-based studies are likely to include some controls with non-malignant lung diseases especially those associated with chronic inflammatory processes are suspected to have predisposing factors for lung cancer. The ORs we found may be underestimated. Second the statistical power of the study may be limited by the relatively small sample size of subjects. In addition other SNPs in ATM gene and in this pathway may be involved in the risk of lung adenocarcinoma gene-gene interaction and haplotypes may offer more clues to clarity the association between host genetic susceptibility and lung adenocarcinoma risk. But it is noteworthy that our study investigated the association between ATM rs189037 polymorphism and lung adenocarcinoma risk in a non-smoking females population for the first time. Meanwhile we explored the combined effects of cooking oil fumes exposure and ATM rs189037 polymorphism on lung adenocarcinoma risk. As our small sample size and only one SNP genotyped large-scale studies with gene-gene and gene-environment interactions in different races and population are required to validate our findings. Conclusions In summary this hospital-based case-control study showed that ATM rs189037 might be associated with the risk of lung adenocarcinoma in Chinese non-smoking females. Furthermore ATM rs189037 AA genotype might be a risk factor affecting lung adenocarcinoma among females without cooking oil fume exposure. References 1 MattsonME PollackES CullenJW (1987) What are the odds that smoking will kill you?American journal of public health77: 4254313826460 2 WeiQ ChengL HongWK SpitzMR (1996) Reduced DNA repair capacity in lung cancer patients. Cancer Res56: 410341078797573 3 SpitzMR WeiQ DongQ AmosCI WuX (2003) Genetic susceptibility to lung cancer: the role of DNA damage and repair. Cancer Epidemiol Biomarkers Prev12: 68969812917198 4 KurzEU Lees-MillerSP (2004) DNA damage-induced activation of ATM and ATM-dependent signaling pathways. DNA Repair (Amst)3: 88990015279774 5 PetriniJH StrackerTH (2003) The cellular response to DNA double-strand breaks: defining the sensors and mediators. Trends Cell Biol13: 45846212946624 6 LavinMF KozlovS (2007) ATM activation and DNA damage response. Cell Cycle6: 93194217457059 7 SavitskyK Bar-ShiraA GiladS RotmanG ZivY et al (1995) A single ataxia telangiectasia gene with a product similar to PI-3 kinase. Science268: 174917537792600 8 KastanMB LimDS (2000) The many substrates and functions of ATM. Nat Rev Mol Cell Biol1: 17918611252893 9 KastanMB BartekJ (2004) Cell-cycle checkpoints and cancer. Nature432: 31632315549093 10 TaulanM LopezE GuittardC ReneC BauxD et al (2007) First functional polymorphism in CFTR promoter that results in decreased transcriptional activity and Sp1/USF binding. Biochem Biophys Res Commun361: 77578117678620 11 SchultzJ LorenzP IbrahimSM KundtG GrossG et al (2009) The functional -443T/C osteopontin promoter polymorphism influences osteopontin gene expression in melanoma cells via binding of c-Myb transcription factor. Mol Carcinog48: 142318459127 12 MenzaghiC ParoniG De BonisC SoccioT MarucciA et al (2006) The -318 C>G single-nucleotide polymorphism in GNAI2 gene promoter region impairs transcriptional activity through specific binding of Sp1 transcription factor and is associated with high blood pressure in Caucasians from Italy. J Am Soc Nephrol17: S11511916565233 13 FreyUH HaunerH JockelKH MantheyI BrockmeyerN et al (2008) A novel promoter polymorphism in the human gene GNAS " | Lung_Cancer |
"We also evaluated chest CT findings to determine the involvement of emphysema. The percentage of the COPD group with involvement of emphysema in the chest CT findings was almost twice as high as that of the non-COPD group (38.8% vs 20.3% respectively). Patient characteristics among non-COPD and COPD patients All cases (n?=?270) Non-COPD (n?=?123) COPD (n?=?147) p value Cases 100 (270) 45.6 (123) 54.4 (147) 0.0001 # Age years a 70.1 (3988) 67.9 (3982) 71.9 (5187) 0.0001 # Sex male 73.7 (199) 62.6 (77) 83.0 (122) 0.0001 # History of smoking 78.9 (213) 65.9 (81) 89.8 (132) 0.0001 # COPD managed b 8.5 (23) 1.6 (2) 14.3 (21) 0.0001 # COPD-related systemic comorbidities 55.9 (151) 52.8 (65) 58.5 (86) 0.390 Diabetes 19.3 (52) 16.3 (20) 21.8 (32) 0.280 Ischemic cardiac disease 7.4 (20) 2.4 (3) 11.6 (17) 0.004 # Hypertension 38.1 (103) 37.4 (46) 38.8 (57) 0.900 Hyperlipidemia 11.9 (32) 8.1 (10) 15.0 (22) 0.092 n indicates number. aData are shown as mean (range). bindicates the patients who had been diagnosed as COPD before bronchoscopy. All other data are shown as% (numbers). #p?<?0.05. COPD: chronic obstructive pulmonary disease. Population of non-COPD and COPD in Japanese patients with lung cancer. Schematic presentation of the percentage of non-COPD (n?=?123) and COPD (n?=?147) among Japanese patients with lung cancer. Patients with COPD were classified by GOLD grade that is grade 1 (n?=?95) grade 2 (n?=?41) grade 3 (n?=?11) and grade 4 (n?=?0). Physical assessment variables among non-COPD and COPD patients All cases (n?=?270) Non-COPD (n?=?123) COPD (n?=?147) p value BMI (kg/m 2 ) a 22.1 (2.8) 22.0 (2.8) 22.2 (2.9) 0.749 spirometric variables %VC a 105.9 (20.6) 104.8 (20.8) 106.7 (20.5) 0.520 FEV1 (ml) a 2062 (610) 2302 (555) 1861 (583) 0.0001 # FEV1/FVC a 67.3 (12.6) 77.8 (6.3) 58.9 (10.3) 0.0001 # %FEV1 predicted a 98.2 (25.7) 109.4 (21.1) 88.9 (25.4) 0.0001 # %IC a 85.9 (19.5) 83.6 (17.8) 87.9 (20.6) 0.111 chest CT finding emphysema 30.4 (82) 20.3 (25) 38.8 (57) 0.001 # n indicates number. aData are shown as mean (SD). All other data are shown as% (numbers). #p?<?0.05. BMI: body mass index; VC: vital capacity; FEV1: forced expiratory volume in 1 second; FVC: forced vital capacity; IC: inspiratory capacity; GOLD: the Global Initiative for Chronic Obstructive Lung Disease. Association of COPD prevalence with lung cancer characteristics in Japanese patients undergoing bronchoscopy To evaluate the association of COPD with characteristics of lung cancer the pathological findings EGFR mutation status clinical staging and decision for thoracic surgery were compared between the COPD group and the non-COPD group (). Characteristics of lung cancer status among non-COPD and COPD patients All cases (n?=?270) Non-COPD (n?=?123) COPD (n?=?147) p value Pathology 0.0001 # Adenocarcinoma 53.7 (145) 69.9 (86) 40.1 (59) ## Sq 27.0 (73) 17.9 (22) 34.7 (52) ## NSCLC 10.4 (28) 4.9 (6) 15.0 (21) ## SCLC 6.7 (18) 5.7 (7) 7.5 (11) Large 2.2 (6) 1.6 (2) 2.7 (4) Clinical stage 0.046 # 1A 25.6 (69) 30.8 (38) 21.1 (31) 1B 13.7 (37) 13.0 (16) 13.6 (20) 2A 9.6 (26) 13.0 (16) 7.5 (11) 2B 7.8 (21) 9.8 (12) 6.1 (9) 3A 11.9 (32) 8.9 (11) 14.3 (21) 3B 5.6 (15) 4.1 (5) 6.8 (10) 4 17.0 (46) 16.3 (20) 17.7 (26) ND 8.9 (24) 4.1 (5) 12.9 (19) ## Thoracic surgery 0.0001 # Yes 138 (51.1) 64.2 (79) 40.1 (59) EGFR mutation status 0.001 # Yes 14.8 (40) 21.1 (26) 9.5 (14) ## No 55.2 (149) 59.3 (73) 51.7 (76) ND 30.0 (81) 19.5 (24) 38.8 (57) ## n indicates number. All data are shown as% (numbers). ND indicates not determined. #p?<?0.05. ##indicates a significant difference compared with the non-COPD group. COPD: chronic obstructive pulmonary disease; Sq: squamous cell carcinoma; NSCLC: non-small cell lung carcinoma; SCLC: small cell lung carcinoma; Large: large cell carcinoma; EGFR: epidermal growth factor receptor. Regarding pathologic findings the incidence of adenocarcinoma was significantly lower in the COPD group than in the non-COPD group. In the present study EGFR mutation was observed only in the patients with adenocarcinoma (40/145 cases; 27.6%). In contrast the number of cases in which EGFR mutation status was not determined was significantly higher in the COPD group than in the non-COPD group. Although determination of the clinical stage should be essential in order to propose the therapeutic options for lung cancer some cases in which clinical staging had not been completed were observed in the study population. The number of these cases was significantly higher in the COPD group than in the non-COPD group. In contrast the proportion of patients with each classification in the clinical staging did not differ between the two groups besides the cases in which the clinical staging was not determined. Among the total study population the number of thoracic surgeries performed was significantly lower in the COPD group than in the non-COPD group. Critical impact of the severity of airflow obstruction on the decision to propose thoracic surgery with curative intent To explore whether or not the severity of airflow obstruction might affect the decision to propose thoracic surgery with curative intent patients at stage 3B and 4 were excluded from the analysis because they were not eligible for thoracic surgery. In addition patients for whom the clinical staging had not been completed were also excluded. As a result we evaluated data from 185 patients with lung cancer at stage 1A to 3A who underwent spirometry and bronchoscopy. These patients were subdivided into those who underwent thoracic surgery (135 cases) and those who did not (50 cases). The characteristics and spirometric data for the patients with or without thoracic surgery are summarized in Tables 4 and 5. The characteristics of lung cancer among these groups are also shown in . Univariate analysis identified a significantly lower frequency of thoracic surgery among the patients of greater age and with more severe airway obstruction and advanced clinical staging. Univariate analysis also identified a significantly higher frequency of thoracic surgery among patients with adenocarcinoma. Finally all of the factors with a significant association in the univariate analysis were applied to the multivariate model to identify variables independently associated with the decision for thoracic surgery. Multivariate analysis identified more severe airway obstruction advanced clinical stagings and higher age as independent factors affecting the decision on thoracic surgery ()." | Lung_Cancer |
"These results have also been included in our supplementary material. A comparison of FDR curves based on three data sets. A comparison of false discovery rate (FDR) curve based on our proposed method for concordant integrative gene set enrichment analysis with the FDR curves based on the gene set analysis (GSA) for individual data sets. In each plot the black solid curve represents the results based on our method; the black dashed curve represents the results based on GSA for the Boston data; the black dotted curve represents the results based on GSA for the Michigan data; the black dot-dashed curve represents the results based on GSA for the Stanford data. The gray dotted lines represent three FDR levels: 0.05 0.1 and 0.2. Both up-regulated (a) and down-regulated (b) differential expression based analysis results are presented. Among the gene sets with FDR < 0.05 we observed many interesting pathways. Among these 74 identified based on down-regulated differential expression there were pathways related to immune system TCR signaling viral myocarditis BCR signaling cell survival WNT-?-catenin signaling cytokine PI3K VEGF signaling interleukins and GPCR signaling. Among these 99 identified based on up-regulated differential expression there were pathways related to different metabolism cell cycle checkpoints and related phases and transitions DNA replication synthesis damage and repair p53 glycolysis gluconeogenesis telomere maintenance and extension apoptosis TGF-? signaling tRNA aminoacylation gene expression lung cancer and PDGF signaling. Consistency between two application results We also investigated whether the inclusion of an additional data set to our previous integrative analysis of two data sets would still generate consistent results. (Notice that the number of common genes was much reduced from 5216 to 2865 when the Stanford data set was included. This would change the number of selected pathways as shown above.) shows the scatter plot for the paired CES calculated based on two data sets and CES calculated based on three data sets (separately for up-regulated and down-regulated differential expression). For each plot a clear correlation pattern can be observed. The Spearman correlation coefficients were both greater than 0.75 for these two plots (0.804 and 0.760). We also compared the listed of selected pathways with FDR < 0.05 (see above for details). For up-regulated differential expression there were 92 pathways in common (among 224 selected based on two data sets and 99 selected based on three data sets); for down-regulated differential expression there were 11 pathways in common (among 15 selected based on two data sets and 74 selected based on three data sets). If [(the number of commonly selected pathways)/(the number of smallest list of selected pathways)] was used as the overlap proportion then we would have 92/99 = 92.9% and 11/15 = 73.3% as the overlap proportions for up-regulated and down-regulated differential expression respectively. Therefore a satisfactory consistency between both results was also observed. A comparison of CESs based on two application results. A comparison of our concordant integrative gene set enrichment analysis results based on two data sets to the results based on three data sets. In each plot the gray dots represent the paired concordant enrichment scores (CESs) for all pathways in the Version 3.0 of the C2 canonical pathway collection and the black dots represent the paired CESs for pathways with FDR< 0.05 for both analysis results. Both up-regulated (a) and down-regulated (b) differential expression based analysis results are presented. About two pathways mentioned particularly in our first application there were two proteasome pathways in the Version 3.0 of the C2 canonical pathway collection: one given by BioCarta and the other given by KEGG. For both pathways their CESs and FDRs for up-regulated differential expression were consistently respectively > 0.999 and < 0.001 based on our integrative analysis of two data sets and these values were also consistently respectively > 0.95 and < 0.005 based on our integrative analysis of three data sets. There were also two BCR signaling pathways collected by KEGG and Signaling Gateway their CESs and FDRs for down-regulated differential expression were consistently respectively > 0.95 and < 0.01 based on our integrative analysis of three data sets. Based on our integrative analysis of two data sets the CES and FDR for the pathway by KEGG were respectively > 0.7 and < 0.2 and these two values for the pathway by Signaling Gateway were respectively > 0.9 and ~ 0.05. shows different paired z-scores from three data sets and the z-scores for these two pathways are highlighted for an illustration. Illustrative examples based on three data sets. Two illustrative examples for our proposed method for a concordant integrative gene set enrichment analysis of three data sets. In each plot the gray dots represent all paired z-scores for 2865 common human genes and the black dots represent the paired z-scores for the gene set specified in the title. KEGG cancer pathways There is a collection of cancer pathways in the database of Kyoto Encyclopedia of Genes and Genomes (KEGG with web link http://www.genome.jp/kegg/). According to the database updated on July 242013 17 pathways are associated with lung cancer and general cancer studies. lists 16 of these pathways that are also in the Version 3.0 of the C2 canonical pathway collection. (The KEGG PI3K-AKT signaling pathway is not included since it is not listed in the C2 collection. Notice that only pathways from KEGG are included. Pathways with same or similar names from other online databases like Reactome are not considered here. This ensures the consistency between the gene sets from the C2 collection and the gene sets mentioned in the KEGG cancer pathways.) Since a pathway could be enriched in either up-regulated or down-regulated differential expression we would choose the one with larger CES if the absolute difference of two CESs was greater than 0.1 (same results observed when this threshold value was set between 0.05 to 0.15) which was a conservative choice of threshold value. Otherwise we would not present any further analysis results for this pathway. For examples if these two CESs were 0.5 (up-regulated) and 0.45 (down-regulated) then no further analysis results would be presented for this pathway; if these two CESs were 0.8 (up-regulated) and 0.1 (down-regulated) then the analysis results based on up-regulated differential expression would be presented. For these 16 pathways listed in the results from the analysis described in our first and second applications were consistent. All the pathways except the TGF-? signaling pathway showed FDRs < 0.2 for at least one applications. Ten and eight pathways showed FDRs < 0.1 and FDRs < 0.05 respectively for at least one applications. Furthermore all sixteen pathways showed FDRs < 0.25 for at least one applications.An exploration of KEGG cancer pathways.Two data setsThree data sets KEGG cancer pathways U/D CES Diff. FDR CES Diff. FDR PPAR signaling *down0.671 >0.10.1940.563 >0.10.210MAPK signaling **down0.639 >0.10.2090.857 >0.10.063ERBB signaling *up0.629 >0.10.1190.581 >0.10.188Calcium signaling **down0.925 >0.10.0510.694 >0.10.153Cytokine-cytokine receptor interaction ***down0.717 >0.10.1720.943 >0.10.022Cell cycle ***up0.998 >0.1 <0.0010.959 >0.10.012p53 signaling ***up0.999 >0.1 <0.0010.944 >0.10.018MTOR signaling *down0.724 >0.10.1670.611 >0.10.193Apoptosis *down ? 0.10.776 >0.10.102WNT signaling ***down ? 0.10.888 >0.10.048TGF-? signalingdown ? 0.10.521 >0.10.236VEGF signaling ***down0.784 >0.10.1360.919 >0.10.033Focal adhesion ***up >0.999 >0.1 <0.0010.830 >0.10.077ECM receptor interaction ***up0.996 >0.1 <0.0010.977 >0.10.005Adherens junction *up0.646 >0.10.114 ? 0.1JAK-STAT signaling ***down0.875 >0.10.0820.901 >0.10.044Our application results for sixteen KEGG cancer pathways. ""Diff"" column presents the absolute difference between the CES based on up-regulated differential expression and the CES based on down-regulated differential expression. If ""Diff""? 0.1 then no further analysis results is presented. Otherwise the larger CES as well as the related FDR and differential expression direction (up or down) are presented in the ""CES"" ""FDR"" and ""U/D"" columns respectively. Both application results (an integrative analysis of two data sets and an integrative analysis of three data sets) are presented for the listed pathways. Pathways with symbols * ** or *** means that FDRs < 0.2 FDRs < 0.1 or FDRs < 0.05 are observed for at least one applications respectively. Conclusions In this study we proposed a mixture model based statistical method for the concordant integrative gene set enrichment analysis. " | Lung_Cancer |
"Therefore we will conduct a pilot study to explore the feasibility of estimating the ICER using person-level data from medical records and other sources. This will allow us to prepare for a future more comprehensive CEA of DAPs across multiple sites. Sampling Because this is a pilot study we will focus our efforts on one breast and one lung DAP at one site to examine whether and how data routinely collected in medical records can be used as the main source of data for costing. This site was chosen because they have collected DAP-specific data for several years and used it for internal reporting and the site is easily accessible to investigators which facilitates data collection and minimizes study costs. The patient sample will be similar to that used for the retrospective observational study at this site. Data collection and analysis As the purpose of this pilot costing analysis is to explore the potential for estimating costs using readily available program hospital and patient data we will focus on data related to service use. Costs are calculated as price times quantity and the data we are collecting from patient charts are the quantities. The number and nature of all diagnostic services provided to each eligible patient will be extracted. This will be reviewed with collaborators to create a standardized list of defined unique services for which costs will be acquired from hospital sources and OHIP billing codes. The question of interest is whether the patient chart provides relevant data on health service use. By costing the data in the charts this produces a fuller estimate of Total Cost. We will use a paired t-test for each patient to test whether the Total Cost using the chart data is statistically significantly different from the Total Cost using data acquired from hospital or program sources. Key informant interviews Approach Telephone interviews will be conducted with health professionals staff and referring physicians from each DAP to learn about barriers and facilitators of ICC. Qualitative methods based on a grounded approach will be used to guide sampling data collection and analysis [36]. The theoretical framework will inform interview questions and their analysis. Sampling and recruitment Interviewees will be identified by the collaborating key contact for each DAP (known sponsor approach). One manager nurse and physician from each DAP plus two referring physicians will be recruited for a minimum target of 40 interviews to collect information from individuals who vary by health profession and site sampling criteria (purposive sampling). They will be invited by regular mail and email and asked to sign and return a signed consent form. Information from representative rather than a large number of participants is needed in qualitative research. It is not meant to produce generalizable results but to provide an in-depth exploration of issues. Sampling is concurrent with data collection and analysis and proceeds until no further unique themes emerge (thematic saturation). If saturation is not achieved after 40 interviews further interviews will be pursued with additional individuals identified by the key contact and by interviewees (snowball sampling). Data collection and analysis A semi-structured interview guide will be developed to explore how DAP structure operation and other factors influence or challenge ICC. Participants will be prompted to discuss system or anizational support team structure and team processes and how these factors influence ICC and outcomes. The interview guide will be pilot-tested with one manager and one clinician from a DAP not participating in the study to refine the wording and flow of questions. Telephone interviews of approximately 30 minutes will be audio-recorded and converted to text by a professional transcriptionist. Unique themes will be identified in an inductive manner using constant comparative technique [3738]. Transcripts will be read independently by two individuals to identify define and anize themes. A log will be maintained of emerging codes their definition and sample narrative illustrating application of that code (open coding). The narrative will be reviewed (constant comparative technique) to identify all instances of the coding framework and items not matching the framework to determine how to expand or merge thematic codes (axial coding). The two will compare findings and achieve consensus through discussion. A third individual will resolve any conflicts. Coded text will be tabulated by theme and DAP to compare and interpret results. Discussion As our population ages an increase in the absolute number of cancer patients is expected. To improve their care and outcomes enhanced ICC is needed. The proposed study constitutes phase one of a longitudinal research program that will evaluate existing and alternative interventions to support ICC for cancer. It also represents the next phase in the evaluation of DAPs as a model by which to enable ICC following evaluation of diagnostic wait times for pilot program implemented across Ontario. The proposed study may be limited in a number of ways. Medical record review will not be comprehensive of all cases at all DAPs across Ontario and clinical measures are limited to wait times and receipt of basic diagnostic tests. However the study is exploratory overall and will attempt to identify whether particular DAP features that enable ICC appear to be associated with shorter wait times or more consistent receipt of diagnostic tests. If there are trends this would warrant a future larger-scale study to confirm such associations. Site sampling enhances the relevance of findings because we will include DAPs with a variety of features. Evaluation is informed by published and evidence-based DAP and clinical guidelines and by a theoretical framework of ICC generated by review of several relevant bodies of knowledge. The costing component will establish a taxonomy of DAP visits and services and associated costs that could be used by all DAPs to calculate costs and in a future cost effectiveness study." | Lung_Cancer |
"]a 2 (29) [4?71] 2 (15) [2?45] 4 (20) [6?44] No. of patients n 10 13 23 No. of PFS eventsf n (%) 8 (80) 11 (85) 19 (83) PFS weeks [95% CI] 8 [2?25] 9 [5?18] 8 [5?18] PFS probability at 6 months [95% CI] 14 [1?45] 6 [0?25] No. of deaths n (%) 6 (60) 12 (92) 18 (78) OS weeks 36 [2 ] 26 [8?36] 26 [10?47] Survival probability at 6 months [95% CI] 50 [18?75] 46 [19?70] 48 [27?66] Survival probability at 12 months [95% CI] 40 [12?67] 23 [6?48] 30 [14?49] A total of 12 patients were censored for PFS 10 in arm A and 2 in arm B (Arm A: 7 patients discontinued treatment before the first on?study assessment [4 because of AE and 3 because of global deterioration]; 1 had inadequate baseline assessment; 1 was still ongoing with study treatment; 1 was no longer willing to participate and had no PD documented. Arm B: 1 patient discontinued because of AE and had SD; 1 was no longer willing to participate and had no PD documented). a Using exact method based on binomial distribution. b For arm A: one?sided P?value for the hypothesis testing H0: ORR was ?5% using exact binomial test. For arm B: one?sided P?value for the hypothesis testing H0: ORR was ?1% using exact binomial test. c Confirmed EGFR mutation. d EGFR status unknown. e Confirmed EGFR wild type. f Objective progression or death. g One patient had E746_A750del5 exon 19; 1 patient had G719C exon 18 and S768I exon 20. h This patient had HER2 amplification and mutation. Abbreviations: CI confidence interval; CR complete response; H0 null hypothesis; NA not applicable; ORR objective response rate; PFS progression?free survival; PR partial response; SD stable disease. Of the 36 patients with SD as BOR (median duration 15 weeks) 10 patients (28%) had prolonged clinical benefit (SD??6 months); of these 5 patients had EGFR?mutant tumors 3 had EGFR wild?type tumors and 2 had tumors of unknown EGFR status. Of 56 patients with both baseline and??1 postbaseline tumor measurement 26 (46%) had some degree of tumor shrinkage (Fig. 2). Among patients with tumor shrinkage 6 (23%) and 12 (46%) were confirmed as having EGFR?WT tumors and EGFR?mutant tumors respectively; 8 (31%) had tumors of unknown EGFR status. Tumor shrinkage was noted in 1 patient with an EGFR T790M tumor; all other EGFR T790M tumors increased in size. Maximum percentage change is shown in target lesions per RECIST (Response Evaluation Criteria in Solid Tumors) in 56 patients with both a baseline and at least one on?study measurement reflected in the database. Six patients had no change in the size of their tumor; of these 1 had EGFR mutation 1 had EGFR of unknown status and 4 had EGFR wild?type tumors. image Progression?Free Survival Overall median PFS (n?=?66) was 12 weeks with 54 (82%) patients reaching PFS events and similar values in the adenocarcinoma and nonadenocarcinoma populations. Median PFS in the adenocarcinoma group was 12 weeks based on 50 patients. In the nonadenocarcinoma group median PFS was 11 weeks (Fig. 3A). Median PFS in patients with EGFR mutation?positive tumors was 18 weeks based on 26 patients with 21 (81%) achieving PFS events; this median was longer than that seen in the overall population. The 6 patients with documented T790M had a median PFS of 7 weeks which was similar to that of patients with EGFR wild?type tumors (8 weeks). Kaplan?Meier curves show (A) progression?free survival and (B) overall survival by arm (all patients). CI indicates confidence interval. image Overall Survival At the time of data cutoff 47 patients (71%) had died and median OS was 37 weeks in the overall population 45 weeks in patients with adenocarcinoma and 27 weeks in patients with nonadenocarcinoma (Fig. 3B). Of the 26 patients with EGFR mutation?positive tumors (both arms) median OS was 57 weeks OS6M was 81% and OS12M was 59%. Safety and Tolerability The majority of treatment?related AEs were of grade 1 or 2 severity () and were manageable with standard supportive care. Common events included diarrhea (85%) dermatitis acneiform (68%) dry skin (38%) fatigue (38%) exfoliative rash (24%) stomatitis (24%) decreased appetite (23%) and pruritus (23%). One patient experienced treatment?related grade 4 AEs of dyspnea and pulmonary embolism considered by the investigator to be possibly related to study drug; 18 patients (27%) experienced treatment?related AEs with a maximum severity of grade 3. The majority of patients (n?=?44 67%) did not require a dose reduction and interruption of daily dosing was seen in 33% for evaluation and management of AEs. Of the 22 patients who did require dose reduction 17 patients had 1 dose reduction and 5 had 2 dose reductions. AEs resulting in dose modification were predominantly dermatologic or gastrointestinal. Six patients permanently discontinued dacomitinib due to treatment?related AEs which included grade 4 dyspnea (day 8) and grade 4 pulmonary embolism (day 9) (both in a single patient); grade 3 fatigue (day 14); grade 3 exfoliative rash (day 134); grade 2 allergic dermatitis (day 3); grade 2 fatigue (day 85); and grade 1 fatigue (day 43). Twelve deaths occurred within 28 days following the last dose of dacomitinib and were reported as serious AEs; none was considered to be treatment?related. Treatment?Related Adverse Events Occurring in ?10% of Patients in the Overall Population (N?=?66) and Hematologic Laboratory Values by Maximum CTCAE Grade (All Cycles; N?=?66) Adverse Event Grade 1/2n (%) Grade 3n (%) Total n (%) Any adverse events 46 (69.7) 18 (27.3)a 65 (98.5) Diarrhea 48 (72.7) 8 (12.1) 56 (84.8) Dermatitis acneiform 41 (62.1) 4 (6.1) 45 (68.2) Dry skin 25 (37.9) 0 25 (37.9) Fatigue 23 (34.8) 2 (3.0) 25 (37.9) Exfoliative rash 14 (21.2) 2 (3.0) 16 (24.2) Stomatitis 15 (22.7) 1 (1.5) 16 (24.2) Decreased appetite 15 (22.7) 0 15 (22.7) Pruritus 12 (18.2) 3 (4.5) 15 (22.7) Nausea 13 (19.7) 0 13 (19.7) Vomiting 8 (12.1) 1 (1.5) 9 (13.6) Aspartate aminotransferase increased 8 (12.1) 0 8 (12.1) Mucosal inflammation 7 (10.6) 0 7 (10.6) Hematologic Laboratory Values Grade 1/2n (%) Grade 3n (%) Total n (%) Hemoglobin 36 (54.5) 1 (1.5) 50 (75.8) Lymphopenia 10 (15.2) 12 (18.2)b 40 (60.6) Neutropenia 2 (3.0) 1 (1.5) 4 (6.1) Thrombocytopenia 4 (6.1) 1 (1.5)c 5 (7.6) Leukopenia 10 (15.2) 0 11 (16.7) a Includes two grade 4 events (dyspnea and pulmonary embolism) both experienced by the same patient. b Includes 2 patients with grade 4 events. c Grade 4. Patient?Reported Outcomes Completion rates for the EORTC QLQ?C30/?LC13 and DLQI questionnaires were high throughout the study (generally?>90% of patients answered at least one question). Patients with radiographic disease control reported improvement in lung cancer symptoms of dyspnea cough pain in chest and pain in arm/shoulder relative to baseline scores first observed after 3 weeks on therapy (Supporting Fig. 1A). Diarrhea was the most commonly reported class?related AE; diarrhea peaked at cycle 3 day 1 (week 6) and remained stable over time (Supporting Fig. 1B). With a score of 0?=?no symptoms and 100?=?most symptoms patients on dacomitinib reported scores that were at the midpoint in the range at their worst. The impact of dacomitinib on PRO for NSCLC symptoms and dermatologic toxicity has been previously presented and will be subsequently reported in full (Campbell AK et al; unpublished data). Pharmacokinetics PK parameters (overall and by histology) following a single dose (cycle 1 day 1) and mean Ctrough values after multiple doses for dose?compliant patients (Supporting ) were consistent with those previously reported.5 Pharmacodynamics Soluble HER2 and EGFR levels were slightly decreased on day 1 of most cycles compared with baseline for most patients. One patient with nonadenocarcinoma demonstrating HER2 amplification had elevated baseline soluble HER2 that significantly declined to population normal baseline levels upon treatment with dacomitinib. This patient's tumor also demonstrated a PR.16 Discussion In this phase 2 trial dacomitinib demonstrated an overall response rate of 5% but the primary endpoint of this study was not met. Three PRs were observed 2 in patients with EGFR mutation?positive tumors and 1 in a patient whose tumor was EGFR wild?type with HER2 amplification.16 In contrast patients with known EGFR T790M did not respond to dacomitinib therapy despite efficacy in preclinical models. These observations could be due to the presence of concurrent drug resistance mechanisms (such as MET amplification)18 or to the inability of dacomitinib to fully inhibit EGFR in tumors harboring EGFR T790M at the doses currently under clinical investigation.5 Strategies to improve EGFR inhibition in EGFR T790M cancers include the combination of irreversible EGFR inhibitors with the EGFR?directed antibody cetuximab (as reported for afatinib plus cetuximab)19; the development of more potent and specific inhibitors of EGFR T790M2021; and the use of intermittent but high doses of existing irreversible EGFR inhibitors.18 In contrast where resistance is mediated by compensatory signaling pathways or tumors harbor more than one concomitant drug resistance mechanism combination strategies with targeted agents in appropriately selected patients will be necessary to treat such cancers (eg inhibition of the MET pathway). In the absence of a known oncogene addiction patients with wild?type EGFR may still benefit from EGFR?directed therapy in the absence of a RECIST?defined radiographic response; endpoints such as PFS and patient report of HRQoL and symptom relief have become increasingly important in a noncurative setting.22 This is demonstrated in the BR21 trial of erlotinib versus placebo where the ORR was low and yet was associated with improvements versus placebo in OS and NSCLC symptoms.10 In the current study in refractory NSCLC 10 of 36 patients with SD as BOR derived prolonged clinical benefit (SD???6 months) with dacomitinib; patients also reported a rapid onset of improvement in key lung cancer symptoms with symptomatic improvements remaining durable over the course of therapy. Common AEs were typically gastrointestinal or dermatologic and consistent with targeting EGFR.24 By patient report both gastrointestinal and dermatologic symptoms peaked early in treatment and stabilized or improved over time (Campbell AK et al; unpublished data). The benefits seen in this study may reflect dacomitinib's broader mode of action in targeting all kinase?active HER family members irreversible binding to the tyrosine kinase domain retreatment in some of those patients with an EGFR?driven tumor following a period off treatment after a prior selective EGFR TKI or other as yet to be determined factors. Data from this and other phase 1 and 2 studies in post?EGFR TKI settings5 and from a head?to?head trial comparing dacomitinib with erlotinib in the second?line setting8 suggest that dacomitinib has clinically relevant activity in patients with NSCLC who do not harbor KRAS mutations. However in the absence of a control arm it remains unclear if this degree of benefit seen here could be due to patient selection or favorable prognostic factors. A phase 3 trial is underway to determine the efficacy and safety of dacomitinib compared with erlotinib in patients with KRAS wild?type NSCLC for whom first?line chemotherapy has failed (ARCHER 1009; ClinicalTrials.gov identifier NCT01360554). " | Lung_Cancer |
"The work cannot be changed in any way or used commercially. Introduction: In nonsmall-cell lung cancer an exon 19 deletion and an L858R point mutation in the epidermal growth factor receptor (EGFR) are predictors of a response to EGFR-tyrosine kinase inhibitors. However it is uncertain whether other uncommon EGFR mutations are associated with sensitivity to EGFR-tyrosine kinase inhibitors. Methods: A post-hoc analysis to assess prognostic factors was performed with the use of patients with EGFR mutations (exon 19 deletion L858R G719X and L861Q) who were treated with gefitinib in the NEJ002 study which compared gefitinib with carboplatin-paclitaxel as the first-line therapy. Results: In the NEJ002 study 225 patients with EGFR mutations received gefitinib at any treatment line. The Cox proportional hazards model indicated that performance status response to chemotherapy response to gefitinib and mutation types were significant prognostic factors. Overall survival (OS) was significantly shorter among patients with uncommon EGFR mutations (G719X or L861Q) compared with OS of those with common EGFR mutations (12 versus 28.4 months; p = 0.002). In the gefitinib group (n = 114) patients with uncommon EGFR mutations had a significantly shorter OS (11.9 versus 29.3 months; p < 0.001). By contrast OS was similar between patients with uncommon mutations and those with common mutations in the carboplatin-paclitaxel group (n = 111; 22.8 versus 28 months; p = 0.358). Conclusions: The post-hoc analyses clearly demonstrated shorter survival for gefitinib-treated patients with uncommon EGFR mutations compared with the survival of those with common mutations and suggest that the first-line chemotherapy may be relatively effective for nonsmall-cell lung cancer with uncommon EGFR mutations. Gefitinib G719X L861Q NEJ002 Uncommon epidermal growth factor receptor mutations OPEN-ACCESS TRUE The clinical efficacy of epidermal growth factor receptor-tyrosine kinase inhibitors (EGFR-TKIs) such as gefitinib and erlotinib has been demonstrated in nonsmall-cell lung cancer (NSCLC) patients in whom standard chemotherapy has failed.12 Further studies have revealed that the presence of activating mutations in the EGFR kinase domain is strongly associated with the therapeutic efficacy of EGFR-TKIs.34 Randomized phase 3 trials have demonstrated that EGFR-TKIs significantly improve median progression-free survival (PFS) compared with platinum-doublet therapy in EGFR-mutated patients.58 However not all mutations in the EGFR kinase domain are responsive to EGFR-TKI treatment. These phase 3 trials have shown that EGFR-TKIs are effective for patients with common EGFR mutations such as an exon 19 deletion or the L858R point mutation which account for more than 90% of EGFR mutations. Retrospective studies and case reports suggest that some uncommon mutations are associated with sensitivity to EGFR-TKIs.920 These mutations include G719X in exon 18 which accounts for approximately 3% of EGFR mutations and L861Q in exon 21 which represents approximately 2% of EGFR mutations. However these uncommon EGFR mutations have not been clearly shown to be predictive markers for the efficacy of EGFR-TKIs because of their low frequency. To investigate the efficacy of gefitinib in patients with uncommon mutations we conducted a post-hoc analysis of the NEJ002 which compared gefitinib and carboplatin-paclitaxel as first-line therapies for advanced NSCLC with activating EGFR mutations. PATIENTS AND METHODS Patient Population We retrospectively analyzed the data of 225 patients who received gefitinib treatment at any point in the NEJ002 study.6 The eligibility criteria of the NEJ002 study included the presence of advanced NSCLC harboring an EGFR mutation (exon 19 deletion or L858R G719X or L861Q point mutation) without the resistant EGFR mutation T790M (identified using the peptide nucleic acidlocked nucleic acid polymerase chain reaction clamp method) no history of chemotherapy an age of 75 years or younger a performance status of 0 to 1 and appropriate an function.2122 Patients provided a written informed consent. The study was conducted in accordance with the Helsinki Declaration of the World Medical Association. The protocol was approved by the institutional review board of each participating institution. Treatment Eligible patients were randomly assigned to receive either gefitinib (250 mg/day) or paclitaxel (200 mg/m2)/carboplatin (area under the curve 6.0) on day 1 every 3 weeks. Chemotherapy was continued for at least three cycles. Gefitinib was administered until the disease progressed intolerable toxicities developed or consent was withdrawn. The protocol recommended that the crossover regimen be used as a second-line treatment. Clinical Assessments The antitumor response to treatment was assessed using computed tomography every 2 months. Unidirectional measurements were adopted on the basis of the Response Evaluation Criteria in Solid Tumors (version 1.0).23 PFS was evaluated from the date of randomization to the date when disease progression was first observed or death occurred. The treatment response and PFS were determined by an external review of computed tomography scans by experts who were not aware of the treatment assignments. Overall survival (OS) was evaluated from the date of randomization to the date of death. Statistical Analysis To assess prognostic factors for OS we used univariate and multivariate Cox proportional hazards models. KaplanMeier survival curves were constructed for PFS and OS and differences between groups were identified using the log-rank test. Differences in response rates were identified using Fishers exact test. Each analysis was two sided with a 5% significance level and a 95% confidence interval. All analyses were performed using SAS for Windows software (release 9.1; SAS Institute Cary NC). RESULTS Patient Population A total of 230 chemonaive patients were enrolled in the NEJ002 study: 115 patients were assigned to receive gefitinib and 115 were assigned to receive carboplatin-paclitaxel (Fig. 1). To evaluate the efficacy of gefitinib in NSCLC patients with uncommon EGFR mutations we analyzed the data of 114 patients in the gefitinib group and 111 patients in the carboplatin-paclitaxel group. We identified five patients who had uncommon EGFR mutations in each group. Two patients who had common mutations and were treated with first-line chemotherapy consisting of carboplatin-paclitaxel were excluded from the PFS analysis in the NEJ002 study. However both were treated with gefitinib and were included in this post-hoc analysis. The demographic and disease characteristics of the patients with uncommon EGFR mutations were similar to those of patients with common EGFR mutations (). The characteristics of each patient with uncommon EGFR mutations are shown in supplementary Table S1 (Supplemental Digital Content 1 http://links.lww.com/JTO/A494). FIGURE 1. Enrollment randomization and follow-up of the study patients. TABLE 1. Patient Characteristics Survival Factors In the univariate analysis of 225 patients who received gefitinib at any point uncommon EGFR mutations had a significant detrimental effect on survival (). We also identified performance statuses 1 and 2 distant metastasis brain metastasis stable disease and progressive disease as significant predictors of worse prognosis for standard chemotherapy and stable disease and progressive disease as significant predictors of worse prognosis for gefitinib. When these variables were included in the Cox proportional hazards model we found that uncommon EGFR mutations performance statuses 1 and 2 stable disease and progressive disease for standard chemotherapy and stable disease and progressive disease for gefitinib had significant hazard ratios (). TABLE 2. Univariate and Multivariate Analysis by Cox Proportional Hazards Model Uncommon EGFR Mutations and Survival The KaplanMeier curve for OS for uncommon versus common EGFR mutations is shown in A. The OS was significantly shorter among patients with uncommon EGFR mutations compared with OS of those with common EGFR mutations in the overall population (12 versus 28.4 months; p = 0.002). A significantly shorter survival time was observed in patients with uncommon EGFR mutations compared with survival time in those with common EGFR mutations in the gefitinib group (11.9 versus 29.3 months; p < 0.001) (Fig. 2B). However a similar survival time was observed between the subgroups of uncommon and common EGFR mutations in the carboplatin-paclitaxel group (22.8 versus 28 months; p= 0.358) (Fig. 2C). FIGURE 2. The overall survival curves of patients with common mutations and uncommon mutations in the entire population (A) the gefitinib group (B) and the carboplatin-paclitaxel group (C). To examine whether the sequence of platinum doublet and gefitinib affected OS we performed a further subgroup analysis. The survival time tended to be shorter among patients receiving first-line gefitinib compared with the survival time among those receiving first-line carboplatin-paclitaxel in the uncommon EGFR mutation group (11.9 versus 22.8 months; p = 0.102). Consistent with previous publications a similar survival time was observed between patients receiving first-line gefitinib and those receiving first-line carboplatin-paclitaxel in the common EGFR mutation group (29.3 versus 28 months; p = 0.378). Uncommon EGFR Mutations PFS and Response In the gefitinib group the median PFS was significantly shorter for patients with uncommon EGFR mutations compared with median PFS of those with common EGFR mutations (2.2 versus 11.4 months; p < 0.001) (Fig. 3A). By contrast the median PFS did not differ significantly between patients with uncommon EGFR mutations and those with common EGFR mutations in the carboplatin-paclitaxel group (5.9 versus 5.4 " | Lung_Cancer |
"Clin Cancer Res 2012 18 6599 6608 23052255 24 Shaw AT Ceritinib in ALK-rearranged non-small-cell lung cancer. N Engl J Med 2014 370 1189 1197 24670165 25 Galkin AV Identification of NVP-TAE684 a potent selective and efficacious inhibitor of NPM-ALK. Proc Natl Acad Sci U S A 2007 104 270 275 17185414 26 Morris SW Fusion of a kinase gene ALK to a nucleolar protein gene NPM in non-Hodgkin's lymphoma. Science 1994 263 1281 1284 8122112 27 Li H Durbin R Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics 2009 25 1754 1760 19451168 28 Li H The Sequence Alignment/Map format and SAMtools. Bioinformatics 2009 25 2078 2079 19505943 29 McKenna A The Genome Analysis Toolkit: a MapReduce framework for analyzing next-generation DNA sequencing data. Genome research 2010 20 1297 1303 20644199 30 Gainor JF ALK Rearrangements Are Mutually Exclusive with Mutations in EGFR or KRAS: An Analysis of 1683 Patients with Non-Small Cell Lung Cancer. Clin Cancer Res 2013 31 Dunning MJ Smith ML Ritchie ME Tavare S beadarray: R classes and methods for Illumina bead-based data. Bioinformatics 2007 23 2183 2184 17586828 32 Su Z A platform for rapid detection of multiple oncogenic mutations with relevance to targeted therapy in non-small-cell lung cancer. J Mol Diagn 2011 13 74 84 21227397 Exceptional response to an IGF-1R inhibitor prior to ALK TKI therapy in a patient with ALK+ lung cancer Representative images from serial CT scans of the chest in a 50 year-old female with ALK+ lung cancer documenting responses to the indicated therapies. Images are labeled af in temporal sequence. The red circles in ac represent a new lesion in the right lung that developed after 1 month of erlotinib and then responded to erlotinib plus an IGF-1R antibody. The scale bar in a indicates 4 cm and is representative for all images. Combination therapy with an IGF-1R inhibitor plus an ALK inhibitor promotes cooperative inhibition of cell growth in TKI sensitive ALK+ lung cancer cells (a) H3122 (EML4-ALK E13;A20) lung cancer cells were treated with crizotinib or crizotinib + MAb391. Soft agar assays were performed to assess growth inhibition. Each point represents hextuplicate biological replicates. Data are presented as the percentage of viable cells compared to control (vehicle only) cells and are representative of three independent experiments. P values were determined with the Student's T-test. (bd) H3122 (EML4-ALK E13;A20) (b) H2228 (EML4-ALK 6a/b;A20) (c) and STE-1 (EML4-ALK E13;A20) (d) lung cancer cells were treated with increasing amounts of crizotinib OSI-906 or the combination for 72h. Cell titer blue assays were performed to assess growth inhibition. Each point represents hextuplicate biological replicates. Data are presented as the percentage of viable cells compared to control (vehicle only) cells and are representative of three or more independent experiments. (e) STE-1 cells were treated with one dose of 1 ?M crizotinib 2 ?M OSI-906 or the combination for a total of 72h prior to harvest. Cells were stained with propidium iodide (PI) and counted on a FACSCalibur machine. (f) H3122 cells were treated with crizotinib OSI-906 or the combination for 2h prior to harvest. Lysates were subjected to immunoblotting with antibodies specific for the indicated proteins. Select images were quantified using a Bio-Rad Gel Doc XR and Image Lab software (Supplementary Fig. 1i and Supplementary Fig. 2b). IRS-1 knock-down impairs downstream signaling and blocks proliferation of ALK+ lung cancer cells (a) H3122 cells were treated with crizotinib or crizotinib + IGF-1 for 72h. Cell titer blue assays were performed to assess growth inhibition. Each point represents hextuplicate biological replicates. Data are presented as the percentage of viable cells compared to control. (b) H3122 cells were serum starved overnight and then treated with the indicated TKIs for 6h. As indicated cells were then stimulated with IGF-1 for 10min. Lysates were subjected to immunoblotting with antibodies specific for the indicated proteins. (c) H3122 cells were treated with vehicle or crizotinib. Lysates were subjected to immunoprecipitation (IP) for IRS-1 and western blotting for the indicated antibodies. (d) Tumor containing lung tissue from two different EML4-ALK E13;A20 transgenic mice were pulverized lysed and subjected to immunoprecipitation (IP) for IRS-1 and western blotting for the indicated antibodies. (e) STE-1 cells were transfected with the non-targeting siRNA (NT) or with two distinct pools of IRS-1 siRNA and treated with 500nM crizotinib for 72h . Lysates were subjected to immunoblotting with antibodies specific for the indicated proteins. (f) STE-1 cells were transfected with the indicated siRNAs and treated with 500 nM crizotinib for 72h. Triplicate biological replicates for each sample were counted on Coulter Counter. P values were determined with the Student's T-test. Data are representative of three independent experiments. (g) Western blot showing IRS-1 knockdown in the experiment shown in Fig. 3f. The IGF-1R pathway is activated in models of ALK TKI resistance Isogenic pairs of H3122 parental (i.e. TKI sensitive) crizotinib-resistant (CR) or X-376-resistant (XR) cells were treated with crizotinib (a) or X-376 (b). Cell titer blue assays were performed with hextuplicate biological replicates. Data shown are representative of ? 3 independent experiments. (c) H3122 XR cells were treated with X-376 for 4h. Lysates were subjected to immunoblotting with antibodies specific for the indicated proteins. (d) H3122 XR cells were treated with X-376 or X-376 + MAb391. Soft agar assays were performed using hextuplicate biological replicates. Data are representative of two independent experiments. (e) H3122 XR cells were treated with X-376 or X-376 + OSI-906 for 72h. Cell titer blue assays were performed with hextuplicate biological replicates. Data are representative of three independent experiments. (f) H3122 XR cells were treated with X-376 AEW-541 or the combination daily for 72h. Cells were stained with propidium iodide (PI) and counted on a FACSCantoII machine. (g) H3122 XR cells were treated with the indicated inhibitors for 4h. Lysates were subjected to immunoblotting with antibodies specific for the indicated proteins. (h) H3122 XR cells were transfected with the indicated siRNAs and treated with 500 nM X-376 for 72h. Quadruplicate biological replicates for each sample were counted on Coulter Counter. Data are representative of three independent experiments. (i) Western blots confirming IRS-1 knockdown in the experiment shown in Fig. 4h. All P values shown were determined with the Student's T-test. Increased IGF-1R and IRS-1 in patient biopsy samples at the time of acquired resistance to crizotinib (ab) Tumor samples taken before and at the time of resistance to ALK TKI therapy were analyzed for IGF-1R pY1161 expression (a) and for IRS-1 expression (b) by immuno-histochemistry. All images viewed correspond to a magnification of 40x. The scale bar indicates 200 micometers. (cd) RNA was extracted from formalin-fixed paraffin embedded tumor biopsy samples prior to and at the time of progressive disease on crizotinib and run on the NanoString assay. Expression levels of IGF-1R (c) and IRS-1 (d) are compared pre- and post- crizotinib. NanoString target sequences for IGF-1R have been previously reported23. The colored dots within each box plot represent distinct pairs of matched pre- and post- crizotinib samples. The black dots indicate the patient sample. The red dots and the green dots represent H3122 parental (TKI sensitive cells) compared with H3122 CR cells at 1 crizotinib resistance (1 ?M final concentration of crizotinib red dot) or H3122 CR cells at 2 crizotinib resistance (2 ?M final concentration of crizotinib green dot). The blue dots represent H3122 parental compared with H3122 XR cells. P values were determined with a modified paired T-test using the limma package. The second generation ALK inhibitor LDK-378 blocks phosphorylation of both ALK and IGF-1R (a) H3122 lung cancer cells containing the EML4-ALK E13;A20 fusion were treated with increasing amounts of crizotinib LDK-378 or TAE-684 for 72h. Cell titer blue assays were performed to assess growth inhibition. Each point represents hextuplicate biological replicates. Data are presented as the percentage of viable cells compared to control (vehicle only treated) cells and are representative of three or more independent experiments. (b) Athymic nu/nu female mice were injected subcutaneously with H3122 lung cancer cells harboring the EML4-ALK E13;A20 fusion. When tumors reached an average volume of 100mm3 mice were randomized to receive crizotinib alone (50 mg kg?1 p.o. daily 5 days) LDK-378 alone (50 mg kg?1 p.o. daily 5 days) or vehicle control (n = 5 for crizotinib and LDK-378 n = 4 for vehicle control). Tumor volumes were assessed every 3-4 days. *P = 0.0159 based on the Wilcoxon rank sum test. (cd) H3122 (c) and H2228 cells (d) were grown overnight in the presence or absence of serum and then treated with LDK-378 for 1 hour. As indicated cells were then stimulated with IGF-1 for 10min and harvested. Lysates were subjected to immunoblotting with antibodies specific for the indicated proteins. 0372741 3058 Clin Pharmacol Ther Clin. Pharmacol. Ther. Clinical pharmacology and therapeutics 0009-9236 1532-6535 24781527 4180036 10.1038/clpt.2014.93 NIHMS612008 Article Erlotinib in African Americans with Advanced Non-Small Cell Lung Cancer: A Prospective Randomized Study with Genetic and Pharmacokinetic Analysis Phelps Mitch A. 1 2 * Stinchcombe Thomas E. 3 * Blachly James S. 2 Zhao Weiqiang 2 Schaaf Larry J. 1 2 Starrett Sherri L. 4 Wei Lai 5 Poi Ming 2 Wang Danxin 2 Papp Audrey 2 Aimiuwu Josephine 1 Gao Yue 1 Li Junan 6 Otterson Gregory A. 2 Hicks William J. 2 Socinski Mark A. 3 Villalona-Calero Miguel A. 2 1College of Pharmacy The Ohio State University 2College of Medicine The Ohio State University 3University of North Carolina College of Medicine 4Wexner Medical Center The Ohio State University 5Center for Biostatistics The Ohio State University 6College of Public Health The Ohio State University Corresponding Author: Miguel Villalona-Calero MD Professor College of Medicine Director Division of Medical Oncology The Ohio State University A455A Starling Loving Hall 320 W 10th Avenue Columbus OH 43210 614-366-5068 Miguel.Villalona@osumc.edu * Contributed equally 6 9 2014 29 4 2014 8 2014 01 8 2015 96 2 182 191 Prospective studies focusing on EGFR inhibitors in African Americans with NSCLC have not been previously performed. In this phase II randomized study 55 African Americans with NSCLC received erlotinib 150mg/day or a body weight adjusted dose with subsequent escalations to the maximum allowable 200mg/day to achieve rash. Erlotinib and OSI-420 exposures were lower compared to previous reports consistent with CYP3A pharmacogenetics implying higher metabolic activity. Tumor genetics revealed only two EGFR mutations EGFR amplification in 17/47 samples 8 KRAS mutations and 5 EML4-ALK translocations. Although absence of rash was associated with shorter time to progression (TTP) disease control rate" | Lung_Cancer |
"The time-varying exposure profiles for ns subjects are represented as series of occurrences xt at time t = 1 ¦100 generated by random exposure events with an intensity in the range 010. The exposurelagresponse associations are defined by the function fs(x) · ws(?) in (4) which is simpler to simulate if compared with the truly bivariate alternative in (5) for each value of exposure x and lag ?. Different scenarios explore alternative choices for the exposureresponse function fs(x) and the lagresponse function ws(?). These are obtained by simple mathematical functions involving logarithms or exponentials. Specifically fs(x) is specified as linear plateau and exponential while ws(?) as constant decay and peak (see Figure S7 in the supporting information). Three scenarios out of the nine possible combinations are shown in the top panels of the others in Figure S8 (supporting information). Results of the simulation study for three scenarios of exposurelagresponse associations (linear-constant plateau-decay and exponential-peak in each column). The graphs illustrate the true simulated 3-D exposurelagresponse association (first row) and the lagresponse (secondthird rows) and exposureresponse curves (fourthfifth rows) from AIC and BIC-selected models corresponding to the bold lines in the 3-D plots. These last panels compare the true simulated associations with the average of the estimated associations together with a sample of estimated curves corresponding to the first 25 simulations (in grey). Results from m = 500 simulated data sets with ns = 400 subjects. Time-to-event data are simulated conditional on the cumulative contribution of the simulated exposure using a permutational algorithm previously proposed for time-varying exposures 29. The cumulative effect is calculated in the form of a function defined in (4) given the exposure history of each subject at time t over a lag period 0L with L = 40. Censoring events are included and represent approximately 25% of the total. For each of the nine scenarios m = 500 data sets are simulated with a number of subjects ns equal to 200400 or 800. 4.2. Evaluation of performance For each data set i = 1 ¦500 the exposurelagresponse association is estimated by Cox regression models with a cross-basis as defined in (5)(7). The Efron method is used for tie handling. Similarly to the example in the exposureresponse function fe(x) is specified as a simple linear term or quadratic B-splines with 01 or 2 knots placed at 3.35 or 6.7. The lagresponse function we(?) is specified as a simple constant term with 1 df or quadratic B-splines with intercept and 01 or 2 knots placed at 13.320 or 26.7 lags. The total number of df for the cross-basis function se(xt) ranges from 1 1 = 1 to 4 5 = 20 in the 36 models. For each simulated data set the best-fitting models are selected as those minimizing AIC and BIC in (12) respectively. Performance is formally evaluated using a synthetic risk summary ?c from (10) corresponding to an overall cumulative effect and then visually assessed on the whole exposurelagresponse association. The formal evaluation consists in the computation of different ?ci at each ith iteration given an exposure history qhi evaluated at a random time t between 41 and 100 for a random individual among the ns subjects. Indices of relative bias coverage and relative RMSE are derived from the following: (13) where I is an indicator function and ?? 1(1 ? ?) is the quantile function of the cumulative normal distribution related to probability 1 ? ? with ? = 0.05. The effect summary ?ci corresponds to the true effect from while is estimated from the best fitting model selected by AIC and BIC by using given the specific exposure history qhi of the random subject at the random time. This approach assures that the performance indicators in (13) are evaluated on the whole range of simulated exposure histories and do not depend on a specific choice. A visual inspection of performance is also provided by computing from the best-fitting models the grid of risk contributions defined in (9) composing the exposurelagresponse surface. Bias is then assessed across the surface by comparing the average fit of the the m = 500 models with the true exposurelagresponse relationship. A bidimensional display of coverage is also provided for each scenario. The performance of the AIC and BIC are also evaluated through their empirical rejection rate for the hypotheses of linearity or constant effect namely the proportion of times the selection procedure favors a model with a non-linear term for fe(x) and a non-constant term for we(?). When H0 is true namely fs(x) = x or ws(?) = c the rejection rate is an estimate of the probability of error of the selection criteria which wrongly select unnecessarily complex models. When H0 is false namely fs(x) ? x or ws(?) ? c the rejection rate is an estimate of the power of the selection criteria for identifying non-linearity and constant lag structures. In a formal hypothesis testing setting these measures would be interpreted as the type I error and the power of the test. 4.3. Results of the simulation study The results of simulations under the nine scenarios with ns = 400 producing approximately 300 uncensored events are summarized in tables in graphs. Table IV reports the formal evaluation of performance on the synthetic risk summary ?c in terms of relative bias coverage and relative RMSE. A visual assessment for three scenarios is provided in each column of the multi-panel . The true simulated exposurelag response associations are displayed in the top panels while the other panels offer a comparison of the true lagresponse and exposureresponse curves at specific values with the average of the estimates from AIC and BIC-selected models together with a sample of 25 individual curves. Table IV Synthetic indices of relative bias coverage and relative root mean square error (RSME) for the nine scenarios of exposurelagresponse associations. Results from m = 500 simulated data sets with ns = 400 subjects Bias Coverage RMSE f(x) ? w(?) AIC BIC AIC BIC AIC BIC Linear-constant 0.01 0.01 0.91 0.94 0.07 0.04 Linear-decay 0.00 0.00 0.93 0.94 0.07 0.05 Linear-peak 0.01 0.01 0.92 0.90 0.08 0.07 Plateau-constant 0.06 0.13 0.84 0.72 0.08 0.09 Plateau-decay 0.04 0.14 0.90 0.74 0.09 0.13 Plateau-peak 0.07 0.21 0.87 0.62 0.11 0.18 Exponential-constant 0.01 0.03 0.90 0.80 0.09 0.09 Exponential-decay 0.05 0.04 0.93 0.87 0.12 0.13 Exponential-peak 0.00 0.17 0.91 0.75 0.12 0.17 Generally AIC-selected models offer a better performance with a lower relative bias and a coverage of confidence intervals closer to the 95% nominal value. The values of relative RMSE suggest that the higher variability of AIC-based estimators is often balanced by the higher bias affecting BIC. At least part of the bias can be attributed to lack of fit due to the insufficient flexibility of quadratic spline functions when used to fit logarithmic or exponential shapes. This phenomenon appears quite relevant for the plateau-type exposure response characterized by the highest relative bias in the order of 47% for AIC but up to 21% for BIC (see Table IV and second column). This pattern is confirmed by the results in Table V showing the average df in each dimension and the empirical rejection rates for the hypotheses of linearity and constant risk. The AIC selection is affected by moderate overfitting sometimes suggesting flexible models in scenarios of linear and/or constant risk. In contrast BIC shows severe underfitting often selecting simple models for complex exposurelagresponse associations in particular regarding linearity. Table V Average df in each dimension for the best fitting models selected through AIC and BIC (left part) and empirical rejection rate for the AIC and BIC-based selection for the hypotheses of linearity and constant risk (right part) for the nine scenarios of exposurelagresponse associations. Results from m = 500 simulated data sets with ns = 400 subjects Average df Empirical rejection rate f(x) w(?) H0 : f(x) = x H0 : w(?) = c f(x) ? w(?) AIC BIC AIC BIC AIC BIC AIC BIC Linear-constant 1.50 1.03 1.57 1.02 0.29* 0.03* 0.23* 0.01* Linear-decay 1.26 1.00 3.60 3.17 0.18* 0.00* 1.00 1.00 Linear-peak 1.22 1.00 4.02 3.72 0.15* 0.00* 1.00 0.98 Plateau-constant 2.26 1.54 1.47 1.00 0.82 0.47 0.19* 0.00* Plateau-decay 2.53 1.55 3.49 3.10 0.97 0.54 1.00 1.00 Plateau-peak 2.18 1.21 4.01 3.56 0.85 0.19 1.00 0.93 Exponential-onstant 2.20 1.56 1.43 1.00 0.83 0.52 0.16* 0.00* Exponential-decay 2.36 1.81 3.58 3.12 0.99 0.80 1.00 1.00 Exponential-peak 2.15 1.29 4.05 3.69 0.90 0.27 1.00 0.93 * H0 is true The undercoverage of confidence intervals as shown in Table IV can be attributed to both lack of fit and a posteriori model selection. The latter as discussed in Section 2.5 may generate undercoverage through the underestimation of the true sampling (co)variance. A comparison of the importance of the two sources can be provided by the assessment of undercoverage in the first scenario where linear and constant functions are actually among the options of the selection procedure and the underlying simulated association can be potentially recovered with no lack of fit. In this scenario AIC-selected models affected by overfitting show a coverage of 91% very close to the nominal value as illustrated in Table IV. The under-coverage seems to be proportional to the bias as confirmed by Figure 6 with a lower coverage corresponding to sections of the bidimensional space characterized by worse fit. Figure 6 Empirical coverage across the risk surfaces for three scenarios of exposurelagresponse associations (linear-constant plateau-decay and exponential-peak in each column). Results from m = 500 simulated data sets with ns = 400 subjects. The simulated examples with ns = 200 and ns = 800 generate approximately 150 and 600 uncensored events respectively. The versions of Tables IVV and for these examples are reported in Tables S2S5 and Figures S9S10 of the supporting information. The comparison suggests that varying the sample size does not dramatically affect the performance of the AIC-based test apart from the expected different power in identifying nonlinear and noncostant exposuretimeresponse associations. Consistently AIC-based selection seems to perform well across the range of number of subjects included in the analysis with a small bias and reasonable coverage. The results of this simulation study are consistent with previous findings on one-dimensional models for exposurelagresponse associations assuming a linear exposureresponse relationship 18. 5. Discussion In this contribution I illustrate a statistical framework for modeling temporal dependencies with time-varying exposures defined here as exposurelagresponse associations. The approach is based on the extension of distributed lag non-linear models a modeling class previously proposed in time series analysis 2324. The extended DLNM methodology brings together and extends previous methodological developments on the topic as summarized in. Briefly it provides a unified framework for different study designs and regression methods and is applicable to time series cross-sectional case-control survival and longitudinal data. A major advantage is the possibility to describe the lag structure of either linear or nonlinear exposureresponse relationships through the choice of two functions that define the association along the dimensions of the predictor and lags including most of the previous approaches as special cases. The example in illustrates how such flexibility is important for obtaining correct estimates of the association. Model specification easily accounts for previous knowledge on the association and incorporates assumptions on the phenomenon to be investigated through the choice of specific functions lag period and constraints. Interpretation of complex exposurelagresponse associations is aided by the definition of simple summary measures of effect and prediction and by graphical representation. The modeling framework is defined through a neat and compact algebraic representation including the derivation of measures of uncertainty such as standard errors and confidence intervals. Estimation is carried out with standard regression models which do not require specialized optimization procedures and may include terms for multiple exposurelagresponse dependencies as shown for radon and smoking here. The parameterization prediction and graphical representation are carried out with few general functions implemented in a freely available and documented software as discussed in. A key issue of the DLNM methodology is about selecting the appropriate model among different options for modeling the bidimensional exposurelagresponse relationship. The simulation study in indicates that AIC-based selection performs reasonably well over a range of 150600 uncensored events while the strong penalty of BIC induces the selection of models too simple to recover the underlying dependency." | Lung_Cancer |
"This study was supported by grants from National Basic Research Program of China (973 Program No. 2012CB967003 to S. Shao) Natural Science Foundation of China (NO. 20935004 81071784 to S. Shao and 81172028 to Z. Hou). The funders had no role in study design data collection and analysis decision to publish or preparation of the manuscript. Introduction Squamous cell carcinoma (SCC) is the second most common type of lung cancer accounting for about 30% of all lung cancers [1]. When diagnosed early lung SCC (LSCC) is well curable by surgical excision. However most of LSCC patients encounter high rate of recurrence for metastasis and resistance to existing chemotherapeutic agents after resection. Therefore in order to reduce mortality of LSCC it is necessary to identify molecular markers for early diagnosis and elucidate the biochemical mechanism governing the processes of recurrence and metastasis as well as therapeutic resistance. A proteomic approach using fluorescent dye-labeled proteins coupled with two-dimensional gel electrophoresis (2-DIGE) and mass spectrometric (MS) analysis has been widely applied to identify differentially expressed proteins between normal and tumor specimens [2]. These differentially expressed proteins could either serve as molecular markers for diagnosis or lead to understanding the molecular mechanisms of metastasis and therapeutic resistance. By employing the 2-DIGE and MS approaches we compared the protein profiles between clinical metastatic non-metastastic LSCC tissues and adjacent normal lung tissues and identified a number of differentially expressed proteins participating in many biological functions such as cell signaling regulation carbohydrate metabolism molecular chaperones and protein synthesis. Among these protein candidates we were particularly interested in fructose-bisphosphate aldolase A (ALDOA) an key enzyme in glycolysis responsible for catalyzing the reversible conversion of fructose-16-bisphosphate to glyceraldehydes-3-phosphate and dihydroxyacetone phosphate [3]. ALDOA is one of the three aldolase isozymes (A B and C) encoded by three different genes. These aldolases are differentially expressed during development. ALDOA is highly expressed in the developing embryo and in adult muscle [3]. ALDOA contributes to various cellular functions and biological process related to muscle maintenance regulation of cell shape and mobility striated muscle contraction actin filament anization and ATP biosynthetic process [4][13]. ALDOA deficiency is associated with myopathy and hemolytic anemia [14][16]. Notably ALDOA has been found highly expressed in a variety of malignant cancers including human lung squamous [17][18] renal cell [19] and hepatocellular carcinomas [20]. However none of these reports examined the involvement of ALDOA in LSCC progression and metastasis. In this study we reported that ALDOA is highly expressed in LSCC and its expression level is correlated with LSCC metastasis. Further we demonstrated that depletion of ALDOA in lung cancer cells reduces its tumorigenicity and capability of migration. These observations suggest that ALDOA is a potential biomarker of LSCC metastasis and play important role in LSCC progression and metastasis. Materials and Methods Samples Preparation and Proteomic Analysis Seven pairs of matched primary LSCC samples (6 male and 1 female aging from 36 to 67 years old with an average age of 55 years old) were obtained from the Department of Thoracic Surgery of the First Affiliated Hospital of Dalian Medical University China. Three pairs are non-metastatic and 4 pairs are metastatic. No patients received preoperative radiotherapy and chemotherapy. The study was approved by the Ethic and Research Committees of Dalian Medical University and was conducted in accordance with the Declaration of Helsinki Principles. The patients thoroughly understood the collecting process and purpose of using the specimens and signed informed consents-specimen collection. The fresh samples from tumor and normal tissues (>5 cm away from the lesion) were snap-frozen and stored at ?80°C. The pathological diagnosis was done to confirm that tumor specimens were real SCC tissues. Surgery follow-ups were conducted to each patient at an interval of 12 months for 3 years. To prepare protein extracts the tissues were homogenized in buffer containing 7 M urea 2 M thiourea 4% CHAPS 30 mM Tris and a cocktail of protease inhibitors (GE Healthcare) and the supernatants were collected by centrifugation at 12000 g for 15 min at 4°C. 50 ug of pooled protein extracts was labeled with Cy2 as the internal standard control Cy3 and Cy5 were used to label experimental samples. The resulting samples were resolved bi-dimensionally on 12.5% SDS-PAGE gels. Images were acquired using the fluorescence scanner (GE Healthcare) at excitation wavelengths of 488/520 nm 532/580 nm or 633/670 nm respectively. The image analysis was processed using DeCyder 6.5 (GE Healthcare). BVA software module was used for matching spots between gels and average abundance and statistics calculation. The protein abundance was represented by the volume ratio of samples versus standards and the proteins of interest with an average ratio more than 1.50 or less than ?1.50 were selected for mass spectrometry analysis. Western Blot immunofluorecence and LSCC tissue microarrays Protein extracts (50 µg) were resolved on 12% SDS-PAGE gels transferred to nitrocellulose membranes (0.45 µm) and immunoblotted with rabbit anti-human ALDOA antibody (HPA004177 Sigma; 1?1500) or mouse anti-human ?-actin monoclonal antibody (1?4000)." | Lung_Cancer |
"Human Genome Variation Society (HGVS) (Human Genome Variation Society (HGVS) 2014). For example we considered that it was not acceptable to report the amino acid change only as redundancy in the genetic code means that different changes at the nucleotide level can result in the same change at the amino acid level. In the results of this EQA scheme suggest that the technical quality of EGFR mutational analysis could be improved as evidenced from a high level of diagnostic errors. Overall the standard of reporting was acceptable. These findings also underline the importance of EQA as a mechanism to reveal errors in methodology and to ensure an adequate quality of molecular testing. Regular participation in EQA should be seen as a routine part of the diagnostic testing process for all labs helping to improve and standardise their processes. We have established a model for a robust and scalable EQA that can contribute to global optimisation and improvements in the overall quality of EGFR testing for patients with NSCLC. We thank the laboratories for their participation in this study. We also thank AstraZeneca for the provision of an unrestricted grant to allow the development to the scheme; and Horizon Diagnostics for their support in quantitative validation of the materials. Dr Normanno is supported by a grant from Associazione Italiana per la Ricerca sul Cancro (AIRC). Supplementary Information accompanies this paper on British Journal of Cancer website (http://www.nature.com/bjc) The authors declare no conflict of interest. Angulo B Garcia-Garcia E Martinez R Suarez-Gauthier A Conde E Hidalgo M Lopez-Rios F 2010 A commercial real-time PCR kit provides greater sensitivity than direct sequencing to detect KRAS mutations: a morphology-based approach in colorectal carcinoma J Mol Diagn 12 292 299 20203003 Bellon E Ligtenberg MJ Tejpar S Cox K de Hertogh G de Stricker K Edsjo A Goulis V Hofler G Jung A Kotsinas A Laurent-Puig P Lopez-Rios F Hansen TP Rouleau E Vandenberghe P van Krieken JJ Dequeker E 2011 External quality assessment for KRAS testing is needed: setup of a European program and report of the first joined regional quality assessment rounds Oncologist 16 467 478 21441573 Deans ZC Bilbe N O'Sullivan B Lazarou LP de Castro DG Parry S Dodson A Taniere P Clark C Butler R 2013 Improvement in the quality of molecular analysis of EGFR in non-small-cell lung cancer detected by three rounds of external quality assessment J Clin Pathol 66 319 325 23378269 Deans ZC Tull J Beighton G Abbs S Robinson DO Butler R 2011 Molecular genetics external quality assessment pilot scheme for KRAS analysis in metastatic colorectal cancer Genet Test Mol Biomarkers 15 777 783 21851273 De Luca A Normanno N 2010 Predictive biomarkers to tyrosine kinase inhibitors for the epidermal growth factor receptor in non-small-cell lung cancer Curr Drug Targets 11 851 864 20388064 European Molecular Genetics Quality Network (EMQN)2014EMQN home page. Available at http://www.emqn. (accessed 18 January 2014). Fukuoka M Wu YL Thongprasert S Sunpaweravong P Leong SS Sriuranpong V Chao TY Nakagawa K Chu DT Saijo N Duffield EL Rukazenkov Y Speake G Jiang H Armour AA To KF Yang JC Mok TS 2011 Biomarker analyses and final overall survival results from a phase III randomized open-label first-line study of gefitinib versus carboplatin/paclitaxel in clinically selected patients with advanced non-small-cell lung cancer in Asia (IPASS) J Clin Oncol 29 2866 2874 21670455 Hindson BJ Ness KD Masquelier DA Belgrader P Heredia NJ Makarewicz AJ Bright IJ Lucero MY Hiddessen AL Legler TC Kitano TK Hodel MR Petersen JF Wyatt PW Steenblock ER Shah PH Bousse LJ Troup CB Mellen JC Wittmann DK Erndt NG Cauley TH Koehler RT So AP Dube S Rose KA Montesclaros L Wang S Stumbo DP Hodges SP Romine S Milanovich FP White HE Regan JF Karlin-Neumann GA Hindson CM Saxonov S Colston BW 2011 High-throughput droplet digital PCR system for absolute quantitation of DNA copy number Anal Chem 83 8604 8610 22035192 Human Genome Variation Society (HGVS)2014Nomenclature for the description of sequence variants. Available at http://www.hgvs./mutnomen/ (accessed 18 January 2014). International anisation for Standardization (ISO)2012ISO 15189:2012 Medical laboratoriesrequirements for quality and competence. Available at http://www.iso./iso/home/store/catalogue_ics/catalogue_detail_ics.htm?csnumber=56115 (accessed 18 January 2014). Linardou H Dahabreh IJ Kanaloupiti D Siannis F Bafaloukos D Kosmidis P Papadimitriou CA Murray S 2008 Assessment of somatic k-RAS mutations as a mechanism associated with resistance to EGFR-targeted agents: a systematic review and meta-analysis of studies in advanced non-small-cell lung cancer and metastatic colorectal cancer Lancet Oncol 9 962 972 18804418 Lopez-Rios F Angulo B Gomez B Mair D Martinez R Conde E Shieh F Tsai J Vaks J Current R Lawrence HJ Gonzalez de Castro D 2013 Comparison of molecular testing methods for the detection of EGFR mutations in formalin-fixed paraffin-embedded tissue specimens of non-small cell lung cancer J Clin Pathol 66 381 385 23386666 Maemondo M Inoue A Kobayashi K Sugawara S Oizumi S Isobe H Gemma A Harada M Yoshizawa H Kinoshita I Fujita Y Okinaga S Hirano H Yoshimori K Harada T Ogura T Ando M Miyazawa H Tanaka T Saijo Y Hagiwara K Morita S Nukiwa T 2010 Gefitinib or chemotherapy for non-small-cell lung cancer with mutated EGFR N Engl J Med 362 2380 2388 20573926 Mitsudomi T Morita S Yatabe Y Negoro S Okamoto I Tsurutani J Seto T Satouchi M Tada H Hirashima T Asami K Katakami N Takada M Yoshioka H Shibata K Kudoh S Shimizu E Saito H Toyooka S Nakagawa K Fukuoka M 2010 Gefitinib versus cisplatin plus docetaxel in patients with non-small-cell lung cancer harbouring mutations of the epidermal growth factor receptor (WJTOG3405): an open label randomised phase 3 trial Lancet Oncol 11 121 128 20022809 Mok TS Wu YL Thongprasert S Yang CH Chu DT Saijo N Sunpaweravong P Han B Margono B Ichinose Y Nishiwaki Y Ohe Y Yang JJ Chewaskulyong B Jiang H Duffield EL Watkins CL Armour AA Fukuoka M 2009 Gefitinib or carboplatin-paclitaxel in pulmonary adenocarcinoma N Engl J Med 361 947 957 19692680 Normanno N De Luca A Bianco C Strizzi L Mancino M Maiello MR Carotenuto A De Feo G Caponigro F Salomon DS 2006 Epidermal growth factor receptor (EGFR) signaling in cancer Gene 366 2 16 16377102 Normanno N Pinto C Taddei G Gambacorta M Castiglione F Barberis M Clemente C Marchetti A 2013 Results of the First Italian External Quality Assurance Scheme for somatic EGFR mutation testing in non-small-cell lung cancer J Thorac Oncol 8 773 778 23575414 Rosell R Carcereny E Gervais R Vergnenegre A Massuti B Felip E Palmero R Garcia-Gomez R Pallares C Sanchez JM Porta R Cobo M Garrido P Longo F Moran T Insa A De Marinis F Corre R Bover I Illiano A Dansin E de Castro J Milella M Reguart N Altavilla G Jimenez U Provencio M Moreno MA Terrasa J Munoz-Langa J Valdivia J Isla D Domine M Molinier O Mazieres J Baize N Garcia-Campelo R Robinet G Rodriguez-Abreu D Lopez-Vivanco G Gebbia V Ferrera-Delgado L Bombaron P Bernabe R Bearz A Artal A Cortesi E Rolfo C Sanchez-Ronco M Drozdowskyj A Queralt C de Aguirre I Ramirez JL Sanchez JJ Molina MA Taron M Paz-Ares L 2012 Erlotinib versus standard chemotherapy as first-line treatment for European patients with advanced EGFR mutation-positive non-small-cell lung cancer (EURTAC): a multicentre open-label randomised phase 3 trial Lancet Oncol 13 239 246 22285168 Sharma SV Bell DW Settleman J Haber DA 2007 Epidermal growth factor receptor mutations in lung cancer Nat Rev Cancer 7 169 181 17318210 Thunnissen E Bovee JV Bruinsma H van den Brule AJ Dinjens W Heideman DA Meulemans " | Lung_Cancer |
"Actin was probed by antibody from Sigma (catalog no. 1978). The gene expression nucleosome positioning and ChIP-seq data have been submitted to Gene Expression Omnibus (http:/www.ncbi.nlm.nih.gov/geo/) under accession numbers GSE40194 GSE40300 GSE40363 and GSE18182. RESULTS We analyzed expression of 1722 regulatory factors including ones involved in cancer metastasis (2729) in transcriptome profiles of 382 lung cancer clinical cases. Our analyses identified that a metastasis suppressor NME2 (also known as NM23 H2/NDPK) was significantly down regulated in advanced stages across four independent data sets (P < 0.05 student's t-test; Supplementary Figure S1a). Details of this analysis including further experiments performed by us which confirmed that NME2 can induce anti-metastatic changes in lung adenocarcinoma-derived A549 cells are provided as supplementary material (Supplementary Information and Supplementary Figures S1bd). Next we determined NME2 occupancy nucleosome positions and transcriptomes before and after induction of NME2 levels in A549 cells. As NME2 is endogenously expressed in A549 cells we used the term NME2 induced to refer to the cellular state following increase of NME2 levels. To ascertain whether NME2 protein level after induction in A549 cells was still in the physiological range we analyzed protein expression of NME2 in normal lung lysates and tumor lung and compared with NME2-induced A549 cells. Our comparative analysis clearly showed that NME2 level within induced A549 cells were within physiological range (Supplementary Figure S1e). Genome-wide NME2 binding promoter-nucleosome occupancy and the transcriptional state ChIP followed by massively parallel sequencing (ChIP-seq) was performed in replicate for both conditions before and after inducing NME2 (A). Out of roughly 7 million sequence reads >80% uniquely aligned to the reference human genome in each case (Supplementary Figure S2a). Using ChIP-seq reads enriched in NME2 relative to IgG we found 2005 and 11 017 peaks before and after inducing NME2 in A549 cells respectively. Although number of NME2 binding sites increased after induction a close inspection of peaks (sites of NME2 binding to DNA) showed that their chromosome-wise distribution was largely similar in both cases (A: Circos plot and Supplementary Figures S2b and c). The replicates were also similar (A: Circos plot and Supplementary Figure S2d). The frequency of TFBSs was also largely similar before and after induction of NME2 (Supplementary Figure S2e). A 12-mer consensus motif identified using Gibbs sampler (30) was present in >70% of the ChIP-seq peaks (B upper panel). We noted that the motif found from ChIP-seq was similar to the one reported earlier from analysis of a single promoter (31) and unpublished data of Thakur et al. (submitted for publication) As expected in more than 50% cases the NME2 motif occurred within 50 bp of the center of peak (B lower panel). We next performed transcriptome profiling of A549 cells before and after NME2 induction. Comparative analysis of the expression profiles revealed 1679 genes as differentially expressed (781 genes were up and 898 genes down regulated (P < 0.05)) in NME2-induced cells; out of these we found at least one NME2 binding site (in the induced condition) within 10 kb of the TSS in as many as 1235 genes. We next asked whether altered state of chromatin in regulatory regions influenced NME2 occupancy and consequent gene expression changes. To test this nucleosome positions were determined in the A549 cells before and after NME2 induction. Mono-nucleosomes were isolated by MNase digestion and we mapped nucleosome positions to putative promoter regions (?7.5 kb to 2.5 kb of TSSs) using tiled microarrays (A) and found 157 634 and 162 570 nucleosomes before and after NME2 induction respectively. Next we checked the relationship between overall number of nucleosomes on each promoter and the expression level of corresponding gene and found that enriched promoter-nucleosome occupancy correlated with decreased expression of corresponding genes (r = ?0.73; P < 0.05 before NME2 induction and r = ?0.80; P < 0.05 after NME2 induction Pearson correlation; B). Target site proximal promoter-nucleosome repositioning upon NME2 expression We noted distinct occurrence of nucleosomes with respect to TSSs across promoters for many genes which showed a phased pattern that was consistent with previous studies of nucleosome distribution in human and yeast (153233) (C). On comparing the two states before and after NME2 induction we found ?11.4% (18 024/157 634) nucleosomes on 1022 genes were repositioned in the NME2-induced condition. We also found that a large number of genes with repositioned nucleosomes were differentially expressed between the two states (830 out of 1022 genes (P < 0.05)) (D). It is important to note that in contrast to B which showed that a high overall increased number of nucleosomes on a given promoter relates to decreased expression D showed that differential expression of genes here resulted from repositioning (and not overall exclusion or gain) of nucleosomes within promoter. Interestingly most repositioning events after NME2 induction were observed near TSSs (D upper panel). We next checked target-site nucleosome occupancy before and after NME2 induction (A). On analyzing relative occurrence we found lower number of positioned nucleosomes in the vicinity (?300500 bp) of NME2 target sites in cells after NME2 induction (B). Out of 3956 NME2 target sites (within ?7.5 to +2.5 kb of TSS) unique to the NME2-induced cells 1257 (31%) present on 1119 putative promoters were found to either overlap or were within 300 bases of a nucleosome in cells before NME2 induction. Furthermore 870 (?70%) of the 1257 sites were found to be nucleosome-free in the NME2-induced condition which involved repositioning of 870 nucleosomes in 791 genes on NME2 induction. Together these findings indicate that many of the NME2 binding sites occupied by nucleosomes in the un-induced condition in A549 cells became NME2-bound (and nucleosome-free) in the NME2-induced condition. To analyze nucleosome repositioning with respect to the NME2 target site after versus before NME2 induction we calculated the distance of nucleosome shift between the two conditions as ?Ndisplacement (C left panel) and found ?64% nucleosomes shifted by more than 300 bp in the NME2-induced condition. In order to test the significance of the noted nucleosome shift we also calculated this distribution in A549 cells where NME2 was depleted (see below) relative to control A549 cells. Observed distributions were significantly altered following induction of NME2; in contrast on NME2 depletion we did not find any repositioning in most cases (Wilcoxon rank sum test; P = 0.00016; C right panel). Next we plotted the 870-nucleosome positions (found within 300 bp of an NME2 target site in the un-induced condition) before and after NME2 induction. This showed a loss in anized nucleosome occurrence around NME2 binding sites in NME2-induced cells relative to the un-induced condition (D). We further noted that expression of all the 791 genes with repositioned nucleosomes was significantly altered in the NME2-induced condition (P < 0.05 student's t-test D). For validation we compared nucleosome occupancy and NME2 binding using quantitative real-time PCR in six genes. In all cases low nucleosome occupancy signal was detected along with high NME2 occupancy in cells after NME2 induction as compared to that observed in un-induced cells (). Target sites are nucleosome occupied in cells with depleted levels of NME2 We reasoned that in addition to induced NME2; A549 cells with depleted levels of NME2 would provide a suitable model to test nucleosome positioning/NME2 occupancy in a contrasting situation. To test this we generated a stable NME2-depleted A549 cell line (see Materials and Methods). Following this we determined nucleosome positions in the NME2-depleted cells. All the 870 NME2 binding sites that were nucleosome-free in the NME2-induced condition and occupied in the un-induced state (D) were also found to be nucleosome-occupied in the NME2-depleted condition. " | Lung_Cancer |
"enough cancer cells etc. In this study two cores in TMAs were not identified with ALK+?in initial FISH analysis due to a lack of cancer cells. Similarly in biopsies the numbers of cancer cells is often very limited making an accurate FISH analysis difficult. With the IHC analysis in this study almost all of the cancer cells in the two cores showed ALK expression despite the fact that only a few ALK+?cells were revealed by FISH analysis. A <100% rate of cellular positivity in ALK+?tumors has been demonstrated to be due to the technical limitations of FISH analysis [13]. Therefore combining IHC and FISH analyses results in ALK status being more accurately evaluated in biopsies. IHC analysis using CSTs D5F3 antibody has been demonstrated with 100% sensitivity [1214-16] suggesting that IHC analysis is an effective way to prescreen patients for FISH analysis in the clinical diagnosis process [141517]. For IHC negative cases FISH analysis is not necessary. In strongly positive IHC cases FISH analysis also may not be necessary. Although there was one strongly positive IHC case which was shown with ALK- by FISH analysis the VENTANA ALK assay and qRT-PCR analysis revealed ALK expression and ALK fusion respectively. In addition it has been reported that the lung cancer patient with IHC-positive and FISH-negative ALK had a dramatic response to crizotinib [18]. Therefore the patient in our case may benefit from crizotinib. Weakly positive IHC cases must be carefully examined. In this study 7 out of 12 (58.3%) weakly positive cases were discordant with FISH analysis. Using the VENTANA ALK IHC assay three out of the seven weakly positive cases showed ALK expression and could be treated with crizotinib. Using qRT-PCR analysis five out of the seven weakly positive cases showed ALK fusion at the RNA level. Therefore there were two cases in which the qRT-PCR analysis result was discordant with the VENTANA ALK IHC assay. Compared to negatively expressed ALK cases without any staining (I) these two cases were indeed weakly stained in cancer cells using the VENTANA ALK IHC analysis (H). However according to the VENTANA ALK IHC assay scoring algorithm the weak staining in these two cases was regarded as unspecific and thus considered negative. Although qRT-PCR analysis demonstrated ALK fusion in these two cases it was detected in a very late stage of the qRT-PCR process. We speculated that the percentage of tumor cells with ALK fusion might be very low in these two cases. However with very high sensitivity (1 in 100 DNA) they would still be detected by qRT-PCR analysis. Whether these two patients would benefit from crizotinib was difficult to predict as no relevant study has been reported. Further study is required. Previous reports have shown that ALK+?lung cancers are characterized by younger patients non-smokers or light smokers when compared with ALK- patients [6719-23]. In this study the ALK+?patients were significantly younger and more likely to have lymph node metastasis compared to ALK- patients. However ALK+?and ALK- lung adenocarcinomas showed no difference in sex smoking habit tumor size pT M factors or pathologic TNM stage. The screening was limited in this study to the lung adenocarcinomas of Chinese patients. There may be an underlying difference in the subject population by race and clinical characteristics. In with advantages such as a low cost and 100% sensitivity IHC with CSTs D5F3 antibody can serve as a robust diagnostic tool with which to routinely screen lung adenocarcinoma patients with ALK+?in pathology labs that do not have access to VENTANA automated IHC platforms. For weakly expressed ALK cases qRT-PCR analysis especially when applied on FFPE samples is suggested as a diagnostic test for ALK fusion detection. Competing interest The authors declared that they have no competing interest. Authors contributions Study concept and design: DL LS JY. Analysis and interpretation of data: LS FL LG XY. Drafting of the manuscript: LS FL DL. All authors have read and approved the final manuscript. Acknowledgment The authors thank Cell Signaling Technology for kindly providing ALK (D5F3) antibody for this research. Ferlay J Shin HR Bray F Forman D Mathers C Parkin DM International agency for research on cancer 2010 http://globocan.iarc.fr 2010 Jemal A Siegel R Ward E Hao Y Xu J Murray T Thun MJ Cancer statistics 2008 CA Cancer J Clin 2008 58 2 71 96 10.3322/CA.2007.0010 18287387 Rikova K Guo A Zeng Q Possemato A Yu J Haack H Nardone J Lee K Reeves C Li Y Global survey of phosphotyrosine signaling identifies oncogenic kinases in lung cancer Cell 2007 131 6 1190 203 10.1016/j.cell.2007.11.025 18083107 Soda M Choi YL Enomoto M Takada S Yamashita Y Ishikawa S Fujiwara S Watanabe H Kurashina K Hatanaka H Identification of the transforming EML4-ALK fusion gene in non-small-cell lung cancer Nature 2007 448 7153 561 6 10.1038/nature05945 17625570 Soda M Takada S Takeuchi K Choi YL Enomoto M Ueno T Haruta H Hamada T Yamashita Y Ishikawa Y A mouse model for EML4-ALK-positive lung cancer Proc Natl Acad Sci U S A 2008 105 50 19893 7 10.1073/pnas.0805381105 19064915 Rodig SJ Mino-Kenudson M Dacic S Yeap BY Shaw A Barletta JA Stubbs H Law K Lindeman N Mark E Unique clinicopathologic features characterize ALK-rearranged lung adenocarcinoma in the western population Clin Cancer Res 2009 15 16 5216 23 10.1158/1078-0432.CCR-09-0802 19671850 Inamura K Takeuchi K Togashi Y Hatano S Ninomiya H Motoi N Mun MY Sakao Y Okumura S Nakagawa K EML4-ALK lung cancers are characterized by rare other mutations a TTF-1 cell lineage an acinar histology and young onset Mod Pathol 2009 22 4 508 15 10.1038/modpathol.2009.2 19234440 Cui JJ Tran-Dube M Shen H Nambu M Kung PP Pairish M Jia L Meng J Funk L Botrous I Structure based drug design of crizotinib (PF-02341066) a potent and selective dual inhibitor of mesenchymal-epithelial transition factor (c-MET) kinase and anaplastic lymphoma kinase (ALK) J Med Chem 2011 54 18 6342 63 10.1021/jm2007613 21812414 Christensen JG Zou HY Arango ME Li Q Lee JH McDonnell SR Yamazaki S Alton GR Mroczkowski B Los G Cytoreductive antitumor activity of PF-2341066 a novel inhibitor of anaplastic lymphoma kinase and c-Met in experimental models of anaplastic large-cell lymphoma Mol Cancer Ther 2007 6 12 Pt 1 3314 22 18089725 Huang WT Chuang SS High MET gene copy number predicted poor prognosis in primary intestinal diffuse large B-cell lymphoma Diagn Pathol 2013 8 16 10.1186/1746-1596-8-16 23379953 Xiong Y Bai Y Leong N Laughlin TS Rothberg PG Xu H Nong L Zhao J Dong Y Li T Immunohistochemical detection of mutations in the epidermal growth factor receptor gene in lung adenocarcinomas using mutation-specific antibodies Diagn Pathol 2013 8 1 27 10.1186/1746-1596-8-27 23419122 Ying J Guo L Qiu T Shan L Ling Y Liu X Lu N Diagnostic value of a novel fully automated immunochemistry assay for detection of ALK rearrangement in primary lung adenocarcinoma Ann Oncol 2013 24 10 2589 93 10.1093/annonc/mdt295 23904459 Camidge DR Theodoro M Maxson DA Skokan M OBrien T Lu X Doebele RC Baron AE Varella-Garcia M Correlations between the percentage of tumor cells showing an anaplastic lymphoma kinase (ALK) gene rearrangement ALK signal copy number and response to crizotinib therapy in ALK fluorescence in situ hybridization-positive nonsmall cell lung cancer Cancer 2012 118 18 4486 94 10.1002/cncr.27411 22282074 Conklin CM Craddock KJ Have C Laskin J Couture C Ionescu DN Immunohistochemistry is a reliable screening tool for identification of ALK rearrangement in non-small-cell lung carcinoma and is antibody dependent J Thorac Oncol 2013 8 1 45 51 23196275 Mino-Kenudson M Chirieac LR Law K Hornick JL Lindeman N Mark EJ Cohen DW Johnson BE Janne PA Iafrate AJ Rodig SJ A novel highly sensitive antibody allows for the routine detection of ALK-rearranged lung adenocarcinomas by standard immunohistochemistry Clin Cancer Res 2010 16 5 1561 71 10.1158/1078-0432.CCR-09-2845 20179225 Li Y Pan Y Wang R Sun Y Hu H Shen X Lu Y Shen L Zhu X Chen H ALK-rearranged lung cancer in chinese: a comprehensive assessment of clinicopathology IHC FISH and RT-PCR PLoS One 2013 8 7 e69016 10.1371/journal.pone.0069016 23922677 Martinez P Hernandez-Losa J Cedres S Castellvi J Martinez-Marti A Tallada N Murtra-Garrell N Navarro-Mendivill A Rodriguez-Freixinos V Canela M Fluorescence in situ hybridization and immunohistochemistry as diagnostic methods for ALK positive non-small cell lung cancer patients " | Lung_Cancer |
"In this study we identified a novel pathway for Sp1-mediated activation wherein miR-182 expression downregulated the expression of FOXO3 a known miR-182 target gene [35]. Sp1 activated miR-182 and FOXO3 at the transcriptional level; however FOXO3 protein expression decreased. These results suggest that post-transcriptional regulation by miRNAs is a powerful mechanism by which to control the final level of protein expression. Many coding genes with Sp1 binding element(s) in their promoters harbor conserved miRNA target sequences in their 3'-UTR. To our knowledge this is first study to demonstrate that Sp1 regulates the expression of a target gene by regulating promoter activity and post-transcriptional processing in parallel. Few studies have characterized the regulation of miRNA by Sp1. Herein using a bioinformatics approach we identified several miRNAs potentially regulated by Sp1 including miR-182. We then showed that Sp1 specifically targets the miR-182 promoter region and activates miR-182 expression. miR-182 reportedly forms a gene cluster with two adjacent miRNAs (miR-96 and miR-183) [35]. The expression of miR-96 and miR-183 also decreased following Sp1 knockdown (Supplementary Figure S2A). Moreover we also investigated the binding of Sp1 to the miR-212 promoter because the latter contains 13 putative Sp1 binding sites (Supplementary Table S1). We found that Sp1 bound to the miR-212 promoter sequence (Supplementary Figure S2B and S2C). Interestingly a recent study showed that FOXO3 is a direct target of miR-212 in the neurons of patients with Alzheimer's disease [36]. miR-182 and miR-212 might cooperate to downregulate FOXO3 expression upon Sp1 overexpression. We cannot rule out this possibility. However depletion of miR-182 was sufficient to impair the Sp1-mediated reduction of FOXO3 expression in our experiments (C) suggesting that miR-182 is the major regulator of FOXO3 in lung cancer cells. Several studies have shown that miR-182 is upregulated in lung cancer. This suggests that miR-182 plays a positive role in lung tumorigenesis. However in two studies of miR-182 function in lung cancer miR-182 inhibited the proliferation of human lung adenocarcinoma cells [37 38]. Our results in this study provide several pieces of evidence to support the notion that miRNA-182 is a positive regulator of lung cancer cell proliferation. Firstly miR-182 was upregulated in the majority of lung cancer clinical samples and lung cancer cell lines examined. Secondly miR-182 knockdown inhibited cell cycle progression and cell growth. Finally miR-182 knockdown reduced lung tumor growth in vivo. Discrepancies in the role of miRNA-182 in lung cancer cell proliferation might derive from the different experimental designs of the studies. For example because miR-182 expression is upregulated in lung cancer we knocked down its expression and examined the effects on cancer cell proliferation. However other studies that described a negative role of miR-182 in lung cancer used miR-182 overexpression to study miR-182's role in cancer cell proliferation. Overexpression conditions can alter the function of many genes [39]. For example Sp1 accumulates in most of cancers; knockdown of Sp1 expression decreases cell proliferation but Sp1 overexpression also attenuates cancer cell growth [40]. Because post-translational modifications affect protein function overexpressed proteins might not be completely processed which could affect their function. Previous studies in melanoma and hepatocellular carcinoma indicated that miR-182 enhanced tumor metastasis [35 41]. However our data as shown in indicated that miR-182 knockdown altered cell morphology and increased migration and invasion activities. In addition miR-182 knockdown increased N-cadherin levels suggesting that miR-182 promotes the mesenchymal to epithelial transition (MET) [42]. Previous studies have shown that TIMP-2 enhances the E-cadherin/?-catenin complex in A549 lung cancer cells [43]. Whether Sp1 or miR-182 regulates TIMP-1 in lung cancer needs to be addressed in future studies. Finally miR-182 levels were lower in CL1-5 cells then in CL1-0 cells resulting in increased metastatic activity in CL1-5. Collectively our data suggest that miR-182 inhibits lung cancer metastasis. Our previous study indicated that Sp1 is down regulated in the late stages of lung cancer progression [32]. Therefore in the late stages of lung tumorigenesis miR-182 expression was down regulated compared with expression in the early stages which led to tumor metastasis through at least in part an increase in FOXO3 expression. It is still not clear why miR-182 has different roles in different types of cancer; this awaits further study. Although we found that FOXO3 is involved in miR-182-mediated lung cancer progression FOXO3 knockdown did not completely abolish the effects of miR-182 knockdown suggesting that other genes regulated by miR-182 contribute to the inhibition of metastasis by miR-182. With this in mind we determined the expression profile of miR-182-regulated genes. Many metastasis-related genes were induced in miR-182-knockdown cells including CD44 ADAM9 and CDH9. CD44 which localizes to the cell membrane is reportedly involved in cell migration in various cancer types [44]. Recent studies also showed that tumor initiating cells with high CD44 expression maintained lung cancer tumorigenicity and drug resistance [45]. Another metastasis-related gene induced by miR-182 knockdown ADAM9 cleaves membrane proteins such as E-cadherin [46]. A previous study showed that combined Kras and Wnt pathway activation increased the incidence of lung cancer formation [47]. Given that ADAM9 is also involved in the activation of the Wnt pathway Sp1 and miR-182 might connect the Kras and the Wnt pathway. In addition CDH9 also involves in the cancer metastasis [48]. In we showed that miR-182 is an Sp1-activated miRNA whose expression increased in lung cancer. miR-182 functioned not only as an oncomiR for lung cancer growth but also as a suppressor of lung cancer metastasis. MATERIALS AND METHODS Cell culture and transfection Human lung cancer cell lines A549 H1299 CL 1-0 and 1-5 were cultured in Dulbecco's modified Eagle's medium (Invitrogen Carlsbad CA) human diploid fibroblasts IMR were cultured in Minimum Essential Media (Invitrogen) and human bronchial epithelial cells BEAS-2B was cultured in RPMI 1640 Medium (Thermo Scientific Rockford IL). All of culture mediums contained 10% fetal bovine serum 100 U/ml penicillin G sodium and 100 ?g/ml streptomycin sulfate (Invitrogen). Cells were cultured at 37? and 5% CO2." | Lung_Cancer |
" Successful examples of this include the co-development (and co-approval) of the BRAF inhibitor vemurafenib and its companion diagnostic BRAF V600E mutation assay for BRAF-mutant metastatic melanoma[1] and the ALK inhibitor crizotinib and its companion diagnostic ALK fusion gene test in advanced ALK-fusion positive non-small cell lung cancer (NSCLC) patients.[2] [3] [4] However in some cases predictive biomarkers for a targeted therapy are not recognized until after the drug is first approved. As an example the anti-EGFR antibody cetuximab was first approved in the US for the treatment of metastatic colorectal cancer in 2004. Numerous retrospective and prospective trials subsequently revealed that tumors harboring KRAS mutations were very unlikely to respond to cetuximab. In July 2009 FDA required labeling changes for cetuximab and another anti-EGFR antibody panitumumab requiring that the indications and usage state there was no treatment benefit with the drugs for patients whose tumors had KRAS mutations in codon 12 or 13 at a time when there were no FDA-approved diagnostic assays for KRAS mutations.[5] Only later in July 2012 did a KRAS mutation assay receive FDA approval based on the results of a prospective randomized trial highlighting the challenges of retrospectively validating a companion diagnostic assay after the pivotal drug trials have been completed.[6] The anti-EGFR TKI erlotinib was initially approved for all patients with advanced NSCLC who had progressed on first-line chemotherapy. A number of subsequent studies determined that patients with EGFR-mutant NSCLC had a high likelihood of responding to these TKI leading to trials in the first-line setting for EGFR-mutant cancer.[7] [8] [9] [10] [11] [12] [13] Four prospective randomized clinical trials studied in Asian populations demonstrated that erlotinib and gefitinib resulted in improved progression-free survival compared to chemotherapy for first line therapy in NSCLC patients with EGFR mutations.[7] [8] [9] [13] Other clinical studies in mixed ethnicity cohorts have concluded with similar results.[10][12] The EURTAC trial was a randomized phase 3 trial to assess the safety and efficacy of erlotinib compared with standard platinum-based chemotherapy for first-line treatment of a patient population with advanced EGFR-mutation detected NSCLC in a largely Caucasian population of European patients. Erlotinib-treated patients experienced significant improvements in median PFS (9.7 months vs. 5.2 months) compared to chemotherapy. Patients on the erlotinib arm also had a considerably higher percentage of responses (58% vs. 15%) in the intent-to-treat population.[11] This trial has been submitted for first line indication of erlotinib in EGFR mutated NSCLC patients. The majority of activating EGFR mutations are located in exons 19 (45%) and 21 (4045%).[14] [15] [16] [17] [18] [19] [20] Guidelines from anizations such as ASCO CAP/AMP and NCCN recommend the use of anti-EGFR TKIs as first-line therapy in patients with EGFR-mutant advanced NSCLC based on the results of these pivotal clinical trials. [21] [22] [23] Recent recommendations by CAP/IASLC/AMP advise the identification of EGFR mutations present at >1% of which exon 19 deletions and an exon 21 mutation (L858R) account for greater than 90% of all mutations.[24] None of the guidelines specify the testing method to be used however the cobas EGFR Mutation test is CE-IVD approved and is recently FDA approved.[25] Here we present the retrospective analysis of a clinical validation study of the EGFR PCR test on a subset of lung cancer specimens from patients screened for the EURTAC trial. The EGFR PCR test demonstrated improved sample workflow relative to the LDTs used in the EURTAC trial enabling EGFR mutation screening in a single assay with a one-day turn-around time. The EGFR PCR test showed superior sensitivity and specificity compared with conventional Sanger sequencing. Methods The major study objectives were 1) to correlate the clinical outcomes (PFS BORR) from the subgroup of available samples tested by the EGFR PCR test to the results from the entire EURTAC population and 2) to compare the analytic performance of the EGFR PCR test to that of the original LDT and Sanger sequencing using massively parallel pyrosequencing (MPP) to resolve discrepancies observed between the other 3 testing methods. In the EURTAC trial1044 patients from hospitals in France Italy and Spain were screened using the LDT. For this study all samples were retrospectively analyzed under IRB approval from Copernicus IRB (00001313). Site specific IRB approval from each clinical site and written consent from all patients was obtained prior to the study conduct phase of NCT00446225.[11] [26] In 487 cases residual specimens were available for retesting with the EGFR PCR test (). A single 5 µm section with at least 10% tumor content from each of the 487 specimens was used for the EGFR PCR test. Genomic DNA from existing eluate or extracted from additional sections was tested on Sanger sequencing and MPP. lists the demographics of the patients screened for the EURTAC trial by the LDT sub-categorized by patients tested or not tested by the EGFR PCR test. Patients enrolled in the EURTAC trial were selected using a laboratory-developed test validated by the Laboratory of Oncology (ICO-Hospital Germans Trias i Pujol Badalona Spain) consisting of three methodologies.[26] In this study a single PCR-based assay for detecting EGFR mutations was used. Details of the analytical performance of this assay have been described previously.[27] .0089518.g001 Flow of samples through the study. E1 samples: tumor block not available for analysis. E2 samples: tumor material insufficient for analysis. LDT ?=? laboratory-developed test. .0089518.t001 Demographics of the patient cohort screened for EURTAC trial. SLCG LDT MD SLCG LDT MND EGFR PCR tested EGFR PCRnot tested EGFR PCR tested EGFR PCR not tested Total 172 53 303 489 Age (years) mean ± SD 64.1±10.4 62.9±10.4 61.7±10.6 61.7±10.6 Sex n (%) Male 41 (23.8) 14 (26.4) 179 (59.1) 281 (57.5) Female 131 (76.2) 39 (73.6) 124 (40.9) 208 (42.5) Race/ethnicity n (%) Caucasian 168 (97.7) 52 (98.1) 296 (97.7) 481 (98.4) Other* 4 (2.3) 1 (1.9) 7 (2.3) 8 (1.6) Smoking status n (%) Never smoked 124 (72.1) 31 (58.5) 74 (24.4) 133 (27.2) Past/currentsmoker 47 (27.3) 22 (41.5) 219 (72.3) 339 (69.3) Unknown 1 (0.6) 0 (0.0) 10 (3.3) 17 (3.5) Stage IIIB 13 (7.6) 2 (3.8) 17 (5.6) 40 (8.2) Stage IV 157 (91.3) 50 (94.3) 277 (91.4) 432 (88.3) Other* 2 (1.2) 1 (1.9) 9 (3.0) 17 (3.5) Histology n (%) Adenocarcinoma 156 (90.7) 47 (88.7) 266 (87.8) 407 (83.2) BronchioalveolarCarcinoma 1 (0.6) 2 (3.8) 5 (1.7) 16 (3.3) Other* 15 (8.7) 4 (7.5) 32 (10.6) 66 (13.5) *Other includes subjects with no information available. LDT ?=? laboratory-developed test; MD ?=? mutation detected; MND ?=? mutation not detected. SLCG inconclusive (n?=?27) data not shown. Statistical considerations Mutation Detected (MD) was defined as the presence of either an exon 19 deletion or L858R mutation. Mutation Not Detected (MND) was defined as the absence of both exon 19 deletions and the L858R mutation. SAS/STAT® software was used for all data analysis. Clinical outcome study statistics Kaplan-Meier survival curves were used to assess the PFS by treatment method (chemotherapy or erlotinib) among patients who were enrolled in the EURTAC trial and screened with the LDT as well as the subset of patients who were determined to be mutation-positive by the EGFR PCR test. Nonparametric log-rank test was performed to assess PFS between patients who were randomized to chemotherapy or erlotinib. The hazard ratio (chemotherapy vs. erlotinib) relative to PFS was also calculated. Best overall response was the best response recorded from the start of treatment until disease progression and BORR (Best overall response rate) was summarized with 95% confidence limits according to Pearson-Clopper methods based on investigators assessment for each treatment arm. Analytical performance statistics For analytical performance an agreement analysis was performed between the EGFR PCR test result and the LDT test. Mutation detection of exon 19 deletions and L858R mutations were analyzed in aggregate. Separately the EGFR PCR test was also compared to Sanger sequencing and MPP by a CLIA-certified laboratory. For the agreement analyses the positive percent agreement (PPA) negative percent agreement (NPA) and overall percent agreement (OPA) with their corresponding 95% confidence intervals (CIs) were calculated. In addition 3-way analyses using MPP as a second reference method was performed to resolve the discrepancy results. Mutation testing methods EGFR PCR Test The EGFR PCR test (cobas EGFR Mutation Test Roche Molecular Systems Inc Branchburg NJ USA) is a CE-IVD marked multiplex allele-specific PCR-based assay designed to detect 41 mutations in exons 181920 and 21 in FFPET specimens of human NSCLC.[28] DNA is isolated using the cobas DNA Sample Preparation Kit (Roche Molecular Systems Branchburg NJ). [29] A minimum of 150 ng of genomic DNA is required for PCR amplification which can typically be isolated from a single 5 µm FFPET section. The EGFR PCR test software version used in this study was designed to detect 29 deletions in exon 19 and 2 L858R variants in exon 21. Macrodissection is only recommended if tumor content is less than 10%; laser capture microdissection is not required. The EGFR PCR test was performed per manufacturer's package insert and results were automatically analyzed and reported. The limit of detection has been validated to 5% mutant alleles. The workflow from DNA isolation to results reporting can be performed in one 8 hour period.[27] LDT Patients in the EURTAC study were screened using a combination of methods developed by Laboratory of Oncology ICO-Hospital Germans Trias i Pujol Barcelona Spain.[11] In short EGFR activating mutations in exons 19 and 21 were initially identified by Sanger sequencing and confirmed by fragment length analysis for exon 19 deletions (FAM-labelled primer in an ABI prism 3130 DNA analyser (Applied Biosystems Foster City CA USA) and by Taqman assay for exon 21 (L858R) mutation. All tumor specimens were from the original biopsy taken prior to any treatment and before randomization. Testing was performed on ? 2mm2 of tissue obtained from one to three slides of 4-micron tissue sections which were subjected to laser capture microdissection to enrich for the presence of tumor cells. DNA was extracted using a standard laboratory protocol and tested at a single site in Spain in Laboratory of Oncology for EGFR activating mutations in exon 19 and 21 using a previously described method. The average turnaround time was approximately 5 days.[26] Bi-directional Sanger sequencing All samples tested by the EGFR PCR test were also tested by Sanger sequencing using DNA from FFPET specimens prepared by the cobas DNA Sample Preparation Kit and sequenced with 2à bidirectional Sanger sequencing by a CLIA-certified laboratory (SeqWright Houston TX USA) using a validated protocol. Repeat Sanger sequencing was performed to compare the detection of EGFR mutations from adjacent sections of tissue to minimize any impact of tissue heterogeneity used for the EGFR PCR test relative to the original LDT results. Also sequencing protocols vary by laboratory in terms of the percent tumor content/sample that requires macrodissection. DNA isolated with the cobas DNA Sample Preparation Kit and used for sequencing required ?10% tumor content. Average turnaround time to results was 7 days. The estimated limit of detection is approximately 20% mutant alleles.[30] Massively parallel pyrosequencing (MPP) Samples with valid EGFR PCR test results with adequate DNA remaining from the initial extraction were tested by a MPP method (454 GS Titanium 454 Life Sciences Branford CT USA) by a CLIA-certified laboratory (SeqWright Houston TX USA) using a validated protocol.[31] This method is a 57 day process that involves amplicon generation pooling ligation emulsion PCR amplification and massively parallel pyrosequencing with manual data analysis. The estimated limit of detection for the assay is 1.25% mutant alleles. [27] The MPP method was used to demonstrate performance of the EGFR PCR test to a more sensitive method and as an arbiter for discrepant cases observed between the LDT or the repeat Sanger sequencing. In order to preserve patient privacy associated with tested clinical samples raw MPP sequencing results were anonymized and presented in Table S1. Results Specimen demographics 487 (47%) of 1044 specimens screened for the EURTAC trial using LDTs were available for testing using the EGFR PCR test. The flow of samples through the study is shown in . Patient demographics and baseline tumor characteristics for all patients by LDT status are shown in . There were no significant differences between subsets of patients tested and patients not tested by the EGFR PCR test (p>0.05) for each LDT status (mutation detected mutation not detected) with the exception of country of the screening clinic. Clinical outcomes for patients based on the EGFR PCR test results Of the 174 patients enrolled in EURTAC trial specimens from 134 (77%) patients were available for testing using the EGFR PCR test. Excluding 11 patients with invalid EGFR PCR test results and 7 patients with a result of EGFR mutation not detected a total of 116 (67%) patients were mutation detected by the EGFR PCR test and evaluable for clinical outcome analysis (57 patients in the chemotherapy arm and 59 in the erlotinib arm). Clinical outcomes (PFS BORR and OS) are presented in Table 2. Among EGFR PCR test positive patients those treated with erlotinib had a significantly prolonged PFS when compared to patients treated with chemotherapy (p-value <0.0001 log-rank test); the median PFS was 10.4 months (95% CI: 8.0 to 13.8 months) and 5.4 months (95% CI: 4.4 to 6.8 months) for patients treated with erlotinib or chemotherapy respectively (Figure 2). The HR based on the Cox proportional hazards model was reduced by 66% (HR 0.34; [95% CI: 0.21 to 0.54]) for patients in the erlotinib versus chemotherapy arm. One year after randomization a higher percentage of patients in the erlotinib compared with the chemotherapy arm were event-free (45% [95% CI: 32% to 59% versus 6% [95% CI: 0% to 15%] respectively). .0089518.g002 Figure 2 Kaplan-Meier curves of progression-free survival (PFS) for different treatments in treatment-naïve patients with nonsmall-cell lung cancer and EGFR mutation detected by the EGFR PCR test and LDT. .0089518.t002 Table 2 Summary of Clinical Outcome Analysis among EGFR PCR test positive patients in the EURTAC trial. Chemotherapy (N?=?57) Erlotinib (N?=?59) PFS (Investigator) Patients with event 37 (64.9%) 47 (79.7%) Patients without eventa 20 (35.1%) 12 (20.3%) ?Time to event (months) ?Medianb (95%CI) 5.4 [4.4; 6.8] 10.4 [8.0; 13.8] ?p-Value (Log-Rank Test) <0.0001 ?Hazard Ratio (95% CI) 0.34 [0.21; 0.54] ?1 year estimate ?Patients remaining at risk 2 24 ?Event-free Rateb (95%CI) 6% [0%; 15%] 45% [32%; 59%] Best Overall Analysis Response rates (95% CI) 14.0% [ 6.3%; 25.8%] 59.3%[ 45.7%; 71.9%] Difference in Response Rates (%) 45.29% [ 28.8%; 61.7%] ?p-Value (Chi-squared Test) <.0001 Odds Ratio (95% CI) 8.93 [3.59; 22.19] OS Patients with event 35 (61.4%) 36 (61.0%) Patients without eventa 22 (38.6%) 23 (39.0%) ?Time to event (months) ?Medianb (95%CI) 20.8 [17.3; 29.4] 25.8 [16.1; 30.0] ?p-Value (Log-Rank Test) 0.5381 ?Hazard Ratio (95% CI) 0.86 [0.54; 1.38] ?2 - year estimate ?Patients remaining at risk 16 23 ?Event-free Rateb (95% CI) 43% [29%; 57%] 51% [38%; 64%] Note: All eligible patients enrolled in study ML20650 were determined as EGFR mutation detected by the LDT. Among those patients with EGFR mutation confirmed by the EGFR PCR test were included in this table. Event ?=? Death or progression free whichever comes first for PFS analysis and event?=?death for OS analysis. a censored. b Kaplan-Meier estimates. C including censored observations. BORR were higher in patients in the erlotinib arm (59.3% [95% CI: 45.7% to 71.9%]) compared to the chemotherapy arm (14.0% [95% CI: 6.3% to 25.8%]). Patients in the erlotinib arm were much more likely to respond to therapy than patients in the chemotherapy arm (odds ratio of 8.93 [95% CI: 3.59 to 22.19]). There was no significant difference in OS between the treatment arms (25.8 months in the erlotinib arm (95% CI: 16.1 to 30.0) and 20.8 months in the chemotherapy arm (95% CI: 17.3 to 29.4) (log-rank test p-value ?=?0.5381)). PFS BORR and OS results for EGFR PCR test positive patients did not differ significantly from those obtained in all patients enrolled in the EURTAC trial which suggests that the EGFR PCR test positive patients are representative of all EURTAC enrolled patients. For the 7 cases where the EGFR PCR test result was mutation not detected and discrepant with the LDT two cases resolved in favor of the LDT by MPP three cases resolved in favor of the EGFR PCR test and one sample was invalid for both Sanger and MPP and the other was in agreement between the EGFR PCR test and Sanger but not MPP (Table S2). Anecdotally 6 of the 7 patients were treated with erlotinib and only one patient achieved greater than or equal to median PFS based on the LDT or the EGFR PCR test. Comparison of EGFR PCR test and LDT results Among 432 specimens with valid results from both the EGFR PCR test and LDT the PPA NPA and OPA were 94.2% (146/155 CI: 89.3% 96.9%) 97.5% (270/277 CI: 94.9% 98.8%) and 96.3% (416/432 CI: 94.1% 97.7%) respectively (Table 3). Thus there was a high concordance between the original LDT and EGFR PCR test results. Among sixteen specimens with discordant results the EGFR PCR test result was confirmed by MPP in 68.8% (11/16) cases (Table S3). .0089518.t003 Table 3 Agreement analysis between EGFR PCR test and LDT. SLCG LDT Total N?=?432 Mutation detected Mutation not detected EGFR PCR test Mutation detected 146 7 153 Mutation not detected 9 270 279 Total 155 277 432* ¢12 samples with inconclusive LDT results and 43 samples with invalid EGFR PCR test results were excluded. Positive percent agreement ?=?94.2% (95% CI [89.396.9%]). Negative percent agreement ?=?97.5% (95% CI [94.998.8%]). Overall percent agreement ?=?96.3% (95% CI [94.197.7%]). Comparison of the EGFR PCR test results with Sanger Sequencing Of 487 specimens tested using the EGFR PCR test and Sanger sequencing 406 gave valid results by both methods (38 were invalid by both methods five were invalid by EGFR PCR test and 38 were invalid by Sanger sequencing). The PPA NPA and OPA for EGFR PCR test compared with Sanger sequencing were 96.6% (112/116 CI: 91.7% 98.7%) 88.3% (256/290 CI: 84.1% 91.5%) and 90.6% (368/406 CI: 87.4% 93.1%; Table 4) respectively. Among 38 discordant results between the EGFR PCR test and Sanger sequencing MPP agreed with the EGFR PCR test result in 30 (78.9%) cases (Table S4). Sanger sequencing detected one L858R not detected by MPP and failed to detect 22 exon 19 deletions and 7 L858R mutations confirmed by MPP. Four MPP results were invalid and the remaining four results agreed with Sanger. The range of percent mutant alleles of the cases missed by Sanger was 3% to 60% with several specimens (n?=?16) under the estimated limit of detection for Sanger. .0089518.t004 Table 4 Agreement analysis between EGFR PCR test and Sanger sequencing. Sanger sequencing Total N?=?406 Mutation detected Mutation not detected EGFR PCR test Mutation detected 112 34 146 Mutation not detected 4 256 260 Total 116 290 406 *81 samples with invalid EGFR PCR test or Sanger sequencing results were excluded. Positive percent agreement ?=?96.6% (95% CI [91.598.7%]). Negative percent agreement ?=?88.3% (95% CI [84.191.5%]). Overall percent agreement ?=?90.6% (95% CI [87.493.1%]). Discussion This study supports the feasibility of performing a retrospective clinical validation of a companion diagnostic from prospective therapeutic clinical trials. The EGFR PCR test results were highly concordant (>96%) with the LDT results used to select patients for the EURTAC trial. As a consequence PFS and BORR of the subset of patients with EGFR mutations detected with the EGFR PCR test were comparable to the full cohort of patients enrolled in the EURTAC trial thus validating the use of the EGFR PCR test to select patients for treatment with anti-EGFR TKIs such as erlotinib. Median PFS survival was 9.7 versus 10.4 months for the erlotinib group and 5.2 versus 5.4 months for the LDTs and EGFR PCR test respectively. The BORR was 58% versus 59.3% months for the erlotinib group and 15% versus 14.0% for the LDTs and EGFR PCR test respectively. Among the 16 discordant specimens between the EGFR PCR test and LDTs a third mutation testing method agreed with the EGFR PCR test result in 11 cases. Of seven cases that were mutation detected by the EGFR PCR test and mutation not detected by the LDT 5 were confirmed by MPP. These patients could have potentially benefited from anti-EGFR TKI therapy. The EGFR PCR test had a number of technical advantages over the LDT used in the EURTAC trial. The LDT required laser capture microdissection of multiple tissue sections and involved 3 separate assays with a median turnaround time of 4.5 days. By comparison the EGFR PCR test required macrodissection only if the tumor content was <10% and can be performed in one day using a single 5 µm section. Furthermore the EGFR PCR test is a commercially available kit-based assay that provides an automated result rather than a manual process subject to interpretation and which can be performed by any qualified clinical laboratory. " | Lung_Cancer |
"Both FDR values for discovered pairwise and triplet combinations were zero therefore all of the discovered logic pairwise and triplet combinations were not generated by chance and all of them might represent real associations. In addition we calculated the recurrence rate of discovered logic pairwise and triplet combinations among all random trials. The logic relationships with the recurrence rate larger than were considered as the relationships which were independent of the specimens selected. Finally we derived probe-AC lower logic relationships and probe-AC higher logic relationships (Table A and B in Table S1). Note that the AC profile data and SCC profile data were binary complementary vectors. If a probe (or a probe pair) is related with AC by the th type of lower (higher) logic relationships then the probe (the probe pair) is related with SCC by the th type of lower (higher) logic relationships where the uncertainty coefficient of the probe-SCC lower (higher) logic relationship is equal to that of the probe-AC lower (higher) logic relationship but . Therefore the probe which has a close relationship with AC is also closely related with SCC. Finally we obtained probe-AC/SCC lower logic relationships and probe-AC/SCC higher logic relationships. Identification of gene-subtype lower and higher logic relationships Each probe which was focused on in this paper is mapped to a single gene. Conversely a gene may be detected by more than one probe. For example the CLCA2 gene was detected by four different probes: 206164_at 206165_s_at 206166_s_at and 217528_at. All of the above four probes were related with AC by the second type of lower logic relationships. Moreover and were the mean uncertainty coefficients for each of the four probes related with AC in both directions respectively. A probe-AC logic relationship set comprised several probe-AC logic relationships where probes were associated to the same gene. In a probe-AC logic relationship set the probe-AC/SCC logic relationship with the largest mean uncertainty coefficients in both directions was used to generate a gene-AC/SCC logic relationship as described in Section Materials and Methods. Thus CLCA2 was related with AC by the second type of lower logic relationships and the coefficient of the CLCA2-AC/SCC relationship was . According to the above method gene-AC/SCC lower logic relationships were generated from probe-AC/SCC lower logic relationships (Table A in Table S2). Each of the rest probe-AC/SCC lower logic relationships generated a gene-AC/SCC lower logic relationship. Finally we obtained gene-AC/SCC lower logic relationships (Table A in Table S3). We found that if a gene was detected by more than one probe and the probes were related with subtypes by lower logic relationships then the types of the probe-AC/SCC lower logic relationships were the same. It is suggested that the probes which are associated to the same gene may be related with subtypes by the same way. We obtained six gene-AC/SCC higher logic relationships from probe-AC/SCC higher logic relationships (Table B in Table S2). Each of the rest probe-AC/SCC higher logic relationships generated a gene-AC/SCC higher logic relationship. Finally we obtained gene-AC/SCC higher logic relationships (Table B in Table S3). In what follows we discussed examples of logic relationships which may be inferred from phenomenons previously described in the literature. Examples of gene-subtype lower logic relationships If each of the genes DSG3 CLCA2 DSC3 and PKP1 was expressed then SCC was present while AC was absent. In addition if each of above genes was not expressed then SCC was absent and AC was present. That is the expression of each of above genes was a sufficient and necessary condition of the presence of SCC as well as the absence of AC. Our results suggested that genes (DSG3 CLCA2 DSC3 and PKP1) may distinguish subtype AC from SCC. Given that intracellular bridges are one of the most characteristic of SCC but not of AC proteins involved in these bridges may be up-regulated in SCC only such as desmosome proteins and intercellular junctional proteins [25]. Desmoglein 3 is the protein encoded by DSG3. This protein is a calcium-binding transmembrane glycoprotein component of desmosome in vertebrate epithelial cells." | Lung_Cancer |
"Tumor markers play a key role in patient management for many malignancies. The potential uses of serum tumor markers include aiding early diagnosis determining prognosis prospectively predicting response or resistance to specific therapies and monitoring therapy in patients with advanced disease. Kallikrein-related peptidases 11 (KLK11) is a member of the human kallikrein gene family which localized on chromosome 19q13.4 [5]. Recent studies have reported that KLK11 has been expressed in many cancers including prostate cancer [6] ovarian cancer [7] gastric cancer [8] as well as rectal carcinoma [9]. An immunofluorometric assay study demonstrated that KLK11 expression in ovarian cancer tissues is a marker of favorable prognosis since patients with KLK-positive tumors exhibit a longer progression-free survival (PFS) and overall survival (OS) [10]. Additionally Sasaki et al. [11] reported that lower KLK11 mRNA expression in lung cancer is an indicator of poor prognosis in patients with lung cancer. However there seems to be a paucity of research concerned with serum KLK11 expression in NSCLC. For this reason the goal of the present study was to investigate the baseline serum levels of KLK11 in patients with NSCLC to determine its potential diagnostic and prognostic roles. Materials and methods Patients A total of 138 patients with NSCLC were examined at the Nanjing Chest Hospital between January 2006 and May 2008. The cohort of patients included 80 (58.0 %) male and 58 (42.0 %) female subjects with a median age of 56 years (range 4568 years). The clinical features of the patients are summarized in . Follow-up lasted through December 2012 with a median follow-up period of 22 months for living patients (range 380 months). PFS was defined as the time interval between the date of diagnosis and the date of disease relapse. OS was defined as the time interval between the date of diagnosis and the date of death.Clinical characteristics of NSCLC patients and controlsVariablesNSCLCControl P valueSubject no.13840Age year57.8?±?10.254.6?±?7.80.614Male/Female80/5826/140.325Histology?AC78?SCC60 AC adenocarcinoma SCC squamous cell carcinoma The diagnosis of lung cancer was made using various methods: sputum cytology fine-needle aspiration or bronchoscopy as dictated by the patients presentation. Pathologists interpreted the cytology or histology of tissue biopsy. Lung cancer was staged using a widely used classification system and the staging procedure included a clinical examination; CT of the chest abdomen and brain; abdominal ultrasonography; bone scanning; and positron emission tomography. The study protocol was approved by the ethics committee of Nanjing Chest Hospital. All patients provided written informed consent before enrollment. Measurement of serum KLK11 levels Serum samples from each individual were obtained at the time of diagnosis before any therapeutic measures were started (surgery chemotherapy or radiation). Samples were centrifuged at 1500g for 10 min at ?4 °C. The supernatant was stored at ?80 °C for assessment of the levels of KLK11. The KLK11 concentration was determined by ELISA with the commercial KLK11 ELISA Ready-SET-Go kit (eBioscience San Diego CA). All samples were blinded to the technologists running the assays and the code was broken to the statisticians after the database was constructed. Statistical analysis Statistical software (SPSS for Windows version 18) was used for the analysis. Differences between independent groups were examined by the MannWhitney U test. To determine the diagnostic accuracy of KLK11 receiver operating characteristic (ROC) curves were retrieved from logistic regression analysis and the area under the curve (AUC) was calculated. Univariate survival analysis was performed using the KaplanMeier method and the log-rank test. Multivariate analysis was conducted to determine an independent impact on survival using the Cox proportional hazard method. P?<?0.05 was considered statistically significant. Results Comparison of serum KLK11 levels between NSCLC patients and controls As shown in Fig. 1 the concentration of KLK11 was significantly higher in patients with NSCLC (2.04?±?0.86 ng/ml) than in those with the controls (0.93?±?0.52 ng/ml) (P?<?0.01).Fig. 1Levels of KLK11 in NSCLC. Among 138 NSCLC patients the serum levels of KLK11 were 2.04?±?0.86 ng/ml which were significantly higher than 0.93?±?0.52 ng/ml in healthy controls (P?<?0.01) Diagnostic value of KLK11 in NSCLC A ROC curve analysis was carried out to assess the value of KLK11 in NSCLC. The area under the ROC curve was 0.892 (confidence interval (95 % CI) 0.8410.942). With a cutoff point of 1.05 ng/ml which was defined as the normal value based on the mean value plus two standard deviation obtained from healthy controls serum KLK11 has a sensitivity of 65.9 % (91/138) a specificity of 82.5 % (33/40) an accuracy of 69.7 % (124/178) a positive predictive value of 92.9 % (91/98) and a negative predictive value of 41.3 % (33/80) (Fig. 2).Fig. 2ROC of KLK11 for the diagnosis of NSCLC. Serum levels of KLK11 among 138 NSCLC patients and 40 healthy controls were determined. The diagnostic potentials of KLK11 were assessed by ROC curves. The AUC value was 0.892 Relationship between serum KLK11 levels and clinicopathologic factors The relationships between KLK11 levels and clinicopathologic factors of lung cancer patients are shown in . The serum KLK11 levels did not differ significantly with age (P?=?0.569) sex (P?=?0.505) or histology (P?=?0.713). The levels of KLK11 were significantly correlated with tumor-node-metastasis (TNM) stage (P?=?0.000) lymph node metastases (P?=?0.000) and distant metastases (P?=?0.000).The clinicopathological factors of NSCLC and the association with KLK11 levelsFactorsnKLk11 (ng/ml) P- valueAge year0.569??60622.07?±?0.77?<60762.12?±?0.66Gender0.505?Male802.16?±?0.82?Female581.99?±?0.53Histology0.713?AC782.05?±?0.85?SCC602.01?±?0.53TNM stage0.000?III882.51?±?0.61?IIIIV501.76?±?0.63Lymph node metastases0.000?Absent682.41?±?0.64?Present701.65?±?0.57Distant metastases0.000?Absent982.38?±?0.59?Present401.89?±?0.71 AC adenocarcinoma SCC squamous cell carcinoma Association of serum KLK11 levels with survival Finally we determined whether the baseline serum concentration of KLK11 would be a prognostic marker in NSCLC. The cutoff point of 1.05 ng/ml was selected to categorize patients as KLK11-high or low. Univariate analysis showed that serum KLK11 level was significantly correlated OS (P?=?0.002) and PFS (P?=?0.009) ().Univariate and multivariate analysis of KLK11 status with regard to PFS and OSVariablesPFSOSHR95 % CI P valueHR95 % CI P valueUnivariate analysis?KLK11 (Low vs. High)0.460.250.820.0090.360.190.690.002?Age (?60 vs. <60)1.230.672.280.5061.180.592.130.792?Gender (Male vs. Female)1.320.711.820.7821.190.691.980.673?Histology (AC vs. SCC)1.830.592.130.7921.340.651.980.546?Stage (III vs. IIIIV)1.330.652.210.0010.931.093.440.025?Lymph node metastases (absent vs. present)1.421.041.940.2711.770.321.660.347?Distant metastases (absent vs. present)1.981.033.010.0391.871.042.990.075Multivariate analysis?KLK11 (low vs. high)0.530.29-0.970.0420.480.24-0.950.037?Age (?60 vs. <60)0.980.52-1.940.8341.061.28-3.010.128?Gender (male vs. Female)1.280.67-1.890.6721.140.46-2.140.542?Histology (AC vs. SCC)1.371.04-2.330.3151.260.64-2.560.424?Stage (III vs. IIIIV)1.250.56-2.260.0011.961.02-3.770.043?Lymph node metastases (absent vs. present)1.130.81-1.570.1481.840.33-1.720.334?Distant metastases (absent vs. present)1.440.85-1.970.0981.890.99-2.350.051 HR hazard ratio CI confidence interval In multivariate analysis high KLK11 was found to be significantly associated with a longer PFS and OS (HR 0.53 and 0.48; P?=?0.042 and P?=?0.037 respectively). KaplanMeier survival curves (Fig. 3) further demonstrate that lung cancer patients with high KLK11 have substantially longer PFS and OS (P?<?0.05) compared to those with low KLK11 cancer. As expected disease stage was found to be strongly associated with decreased PFS and OS in both univariate and multivariate analyses (P?<?0.05).Fig. 3KaplanMeier survival curves for PFS and OS in patients with KLK11-high and -low NSCLC." | Lung_Cancer |
"Study for Epidermal Growth Factor Receptor and KRAS Mutation Detection in 74 Blinded Non-small Cell Lung Carcinoma Samples: A Total of 5550 Exons Sequenced by 15 Molecular French Laboratories. J Thorac Oncol6: 1006101521532509 39 BellonE LigtenbergMJ TejparS CoxK de HertoghG et al (2011) External quality assessment for KRAS testing is needed: setup of a European program and report of the first joined regional quality assessment rounds. Oncologist16: 467478 Br J Cancer Br. J. Cancer British Journal of Cancer 0007-0920 1532-1827 Nature Publishing Group 24921918 4119981 bjc2014308 10.1038/bjc.2014.308 Epidemiology Possible pro-carcinogenic association of endotoxin on lung cancer among Shanghai women textile workers Pro-carcinogenic association of endotoxin on lung cancer Checkoway H 1 * Lundin J I 2 Costello S 3 Ray R 4 Li W 4 Eisen E A 3 Astrakianakis G 5 Seixas N 2 Applebaum K 6 Gao D L 7 Thomas D B 4 1Department of Family and Preventive Medicine University of California San Diego La Jolla CA 92093 USA 2Department of Environmental and Occupational Health Sciences University of Washington Seattle WA 98195 USA 3Department of Environmental Health Sciences University of California Berkeley CA 94720 USA 4Division of Public Health Sciences Fred Hutchinson Cancer Research Center Seattle WA 98109 USA 5School of Population and Public Health University of British Columbia Vancouver BC V6T1Z4 Canada 6Department of Environmental and Occupational Health Gee Washington University Washington DC 20052 USA 7Zhong Shan Hospital Cancer Center Shanghai 200030 China *E-mail: hcheckowayucsd.edu 29 07 2014 12 06 2014 111 3 603 607 20 02 2014 05 05 2014 11 05 2014 Copyright 2014 Cancer Research UK 2014 Cancer Research UK From twelve months after its original publication this work is licensed under the Creative Commons Attribution-NonCommercial-Share Alike 3.0 Unported License. To view a copy of this license visit http://creativecommons./licenses/by-nc-sa/3.0/ Background: Endotoxin (lipopolysaccharide) is a widespread contaminant in many environmental settings. Since the 1970s there has been generally consistent evidence indicating reduced risks for lung cancer associated with occupational endotoxin exposure. Methods: We updated a casecohort study nested within a cohort of 267?400 female textile workers in Shanghai China. We compared exposure histories of 1456 incident lung cancers cases diagnosed during 19892006 with those of a reference subcohort of 3022 workers who were free of lung cancer at the end of follow-up. We applied Cox proportional hazards modelling to estimate exposureresponse trends adjusted for age and smoking for cumulative exposures lagged by 010 and 20 years and separately for time windows of ?15 and >15 years since first exposure. Results: We observed no associations between cumulative exposure and lung cancer irrespective of lag interval. In contrast analyses by exposure time windows revealed modestly elevated but not statistically significant relative risks (?1.27) at the highest three exposure quintiles for exposures that occurred >15 years since first exposure. Conclusions: The findings do not support a protective effect of endotoxin but are suggestive of possible lung cancer promotion with increasing time since first exposure. endotoxin lipopolysaccharide lung cancer epidemiology textile industry occupational health Br J Cancer Br. J. Cancer British Journal of Cancer 0007-0920 1532-1827 Nature Publishing Group 24651386 3992504 bjc2014146 10.1038/bjc.2014.146 Clinical Study A multicentre randomised controlled trial of reciprocal lung cancer peer review and supported quality improvement: results from the improving lung cancer outcomes project Improving lung cancer outcomes project results Russell G K 1 Jimenez S 1 Martin L 1 Stanley R 2 Peake M D 1 3 Woolhouse I 1 4 * 1Clinical Standards Department Royal College of Physicians London NW14LE UK 2Clinical Audit Support Unit NHS Information Centre for Health and Social Care Leeds LS16AE UK 3Department of Respiratory Medicine Glenfield Hospital Leicester LE39QP UK 4Department of Respiratory Medicine Queen Elizabeth Hospital Birmingham Birmingham B152WB UK *E-mail: ian.woolhouseuhb.nhs.uk 15 04 2014 20 03 2014 110 8 1936 1942 19 12 2013 11 02 2014 24 02 2014 Copyright 2014 Cancer Research UK 2014 Cancer Research UK From twelve months after its original publication this work is licensed under the Creative Commons Attribution-NonCommercial-Share Alike 3.0 Unported License. To view a copy of this license visit http://creativecommons./licenses/by-nc-sa/3.0/ Background: Results from the National Lung Cancer Audit demonstrate unexplained variation in outcomes. Peer review with supported quality improvement has been shown to reduce variation in other areas of health care but has not been formally tested in cancer multidisciplinary teams. The aim of the current study is to assess the impact of reciprocal peer-to-peer review visits with supported quality improvement and collaborative working on lung cancer process and outcome measures. Methods: English lung cancer teams were randomised to usual care or facilitated reciprocal peer review visits followed by 12 months of supported quality improvement. The primary outcome was change in the following national audit indicators; mulitdisciplinary team discussion histological confirmation active treatment surgical resection small-cell chemotherapy and specialist nurse review. Patient experience was measured using a new lung cancer patient questionnaire in the intervention group. Results: Thirty teams (31 trusts) entered the intervention group and 29 of these submitted a total of 67 quality improvement plans. Active treatment increased in the intervention group (n=31) by 5.2% compared with 1.2% in the control group (n=48 mean difference 4.1% 95% CI ?0.1 to 8.2% P=0.055). The remaining audit indicators improved similarly in all groups. Mean patient experience scores in the intervention group did not change significantly during the study but a significant improvement was seen in the scores for the five teams with the worst baseline scores (0.86 to 0.22 P<0.001). Conclusions: Reciprocal peer review with supported quality improvement was feasible and effective in stimulating quality improvement activity but resulted in only modest improvements in lung cancer treatment rates and patient experience. lung cancer multidisciplinary quality improvement peer Lung cancer is the commonest cause of cancer death in England and Wales with around 38?000 cases diagnosed each year and ?35?000 deaths. Data from the National Lung Cancer Audit (NLCA) demonstrate significant variation in process and outcome measures across England. In 2009 there was a three-fold difference in survival and active treatment rates which persisted following case mix adjustment (Beckett et al 2012). Furthermore reported lung cancer outcomes in the UK are worse than other comparable European countries (Walters et al 2013) and have improved little in recent years (Khakwani et al 2013). It has been estimated that if survival rates were increased to that of the best in Europe around 1300 lives could be saved each year in the United Kingdom (Abdel-Rahman et al 2009). Variation in health care is not unique to lung cancer and addressing unwarranted variation is challenging (Wise 2010). Although external regulation may have a role in some areas this approach is more difficult to apply to the complex pathways involved in lung cancer diagnosis and treatment. Peer review with supported quality improvement offers a promising alternative but the evidence for its effectiveness is limited. The Washington State's Surgical Care and Outcomes Assessment Program utilised a peer support programme to share the best practice which led to a significant reduction in post-operative complications (Kwon et al 2012). Within the United Kingdom the national COPD resources and outcomes project demonstrated that reciprocal peer-to-peer review led to only limited quantitative differences in the quality of services offered (Roberts et al 2012). A qualitative analysis of this study identified a number of barriers to improvement including difficulties in establishing effective working relationships funding changes and service re-design. In 2003 the Institute for Healthcare Improvement described the collaborative model to achieve a breakthrough improvement (Institute for Healthcare Improvement 2003). Collaboratives allow teams working on the same issue to share good practice and innovation permitting others to take these ideas and implement them in the context of their own anisation resources and case mix. Pronovost et al (2006) successfully employed this collaborative approach together with supported quality improvement to implement five evidence-based interventions on the intensive care unit resulting in the reduction in catheter-related bloodstream infections to zero. These studies offer a persuasive proof of concept but the absence of a control group or of patient-specific outcomes measures limits their implementation in other disease areas such as cancer. The aim of the current study is to determine whether a programme of reciprocal peer-to-peer review visits with supported quality improvement and collaborative working can significantly improve lung cancer process and outcome measures and thus reduce unwarranted variation in outcomes. Materials and methods Study design We conducted a prospective randomised controlled trial. Study population One hundred and sixty-two English NHS trusts were identified from the 2008 NLCA annual report. Centres only providing treatment (not diagnostics) orthopaedic hospitals and ambulance trusts were excluded. Invitations to participate were sent to the remaining 152 trusts. Trusts who agreed to participate and who had 2008 NLCA case ascertainment rates of > 50% expected were paired before randomisation on the basis of contrasting results for four key indicators from the NLCA. The indicators were active treatment rates surgical resection rates median survival and the proportion of patients assessed by a clinical nurse specialist. Each trust was colour coded for each indicator red if below the national average and green if above. By placing each trust with its colour-coded indicators on a map we were able to pair trusts on the basis of a contrasting mixture of red and green indicators and a travel time between centres of around 2?h. On the basis of data from the national COPD resources and outcomes project we determined that we would be able to complete 30 peer review visits during the lifetime of the project thus allowing 30 lung cancer multidisciplinary teams (15 pairs) to be randomised into the intervention arm. Randomisation was performed in a blinded fashion by assigning a random number to each pair of trusts and then allocating pairs numbered 115 to the intervention group. The remaining trusts formed either the control group (if they had agreed to participate) or the non-participant group and had no further contact with the study team but continued to submit data to the NLCA as usual. Intervention The study timeline is shown in Figure 1. Following introductory workshops the multidisciplinary teams within each pair undertook facilitated reciprocal site visits. The visits consisted of observation of the host team's multidisciplinary team meeting three discussion sessions focusing on the functioning of the mulitdisciplinary team meeting the host team's NLCA data and patient experience questionnaire results. The final session aimed to identify the focus of improvement work to be undertaken by the host team. The quality improvement facilitator introduced a structured template for the quality improvement plans and provided a short introduction to using the model of improvement to guide implementation of the plans. Over the next 12 months the quality improvement facilitator provided support via electronic mail telephone and follow-up visits where required. Teams within the intervention group supported each other via mini-collaboratives in the form of web-based teleconferences and two face-to-face workshops. Outcomes Changes in process and outcome were assessed using data from local quality-improving plans and the following indicators from the NLCA: the proportion of patients discussed at a multidisciplinary team meeting histological confirmation rate active treatment rate surgical resection rate the proportion of patients with small-cell lung cancer receiving chemotherapy and the proportion of patients seen by a lung cancer nurse specialist. Patient experience was assessed in the intervention group using a new lung cancer-specific patient experience questionnaire designed in collaboration with the Roy Castle Lung Cancer Foundation. The questionnaire included 11 questions selected with permission from the previously validated 2004 national cancer patient survey. The questions covered the following domains: communication privacy respect and dignity and three free text questions (see Appendix I). Participating teams were asked to distribute 30 questionnaires to patients recently seen in their services. The clinical nurse specialists distributed the questionnaires to patients who anonymously returned them to the Royal College of Physicians. An independent qualitative ethnographic evaluation of the study was undertaken by the Social Science Applied to Healthcare Improvement Research Group at the University of Leicester. Statistical methods Data were tested for normality using the ShapiroWilk test. Baseline NLCA indicators were taken from the 2009 NLCA report and the intervention control and non-participant groups were compared using a ?2- test. The changes in NLCA indicators from 2009 to 2011 were compared using an independent t-test. Patient experience questionnaire responses for each question were labelled and re-coded to separate them into the worst patient experience category (score 1) vs all other responses (score 0). These scores were then summated to create a domain and a total patient experience score with a possible range of 011 whereby a higher score indicates a worse patient experience. Analyses were performed using the statistical software package SPSS (International Business Machines Corp. Armonk NY USA). Funding and ethics The study was funded by a Closing the Gap' grant from the Health Foundation. The National Research Ethics Service confirmed that the study was service evaluation and quality improvement and did not require ethical review. Results One hundred trusts (66%) replied to the invitation to participate and 91 (61%) agreed to participate in the study. Eighty-one trusts had 2008 NLCA data of sufficient quality to allow pairing. Two trusts provided a joint multidisciplinary team allowing 40 pairs of multidisciplinary teams to be created. One pair agreed to act as a pilot and was excluded from further analysis. Of the remaining 39 pairs 15 pairs (31 trusts) were randomised to the intervention group. The remaining 24 pairs formed the control group. During the study two trusts in the control group amalgamated to form one trust so the total number of trusts in the control group was 47 (Figure 2). Quality improvement plans Two hundred and thirty medical professionals from 31 trusts participated in the review visits. Twenty-nine teams submitted a total of 67 quality improvement plans. The issues identified in the quality improvement plans are shown in Table 1. Eighteen teams collected local data to measure impact. An example of such data is shown in Figure 3. This trust identified small-cell lung cancer chemotherapy as an area for improvement. They introduced a number of changes to their diagnostic and treatment pathways including prioritisation of small-cell pathology reporting faxing of the results to the multidisciplinary team coordinator and lung nurse specialist to allow early booking of oncology appointments. These changes were monitored using a run chart that demonstrated a reduction in the time from multidisciplinary team meeting to chemotherapy treatment and an increase in the proportion of small-cell lung cancer patients receiving chemotherapy from 60% in 2009 to 71% in 2011. National lung cancer audit indicators Baseline (2009) NLCA indicators for the intervention control and non-participant groups were similar (Table 2). The mean change for each NLCA indicator from baseline to 2011 in the intervention and control group is shown in Figure 4. The proportion of patients receiving active anti-cancer treatment in the intervention group increased by 5.2% compared with 1.2% in the controls (mean difference 4.1% 95% CI ?0.1 to 8.2% P=0.055). The remaining NLCA indicators improved similarly both in the intervention and control groups. Patient experience In the intervention group patient experience questionnaires were returned by 438 patients from 30 multidisciplinary teams at baseline (return rate 49%) and 372 patients from 27 trusts following the intervention (return rate 41%). Baseline total scores were low (01.31) indicating high levels of patient satisfaction with the care received although there was a statistically significant (P<0.001) variation in results by the multidisciplinary team (Figure 5). In particular the proportion of patients responding yes to the question did you find that the person who told you about your diagnosis did so with sufficient sensitivity/care?' varied significantly by 57%100% (P<0.001). The total questionnaire scores did not change significantly during the study (0.220.17 P=0.377) however the variation by the multidisciplinary team reduced (Figure 5). Given that the study aimed to bring the standard of the lower performing trusts to that of the best we performed a post hoc analysis for the five trusts with the worst baseline patient experience scores. This demonstrated that the mean total score improved significantly for these trusts from 0.86 to 0.22 P<0.001. The biggest improvement in this group was seen in the proportion of patients responding yes to the question did you find that the person who told you about your diagnosis did so with sufficient sensitivity/care?' which increased from 75% to 90% (P=0.05). One multidisciplinary team in this group achieved this improvement by using their baseline questionnaire results as a lever to encourage attendance at an advanced communications skills course. The questionnaire domain-specific scores did not change significantly during the study. Of the individual questions a significant improvement was seen in the rating of the quality of information provided as excellent which rose from 53%59% P<0.05. Qualitative evaluation Participants' experiences were overwhelmingly positive. The reciprocal peer-to-peer visits with supported quality improvement were seen as a strong driver to change. The method of pairing multidisciplinary teams was important. In particular pairing teams with different results not just good' with bad' and allowing teams to visit each other's sites to ensure a two-way sharing of best practice. The independent quality improvement facilitator role was seen as crucial to ensure the visits remained focussed and that the engagement with quality improvement plans was maintained. Finally the involvement of senior managers was crucial to the successful implementation of the quality improvement plans. The detailed findings from the independent evaluation of this project have been reported elsewhere (Aveling et al 2012). Discussion Lung cancer outcomes remain relatively poor and reducing unexplained variation is an attractive proposition to promote improvement. There are a number of ways that clinical teams may share best practice and innovative service delivery models however studies formally evaluating their impact are limited. To our knowledge this is the first study to formally test a national quality improvement strategy which aimed to bring the standard of all lung cancer teams to that of the best. We have demonstrated that reciprocal peer-to-peer review with supported quality improvement is both feasible and effective at stimulating local quality improvement activity but had a relatively modest and somewhat disappointing impact on process and outcome measures as measured by NLCA indicators and a new lung cancer patient experience questionnaire. The facilitated reciprocal visits represented a new and unique opportunity for all members of a lung cancer team to exchange ideas in a supported environment and to formally design then implement quality improvement plans. Nearly two-thirds of lung cancer multidisciplinary teams in England agreed to take part in the study and reassuringly baseline NLCA indicators did not differ significantly between participants and non-participants suggesting that the willingness to participate in quality improvement activity is not related to baseline performance. There were a wide range of areas identified for improvement but nearly half of the teams identified multidisciplinary team meeting effectiveness as a key issue. This is not surprising given that these meetings are pivotal in the lung cancer pathway. Live observation of each multidisciplinary team meeting followed by facilitated feedback proved to be a strong driver to improve on problems such as ensuring weekly presence of all the treatment specialists as well as more simple issues such as room layout. The need to streamline diagnostic and treatment pathways was also identified as a common problem. Recent NICE guidance on the management of lung cancer (National Institute for Health and Care Excellence 2011) recommended a paradigm shift in the diagnostic algorithm from performing multiple diagnostic and staging investigations to performing a single test that will provide both diagnostic and staging information. A number of teams within our study were able to introduce such pathways and demonstrate impressive reductions in diagnostic times and more prompt treatment. This together with more effective multidisciplinary team working may have led to the small increase in the active anti-cancer treatment rates seen within the intervention group. However an alternative explanation for the improvement is regression to the mean given that treatment rates in the intervention group were lower at baseline and overall the lack of significant improvement across the range of NLCA indicators in the intervention group was disappointing. One possible explanation for this is the challenge that some participating teams encountered converting enthusiastic quality improvement plans into tangible improvements for patients over a relatively short time period. The qualitative evaluation confirmed that participants often underestimated the time and energy required to implement and sustain change and highlighted the importance of early engagement with hospital managers to maintain momentum (Aveling et al 2012). Alternatively other national lung cancer initiatives implemented at the time of the study may have driven coexistent improvements in the control group. For example the drive to encourage all lung cancer patients to be referred for clinical nurse specialist support has subsequently been shown to increase the probability that a lung cancer patient receives active treatment. Although even small improvements in lung cancer treatment rates are very welcome it is recognised that undergoing investigation for suspected lung cancer generates high levels of patient anxiety and many patients will remain too unwell to benefit from currently available drugs. The assessment of patient experience is therefore of particular importance in lung cancer. This has proved challenging in detailed national cancer surveys owing to the advance in age poor health and short median survival of lung cancer patients. The response rate to our short questionnaire was relatively high at 4149% compared with the 2011 national survey in which only 7% of lung cancer patients responded (Department of Health 2012) but still represents the views of less than half of lung cancer patients and is a relative limitation in terms of generalisability of the results. It was reassuring to note that at entry to the study patients in the intervention group generally rated their experience as highly satisfactory. This may explain the low number of teams who specifically identified patient experience as an area for quality improvement. In terms of assessing the impact of the reciprocal peer-to-peer review visits and supported quality improvement on patient experience it is likely that this high-baseline satisfaction and the lack of patient experience data for the control group limited our ability to detect a significant change. However our results suggest that those teams with poor scores may be able to use patient experience data to promote significant improvements particularly in areas such as communication skills. Further work is required to develop a lung cancer patient experience measure that is both acceptable to patients and able to detect small but clinically important changes in experience. Although similar in name to the national cancer peer review process there are a number of important differences between the reciprocal peer-to-peer review and supported quality improvement process employed in the current study and national cancer peer review. The latter predominantly performs a quality assurance role ensuring that cancer teams meet a minimum standard via compliance with a number of process measures. Support with quality improvement is not provided and site visits are now rarely performed. The qualitative evaluation of our study highlighted the importance of an independent quality improvement facilitator to the success of the peer review visits and the subsequent implementation of the quality improvement plans. Integration of facilitated reciprocal peer-to-peer review and supported quality improvement into national cancer peer review both for lung cancer and other tumour sites is an attractive proposition and requires further study. However our results suggest that this strategy alone is unlikely to have a major impact on lung cancer treatment rates. This phenomenon is not new in lung cancer for example the introduction and NICE approval of gefitinib treatment for the first-line treatment of lung cancer in 2010 was associated with only a 1% increase in active anti-cancer treatment rates over the following year (Health and Social Care Information Centre 2012). Achieving a stepwise increase in lung cancer treatment rates and survival is likely to require a multi-targeted approach including earlier diagnosis streamlined lung cancer pathways new treatments and a reduction in unexplained variation via supported quality improvement programmes. This project was funded by a Health Foundation Closing the Gap award. (grant number: 7797/5557). Appendix I Improving lung cancer outcomes project: patient experience questionnaireWhat is this survey about? This questionnaire asks about your experience of lung cancer treatment and care at the hospital. It was developed in 2010 and it has been used by Lung Cancer Nurse Specialists in 30 hospital across participating in the Improving Lung Cancer Outcomes Project' led by the Royal College of Physicians and several other anisations. The project aims to improve the quality of services and care for people affected by lung cancer. Why should I complete the survey? We need to know your opinion of the current services and care to help improve these for people affected by lung cancer. Your participation in this survey is voluntary and your answers will be treated in confidence. If you choose not to take part in this survey it will not affect the care you receive from the NHS in any way. Please do not write your name and address anywhere on the questionnaire as this information is not required. No information you give in this questionnaire will be shared in a way that allows you to be identified. How to complete the survey and how long it will take. The questionnaire is short and will take 510?min to complete. Please try to answer every question. Please return your questionnaire even if you have not answered every question. If English is not your first language or if you if you have difficulty understanding the questions then please ask a relative or carer to help you complete the questionnaire. Questions or help? If you have any questions please contact your local lung clinical nurse specialist team. Please select one answer to each question by placing a in the appropriate box. There is space at the end of the survey for you to write any comments. This work is published under the standard license to publish agreement. After 12 months the work will become freely available and the license terms will switch to a Creative Commons Attribution-NonCommercial-Share Alike 3.0 Unported License. Abdel-Rahman M Stockton D Rachet B Hakulinen T Coleman MP 2009 What if cancer survival in Britain were the same as in Europe: how many deaths are avoidable Br J Cancer 101 (Suppl 2 S115 S124 19956155 Aveling EL Martin G JimÃnez GarcÃa S Martin L Herbert G Armstrong N Dixon-Woods M Woolhouse I 2012 Reciprocal peer review for quality improvement: an ethnographic case study of the Improving Lung Cancer Outcomes Project BMJ Qual Saf 21 1034 1041 Beckett P Woolhouse I Stanley R Peake MD 2012 Exploring variations in lung cancer care across the UK-the story so far' for the National Lung Cancer Audit Clin Med 12 14 18 22372213 Department of Health2012National Cancer Patients' Experience Survey Programme 2012/13. England. Health And Social Care Information Centre2012National Lung Cancer Audit Report. Institute for Healthcare Improvement2003The Breakthrough Series: IHI's Collaborative Model for Achieving Breakthrough Improvement. Boston. Khakwani A Rich AL Powell HA Tata LJ Stanley RA Baldwin DR Duffy JP Hubbard RB 2013 Lung cancer survival in England: trends in non-small-cell lung cancer survival over the duration of the National Lung Cancer Audit Br J Cancer 109 (8 2058 2065 24052044 Kwon S Florence M Grigas P Horton M Horvath K Johnson M Jurkovich G Klamp W Peterson K Quigley T Raum W Rogers T Thirlby R Farrokhi E Flum D 2012 Creating a learning healthcare system in surgery: Washington State's Surgical Care and Outcomes Assessment Program (SCOAP) at 5 years Surgery 151 146 152 22129638 National Institute for Health and Care Excellence 2011 The Diagnosis And Treatment Of Lung Cancer (Update Of Nice Clinical Guideline 24) Clinical guidelines CG121 London UK Pronovost P Needham D Berenholtz S Sinopoli D Chu H Cosgrove S Sexton B Hyzy R Welsh R Roth G Bander J Kepros J Goeschel C 2006 An intervention to decrease catheter-related bloodstream infections in the ICU N Engl J Med 355 2725 2732 17192537 Roberts CM Stone RA Buckingham RJ Pursey NA Lowe D Potter JM 2012 A randomized trial of peer review: the UK National Chronic Obstructive Pulmonary Disease Resources and Outcomes Project: three-year evaluation J Eval Clin Pract 18 (3 599 605 21332611 Walters S Maringe C Coleman MP Peake MD Butler J Young N Bergström S Hanna L Jakobsen E Kölbeck K Sundstrøm S Engholm G Gavin A Gjerstorff ML Hatcher J Johannesen TB Linklater KM McGahan CE Steward J Tracey E Turner D Richards MA Rachet B ICBP Module 1 Working Group 2013 Lung cancer survival and stage at diagnosis in Australia Canada Denmark Norway Sweden and the UK: a population-based study 2004-2007 Thorax 68 551 564 23399908 Wise J 2010 Health atlas shows large variations in care in England BMJ 341 c6809 c6809 Figure 1 Study timelines. Figure 2 Consort diagram disposal of eligible trusts including screening randomisation and follow-up. Figure 3 Run chart showing the waiting times from the multidisciplinary team meeting to the first treatment for 10 consecutive small-cell lung cancer patients following the implementation of the quality improvement plan at one trust in the intervention group. Figure 4 Mean change in national lung cancer audit metrics from baseline (2009) to 2011. P=0.055 active treatmentintervention vs controls. Intervention n=31 trusts control n=47 trusts and non-intervention (control and non-participants combined) n=66 trusts. Abbreviations: CNS clinical nurse specialist; MDT multidisciplinary team; SCLC small-cell lung cancer." | Lung_Cancer |
"human FTSJ2 and porcine FTSJ2. (A) The protein structure of E. coli RrmJ which was resolved by B¼gl et al. (2000) (PDB ID: 1EIZ) [7]. (B) The protein structure of human FTSJ2 which was resolved by Wu et al. (2009) (PDB ID: 2NYU) [36]. (C) The protein structure of porcine FTSJ2 which was predicted using the SWISS-MODEL website with human FTSJ2 as a template. The ?-helices and ?-strands are shown in green and yellow respectively. The SAM residues and the K-D-K-E catalytic center are shown in the ball and stick representations respectively. (TIF) Click here for additional data file. Figure S2 Porcine Ftsj2 mRNA expression in porcine tissues. (A) Expression of porcine Ftsj2 mRNA as measured by semi-quantitative RT-PCR. Porcine ?-actin mRNA was used as a loading control. (B) Quantification of the porcine Ftsj2 mRNA expression which normalized to the ?-actin mRNA expression. The values are equal to?=?the means of duplicate experiments. (TIF) Click here for additional data file. The authors would like to thank Dr. Jeremy J.W. Chen for providing the CL1-0 and CL1-5 cell lines. We also like to thank our colleagues (Drs. Tung-Chou Tsai Yu-Tang Tung and Zi-Lun Lai) in the Molecular Embryology and DNA Methylation Laboratory for their help with discussions and technical issues. References 1 AngM LiberekK SkowyraD ZyliczM GeopoulosC (1991) Biological role and regulation of the universally conserved heat shock proteins. J Biol Chem266: 24233242361761528 2 BenjaminIJ McMillanDR (1998) Stress (heat shock) proteins: molecular chaperones in cardiovascular biology and disease. Circ Res83: 1171329686751 3 RichmondCS GlasnerJD MauR JinH BlattnerFR (1999) Genome-wide expression profiling in Escherichia coli K-12. Nucleic Acids Res27: 3821383510481021 4 OguraT TomoyasuT YukiT MorimuraS BeggKJ et al (1991) Structure and function of the ftsH gene in Escherichia coli. Res Microbiol142: 2792821925026 5 CaldasT BinetE BoulocP CostaA DesgresJ et al (2000) The FtsJ/RrmJ heat shock protein of Escherichia coli is a 23 S ribosomal RNA methyltransferase. J Biol Chem275: 164141641910748051 6 LapeyreB (2004) Conserved ribosomal RNA modification and their putative roles in ribosome biogenesis and translation. Curr Genet12: 263284 7 B¼glH FaumanEB StakerBL ZhengF KushnerSR et al (2000) RNA methylation under heat shock control. Mol Cell6: 34936010983982 8 BlanchardSC PuglisiJD (2001) Solution structure of the A loop of 23S ribosomal RNA. Proc Natl Acad Sci USA98: 3720372511259644 9 CaldasT BinetE BoulocP RicharmeG (2000) Translational defects of Escherichia coli mutants deficient in the Um(2552) 23S ribosomal RNA methyltransferase RrmJ/FTSJ. Biochem Biophys Res Commun271: 71471810814528 10 FederM PasJ WyrwiczLS BujnickiJM (2003) Molecular phylogenetics of the RrmJ/fibrillarin superfamily of ribose 2?-O-methyltransferases. Gene302: 12913812527203 11 PintardL LecointeF BujnickiJM BonnerotC GrosjeanH et al (2002) Trm7p catalyses the formation of two 2?-O-methylriboses in yeast tRNA anticodon loop. EMBO J21: 1811182011927565 12 PintardL BujnickiJM LapeyreB BonnerotC (2002) MRM2 encodes a novel yeast mitochondrial 21S rRNA methyltransferase. EMBO J21: 1139114711867542 13 BonnerotC PintardL LutfallaG (2003) Functional redundancy of Spb1p and a snR52-dependent mechanism for the 2?-O-ribose methylation of a conserved rRNA position in yeast. Mol Cell12: 1309131514636587 14 KresslerD RojoM LinderP CruzJ (1999) Spb1p is a putative methyltransferase required for 60S ribosomal subunit biogenesis in Saccharomyces cerevisiae. Nucleic Acids Res27: 4598460810556316 15 LapeyreB PurushothamanSK (2004) Spb1p-directed formation of Gm2922 in the ribosome catalytic center occurs at a late processing stage. Mol Cell16: 66366915546625 16 PintardL KresslerD LapeyreB (2000) Spb1p is a yeast nucleolar protein associated with Nop1p and Nop58p that is able to bind S-adenosyl-L-methionine in vitro. Mol Cell Biol20: 1370138110648622 17 HagerJ StakerBL B¼glH JakobU (2002) Active site in RrmJ a heat shock-induced methyltransferase. J Biol Chem277: 419784198612181314 18 YangD OyaizuY OyaizuH OlsenGJ WoeseCR (1985) Mitochondrial origins. Proc Natl Acad Sci USA82: 444344473892535 19 FreudeK HoffmannK JensenLR DelatyckiMB des PortesV et al (2004) Mutations in the FTSJ1 gene coding for a novel S-adenosylmethionine-binding protein cause nonsyndromic X-linked mental retardation. Am J Hum Genet75: 30530915162322 20 CampbellJM LockwoodWW BuysTP ChariR CoeBP (2008) Integrative genomic and gene expression analysis of chromosome 7 identified novel oncogene loci in non-small cell lung cancer. Genome51: 1032103919088816 21 MorelloLG ColtriPP QuaresmaAJ SimabucoFM SilvaTC (2011) The human nucleolar protein FTSJ3 associates with NIP7 and functions in pre-rRNA processing. PLoS One6: e2917422195017 22 SimabucoFM MorelloLG Arag£oAZ Paes LemeAF ZanchinNI (2012) Proteomic characterization of the human FTSJ3 preribosomal complexes. J Proteome Res11: 3112312622540864 23 WangH BoisvertD KimKK KimR KimSH (2000) Crystal structure of a fibrillarin homologue from Methanococcus jannaschii a hyperthermophile at 1.6 A resolution. EMBO J19: 31732310654930 24 HodelAE GershonPD QuiochoFA (1998) Structural basis for sequence-nonspecific recognition of 5?-capped mRNA by a cap-modifying enzyme. Mol Cell1: 4434479660928 25 VidgrenJ SvenssonLA LiljasA (1994) Crystal structure of catechol O- methyltransferase. Nature368: 3543588127373 26 TamuraK PetersonD PetersonN StecherG NeiM et al (2011) MEGA5: molecular evolutionary genetics analysis using maximum likelihood evolutionary distance and maximum parsimony methods. Mol Biol Evol28: 2731273921546353 27 PollastriG McLysaghtA (2005) Porter: a new accurate server for protein secondary structure prediction. Bioinformatics21: 1719172015585524 28 LiuFC ChenHL ChongKY HsuAL ChenCM (2008) Production of recombinant porcine colipase secreted by Pichia pastoris and its application to improve dietary fat digestion and growth of postweaning piglets. Biotechnol Prog24" | Lung_Cancer |
"The objective response rate (ORR) for patients with adenocarcinoma (primary endpoint) was 5% (2 partial responses; 1?sided P?=?.372 for null hypothesis [H0]: ORR ? 5%) and 6% (1 partial response) for patients with nonadenocarcinoma. Responders included: 2 of 25 EGFR mutation?positive tumors; 1 of 3 EGFR wild?type with HER2 amplification. Median progression?free survival was 12 weeks overall (n?=?66) and 18 weeks (n?=?26) for patients with EGFR mutation?positive tumors. Common treatment?related adverse events were of grade 1 or 2 severity manageable with standard supportive care and included diarrhea (grade 3 [G3] 12%) acneiform dermatitis (G3 6%) exfoliative rash (G3 3%) dry skin (G3 0%) fatigue (G3 3%) and stomatitis (G3 2%). Six patients (9%) discontinued due to treatment?related adverse events. By patient report NSCLC symptoms of dyspnea cough and pain (chest arm/shoulder) showed improvement first observed after 3 weeks on therapy. S Dacomitinib demonstrated preliminary activity and acceptable tolerability in heavily pretreated patients and may offer benefit in molecularly defined patient subsets. Cancer 2014;120:11451154. 2014 The Authors. Cancer published by Wiley Periodicals Inc. on behalf of American Cancer Society. This study investigated the efficacy and safety of dacomitinib in advanced refractory nonsmall cell lung cancer (NSCLC) selecting for patients with KRAS wild?type tumors to exclude those least likely and simultaneously enrich for those most likely to benefit from therapy. Although the observed response rate was low a number of patients experienced prolonged disease control accompanied by rapid and durable lung cancer symptom relief suggesting that dacomitinib has relevant activity against KRAS wild?type NSCLC. dacomitinib PF?00299804 nonsmall cell lung cancer erlotinib adenocarcinoma nonadenocarcinoma source-schema-version-number 2.0 component-id cncr28561 cover-date 15 April 2014 details-of-publishers-convertor Converter:WILEY_ML3GV2_TO_NLM version:4.0.5 mode:remove_FC converted:21.05.2014 We thank all of the participating patients and their families as well as the global network of investigators research nurses study coordinators and operations staff. Medical writing support was provided by Christine Arris at ACUMED (Tytherington UK) with funding from Pfizer Inc. Introduction Following failure of chemotherapy and erlotinib treatment options are limited for patients with advanced nonsmall cell lung cancer (NSCLC). Reversible epidermal growth factor receptor (EGFR) tyrosine kinase inhibitors (TKIs) such as erlotinib and gefitinib selectively target EGFR/HER1 one of the members of the human epidermal growth factor receptor (HER) family and are most effective in cancers harboring EGFR mutations. The remaining members of the HER family comprise HER2 and HER4 tyrosine kinases and the kinase?null HER3.1 HER family members act together via hetero? and homodimerization to enable downstream signaling pathways modulating a range of cellular activities including growth proliferation differentiation and migration.1 In contrast to patients with EGFR?mutation?positive tumors patients with KRAS?mutant NSCLC are unlikely to respond to gefitinib or erlotinib and do not have an improved progression?free survival (PFS) compared with those who have placebo following erlotinib therapy.2 Dacomitinib (PF?00299804) is a potent irreversible oral small?molecule inhibitor of HER1/EGFR HER2 and HER4 tyrosine kinases with antitumor activity in both gefitinib?sensitive and gefitinib?resistant including EGFR T790M preclinical NSCLC models.3 Dacomitinib demonstrated encouraging antitumor activity against NSCLC in Western and Japanese patients in phase 1 studies5 further supported by preliminary data from phase 2 NSCLC studies conducted in Asian patients with KRAS wild?type refractory disease7; unselected patients previously treated with chemotherapy8; and patients with EGFR?mutant disease (first?line treatment).9 This phase 2 trial (ClinicalTrials.gov identifier NCT00548093) assessed the efficacy safety and impact on health?related quality of life (HRQoL) of dacomitinib in patients with KRAS wild?type NSCLC who progressed after 1 or 2 chemotherapy regimens and erlotinib. Materials and Methods Patient Population Main inclusion criteria were age??18 years histologically or cytologically confirmed advanced NSCLC progression on erlotinib and 1 or 2 regimens of chemotherapy confirmation of KRAS wild?type tumor or known EGFR exon 19 deletion or EGFR exon 21 mutation (previously documented EGFR mutation was accepted when insufficient tissue was available for KRAS testing) and Eastern Cooperative Oncology Group performance status (ECOG PS) of 0 to 2. Exclusion criteria included chemotherapy radiotherapy biological or investigational agents or surgery within 4 weeks of study entry; EGFR inhibitors within 2 weeks of study entry; intolerance to erlotinib; prior investigational EGFR?targeted therapy without written agreement of the study sponsor; and uncontrolled or significant cardiovascular disease. Trial Design and Treatment This was a multicenter open?label phase 2 trial. To address differences in the expected response rates between tumors of different histologies10 2 cohorts comprising patients with adenocarcinoma and those without adenocarcinoma (nonadenocarcinoma) were enrolled. Patients received 45 mg of dacomitinib once daily on an empty stomach (2 hours before or after dacomitinib intake) on a continuous basis during a 21?day cycle. Dose interruptions of?<2 weeks without discontinuation from the study were allowed for toxicity; 2 dose attenuation levels of 30 mg and then 20 mg were allowed. Treatment was discontinued for disease progression intolerance (grade 3 or 4 toxicity or intolerable grade 2 toxicity that does not resolve to grade 1 or baseline after 2 weeks' interruption) global deterioration of health?related symptoms protocol noncompliance or patient withdrawal. The primary endpoint was best overall response (BOR) according to Response Evaluation Criteria in Solid Tumors (RECIST) version 1.012 for patients with tumors of adenocarcinoma histology. Secondary efficacy endpoints included: BOR in patients with tumors of nonadenocarcinoma histology duration of objective response PFS PFS at 6 months (PFS6M) overall survival (OS) and OS at 6 (OS6M) and 12 (OS12M) months. Other secondary endpoints were safety; patient?reported outcomes (PROs) of HRQoL" | Lung_Cancer |
"Cancer Treatment Radiation Therapy Feasibility of Proton Transmission-Beam Stereotactic Ablative Radiotherapy versus Photon Stereotactic Ablative Radiotherapy for Lung Tumors: A Dosimetric and Feasibility Study Lung SABR Using Transmission Proton Beams Mou Benjamin Beltran Chris J. * Park Sean S. Olivier Kenneth R. Furutani Keith M. Department of Radiation Oncology Mayo Clinic Rochester Minnesota United States of America Deutsch Eric Editor Institut Gustave Roussy France * E-mail: Beltran.Chrismayo.edu Competing Interests: The authors have declared that no competing interests exist. Conceived and designed the experiments: BM KMF SSP KRO CJB. Analyzed the data: BM KMF SSP KRO CJB. Contributed reagents/materials/analysis tools: BM KMF SSP KRO CJB. Wrote the paper: BM KMF SSP KRO CJB. 2014 2 6 2014 9 6 e98621 21 1 2014 6 5 2014 2014 Mou et al This is an open-access distributed under the terms of the Creative Commons Attribution License which permits unrestricted use distribution and reproduction in any medium provided the original author and source are credited. Stereotactic ablative radiotherapy is being increasingly adopted in the treatment of lung tumors. The use of proton beam therapy can further reduce dose to normal structures. However uncertainty exists in proton-based treatment plans including range uncertainties large sensitivity to position uncertainty and calculation of dose deposition in heterogeneous areas. This study investigated the feasibility of proton transmission beams i.e. without the Bragg peak to treat lung tumors with stereotactic ablative radiotherapy. We compared three representative treatment plans using proton transmission beams versus conformal static-gantry photon beams. It was found that proton treatment plans using transmission beams passing through the patient were feasible and demonstrated lower dose to normal structures and markedly reduced treatment times than photon plans. This is the first study to demonstrate the feasibility of proton-based stereotactic ablative radiotherapy planning for lung tumors using proton transmission beams alone. Further research using this novel approach for proton-based planning is warranted. The authors have no support or funding to report. Introduction Stereotactic ablative radiotherapy (SABR) plays an essential role in the treatment of patients with medically inoperable early stage lung cancer and oligometastasis. The use of protons for lung SABR is emerging as an appealing treatment option because of its potential to deliver higher doses of conformal radiotherapy and spare normal tissues better than traditional photons [1] [2] [3] [4]. This can be achieved because of the natural characteristics of proton beams that deposit its dose at depth with no exit dose referred to as a Bragg peak. However conventional dosimetric models fail to accurately model how protons scatter and deposit dose in highly heterogeneous areas which leads to uncertainties in proton treatment plans [5]. In addition the uncertainties in the stopping power of the various tissues in the body and the interplay effect between spot scanning proton therapy and the target motion leads to large uncertainties in the treatment of lung tumors [5] [6]. In this study we report on the feasibility of proton transmission-beam SABR (PT-SABR) for lung tumors which uses the transmission portion of a spot scanning proton beam i.e. without the Bragg peak. This technique eliminates the major uncertainties of proton therapy mentioned above by having the proton beams pass through the patient. In addition the use of the transmission beam allows an entire field to be treated in one breath hold. This quick treatment and decreased uncertainties lead to smaller planning volumes. To the best of the authors knowledge this is the first report on the use of this novel approach to plan SABR with protons without using the Bragg peak which may have dosimetric advantages over photon treatments. Materials and Methods Ethics Statement Written informed consent was obtained from all patients registered in the SABR database. This study including the consent procedure was approved by the Mayo Clinic institutional review board. Patient Cohort Patients were identified from a prospectively collected institutional database of patients treated with SABR. Patients with lung tumors less than one centimetre in maximum dimension were included. The radiation treatment plans of three patients were extracted from the treatment planning system. All patients were treated using three-dimensional conformal multiple static-gantry photon beams. Plans were normalized so that 95% of the planning target volume (PTV) received at least 95% of the prescription dose. The prescription doses for these plans were adjusted to 34 Gy in one fraction based on the recently reported results of Radiation Therapy Oncology Group (RTOG) 0915 which established this dose fractionation regimen as a possible standard dose to be used in future trials [7]. Dose calculations for photon plans used the anisotropic analytical algorithm. Proton Treatment Planning A machine was commissioned in Eclipse v.10 (Varian Medical Systems Palo Alto CA) which allowed for planning and calculating transmission dose plans. The spot size (sigma) of the transmission beam which had an energy of 229 MeV was 2.2 mm. A proton plan that only used the transmission portion of the beam was created for each patient. Proton beam arrangements were selected so that no beams entered through the heart or spinal cord and allowed up to two non-coplanar beams. Four to five beams were used to keep the skin dose comparable to photon plans. The energy of the protons for each spot of a field was 229 MeV; this ensured the Bragg peak was not located within the patient. Dose calculations for the transmission portion of the proton beam were verified with Monte Carlo (Geant4). The proton plans were normalized so that the internal target volume (ITV) receives at least 95% of prescription dose including when range and position errors were included (3.5% and 2 mm) which is standard for spot scanning proton therapy. ITVs were created based on motion of the gross tumor volume in three dimensions using four-dimensional computed tomography image data. The dose constraints from RTOG 0915 were compared for the photon and proton plans as well as the total time that would be required to deliver the treatment. The radiotherapy delivery time per beam was estimated at 1 nC per second for proton therapy which is readily achievable by most spot scanning proton centers and 600 MU per minute for the photon plans. Differences in dosimetric and treatment planning parameters between photon and proton plans were analyzed with two-sided paired t-tests using SAS version 9.2 (SAS Institute Inc. Cary NC). Results The ITVs of the three tumors measured 0.220.42 and 0.99 cubic centimeters. All three proton plans had excellent coverage of the ITV. For all ITVs over 99.4% of the volume received at least 95% of the prescription dose including when uncertainties were examined. This was comparable with the photon plans where 100% of the ITVs received at least 95% of the prescription dose. For most normal tissues lower doses to these ans were achieved with the proton plans compared to the photon plans (). In fact (near) complete sparing of the spinal cord heart and esophagus was possible with protons through careful selection of beam angles (). .0098621.g001 Dose-volume histogram comparison of ans at risk. .0098621.t001 Dosimetric comparison of photon and proton plans. Parameter Photon Proton P-value Mean Range Mean Range Internal target volume (cc) 0.54 0.220.99 0.54 0.220.99 N/A Spinal cord Maximum dose (Gy) 5.66 2.398.07 1.97 0.003.06 0.04 Lungs (bilateral) Mean lung dose (Gy) 1.35 0.951.92 0.69 0.031.36 0.12 V20 (%) 0.66 0.391.20 0.49 0.161.01 0.06 V5 (%) 7.32 5.411.30 6.65 2.9611.70 0.56 Heart Mean dose (Gy) 8.36 6.2712.51 0.00 0.000.00 0.13 Skin Maximum dose (Gy) 11.75 9.8613.28 11.40 7.3716.23 0.89 Esophagus Maximum dose (Gy) 6.49 2.989.43 3.40 0.007.51 0.05 Homogeneity Index 1.25 1.211.29 1.07 1.031.11 0.06 Conformity Index 17.14 8.2330.05 3.47 2.174.64 0.15 Proton plans used four to five non-coplanar beams compared to nine to ten beams for photon plans (Figure 2). The average number of monitor units per field was 818 (range 758871) with photons and only 38 (range 3159) with protons. This would translate to an average beam-on time per field of 82 seconds versus 6 seconds for photon and proton plans respectively. These differences in monitor units and beam-on time were statistically significant with P<0.01(Table 2). .0098621.g002 Figure 2 Comparison of isodose distributions. Proton (left) and photon (right) treatment plans. .0098621.t002 Table 2 Comparison of treatment time between photon and proton plans. Parameter Photon Proton P-value Mean Range Mean Range Total monitor units (MU) 7929 68208713 178 122235 <0.01 Fields 9.7 910 4.7 45 N/A Average MU/field 818 758871 38 30.546.9 <0.01 Beam on time per field (seconds) 81.8 75.687.1 5.8 4.77.2 <0.01 Discussion Exploiting the transmission beam in proton therapy planning has significant potentials for dose escalation and re-irradiation in lung tumors and eliminates the concern over the uncertainty of the stopping power and its impact on the Bragg peak location. PT-SABR planning requires fewer beams than photons and careful selection of optimal beam angles allows for minimal dose to adjacent normal tissues and tumor dose escalation which may translate to improved local control rates. RTOG 0915 showed that 34 Gy in a single fraction was comparable to 48 Gy in four fractions [7] and the dosimetric constraints from the protocol were easily achieved using both proton and photon plans for patients in this study. Further optimization with proton therapy can allow even higher doses to be delivered while still respecting established dosimetric constraints for normal tissues. This may translate to better tumor control but requires more investigation in a clinical setting. Patients planned with PT-SABR required fewer beams (5 vs. 10) which reduce the total treatment time and the low dose outside the tumor. The average monitor units per field for PT-SABR plans" | Lung_Cancer |
"This population therefore could be sufficiently different to give unexpected results. However the results of this trial will inform as to the acceptability of this approach as well as its effectiveness. Abbreviations CONSORT: Consolidated statement of reporting trials; COPD: Chronic obstructive pulmonary disease; DNA: Deoxyribonucleic acid; NHS: National health service UK; SNP: Single nucleotide polymorphism; SAE: Stamped addresses envelope. Competing interests JN and PG are in receipt of research grants from Lab 21 Cambridge who are marketing the Respiragene test in the UK and Synergenz Bioscience Ltd. who financed the development of the test from its origins in New Zealand. We initially purchased SmokeScreen kits (for salivary cotinine estimation) from GFC Diagnostics Ltd. But they subsequently supplied 30 kits free of charge. Authors contributions JN and PG developed the idea of a control trial of the Respiragene test after discussions with Aino Telaranta-Keerie of Lab 21 Cambridge. WK was involved in helping to write the protocol and her experience in running smoking cessation clinics was very helpful. PW was our statistical adviser and SdeL helped us to write the protocol in accordance with CONSORT principles and in development of trial methodology. All authors read and approved the final manuscript. Authors information PG is a Visiting Professor of Primary Care at The University of Surrey. SdeL is Professor of Health Care and Clinical Informatics at The University of Surrey. JN is a primary care physician and visiting research fellow at The University of Surrey. WK is a visiting research fellow at The University of Surrey and an experienced smoking cessation nurse. PW is a Statistics Consultant in the Department of Mathematics at The University of Surrey. Pre-publication history The pre-publication history for this paper can be accessed here: http://www.biomedcentral.com/1471-2466/14/77/prepub Supplementary Material Additional file 1 Detailed statistical analysis. Click here for file Acknowledgements We are grateful for the help of Aino Telaranta-Keerie and the staff of Lab 21 for their support and for carrying out the Respiragene tests. We are also indebted to Kevin Murphy of Synergenz for his encouragement and support. Professor Robert Young and his team of Auckland New Zealand developed the Respiragene test and the risk score formula. His advice and guidance has been invaluable. Wetterstrand KA DNA Sequencing Costs Data from the NHGRI Large-Scale Genome Sequencing Program http://en.wikipedia./wiki/Personal_genomics#cite_note-18 Smerecnik C Grispen JEJ Quaak M Effectiveness of testing for genetic susceptibility to smoking-related diseases on smoking cessation outcomes: a systematic review and meta-analysis Tob Control 2012 21 3 347 354 10.1136/tc.2011.042739 21948804 Smith SM Campbell MC Macleod U Factors contributing to the time taken to consult with symptoms of lung cancer: a cross sectional study Thorax 2009 64 1953 531 Sanderson SC ONeill SC White DB Bepler G Bastian L Lipkus IM McBride CM Responses to online GSTM1 genetic test results among smokers related to patients with lung cancer: a pilot study Cancer Epidemiol Biomarkers Prev 2009 18 7 1953 1961 10.1158/1055-9965.EPI-08-0620 19567511 Young RP Hopkins R Black PN Eddy C Wu L Gamble GD Mills GD Garrett JE Eaton TE Rees MI Functional variants of antioxidant genes in smokers with COPD and in those with normal lung function Thorax 2006 61 5 394 399 10.1136/thx.2005.048512 16467073 Young RP Hopkins RJ Christmas T Black PN Metcalf P Gamble GD COPD prevalence is increased in lung cancer independent of age sex and smoking history Eur Respir J 2009 34 2 380 386 10.1183/09031936.00144208 19196816 Young RP Hopkins RJ Hay BA Epton MJ Mills GD Black PN Gardner HD Sullivan R Gamble GD Lung cancer susceptibility model based on age family history and genetic variants [Electronic Resource] 2009 4 4 e5302 .0005302 Young RP Hopkins RJ Hay BA Gamble GD GWAS And Candidate SNPs For COPD And Lung Cancer Combine To Identify Lung Cancer Susceptibility: Validation In A Prospective Study Am J Respir Crit Care Med 2010 181 A3738 Young RP Hopkins RJ Hay BA Epton MJ Mills GD Black PN Gardner HD Sullivan R Gamble GD A gene-based risk score for lung cancer susceptibility in smokers and ex-smokers Postgrad Med J 2009 85 515 524 10.1136/pgmj.2008.077107 19789190 Young RP Hopkins RJ Hay BA Epton MJ Black PN Gamble GD Lung cancer gene associated with COPD: triple whammy or possible confounding effect? Eur Respir J 2008 32 5 1158 1164 10.1183/09031936.00093908 18978134 McBride CM Bepler G Lipkus IM Lyna P Samsa G Albright J Datta S Rimer BK Incorporating genetic susceptibility feedback into a smoking cessation program for African-American smokers with low income Cancer Epidemiol Biomarkers Prev 2002 11 6 521 528 12050092 Sanderson SC Humphries SE Hubbart C Hughes E Jarvis MJ Wardle J Psychological and Behavioural Impact of Genetic Testing Smokers for Lung Cancer Risk: A Phase II Exploratory Trial J Health Psychol 2008 13 481 494 10.1177/1359105308088519 18420756 Wells S de Lusignan S Does screening for loss of lung function help smokers give up? Br J Nurs 2003 12 12 744 750 12829957 Parkes G Greenhalgh T Griffin M Dent R Effect on smoking quit rate of telling patients their lung age: The Step2quit randomised control trial BMJ 2008 336 598 600 10.1136/bmj.39503.582396.25 18326503 Hopkins RJ Young RP Hay B Gamble GD Lung cancer risk testing enhances NRT uptake and quit rates in randomly recruited smokers offered a gene based risk test Am J Respir Crit Care Med 2012 185 A2590 Hopkins RJ Young RP Hay B Gamble GD Gene-based lung cancer risk score triggers smoking cessation in randomly recruited smokers Am J Respir Crit Care Med 2011 183 A5441 West R Shiffman S McLean D Fast Facts: Smoking Cessation (Fast Facts series) Paperback 2007 London: Health Press Young RP Hopkins RJ Smith M Hogarth DK Smoking cessation: the potential role of risk assessment tools as motivational triggers [Review] Postgrad Med J 2010 86 1011 26 33 10.1136/pgmj.2009.084947 20065338 Cabebe E Recruitment details: REACT Clinical Trial Lung Cancer Detection Study http://www.elcaminohospital./Cancer_Center/Clinical_Trials/Lung_Cancer_Detection_Study McClure JB Ludman EJ Grothaus L Pabiniak C Richards J Impact of spirometry feedback and brief motivational counseling on long-term smoking outcomes: a comparison of smokers with and without lung impairment Patient Education & Counseling 2010 80 2 280 283 10.1016/j.pec.2009.11.002 20434863 Sanderson SK Humphries SE Hubbart C Psychological and behavioural impact of genetic testing smokers for lung cancer risk J Health Psychol 2010 13 4 481 494 18420756 Croghan E NHS Local stop smoking services services delivery and monitoring guidance 2011/12 ://www.gov.uk/government/uploads/system/uploads/attachment_data/file/213755/dh_125939.pdf Barnfather KD Cope GF Chapple IL Effect of incorporating a 10 minute point of care test for salivary nicotine metabolites into a general practice based smoking cessation programme: randomised controlled trial BMJ 2005 331 999 10.1136/bmj.38621.463900.7C 16210250 West R Smoking toolkit study: protocol and methods 2006 http://www.smokinginengland.info/sts-documents/ (ST5001) Moher D Hopewell S Schulz KF Montori V Gotzsche PC Devereaux PJ Elbourne D Egger M Altman DG CONSORT 2010 explanation and elaboration: updated guidelines for reporting parallel group randomised trials BMJ 2010 340 c869 10.1136/bmj.c869 20332511 DH/IPU/Patient Confidentiality Department of Health: Confidentiality NHS Code of practice 2003 http://webarchive.nationalarchives.gov.uk/20130107105354/http://www.dh.gov.uk/prod_consum_dh/groups/dh_digitalassets/dh/en/documents/digitalasset/dh_4069254.pdf Lee JH Jones PG Bybee K OKeefe JH A longer course of varenicline therapy improves smoking cessation rates [Review] Prev Cardiol 2008 11 4 210 214 10.1111/j.1751-7141.2008.00003.x 19476573 West R Sohal T Catastrophic pathways to smoking cessation: findings from national survey BMJ 2006 332 458 460 10.1136/bmj.38723.573866.AE 16443610 Kahenda JW Loomis BR Anhikara B Marshall L A review of economic evaluations of tobacco control programs Int J Environ Res Public Health 2009 6 1 51 68 19440269 Sanders D Fowler G Mant D Fuller A Jones L Marzillier J Randomized controlled trial of anti-smoking advice by nurses in general practice J R Coll Gen Pract 1989 39 324 273 276 2556540 Wennike P Danielsson T Björn B Westin A Tøneson P Smoking reduction promotes smoking cessation: results from a double blind randomized placebo-controlled trial of nicotine gum with 2-year follow-up Addiction 2003 98 10 1395 1402 10.1046/j.1360-0443.2003.00489.x 14519176 MacPherson L Stipelman BA Duplinsky M Lejuez CW Distress tolerance and pre-smoking treatment attrition: examination of moderating relationships Addict Behaviour 2008 33 11 1385 1393 10.1016/j.addbeh.2008.07.001 Soulier-Parmeggiani L Griscom S Bongard O Avvanzino R Bounameaux H One-year results of a smoking-cessation programme Journal Suisse de Médecine 1999 129 10 395 398 10212973 PLoS One plos plosone 1932-6203 Public Library of Science San Francisco USA 24642707 3958375 PONE-D-14-01187 .0091811 Research Article Biology and Life Sciences Biochemistry Biomarkers Medicine and Health Sciences Diagnostic Medicine Gastroenterology and Hepatology Gastrointestinal Cancers Oncology Basic Cancer Research Metastasis Cancers and Neoplasms Carcinomas Adenocarcinomas Colon Adenocarcinoma Gastrointestinal Tumors Pathology and Laboratory Medicine Anatomical Pathology Surgical Pathology Molecular Pathology The Clinical Implication of Cancer-Associated Microvasculature and Fibroblast in Advanced Colorectal Cancer Patients with Synchronous or Metachronous Metastases Cancer-Associated Microenvironment in Advanced Colorectal Cancer Kwak Yoonjin 1 2 Lee Hee Eun 1 Kim Woo Ho 1 2 Kim Duck-Woo 3 Kang Sung-Bum 3 Lee Hye Seung 4 * 1 Department of Pathology Seoul National University Hospital Seoul South Korea 2 Department of Pathology Seoul National University College of Medicine Seoul South Korea 3 Department of Surgery Seoul National University Bundang Hospital Seongnam-si Gyeonggi-do South Korea 4 Department of Pathology Seoul National University Bundang Hospital Seongnam-si Gyeonggi-do South Korea Lo Anthony W. I. Editor The Chinese University of Hong Kong Hong Kong * E-mail: hye2snu.ac.kr. Competing Interests: The authors have declared that no competing interests exist. Conceived and designed the experiments: HEL WHK HSL. Performed the experiments: HEL WHK HSL. Analyzed the data: YK HEL HSL. Contributed reagents/materials/analysis tools: HEL WHK DWK SBK HSL. Wrote the paper: YK HEL WHK DWK SBK HSL. 2014 18 3 2014 9 3 e91811 11 1 2014 14 2 2014 2014 Kwak et al This is an open-access article distributed under the terms of the Creative Commons Attribution License which permits unrestricted use distribution and reproduction in any medium provided the original author and source are credited. Background We aimed to evaluate the clinical significance of microvessel density (MVD) lymphatic vessel density (LVD) and cancer-associated fibroblasts (CAFs) in relation to tumor location in advanced colorectal cancer (CRC). Methods Using immunohistochemistry we examined 181 advanced CRC patients for CD31 and D2-40 to measure MVD and LVD respectively ?-smooth muscle actin (SMA) and desmin to identify CAFs and PTEN to examine genetic changes of CAFs. To evaluate the regional heterogeneity of these properties we examined tissue from four sites (the center and periphery of the primary cancer a distant metastasis and a lymph node metastasis) in each patient. Results MVD LVD and CAFs showed significant heterogeneity with respect to the tumor location. LVD was the greatest in the center of the primary cancers and the amount of CAFs was the lowest in distant metastases. In distant metastases those from the lung had higher LVD and MVD but fewer CAFs than those from the liver peritoneum or ovary. Patients with low MVD and LVD in the center of the primary cancer had worse outcomes and patients with few CAFs in distant metastases and in the primary tumor had a lower survival rate. PTEN expression in CAFs in distant metastases was lost in 11 of 181 CRC patients (6.1%) which was associated with a worse prognosis. Conclusions The microenvironment including cancer-associated microvasculature and fibroblasts is heterogeneous with respect to the tumor location in CRC patients. Therefore heterogeneity of microenvironments should be taken into account when managing CRC patients. This study was supported by grant number 03-2011-012 from the Seoul National University Bundang Hospital Research Fund. The funder had no role in study design data collection and analysis decision to publish or preparation of the manuscript. Introduction Although the mortality rates of colorectal cancer (CRC) patients have decreased in most western countries and in several developing countries in Asia advanced CRC patients who initially present with stage IV disease or those who develop distant metastases several months after diagnosis still have a lower five-year survival rate [1] [2]._ENREF_4 Recently the range of systemic chemotherapy has expanded and targeted therapy including epidermal growth factor receptor (EGFR) and vascular endothelial growth factor (VEGF) inhibitor therapies have been used in advanced CRC patients increasing patient survival [3]. However some CRC patients respond poorly to targeted therapy despite presenting positive results in targeted therapy-specific mutation studies [4]. One possible explanation for this therapeutic failure is tumor heterogeneity; several studies have reported that CRCs possess a heterogenic genotype or phenotype including KRAS p53 and BRAF [5][7]. Therefore the differing characteristics of the primary tumor site and the corresponding metastatic an need to be clarified to improve the management of CRC patients with metastatic diseases. Furthermore understanding the clinicopathological characteristics of advanced CRC is important for the development and improvement of systemic therapies. Since Paget et al. first described the cancer microenvironment by the seed and soil theory [8] there has been growing evidence that cancer-associated stroma might affect the cancer cells themselves and contribute to cancer progression [9]. The main components of the cancer microenvironment are microvasculature (microvessels and lymphatic vessels) inflammatory cells and cancer-associated fibroblasts (CAFs) [10][12]. The current method of verifying angiogenetic and lymphangiogenetic activity in cancer tissue is to assess microvessel density (MVD) and lymphatic vessel density (LVD) respectively. MVD has been proposed as a surrogate marker of cancer-associated angiogenesis to identify patients with a high risk of recurrence or those with poor prognoses for various cancers including CRC [13] [14]; however the prognostic correlation of angiogenesis in CRC is still controversial [15] [16]. Similar to angiogenesis LVD has received interest as a means of lymphatic metastasis and survival [17] [18] but its role in tumor progression is still unclear [19]. The other prominent component of stroma CAFs are consistently activated and affect many aspects of tumor initiation invasion and progression [9]. While some studies have suggested that CAFs may inhibit tumor progression [20] [21] other studies have proposed that CAFs may promote progression in prostate breast and skin cancers [22][24]. In the context of CRC Tsujino et al. have suggested that ?-smooth muscle actin (SMA)-expressing CAFs might be a useful indicator of poor prognosis. However these results were restricted to stage II and III CRCs [25]. In addition to cancer cells genetic alterations in CAFs have demonstrated including the loss of heterozygosity microsatellite instability and genetic mutations [26] [27]. Recently genetic inactivation of PTEN in CAFs was reported in breast cancer patients [28]. Trimboli et al. identified that PTEN loss in stromal fibroblasts resulted in extensive extracellular matrix remodeling and angiogenesis which characteristic of tumor progression [28]. However expression loss of PTEN and its clinical significance have not been investigated in colorectal cancer patients. The aim of this study was to investigate the characteristics of microenvironments including microvasculatures and CAFs in advanced CRC patients. Additionally we assessed the intratumoral heterogeneity in the primary tumor and the discordance between primary tumor and distant metastasis microenvironments. Materials and Methods Patient selection A total of 181 advanced CRC patients with synchronous or metachronous metastases who were treated at Seoul National University Bundang Hospital (Seongnam-si South Korea) between 2003 and 2009 were enrolled in this study. Synchronous metastases were defined as distant metastases occurring within six months of the primary diagnosis of CRC and metachronous metastases were those occurring after that time point [29]. " | Lung_Cancer |
"Hypertension and renal insufficiency are two risk factors for RPLS. Twenty-four patients (57%) experienced hypertension (15 grade 3 but no grade 4) during the study 15 of whom had a history of hypertension and 12 had taken antihypertensive medications before entering the study. Eight patients with hypertension also experienced proteinuria. Fourteen patients (33%) experienced proteinuria (all grades 1 or 2 except a single grade 3) none of whom had a history of renal disease. Fourteen patients experienced CrCL decreases during treatment with six patients having CrCL decreases below 60?ml?min?1 after treatment cycle 4. Efficacy evaluation As the study was closed prematurely there was no statistical power to test the primary hypothesis. Of the 42 patients enrolled 4 patients discontinued early from the study due to AEs (2) consent withdrawal (1) and investigator decision (1). As they did not have a post-baseline tumour assessment they were excluded from the efficacy assessment per predefined statistical analysis plan. Of the 38 patients evaluable for efficacy the median PFS was 5 months (95% CI 4.37.1; A) and ORR was 26% (95% CI 1240%) all of which (10/38) were PR. The disease control rate (PR+stable disease) was 89% (26%+63%). A mean reduction of 20% was observed in average percentage changes over time in tumour burden (sum of largest diameters of target lesions) from baseline. Of the 38 patients evaluable for efficacy 22 (58%) developed hypertension as AE during the study. Seven (7 out of 22=32%) had a PR compared with only three with no hypertension (3 out of 16=18%) suggesting that patients who developed hypertension may have had a higher likelihood of response to this treatment. Correlative studies Participation in the correlative studies was optional. Erythropoietin levels were obtained from 16 patients. No trend towards increase in haemoglobin or change in erythropoietin level was seen over time. Pharmacokinetic and antibody evaluation Twenty-three patients participated in blood sampling for PK analysis. Mean observed noncompartmental PK parameters for free ziv-aflibercept are presented in . The concentrationtime profiles and PK of free ziv-aflibercept and adjusted bound ziv-aflibercept: VEGF were consistent with results in the phase I study (Diaz-Padilla et al 2012). Mean trough concentrations after the second ziv-aflibercept dose plateaued and remained at ?10?mg?l?1. The mean adjusted bound ziv-aflibercept:VEGF complex Cmax was 7.81?mg?l?1. Trough concentrations plateaued after day 42 and remained constant for the remainder of the study. Two patients had one sample each that was positive in the anti-drug antibody (ADA) assay. One was positive at baseline but did not have an antibody titre drawn at the end of treatment (EOT) visit. This patient completed all six cycles of combination treatment without dose delay/reduction or grade 3/4 AEs and had stable disease. The other one was negative at baseline but positive at the EOT visit. This patient experienced anaphylaxis 20?minutes after start of the ziv-aflibercept infusion on day 1 of the second cycle. Study drug was permanently withdrawn. This patient had PK parameters and a concentrationtime profile different from ADA-negative patients probably because of the ADA formation. Discussion Ziv-aflibercept has been tested as a single agent and in combination with chemotherapy in the treatment of NSCLC (Leighl et al 2010; Ramlau et al 2012). On the basis of activity and safety profile we conducted the current phase II study to explore the efficacy of ziv-aflibercept in the first-line setting. Similar to ECOG 4599 AVAiL and PointBreak trials (Sandler et al 2006; Patel et al 2009a; Reck et al 2009) this study was designed to test a three-drug regimen including an anti-angiogenesis agent in this case ziv-aflibercept/cisplatin/pemetrexed. In addition maintenance therapy with single-agent ziv-aflibercept was intended to prolong the benefits and delay the development of resistance. This approach was first tested in a phase I dose-escalation study that used the same regimen of ziv-aflibercept/cisplatin/pemetrexed in 18 patients with advanced solid tumours (Diaz-Padilla et al 2012). Our study population was representative of patients with advanced NSCLC. Overall the median ziv-aflibercept dose intensity was similar to the planned intensity. The delivered dose intensities of pemetrexed/cisplatin in this study were over 98% higher than those in the pemetrexed/cisplatin arm (94.8% and 95.0% respectively) of the phase III trial (Scagliotti et al 2008). The PK of ziv-aflibercept in this study was characterised as nonlinear and similar to that observed in the phase I study. The mean observed terminal t1/2 was independent of ziv-aflibercept dose. Administration of ziv-aflibercept did not alter pemetrexed PK. Development of ADA was a rare event leading to reduced drug concentration in one patient who experienced anaphylaxis. As with all therapeutic proteins there is a potential for immunogenicity; however severe hypersensitivity reactions are rare. Although this study was terminated early the two co-primary end points ORR of 26% and median PFS of 5 months were in accordance with most historical first-line NSCLC studies (Schiller et al 2002; Scagliotti et al 2008) and slightly less than triplet regimens incorporating another anti-VEGF agent (Sandler et al 2006; Reck et al 2009). However there was no statistical power to test the primary hypothesis that ziv-aflibercept would enhance the efficacy of standard chemotherapy in NSCLC. Biomarkers that can reliably predict the degree of VEGF blockade in vivo are currently not available. Preclinical studies identified increased erythropoietin production and erythropoiesis as a possible surrogate marker of VEGF inhibition as animal data indicate that stringent VEGF inhibition including by ziv-aflibercept modulates erythropoiesis via increased hepatic erythropoietin synthesis (Tam et al 2006). Bevacizumab has also been associated with increased haemoglobin in NSCLC (Riess et al 2012) and reduced anaemia (Sher and Wu 2011). Therefore this study explored whether the increase in haemoglobin observed previously could be reproduced in the presence of chemotherapy and would correlate with anti-angiogenic activity. No trend towards increase in haemoglobin or change in erythropoietin level was found in a small subset of patients." | Lung_Cancer |
"B-mode ultrasound image after single high-intensity focused ultrasound insonation demonstrates a sharply demarcated and strongly hyperechoic sonolesion within the tumour. Macroscopic appearance of the zone of ablated tumour tissue (inside the highlighted circle) in the resected specimen. Arrows show the tumour margin of non-ablated adenocarcinoma. H&E staining showed coagulative necrosis with cytoplasmic eosinophilia disruption of cellular membranes with blurred cytoplasmic borders karyolysis and nuclear pyknosis. Insonated and non-insonated cancer tissues showed sharp demarcations. There was a small region between the area of coagulation necrosis and vital cancer tissue in which cells showed cytoplasmic vacuolization (). These characteristics were not found in the untreated areas of cancer tissue. NADPH-diaphorase staining produced a sharp demarcation between ablated and non-ablated cancer tissue and demonstrated that vital lung tissue was present immediately adjacent to ablated cancer tissue (). HIFU-treated tumour tissue did not show evidence of vitality by NADPH-diaphorase staining. Sonographic lesions were not detected in the tumour surrounding the lung tissue or in the direction of the HIFU irradiation. In contrast a non-treated metastatic tumour in the same lobe showed complete vitality. Histological examination of large cell neuroendocrine carcinoma immediately after ex vivo high-intensity focused ultrasound application. The border between ablated and non-ablated tumour is shown. There is a vital tumour in the upper left image (A). The thermal effect is visible as a small area which contains cells with cytoplasmic vacuolization (B) and as a coagulative necrosis with cytoplasmic eosinophilia disruption of cellular membranes with blurred cytoplasmic borders karyolysis and nuclear pyknosis (C). Arrows indicate the sonolesion boundary (H&E). Nicotinamide adenine dinucleotide phosphate (NADPH)-diaphorase staining. There is a sharp demarcation between vital lung tissue (A) and ablated tumour tissue (B). Immediately after ex vivo high-intensity focused ultrasound application NADPH-diaphorase staining showed a lack of uptake of the vitality stain in finger-shaped tumour extensions (B). In vivo examination A lung tumour could be simulated in the flooded lung of each of the three animals by sonography-guided injection of BioGlue®. The central tumour appeared hypoechoic by B-mode sonography and was sharply demarcated from the lung parenchyma with small inclusions of air. A temperature rise was monitored within each one-second application of HIFU irradiation. A section of 25 seconds of HIFU exposure in the one second on one second off scheme is shown in . Repeated HIFU insonation caused an overall average temperature increase of up to 53.7°C (±4.5 n?=?3). Temperature profile inside the simulated target lesion (BioGlue®). The temperature profile is shown for the simulated lesion during transthoracic high-intensity focused ultrasound insonation after in vivo flooding of the left lung of a pig. Temperature increases were monitored for each one-second treatment with HIFU irradiation. A section of 25 seconds of HIFU exposure following the one second on/off scheme is demonstrated. The repeated HIFU insonation caused a temperature increase up to 54°C. Arterial blood pressure oxygen and carbon dioxide partial pressure were normal in all three animals during and after HIFU insonation. No animals died during the procedure. Discussion Currently the best curative treatment for early-stage non-small cell lung cancer and lung metastases is surgical resection. However surgery is not appropriate for patients with reduced pulmonary function due to the loss of lung parenchyma. Minimally invasive technologies for local tumour control have been developed as alternatives to surgery. The most common method is percutaneous radiofrequency ablation. However this kind of thermal ablation is limited because the extent to which tissue has been successfully ablated cannot be accurately assessed. This could be a reason for the observed rate of local recurrence. Another risk factor for local tumour progression is the adherence of viable tumour tissue to needle applicators and subsequent spreading of tumour cells [12]. In addition pulmonary percutaneous radiofrequency ablation is invasive and associated with major complications and mortality. HIFU has been examined in animal experiments and clinical trials as a technique for localized tissue ablation for more than 60 years. HIFU is superior to other radiation beams because it penetrates deep and selectively destroys tumour tissue. In addition HIFU can be applied as many times as needed [13]. HIFU is currently used as a therapy for cancers of the abdominal ans breast and brain [14-18]. Non-invasive local therapies with curative intention are not available for lung tumours. HIFU has never been applied to lung tumours because the air content in ventilated lungs reflects acoustic intensities. We solved this problem with lung flooding. Lung flooding enables efficient lung sonography and tumour imaging in ex vivo human and in vivo porcine lung cancer models [11]. The cancerous tissue was visualized by replacing the alveolar gas with fluid facilitating ultrasound-guided HIFU. The aim of the present study was to explore the ability of therapeutic ultrasound to penetrate the overlying lung parenchyma without damage and to increase the temperature of the tumour tissue. A tissue temperature greater than 60°C will usually cause instantaneous and irreversible cell death within one second in most extrapulmonary tissues due to coagulation necrosis. Coagulation necrosis is the primary mechanism by which HIFU destroys tumour cells [6]. Our ex vivo studies showed that lung cancer tissue absorbed acoustic energy leading to an increase in tumour temperature of 52.1 K. Based on the temperature of a cooled lung lobe (15°C) a peak temperature of 67°C was created. The heat induced by HIFU was sufficient to generate coagulation necrosis in the lung cancer tissue. In contrast the same acoustic HIFU energy caused a minimal temperature increase (7.1 K) in flooded parenchyma. NADPH-diaphorase staining showed that HIFU was highly selective for tumour tissue in flooded lungs. The lung parenchyma directly adjacent to the ablated cancer tissue was undamaged and viable. This can be explained by the very low attenuation of saline which is the major mass component in flooded lungs [19]. Thus the risk of damaging the surrounding tissue or adjacent ans can be minimised as previously described in a study of HIFU in abdominal tumours [20]. A normal saline solution was injected into the abdominal cavity to reduce complications from HIFU therapy for abdominal tumours. This method does not have adverse effects on the efficacy of HIFU ablation [21]. " | Lung_Cancer |
"There are two kinds of localizing procedures: marking with thoracoscopically directly visible materials and marking with radio-opaque materials. Examples of directly visible materials are hook wire methylene blue and indocyanine green. Ethiodized oil (lipiodol) barium and iodine contrast agents are used for radio-opaque markers. Each marking method has strong and weak points. Localization with a hook wire is easy to perform but carries a high risk of pneumothorax and a propensity to dislodge during transport and surgical preparation (6 7). Methylene blue and indigo carmine have a tendency to diffuse over a large area by the time the operation is done and render localization features inadequate (8 9). The use of a radio-opaque marker (such as barium or lipiodol) requires an intraoperative fluoroscopy to confirm an adequate excision as well as lead to increased radiation exposure (10-13). The use of mixture has been reported to make up for the weakness of marking materials. For example the problem of dye diffusion has led to attempts to use a mixture of dye with various materials such as cyanoacrylate adhesive or collagen or autologous blood (14-16). However they have not been widely used for localization due to difficulties in making and manipulation. Lipiodol and methylene blue are commonly used materials for localization (17-20). We hypothesized that lipiodol reduces the spread of methylene blue and provides additional localization opportunities by its radio-opacity. The use of a mixture of lipidol and methylene blue (MLM) for a percutaneous injection material requires a high success rate for appropriate localization and a low complication rate. To our knowledge there have been no reports that evaluate the availability of MLM as a percutaneous injection material in human lungs. This study compared MLM with methylene blue as a percutaneous injection material for pulmonary localization in rabbit lungs. MATERIALS AND METHODS Animal preparation This study was performed after approval by the Institutional Animal Care and Use Committee (IACUC) in Seoul National University Hospital biomedical research institute (IACUC approval No. 11-0356). Twenty-four adult New Zealand White rabbits were used. We recorded their weight before the procedures. The animals were randomly divided into two groups: Group A (n=12) and Group B (n=12) each sacrificed at about 6 hr and 24 hr after percutaneous injections respectively (Fig. 1). Six hours after percutaneous injections were same day operations of the preoperative localization; and 24 hr after percutaneous injections were next day operations of the preoperative localization. The injection of each material was done in all 24 subjects because we injected methylene blue and MLM at two different lung sites for each subject. Percutaneous injection materials: mixture of lipiodol and methylene blue versus methylene blue A pilot study was performed to decide the optimal amount of materials for percutaneous injections. Methylene blue (1% 100 mg/mL TERA Pharmaceuticals Buena Park CA USA) of 0.3 to 0.9 mL was used for human lung localization in previous studies by Wicky et al. (18) and Vandoni et al. (19). In the pilot study with rabbit lungs we injected 0.1 mL and 0.05 mL of methylene blue and MLM in four subjects. We found that staining was extensive (more than half height of one lobe) with 0.1 mL and localized (about 1 cm of staining diameter) with 0.05 mL for both methylene blue and MLM. Extensive dispersion made it difficult to find exact injecting sites; subsequently 0.05 mL of methylene blue was administered. We made variable mix ratios of lipiodol and methylene blue in vitro; 1:1 1:2 1:3 1:4 and 1:5 in order to find an appropriate mixing ratio of lipiodol (480 mg Iodine/mL Andre Guerbet Aulnay-sous-Bois France) and methylene blue. The separation of two materials occurred instantly after mechanical blending to the fat-soluble character of lipiodol and the water-soluble character of methylene blue. A higher concentration of lipiodol in MLM resulted in increased uneven blending and rapid separation. A mixture with a 1:6 (or lower) mixing ratio contained a minimal amount of lipiodol and it might make it difficult to be detected on the fluoroscopy; subsequently we decided that 1:5 was an appropriate mixing ratio for injection. A total of 0.06 mL of MLM (0.01 mL of lipiodol plus 0.05 mL of methylene blue) was administrated in each subject to avoid the effect of different volumes of methylene blue to the diffusion extent of the materials. CT guided percutaneous injections Percutaneous injection was performed with computed tomography (CT) guidance (Discovery CT750 HD; GE Healthcare Waukesha WI USA). We performed pre-procedural CT scans in order to determine an appropriate skin entry site for the successful placement of a needle in the desired location. The desired location was the basal portion of both caudal lobes around the mid-scapula line. We tried to situate the needle tip at 5 mm depth from the visceral pleura and avoid passing through the pulmonary vessels. We placed the needle of 20 gauze and 3.5 cm length in the lung parenchyma after marking the appropriate skin entry site. The parameters of CT used in our study were: tube voltage of 120 kV tube current of 25 mA slice thickness of 2 mm thickness and gantry rotation speed of 350 milliseconds. We connected 1 mL syringe to the needle hub and retracted the syringe piston to confirm that no blood was aspirated after the needle tip was accurately located within the desired location. We then injected the materials and immediately removed the needle. On the procedural CT scan we measured the distance from the skin-entry to the needle tip and the depth from visceral pleura to the needle tip. A post-procedural CT scan identified procedure-related complications that included the leakage of injecting materials and pneumothorax; in addition we recorded the extent shape and density of radio-opacity of MLM after injection. The extent of MLM was defined as a maximum diameter of the radio-opacities. The shape of radio-opacity was categorized into 3 groups (small faint nodular scattered nodular and discrete compact nodular). We recorded the injection time to measure the time interval between injection and sacrifice. Fluoroscopic examinations A successful localization of lipiodol was determined by fluoroscopic examination; subsequently we evaluated the radio-opacity of MLM using the fluoroscopy X-ray unit (BV Pulsera; Philips Medical Systems Best The Netherlands) at the immediate post-procedure session and the follow up session at 6 hr in Group A and 24 hr in Group B. The parameters of fluoroscopy were: tube voltage of 59 kV and tube current of 946 mA. We obtained anteroposterior fluoroscopic images of the thorax of the rabbit with a 17 cm of field of view. A radio-opaque ruler of 5 cm was located near the rabbit in order to estimate the exact size of lipiodol opacity. We recorded the time of the fluoroscopic examinations and the radiographic findings of MLM (size and shape of the radio-opacity). Evaluation of the staining and radio-opacity We assessed the directly visible staining on the freshly excised lung surface and radio-opacity of MLM on the fluoroscopic examinations using 4-point scoring in order to compare the localization ability of MLM and methylene blue as a percutaneous injection material. A blind reviewer who was unaware of the injection materials assessed the staining ability. In order to evaluate the staining ability the blind reader reviewed the photographic images of the freshly excised lung specimens obtained before formalin fixations and rated the staining by 4-point scores: 0=non-visualization of staining 1=inappropriate; extensive dispersion made it difficult to find accurate injecting locations 2=acceptable; available to estimate injecting locations in spite of the dispersion and 3=excellent definitely localized staining (Fig. 2). The maximum diameter of the staining extent on the lung surface was measured. We calculated and compared scores and extent of staining between two materials. For the fluoroscopic findings the radio-opacity of MLM was evaluated using 4-point scoring: 0=no detectable radio-opacity 1=inappropriate minimally increased opacity 2=acceptable low density of increased opacity 3=excellent compact nodular increased opacity (Fig. 3). We compared the average scores of initial and follow up fluoroscopic examinations. We considered a score of 0 or 1 as inappropriate and a score of 2 or 3 as appropriate for localization for both staining and radio-opacity. We compared the number of appropriate or excellent localization between MLM and methylene blue. Sacrifice and histopathologic examinations Both freshly excised entire lungs were used as final specimens. The lung tissues were fixed in 10% neutral formalin embedded in paraffin and cut into 5 µm thick slices after we took photographs to record staining on the lung surface. We made 4 axial slices that covered the center of the staining. The slices were subjected to hematoxylin-eosin (H-E) stain to the evaluate lung parenchymal change. We evaluated the presence or absence of neutrophil infiltration vasculitis necrosis hemorrhage and foam cell in alveolus. The extent of each histopathologic finding was estimated using visual grading scores as 0 (no) 1 (focal) or 2 (diffuse). Localized parenchymal change (<50% of total area) surrounded by normal lung was defined as focal. Extensive lung parenchymal change (?50% of total area) that replaced normal lung was defined as diffuse. An experienced pathologist with eight years of experience reviewed all slices. The overall severity of the lung parenchymal change was defined as a total score by adding visual grading scores for each histopathologic finding. We compared the overall severity score between MLM and methylene blue as well as between Group A and Group B. Statistical analysis All data are expressed as mean±standard deviation (SD) unless otherwise stated. Comparisons of the average scores were performed by two-tailed unpaired Student's t-test or Mann-Whitney test. We used a Fisher's exact test to compare the number of subjects in the subgroups. Linear by linear association evaluated the association of the extent of lung parenchymal change and materials or groups. Null hypotheses of no difference were rejected if the P values were less than 0.05. The statistical analysis was performed with commercially available statistical software IBM SPSS Statistics version 20.0 (IBM Corp. in Armonk NY USA). RESULTS Subject characteristics procedural records time interval of injection and examinations Among the 24 subjects included in our study successful CT-guided percutaneous injections into the desired location of the lung were achieved in 21 subjects (11 in Group A and 10 in Group B). Three subjects died during anesthesia. Mean weight was 3.2±0.2 kg for Group A and 3.3±0.2 kg for Group B. Injection depth from visceral pleura to needle tip was 0.4±0.1 cm (range: 0.3-0.6 cm) for MLM and 0.4±0.1 cm (range: 0.3-0.7 cm) for methylene blue (P=0.43). Distance from skin to needle tip was 2.8±0.6 cm (range: 2.1-5.0 cm) for MLM and 2.8±0.3 cm (range: 2.2-3.5 cm) for methylene blue (P=0.83). Of 42 CT-guided percutaneous injections total number of procedure related complications was 10 (24%) including 7 leakage (all in MLM) and 3 pneumothorax (2 in MLM 1 in methylene blue). The complication rate in MLM was significantly higher than methylene blue (43% vs 5%) (P=0.004). On post-procedural CT images the extent of the radio-opacity of MLM was" | Lung_Cancer |
"The clinical data for all patients were summarized in Additional file 1: Table S1. Relative BANCR expression in NSCLC tissues and its clinical significance. (A) Relative expression of BANCR in NSCLC tissues (n?=?113) compared with corresponding non-tumor tissues (n?=?113). BANCR expression was examined by qPCR and normalized to GAPDH expression. Results were presented as the fold-change in tumor tissues relative to normal tissues. (B) BANCR expression was classified into two groups. (C D) KaplanMeier disease-free survival and overall survival curves according to BANCR expression levels. *P?<?0.05 **P?<?0.01. Correlation between BANCR expression and clinicopathological characteristics of NSCLC patients (n?=?113) Characteristics BANCR P High no. cases (%) Low no. cases (%) Chi-squared test P-value Age(years) 0.616 ?65 29(54.7) 30(50.0) >65 24(45.3) 30(50.0) Gender 0.232 Male 35(66.0) 33(55.0) Female 18(34.0) 27(45.0) Histological subtype 0.466 Squamous cell carcinoma 30(56.6) 38(63.3) Adenocarcinoma 23(43.4) 22(36.7) TNM Stage <0.001* Ia + Ib 25(47.2) 9(15.0) IIa + IIb 17(32.1) 21(35.0) IIIa 11(20.7) 30(50.0) Tumor size 0.001* ?5cm 35(66.0) 21(35.0) >5cm 18(34.0) 39(65.0) Lymph node metastasis 0.001* Negative 34(64.2) 20(33.3) Positive 19(35.8) 40(66.7) Smoking History 0.127 Smokers 39(64.2) 36(60.0) Never Smokers 14(35.8) 24(40.0) * Overall P?<?0.05. Association of BANCR expression with patients survival Kaplan-Meier survival analysis was conducted to investigate the correlation between BANCR expression and NSCLC patient prognosis. According to relative BANCR expression in tumor tissues the 113 NSCLC patients were classified into two groups: the high BANCR group (n?=?53 fold-change???4); and the low BANCR group (n?=?60 fold-change ?4) (B). With respect to progression-free survival (PFS) this was 35.3% for the high BANCR group and 17.2% for the low BANCR group. Median survival time for the high BANCR group was 31 months and 16 months for the low BANCR group (C). The overall survival rate over 3 years for the high BANCR group was 46% and 27.5% for the low BANCR group. Median survival time for the high BANCR group was 32 months and 18 months for the low BANCR group (D). Univariate analysis identified three prognostic factors: lymph node metastasis; TNM stage; and BANCR expression level. Other clinicopathological features such as gender and age were not statistically significant prognosis factors (). Multivariate analysis of the three prognosis factors confirmed that a low BANCR expression level was an independent predictor of poor survival for NSCLC (p?=?0.031) in addition to TNM stage (p?=?0.038) (). Univariate and multivariate analysis of overall survival in NSCLC patients (n?=?113) Variables Univariate analysis Multivariate analysis HR 95% CI p value HR 95% CI p value Age 1.257 0.712-2.219 0.431 Gender 1.185 0.670-2.098 0.559 Smoker 1.120 0.842-1.491 0.436 Histological subtype 0.982 0.738-1.307 0.902 Chemotherapy 0.787 0.587-1.055 0.110 Tumor size 1.233 0.926-1.640 0.151 Lymph node metastasis 0.424 0.235-0.764 0.004* 0.577 0.311-1.071 0.081 TNM stage (I vs. II or IIIa) 0.320 0.149-0.685 0. 003* 0.431 0.195-0.954 0.038* BANCR expression 0.367 0.201-0.669 0. 001* 0.496 0.262-0.938 0.031* HR hazard ratio; 95 % CI 95 % confidence interval * Overall P?<?0.05. Histone deacetylation is involved in the downregulation of BANCR Expression levels of BANCR in NSCLC cell lines were determined by qPCR. Compared with that in 16HBE cells relative expression levels of BANCR were reduced in NSCLC cells (A). Because of the different expression patterns for BANCR in NSCLC and melanomas we investigated the mechanisms controlling tissue-specific expression of BANCR. We analyzed the promoter region of BANCR and found there were no CpG islands (data not shown). Histone protein modification was thought to play an important role in the transcription of lncRNAs; however knockdown of two core subunits of polycomb repressive complex 2 (SUZ12 and EZH2) had no influence on BANCR expression (Additional file 2: Figure S1A). Histone deacetylation is involved in BANCR downregulation. (A) BANCR expression levels of NSCLC cell lines (A549 SPC-A1 H1299 H1650 H1975 and SK-MES-1) compared with that in normal human bronchial epithelial cells (16HBE). (B) qPCR analysis of BANCR expression levels following the treatment of SPC-A1 and A549 cells with TSA. (C) qPCR analysis of HDAC2 and HDAC3 expression levels following the treatment of SPC-A1 and A549 cells with si-HDAC2 or si-HDAC3.(D E) qPCR analysis of BANCR expression levels following the treatment of SPC-A1 and A549 cells with si-HDAC1 and si-HDAC3. We observed that BANCR expression was upregulated in SPC-A1 and A549 cells following treatment with the histone deacetylase (HDAC) inhibitor trichostatin A (TSA) (B). We sought to determine whether repression of BANCR was mediated by HDACs. Specific anti-HDAC1 and HDAC3 siRNAs were transfected into NSCLC cells and HDAC1 and HDAC3 expression was significantly decreased (C). Expression levels of BANCR were significantly upregulated in cells transfected with si-HDAC3. Transfection with the scrambled siRNA or si-HDAC1 did not induce BANCR expression (D and E). Moreover the HDAC3 expression was upregulated in NSCLC cells and negatively correlated with BANCR expression (Additional file 2: Figure S1B). Furthermore NSCLC cells were treated with RGFP966 which is an seletive inhibitor for HDAC3 with an IC50 of 0.08?M and no effective inhibition of other HDACs at concentrations up to 15?M. The results of qPCR showed that the expression of BANCR was upregulated in NSCLC cells after treated with RGFP966 when compared with control cells (Additional file 2: Figure S1C). " | Lung_Cancer |
"of this novel approach to proton SABR is warranted. The authors thank Katy Nelson for maintaining the SABR database. References 1 GeD HillbrandM StockM DieckmannK PotterR (2008) Can protons improve SBRT for lung lesions? Dosimetric considerations. Radiotherapy and oncology: journal of the European Society for Therapeutic Radiology and Oncology88: 36837518405986 2 HoppeBS HuhS FlampouriS NicholsRC OliverKR et al (2010) Double-scattered proton-based stereotactic body radiotherapy for stage I lung cancer: a dosimetric comparison with photon-based stereotactic body radiotherapy. Radiotherapy and oncology: journal of the European Society for Therapeutic Radiology and Oncology97: 42543020934768 3 MacdonaldOK KruseJJ MillerJM GarcesYI BrownPD et al (2009) Proton beam radiotherapy versus three-dimensional conformal stereotactic body radiotherapy in primary peripheral early-stage non-small-cell lung carcinoma: a comparative dosimetric analysis. International journal of radiation oncology biology physics75: 950958 4 WestoverKD SecoJ AdamsJA LanutiM ChoiNC et al (2012) Proton SBRT for medically inoperable stage I NSCLC. Journal of thoracic oncology: official publication of the International Association for the Study of Lung Cancer7: 10211025 5 PaganettiH (2012) Range uncertainties in proton therapy and the role of Monte Carlo simulations. Physics in medicine and biology57: R9911722571913 6 SecoJ PanahandehHR WestoverK AdamsJ WillersH (2012) Treatment of non-small cell lung cancer patients with proton beam-based stereotactic body radiotherapy: dosimetric comparison with photon plans highlights importance of range uncertainty. International journal of radiation oncology biology physics83: 354361 7 VideticGM HuC SinghA ChangJY ParkerW et al (2013) Radiation Therapy Oncology Group (RTOG) Protocol 0915: A Randomized Phase 2 Study Comparing 2 Stereotactic Body Radiation Therapy (SBRT) Schedules for Medically Inoperable Patients With Stage I Peripheral Non-Small Cell Lung Cancer. International journal of radiation oncology biology physics87: S3 8 KeallPJ MagerasGS BalterJM EmeryRS ForsterKM et al (2006) The management of respiratory motion in radiation oncology report of AAPM Task Group 76. Medical physics33: 3874390017089851 9 RegisterSP ZhangX MohanR ChangJY (2011) Proton stereotactic body radiation therapy for clinically challenging cases of centrally and superiorly located stage I non-small-cell lung cancer. International journal of radiation oncology biology physics80: 10151022 10 BradleyJD PaulusR KomakiR MastersGA ForsterK et al (2013) A randomized phase III comparison of standard-dose (60 Gy) versus high-dose (74 Gy) conformal chemoradiotherapy with or without cetuximab for stage III non-small cell lung cancer: Results on radiation dose in RTOG 0617. Journal of Clinical Oncology31: 7501 Cancer Cancer cncr Cancer 0008-543X 1097-0142 BlackWell Publishing Ltd Oxford UK 24752945 4140446 10.1002/cncr.28714 Original s A phase 2 cooperative group adjuvant trial using a biomarker-based decision algorithm in patients with stage I non-small cell lung cancer (SWOG-0720 NCT00792701) Bepler Gerold MD PhD 1 Zinner Ralph G MD 2 Moon James MS 3 Calhoun Royce MD 4 Kernstine Kemp MD 5 Williams Charles C MD 6 Mack Philip C PhD 4 Oliveira Vasco PhD 1 Zheng Zhong MD PhD 6 Stella Philip J MD 7 Redman Mary W PhD 2 Gandara David R MD 4 1 Karmanos Cancer Institute Detroit Michigan 2 The University of Texas MD Anderson Cancer Center Houston Texas 3 SWOG Statistical Center Seattle Washington 4 University of California at Davis Sacramento California 5 City of Hope Duarte California 6 H. Lee Moffitt Cancer Center Tampa Florida 7 Michigan Cancer Research Consortium Community Clinical Oncology Program Ann Arbor Michigan Corresponding author: Gerold Bepler MD PhD Karmanos Cancer Institute 4100 John R Detroit MI 48201; Fax: (313) 576-8628; beplergkarmanos. 01 8 2014 18 4 2014 120 15 2343 2351 10 2 2014 17 3 2014 18 3 2014 2014 The Authors. Cancer published by Wiley Periodicals Inc. on behalf of American Cancer Society 2014 This is an open access under the terms of the Creative Commons Attribution-NonCommercial-NoDerivs License which permits use and distribution in any medium provided the original work is properly cited the use is non-commercial and no modifications or adaptations are made. BACKGROUND This cooperative group adjuvant phase 2 trial in patients with completely resected stage I non-small cell lung cancer with tumor diameters measuring ??2 cm was designed to assess the feasibility and preliminary efficacy of assigning patients to therapy or observation using a molecularly based decision algorithm. METHODS At least a lobectomy and sampling of recommended mediastinal lymph node stations good Zubrod performance status adequate an function and a formalin-fixed and paraffin-embedded tumor specimen were required. Excision repair cross-complementing group 1 (ERCC1) and ribonucleotide reductase M1 (RRM1) were analyzed using immunofluorescence-based in situ automated quantitative image analysis and categorized as high or low using prespecified cutoff values. Patients with high ERCC1 and RRM1 were assigned to observation and all others to 4 cycles of cisplatin and gemcitabine. Feasibility was defined as treatment assignment within 84 days from surgery in >?85% of patients. Secondary objectives were to estimate the 2-year survival. RESULTS Treatment assignment met the feasibility criteria in 88% of eligible patients (71 of 81 patients). The collective 2-year disease-free and overall survival rates were 80% and 96% respectively. Protein levels for RRM1 fell within the previously established range ERCC1 levels were slightly lower than expected and they were significantly correlated (correlation coefficient 0.4). The rates of assignment of patients to observation (22%) and chemotherapy (78%) were as expected. S Gene expression analysis for treatment assignment is feasible. Survival results are encouraging and require future validation. Real-time performance of quantitative in situ ERCC1 and RRM1 analysis requires further development. lung cancer adjuvant therapy personalized medicine ERCC1 (excision repair cross-complementing group 1) RRM1 (ribonucleotide reductase M1) INTRODUCTION After publication of the International Adjuvant Lung Cancer Trial in 2004 adjuvant chemotherapy containing a platinum agent has become the standard of care for patients with a complete surgical resection of American Joint Committee on Cancer stage II to III (version 6) non-small cell lung cancer (NSCLC).1 The trial included patients with stage I to III disease and demonstrated an absolute 4.1% improvement in overall survival (OS) and a subgroup analysis indicated that the OS benefit increased with stage: the hazards ratio (HR) for death among patients receiving adjuvant chemotherapy compared with controls was approximately 0.98 for patients with stage I disease 0.88 for patients with stage II disease and 0.79 for patients with stage III disease.1 The data were confirmed by the National Cancer Institute of Canada Clinical Trials Group JBR.10 trial in 2005 which included patients with stage IB and stage II disease.2 A third trial Cancer and Leukemia Group B (CALGB) 9633 which included only patients with stage IB disease was terminated early and also reported a therapeutic benefit for adjuvant chemotherapy.3 However a final analysis of mature data revealed no statistically significant OS benefit (HR 0.83) but demonstrated a benefit for patients with tumor diameters of ??4 cm (HR 0.69).4 During the same time period an increasing number of correlative biomarker analyses demonstrated that the efficacy of platinum agents was associated with intratumoral levels of the excision repair cross-complementing group 1 (ERCC1) gene with high levels indicating resistance.59 Similarly high intratumoral levels of the regulatory subunit of ribonucleotide reductase M1 (RRM1) were reported to be predictive of resistance to gemcitabine.913 Finally both biomarkers had also been reported to be prognostic of survival in patients who had not received chemotherapy or radiation with high levels indicating longer survival.81416 Based on these data we designed an adjuvant trial in 2007. The underlying hypothesis was that patients with high intratumoral levels of ERCC1 and RRM1 would not benefit from chemotherapy and would have a good prognosis because of a less aggressive tumor phenotype. In contrast patients with low levels of ERCC1 and RRM1 would have tumors that were sensitive to chemotherapy but with a more aggressive phenotype. Because a biomarker-driven adjuvant chemotherapy selection trial had not been performed in patients with NSCLC we focused on demonstrating the feasibility of such an approach before launching a phase 3 trial. In addition because adjuvant chemotherapy had quickly become the standard of care for patients with stage II/IIIA disease we focused our efforts on patients with stage I disease. After discussions within the SWOG (formerly the Southwest Oncology Group) lung cancer working group and the National Cancer Institute (NCI)'s Cancer Therapy Evaluation Program and after peer review by a National Institutes of Health study section the consensus was to focus this feasibility trial on patients with stage I disease and tumor diameters of ?2 cm. MATERIALS AND METHODS Trial Design and Treatment Plan The trial (NCT00792701 SWOG-0720) complied with the Declaration of Helsinki and was approved by the Institutional Review Boards of the study institutions. Eligibility criteria included a diagnosis of NSCLC; stage I disease (according to version 6 of the American Joint Committee on Cancer staging manual) with a tumor diameter ??2?cm; a complete surgical resection by lobectomy bilobectomy or pneumonectomy; surgical staging of the mediastinum through sampling of at least 2 lymph node stations; a positron emission tomography scan; a computed tomographic scan of the chest and abdomen; adequate bone marrow liver and renal function; a Zubrod performance status of 0 or 1; and willingness to provide a smoking history. Patients with a prior malignancy prior radiation to the chest or other significant illnesses according to good medical practice were excluded. Patients had to be registered on the trial within 35 days of surgery. Tumor specimens were then retrieved and shipped to a central laboratory. They were analyzed for in situ tumor levels of ERCC1 and RRM1 using an immunofluorescence-based automated quantitative analysis method.17 Prespecified cutoff levels that had been determined in 187 patients with stage I disease (??65 for ERCC1 and ??40 for RRM1) were used to categorize specimens as high or low expressors for each marker (Fig. 1).16 The appropriate therapeutic assignment was then passed on to the statistical center and the participating therapeutic center; however specific protein levels were not communicated to the treatment center. Therapeutic assignment was based solely on biomarker categories and no other stratification parameters were used. Figure 1 CONSORT (Consolidated Standards Of Reporting Trials) diagram of the trial is shown. Patients with high levels of both biomarkers received active surveillance and patients with low levels of one or both biomarkers received 4 cycles of cisplatin (at a dose of 80 mg/m2 on day 1) and gemcitabine (at a dose of 1 g/m2 on days 1 and 8) every 21 days. The protocol included provisions for dose reductions or treatment delays. The addition of other targeted or cytotoxic agents during therapy or as maintenance was not permitted. Specimen Collection Processing and Gene Expression Analysis The study required the collection and shipment of formalin-fixed and paraffin-embedded tumor blocks before therapy. However if local policies did not permit submission of a tissue block 10 serial unstained sections could be submitted. Processing was done in a reference laboratory by 1 of 2 investigators (V.O. and Z.Z.). Sections measuring 5 ?m in thickness were placed on frosted glass slides and in situ quantification was performed by the automated quantitative analysis method (PM-2000 [version 1] HistoRx Inc New Haven CT) as previously described.91618 The primary antibody for the detection of ERCC1 was clone 8F1 (product code NB500-704 lots G412 and H347 from Novus Biologicals [Littleton Colo]) and the antiserum for RRM1 was R1AS-6 (generated in a rabbit in 2003 against a keyhole limpet hemocyanin [KLH]-conjugated 21-aminoacid peptide specific to the N-terminal of RRM1 column purification lot 09-2008). Slides were scanned with SpotGrabber (HistoRx New Haven Conn.) and image data were captured with a digital camera and fluorescence microscope and analyzed. Scores were adjusted to range from 1 to 255. Because full sections were evaluated for each specimen multiple spots with diameters of 0.6 mm were analyzed to obtain a representative level of protein expression. The number of spots was dependent on suitable areas with tumor cells and it ranged from 5 to 25 spots (median 10 spots) for both targets. Runs included a tissue microarray of 15 control specimens in triplicate for control purposes. Statistical Analysis The primary objective of the current study was the feasibility of a biomarker-based treatment assignment in the cooperative group setting. If the true success rate were ??75% then a biomarker-based treatment assignment would not be considered feasible but if the true success rate were ??90% it would be feasible. If ??47 of 55 eligible patients (85%) were successfully assigned to treatment or active monitoring within 84 days from surgery this would be considered evidence of feasibility. The design had 91% power using an exact binomial test with a 1-sided type I error of 5%. Secondary objectives included estimating the collective 2-year disease-free survival (DFS) for patients who accepted their treatment assignment and in the subset of patients who received adjuvant chemotherapy. However there would be no comparison made between treatment arms. To assess DFS the disease status was monitored every 2 months for the first 6 months and subsequently every 3 months by computed tomography after enrollment and according to good medical practice. Toxicities related to the administration of chemotherapy were assessed according to the National Cancer Institute Common Terminology Criteria for Adverse Events (version 3.0; ctep.cancer.gov). DFS was defined as the time from the date of enrollment to disease recurrence or death due to any cause and estimated according to the Kaplan-Meier method. A Cox regression model was fit with the time from surgery to enrollment as a covariate to evaluate its effect on DFS. A natural log transformation was applied to the raw protein measurement data and the Pearson correlation coefficient was used to test associations. Bivariate comparison of baseline characteristics between the assigned treatment groups was performed using the Fisher exact test for categorical variables or the Student t test or Wilcoxon rank sum test for continuous variables. A multivariable logistic model to evaluate baseline factors and treatment assignment was fit using backwards selection. Median ERCC1 and RRM1 expression levels were compared with historical medians using the 1-sample Wilcoxon signed rank test. The percentage of patients with both ERCC1 ??65 and RRM1 ??40 was compared with the historical rate using a chi-square test. All statistical analyses and graphics were performed using SAS statistical software (version 9.2; SAS Institute Inc Cary NC). A significance level of 5% was used for all analyses. RESULTS Patient and Trial Characteristics To ensure an adequate sample size of eligible patients and biomarker-specific subgroups a total of 85 patients was registered between April 2 2009 and April 1 2011 from 27 participating sites. Four patients were ineligible; 3 had inadequate lymph node sampling and 1 did not have a tumor measuring ??2 cm. Table 1 provides the characteristics of the 81 eligible patients. Table 1 Patient Demographics and Disease Characteristics Variablesa All Patients Assigned to Chemotherapy Assigned to Observation P Refused Assignment Accepted Assignment P N = 81 N = 63 N = 18 N = 20 N = 61 Age y .37 .39 ?Median 64 63.3 68.8 67.2 63.3 ?Mean 63.5 62.9 65.5 65.2 62.9 ?Range 41.684.2 41.684.2 41.681.7 44.282.9 41.684.2 Sex .18 .61 ?Female 44 (54%) 37 (59%) 7 (39%) 12 (60%) 32 (52%) ?Male 37 (46%) 26 (41%) 11 (61%) 8 (40%) 29 (48%) Ethnicity .65 .18 ?Unknown 7 (8%) 5 (8%) 2 (11%) 0 (0%) 7 (11%) ?Non-Hispanic 74 (91%) 58 (92%) 16 (89%) 20 (100%) 54 (89%) Race .73b .75b ?African American 8 (10%) 8 (13%) 0 (0%) 2 (10%) 6 (10%) ?Asian 3 (4%) 2 (3%) 1 (6%) 0 (0%) 3 (5%) ?Pacific Islander 2 (2%) 1 (2%) 1 (6%) 0 (0%) 2 (3%) ?White 66 (81%) 52 (83%) 14 (78%) 17 (85%) 49 (80%) ?Unspecified 2 (2%) 0 (0%) 2 (11%) 1 (5%) 1 (2%) Histology .06c .60c ?Adeno 52 (64%) 44 (70%) 8 (44%) 14 (70%) 38 (62%) ?Squamous 25 (31%) 17 (27%) 8 (44%) 6 (30%) 19 (31%) ?Large 1 (1%) 1 (2%) 0 (0%) 0 (0%) 1 (2%) ?Bronchioloalveolar 1 (1%) 0 (0%) 1 (6%) 0 (0%) 1 (2%) ?Other 2 (2%) 1 (2%) 1 (6%) 0 (0%) 2 (3%) Stage of disease .16 .27 ?IA (<3 cm) 25 (31%) 22 (35%) 3 (17%) 4 (20%) 21 (34%) ?IB (?3 cm) 56 (69%) 41 (65%) 15 (83%) 16 (80%) 40 (66%) Zubrod performance status .11 1.00 ?0 44 (54%) 31 (49%) 13 (72%) 11 (55%) 33 (54%) ?1 37 (46%) 32 (51%) 5 (28%) 9 (45%) 28 (46%) Weight loss (6 mo) 1.00d .31d ?<5% 64 (79%) 49 (78%) 15 (83%) 14 (70%) 50 (82%) ?5-<10% 9 (11%) 7 (11%) 2 (11%) 3 (15%) 6 (10%) ?1020% 4 (5%) 3 (5%) 1 (6%) 2 (10%) 2 (3%) ?>20% 1 (1%) 1 (2%) 0 (0%) 0 (0%) 1 (2%) ?Unknown 3 (4%) 3 (5%) 0 (0%) 1 (5%) 2 (3%) Smoking status ?Current 33 (41%) 26 (41%) 7 (39%) 8 (40%) 25 (41%) ?Former (quit ?1 y) 39 (48%) 30 (48%) 9 (50%) 10 (50%) 29 (48%) ?Never 9 (11%) 7 (11%) 2 (11%) 1.00e 2 (10%) 7 (11%) 1.00e Abbreviation: Adeno adenocarcinoma. a All P values shown are 2-sided. b White versus all other races. c Adenocarcinoma versus all other histologies. d Weight loss <5% versus ?5%. e Derived using the Freeman-Halton exact test. The distribution of assignment to chemotherapy and observation was 63 patients (78%) and 18 patients (22%) respectively which was not significantly different (P?=?.20 Fisher exact test) from the expected rates of 70% (129 patients) and 30% (55 patients) respectively.16 Based on protein levels in these 81 patients the number of those with low ERCC1 and low RRM1 was 31 patients (38%) 22 patients had low ERCC1 and high RRM1 (27%) 10 patients had high ERCC1 and low RRM1 (12%) and 18 patients had high ERCC1 and RRM1 (22%) which is not significantly different from prior results (P?=?.14 Fisher exact test; 54 of 184 29%; 38 of 184 21%; 37 of 184 20%; and 55 of 1840.3 respectively). We investigated whether treatment arm assignment varied by patients' smoking status histology age and sex. In bivariate comparisons no statistically significant associations were found. However the multivariable logistic model found that patients with adenocarcinoma (P?=?.03) and potentially stage IA disease (P?=?.06) were more likely to be assigned to adjuvant chemotherapy (ie they were more likely to have low levels of ERCC1 RRM1 or both). One of the 18 patients assigned to observation and 19 of the 63 patients assigned to chemotherapy rejected this choice and withdrew consent. There was no statistically significant difference in patient characteristics between those who accepted and those who refused their treatment assignment (Table 1). Feasibility The trial achieved its primary feasibility objective with a treatment assignment within the prespecified timeframe in 71 of 81 patients (88%). We successfully determined protein levels in all 85 patients. Ten of the 81 eligible patients did not achieve assignment to treatment versus observation within the 84-day time interval from surgical resection. The time interval from surgery to assignment ranged from 86 days to 105 days in these 10 patients. For 3 patients the specimens were received after the 84-day limit had passed. For the other 7 patients the time interval from receipt to reporting ranged from 7 days to 25 days (median 18 days). For the 71 patients with a successful assignment within the 84-day time interval from surgical resection the time from receipt to reporting ranged from 3 days to 26 days (median 8 days). The reasons for reporting results in excess of 14 days were equipment failure and inadequate expression values in control specimens which required equipment recalibration and a repeat processing of the specimens. Overall the time from receipt of specimens to reporting ranged from 1 day to 27 days (median 11 days; mean 12 days) which is similar to that reported for patients with advanced NSCLC (range 1 day-47 days; median 11 days; mean 12 days).18 Survival and Toxicity Survival analyses were performed on the 61 patients who accepted assignment to treatment (44 patients) or surveillance (17 patients). Patients who rejected their treatment assignment withdrew consent and thus could not be followed for survival. Fourteen patients had DFS events; 2 had died (1 from disease recurrence and the other from cardiac disease without recurrence). The median follow-up among those patients still alive at the time of last follow-up was 27 months (range 3 months-44 months). Six patients had <?24 months of follow-up. The collective 2-year DFS and OS rates were 80% (95% confidence interval [95% CI] 67%-88%) (Fig. 2A) and 96% (95% CI 87%-99%) from the date of registration. The 2-year DFS rate was 83% (95% CI 68%-92%) for patients who received chemotherapy (Fig. 2B) and it was 71% (95% CI 43%-87%) for those observed (Fig. 2C). Table 2 includes 2-year DFS estimates within each of the 3 gene expression categories in the chemotherapy arm. The median time from surgery to enrollment was 41 days (range 11 days-79 days). The time from surgery was added as a covariate to a Cox regression model and was not found to be significantly related to DFS (P?=?.22) or OS (P?=?.36). Table 2 Disease-Free Survival Rates Patient Group No. DFS (95% CI) 1-Year 2-Year Accepted assigned treatment 61 88% (77%-94%) 80% (67%-88%) Received chemotherapy 44 95% (83%-99%) 83% (68%-92%) By protein level category (for those that received chemotherapy) ?Low ERCC1/low RRM1 20 95% (69%-99%) 84% (59%-95%) ?Low ERCC1/high RRM1 18 94% (65%-99%) 82% (55%-94%) ?High ERCC1/low RRM1 6 100% (100%-100%) 100% (100%-100%) Abbreviations: 95% CI 95% confidence interval; DFS disease-free survival; ERCC1 excision repair cross-complementing group 1; RRM1 ribonucleotide reductase M1. Figure 2 Kaplan-Meier survival estimates are shown. (A) Collective disease-free survival is shown for patients who accepted adjuvant chemotherapy or observation based on gene expression analysis. (B) Disease-free survival is shown for patients who received adjuvant chemotherapy. (C) Disease-free survival is shown for patients in the observation group. Conf Int indicates confidence interval. A total of 22 patients discontinued chemotherapy because of treatment-related toxicity (50%). None of the patients died because of treatment-related toxicity. Details are provided in Table 3. Table 3 Number of Patients With Grade 3 and Grade 4 Adverse Events Among the 44 Patients Who Received Chemotherapya Level of Severity Adverse Event Grade 3 Grade 4 No. of patients with events 13 14 Type of events ?Neutropenia 11 6 ?Thrombocytopenia 4 4 ?Nausea 4 0 ?Vomiting 4 0 ?Anemia 2 0 ?Anorexia 2 0 ?Fatigue 2 0 ?Febrile neutropenia 1 1 ?Thromboembolism 1 1 ?Dehydration 1 0 ?Hearing impairment 1 0 ?Mucositis 1 0 ?Pleural effusion 1 0 ?Renal failure 1 0 ?Bradycardia (sinus) 1 0 ?Syncope 1 0 ?ALT elevation 1 0 ?Hypokalemia 1 0 ?Hyponatremia 0 2 Abbreviation: ALT alanine aminotransferase. a Adverse events were assessed according to the Common Terminology Criteria for Adverse Events (version 3.0). In Situ ERCC1 and RRM1 Protein Levels RRM1 levels ranged from 2.4 to 234.3 (median 39.7; mean 48.1) which were not significantly different from the expected values (median 40.5; range 8.3-96.2) (P?=?.87).16 ERCC1 protein levels ranged from 4.3 to 211.2 (median 41.9; mean 58.8) and these values were significantly different from the expected values (median 65.9; range 1.9-178.7) (P?=? 0.02). There was a significant correlation noted between ERCC1 and RRM1 levels (correlation coefficient 0.39; P?=?.0003) (Fig. 3) as previously reported.91618 Figure 3 Distribution of excision repair cross-complementing group 1 (ERCC1) and ribonucleotide reductase M1 (RRM1) levels in eligible patients is shown. The median protein levels of ERCC1 in adenocarcinomas squamous cell carcinomas and the other histologies were 34.257.1 and 121.5 respectively. The corresponding median levels of RRM1 were 38.142.6 and 48.9 respectively. Although the levels were higher in squamous cell carcinomas compared with adenocarcinomas the medians were not statistically significant (ERCC1: P?=?.16; RRM1: P?=?.72). DISCUSSION Disease stage is a predictor of benefit from adjuvant chemotherapy in patients with NSCLC. Patients with stage III disease derive the most benefit and those with stage I are reported to derive the least.1241923 Although not statistically significant for patients with stage I disease and a tumor diameter >?3 cm a numerical risk reduction of 7% has been reported and for those with tumors measuring ??3 cm a numerical risk increase of 40% has been reported.23 A significant treatment-related toxicity is febrile neutropenia which has been reported in 7% to 24% of patients.242022 Treatment-related deaths occur in 0.5% to 2% of patients.122022 The inclusion of molecular markers predictive of therapeutic efficacy into adjuvant decision algorithms would greatly improve the clinical benefit and reduce toxicity for patients with NSCLC. This approach is particularly attractive for patients with stage I disease in whom the parameters for weighing risks and benefits are to our knowledge the least well defined. Recent advances in molecular diagnostics have resulted in improved outcomes for patients whose tumors harbor mutations in oncogenic signal transduction molecules that can be inactivated by therapeutic agents. Similarly platinum agents target DNA and gemcitabine targets ribonucleotide reductase; both are unequivocally required not only for cellular proliferation but also for other essential cellular functions. Although to our knowledge specific oncogenic mutations have not been identified to date ERCC1 and RRM1 have emerged as promising predictors of efficacy for cisplatin and gemcitabine respectively. We conducted a phase 2 trial of treatment selection based on the levels of protein expression of ERCC1 and RRM1 for patients with completely resected stage I NSCLC and tumor diameters ??2 cm primarily to establish feasibility but also to evaluate preliminary efficacy as assessed by 2-year survival rates. We achieved our primary goal by demonstrating within a cooperative group environment that treatment assignment can be achieved for >?85% of patients within 84 days (12 weeks) the established timeframe for the initiation of adjuvant therapy from surgery in patients with NSCLC.1242022 At first glance our demonstration of feasibility should not be surprising. However it is important to note that surgical practice has not usually engaged a medical" | Lung_Cancer |
"Therefore gathering a complete profile of mutations in lung cancers for the application of personalized and tailored targeted therapy is critical to develop future cancer treatments. We believe a faster and cost effective genotyping tool such as Ion Torrent sequencing technology will be greatly beneficial for the assignment of such specific therapeutics in the near future use for lung cancers. Materials and Methods Ethics statement The study has been approved by the Human Research Ethics Committee of the First Affiliated Hospital of Dalian Medical University China. For Formalin fixed and paraffin embedded (FFPE) tumor samples from the tumor tissue bank at the Department of Pathology of the hospital the institutional ethics committee waived the need for consent. All samples and medical data used in this study have been irreversibly anonymized. Patient information Tumor samples used in the study were collected from the First Affiliated Hospital of Dalian Medical University China. A total of 76 FFPE tumor samples from lung cancer patients were analyzed. The mean age of the 76 patients was 61 years (range: 2880 years). Of these 40 patients were male with a mean age of 61 years (range: 2880 years) and 36 patients were female with a mean age of 61 (range: 3675 years). Tumor samples used in the study were collected from the First Affiliated Hospital of Dalian Medical University China. A total of 76 FFPE tumor samples from lung cancer patients were analyzed. The mean age of the 76 patients was 61 years (range: 2880 years). Of these 40 patients were male with a mean age of 61 years (range: 2880 years) and 36 patients were female with a mean age of 61 (range: 3675 years). 33 of the 76 patients (20 men 13 women) were graded as low pathologic differentiation; 27 (14 men 13 women) at mid 15 (6 men 9 women) at high and 1 women of unknown differentiation. AJCC cancer staging is as follows: 0 patients at I or Ia; 18 (10 men 8 women) at stage Ib; 3 (2 men 1 woman) at stage IIa; 9 (5 men 4 women) at stage IIb; 26 (14 men 12 women) at stage IIIa; 8 (4 men 4 women) at stage IIIb; 0 patients at stage IIIc; and 12 (5 men 7 women) at stage IV. Out of the total 76 patients 16 of the 40 men reported no history of smoking whereas none of the 36 women reported to be smokers; 6 men reported light smoking; 17 men reported heavy smoking and 1 man with an unknown smoking history. DNA preparation DNA was isolated from FFPE samples after deparaffinization and extraction of 35 µm thick paraffin sections in xylene using the QIAamp DNA Mini Kit (Qiagen) per the manufacturer's instructions. Ion torrent PGM library preparation and sequencing An Ion Torrent adapter-ligated library was made following the manufacturer's protocol for the Ion AmpliSeq Library Kit 2.0 (Life Technologies) (Part #4475345 Rev. A). Briefly 50 ng pooled amplicons were end-repaired and DNA ligase was used to ligate Ion Torrent adapters P1 and A. After purification with AMPure beads (Beckman Coulter Brea CA USA) adapter-ligated products were nick-translated and PCR-amplified for a total of 5 cycles. AMPure beads (Beckman Coulter) were used to purify the resulting library and an Agilent 2100 BioAnalyzer (Agilent Technologies) and Agilent BioAnalyzer DNA High-Sensitivity LabChip (Agilent Technologies) were used to determine the concentration and size of the library. Sample emulsion PCR emulsion breaking and enrichment were performed using the Ion PGM 200 Xpress Template Kit (Part #4474280 Rev. B) according to the manufacturer's instructions. Briefly an input concentration of one DNA template copy/Ion Sphere Ps (ISPs) was added to the emulsion PCR master mix and the emulsion generated using an IKADT-20 mixer (Life Technologies). Next ISPs were recovered and template-positive ISPs were enriched for use with Dynabeads MyOne Streptavidin C1 beads (Life Technologies). ISP enrichment was confirmed using the Qubit 2.0 fluorometer (Life Technologies)." | Lung_Cancer |
"an-specific analysis demonstrated that pre-treatment diameter of lung metastatic lesions had a moderately positive association with percent change in post-treatment tumor diameter (R?=?0.341 ). There were fewer target lesions in the other three ans than in the lung and there was no association between liver lymph node or kidney lesion size and percent change in post-treatment tumor diameter (). The percent changes in target lesion size differed significantly between the four individual ans (P?=?0.0007 by the Kruskal Wallis test). The mean (± SD) percent changes in target lesion size in the lung liver lymph nodes and kidney were ?27.1?±?33.5 0.5?±?29.4 ?16.7?±?19.6 and ?2.7?±?21.7 respectively. Target lesions in the lung showed the greatest change in size which was significantly greater than in the liver and kidney (P?=?0.007 and 0.002 respectively). There was no difference in the percent change in target lesion size between the lung and lymph nodes (P?=?0.114) (). Association between pre-treatment tumor size and percent change in lesion size after sunitinib treatment. Association between pre-treatment tumor size and percent change in size was analyzed for lesions in the lung (a) liver (b) lymph nodes (c) and kidney (d). The pre-treatment size of lung lesions showed a moderately positive association with percent size change after treatment with sunitinib while no association was observed in the liver lymph nodes and kidney. Percent change in target lesion size in different ans. The reduction in lesion size was significantly greater in lung lesions compared with liver and kidney lesions. Lung lesions with an initial diameter?<?17.3 mm (median) showed a significant percent reduction in size compared with lesions???17.3 mm. No significant differences in relation to initial lesion size were observed in the liver lymph nodes and kidney. Lesions in each an were divided into two groups according to the median pre-treatment diameter and percent changes in tumor diameter were compared between the two groups. Lung lesions with a pre-treatment diameter less than the median value of 17.3 mm showed a significant percent reduction in diameter compared with tumors???17.3 mm (P?=?0.002). There were no differences in the percent change in relation to size above or below the median value in other ans (). Cut-off value for pre-treatment tumor diameter predicting response to sunitinib in lung metastasis ROC curves were drawn to determine cut-off values predicting 30% and 50% reductions in the diameter of lung metastatic lesions (). The cut-off predicting a 30% reduction in diameter was 16.5 mm with a sensitivity of 69.6% specificity of 58.2% and an area under the curve (AUC) of 0.662. The cut-off predicting a 50% reduction in diameter was also 16.5 mm with a sensitivity of 67.0% specificity of 77.8% and an AUC of 0.752. Using this cut-off value the percent change in lesion size for lesions?<?16.5 mm was ?41.7?±?35.5% while that for lesions???16.5 mm was ?16.2?±?26.9% (P?=?0.0005). Cut-off values of initial lung tumor size for predicting 30% and 50% reductions in diameter after sunitinib treatment. Based on ROC analysis the cut-off values of initial lung lesion size for predicting reductions in diameter of both 30% and 50% were 16.5 mm. Influence of pre-treatment CRP value cytoreductive nephrectomy and treatment line on percent change in target lesion size in the lung Metastatic lung lesions were categorized into two groups based on pre-treatment C-reactive protein (CRP) levels. The mean diameter and percent change in lesion size in patients with CRP?<?2.0 mg/ml were 19.0?±?9.3 mm and ?38.3?±?30.5% respectively while those in patients with CRP???2.0 mg/ml were 28.3?±?20.6 mm and ?9.6?±?33.9% respectively. The lesions were further divided into three subgroups according to pre-treatment diameter?<?20 mm ? 20 to?<?40 mm and???40 mm. Percent changes were compared between lesions in patients with CRP?<?2.0 mg/dl (low CRP) and those with CRP???2.0 mg/dl (high CRP) in each subgroup. For lesions?<?20 mm patients with low CRP had significantly greater reductions in tumor diameter than patients with high CRP (?43.8?±?33.4% vs. ?15.3?±?37.7% P?=?0.0019). In patients with lesions ?20 to?<?40 mm there was a tendency towards a greater reduction in patients with low CRP compared with high CRP though the difference was not significant (?29.0?±?17.3% vs. ?12.4?±?30.2% P?=?0.054) and similarly there was no significant association between tumor reduction and CRP level in patients with lesions???40 mm (?13.3?±?20.6 vs. 6.8?±?17.4 P?=?0.151) (). Influence of CRP on percent change in lung lesion size. In patients with lung lesions?<?20 mm the percent reduction in size was significantly greater in patients with low compared with high CRP levels. Meanwhile CRP level had a marginal effect on size reduction in lesions???20 to?<?40 mm and no effect in lesions???40 mm. Percent changes in size were compared between lung lesions in patients in each diameter subgroup who did and did not undergo cytoreductive nephrectomy. There were no lung lesions???40 mm in patients who did not undergo cytoreductive nephrectomy. There was no significant difference between mean percent change in lesion size in patients with and without cytoreductive nephrectomy (?36.1?±?32.6 vs. ?28.2?±?41.9 P?=?0.421 and ?20.4?±?25.1 vs. ?32.0?±?21.9 P?=?0.307 in lesions?<?20 mm and???20 mm respectively). Similarly there was no significant difference in percent change in lesion size between lung lesions in patients treated as first-line therapy and those treated as second-line or later therapy in any diameter subgroup (?38.1?±?37.7 vs. ?32.1?±?33.9 P?=?0.280; ?23.5?±?21.6 vs. ?17.5?±?23.3 P?=?0.803; and 3.5?±?2.6 vs. 1.9?±?22.9 P?>?0.9 in lesions?<?20 mm ? 20 to?<?40 mm and???40 mm respectively). Discussion A previous study on metastatic RCC by Yuasa et al. demonstrated that: 1) smaller initial tumor size predicted a good response to TKIs; 2) the greatest response was achieved in patients with lung lesions; and 3) there was no difference in tumor response between patients treated with sorafenib and sunitinib [6]." | Lung_Cancer |
" <0.001* Ia + Ib 25(47.2) 9(15.0) IIa + IIb 17(32.1) 21(35.0) IIIa 11(20.7) 30(50.0) Tumor size 0.001* ?5cm 35(66.0) 21(35.0) >5cm 18(34.0) 39(65.0) Lymph node metastasis 0.001* Negative 34(64.2) 20(33.3) Positive 19(35.8) 40(66.7) Smoking History 0.127 Smokers 39(64.2) 36(60.0) Never Smokers 14(35.8) 24(40.0) * Overall P?<?0.05. Association of BANCR expression with patients survival Kaplan-Meier survival analysis was conducted to investigate the correlation between BANCR expression and NSCLC patient prognosis. According to relative BANCR expression in tumor tissues the 113 NSCLC patients were classified into two groups: the high BANCR group (n?=?53 fold-change???4); and the low BANCR group (n?=?60 fold-change ?4) (B). With respect to progression-free survival (PFS) this was 35.3% for the high BANCR group and 17.2% for the low BANCR group. Median survival time for the high BANCR group was 31 months and 16 months for the low BANCR group (C). The overall survival rate over 3 years for the high BANCR group was 46% and 27.5% for the low BANCR group. Median survival time for the high BANCR group was 32 months and 18 months for the low BANCR group (D). Univariate analysis identified three prognostic factors: lymph node metastasis; TNM stage; and BANCR expression level. Other clinicopathological features such as gender and age were not statistically significant prognosis factors (). Multivariate analysis of the three prognosis factors confirmed that a low BANCR expression level was an independent predictor of poor survival for NSCLC (p?=?0.031) in addition to TNM stage (p?=?0.038) (). Univariate and multivariate analysis of overall survival in NSCLC patients (n?=?113) Variables Univariate analysis Multivariate analysis HR 95% CI p value HR 95% CI p value Age 1.257 0.712-2.219 0.431 Gender 1.185 0.670-2.098 0.559 Smoker 1.120 0.842-1.491 0.436 Histological subtype 0.982 0.738-1.307 0.902 Chemotherapy 0.787 0.587-1.055 0.110 Tumor size 1.233 0.926-1.640 0.151 Lymph node metastasis 0.424 0.235-0.764 0.004* 0.577 0.311-1.071 0.081 TNM stage (I vs. II or IIIa) 0.320 0.149-0.685 0. 003* 0.431 0.195-0.954 0.038* BANCR expression 0.367 0.201-0.669 0. 001* 0.496 0.262-0.938 0.031* HR hazard ratio; 95 % CI 95 % confidence interval * Overall P?<?0.05. Histone deacetylation is involved in the downregulation of BANCR Expression levels of BANCR in NSCLC cell lines were determined by qPCR. Compared with that in 16HBE cells relative expression levels of BANCR were reduced in NSCLC cells (A). Because of the different expression patterns for BANCR in NSCLC and melanomas we investigated the mechanisms controlling tissue-specific expression of BANCR. We analyzed the promoter region of BANCR and found there were no CpG islands (data not shown). Histone protein modification was thought to play an important role in the transcription of lncRNAs; however knockdown of two core subunits of polycomb repressive complex 2 (SUZ12 and EZH2) had no influence on BANCR expression (Additional file 2: Figure S1A). Histone deacetylation is involved in BANCR downregulation. (A) BANCR expression levels of NSCLC cell lines (A549 SPC-A1 H1299 H1650 H1975 and SK-MES-1) compared with that in normal human bronchial epithelial cells (16HBE). (B) qPCR analysis of BANCR expression levels following the treatment of SPC-A1 and A549 cells with TSA. (C) qPCR analysis of HDAC2 and HDAC3 expression levels following the treatment of SPC-A1 and A549 cells with si-HDAC2 or si-HDAC3.(D E) qPCR analysis of BANCR expression levels following the treatment of SPC-A1 and A549 cells with si-HDAC1 and si-HDAC3. We observed that BANCR expression was upregulated in SPC-A1 and A549 cells following treatment with the histone deacetylase (HDAC) inhibitor trichostatin A (TSA) (B). We sought to determine whether repression of BANCR was mediated by HDACs. Specific anti-HDAC1 and HDAC3 siRNAs were transfected into NSCLC cells and HDAC1 and HDAC3 expression was significantly decreased (C). Expression levels of BANCR were significantly upregulated in cells transfected with si-HDAC3. Transfection with the scrambled siRNA or si-HDAC1 did not induce BANCR expression (D and E). Moreover the HDAC3 expression was upregulated in NSCLC cells and negatively correlated with BANCR expression (Additional file 2: Figure S1B). Furthermore NSCLC cells were treated with RGFP966 which is an seletive inhibitor for HDAC3 with an IC50 of 0.08?M and no effective inhibition of other HDACs at concentrations up to 15?M. The results of qPCR showed that the expression of BANCR was upregulated in NSCLC cells after treated with RGFP966 when compared with control cells (Additional file 2: Figure S1C). These data indicate that HDAC3 knockdown induced BANCR increase may be due to the inhibition of HDAC3 enzymatic activity. BANCR inhibits NSCLC cell viability and induces apoptosis To assess the biological role of BANCR in NSCLC we investigated the effects of BANCR over-expression on the viability and apoptosis of SPCA1 or A549 cells. Our qPCR results revealed that BANCR expression was significantly upregulated compared with that in control cells (A). MTT assay results showed that the growth of SPC-A1 and A549 cells transfected with pCDNA-BANCR was impaired compared with that for control cells (B and C). Colony formation assay results revealed that clonogenic survival was inhibited following overexpression of BANCR in SPC-A1 and A549 cells (D). Flow cytometry analysis of SPC-A1 and A549 cells showed that upregulation of BANCR expression promoted apoptosis in comparison with that in control cells (E). Effects of BANCR on NSCLC cell viability and apoptosis in vitro. (A) SPC-A1 and A549 cells were transfected with pCDNA-BANCR. (B C) MTT assays were used to determine the cell viability for pCDNA-BANCR-transfected SPC-A1 and A549 cells. Values represented the mean?±?s.d. from three independent experiments. (D) Colony-forming assays were conducted to determine the proliferation of pCDNA-BANCR-transfected SPC-A1 and A549 cells. (E) Apoptosis was determined by flow cytometry. UL necrotic cells; UR terminal apoptotic cells; LR early apoptotic cells. *P?<?0.05 and **P?<?0.01. BANCR inhibits migration and invasion of NSCLC cells The wound healing assay results showed that cells transfected with pCDNA-BANCR resulted in a slower closing of scratch wounds compared with that for control cells (A and B). We evaluated cancer cell invasion through matrigel and migration through transwells. Increased BANCR expression levels impeded the migration of SPC-A1 and A549 cells by approximately 64% compared with controls (C and D). Similarly invasion of SPC-A1 and A549 cells was also reduced by 59% following upregulation of BANCR expression. Effects of BANCR on NSCLC migration and invasion in vitro. SPC-A1 and A549 cells were transfected with pCDNA-BANCR. (A B) Wound-healing assays were used to investigate the migratory ability of NSCLC cells. (C D) Transwell assays were used to investigate the changes in migratory and invasive abilities of NSCLC cells. *P?<?0.05 and **P?<?0.01. Knockdown of BANCR expression promotes NSCLC cells invasion To determine whether inhibition of BANCR expression could promote NSCLC cells viability and invasion we performed targeted knockdown of BANCR expression using RNA interference (RNAi) in A549 cells (A). MTT assays revealed that downregulation of BANCR expression did not affect cell viability (data not shown). However decreased BANCR expression levels promoted A549 cell migration and invasion in vitro (B). Effects of BANCR overexpression on tumor metastasis in vivo. (A) BANCR expression levels were determined by qPCR following the treatment of A549 cells with si-BANCR. (B) Transwell assays were conducted to determine the migratory and invasive abilities of si-BANCR-transfected A549 cells. Analysis of an experimental metastasis animal model was performed by injecting BANCR-overexpressing SPC-A1 cells into nude mice. (C) Lungs from mice in each experimental group with the numbers of tumor nodules on lung surfaces were shown. (D) Visualization of the entire lung and HE-stained lung sections. **P?<?0.01. BANCR suppresses NSCLC cell metastasis in vivo To validate the effects of BANCR on the metastasis of NSCLC cells in vivo SPCA1 cells stably transfected with pCDNA-BANCR were injected into nude mice. Metastatic nodules on the surface of lungs were counted after 7 weeks. Ectopic overexpression of BANCR resulted in a reduction of the number of metastatic nodules compared with those in the control group (C). This difference was further confirmed following examination of the entire lungs and through hematoxylin and eosin (HE) staining of lung sections (D). Our in vivo data complemented the results of functional in vitro studies involving BANCR. BANCR influences NSCLC cell EMT We conducted qPCR and western blotting assays to detect the expression of EMT-induced markers (E-cadherin N-cadherin and Vimentin) in cells over-expressing BANCR. Our findings showed that increased BANCR expression levels induced E-cadherin expression while decreased N-cadherin Vimentin and MMP-2 expression (Figure 6A). Simultaneously upregulation of BANCR expression led to decreased SNAIL1 SNAIL2 and SIP1 expression (Figure 6B). Western blotting and immunofluorescence analysis also revealed that enhanced BANCR expression stimulated E-cadherin expression and reduced Vimentin expression in NSCLC cells (Figure 6B and C). Figure 6 BANCR overexpression suppresses NSCLC cell invasion and metastasis by affecting EMT. (A B) Analysis of E-cadherin N-cadherin Vimentin MMP-2 MMP-9 SNAIL1 SNAIL2 TWIST and SIP1 expression in A549 cells treated with pCDNA-BANCR. (CD) Analysis of E-cadherin and Vimentin expression in A549 cells treated with pCDNA-BANCR by western blot and immunofluorescence. All experiments were performed in triplicate with three technical replicates. *P < 0.05 **P < 0.01. Discussion Recent evidence has shown that ncRNAs play an important role in cancer pathogenesis and could provide new insights into the biology of this disease [2122]. Over the past decade microRNAs (miRNAs) have moved to the forefront of ncRNA research in NSCLC. However lncRNAs in NSCLC are still an emerging field with only a handful of lncRNAs involved in NSCLC tumorigenesis. One of these lncRNAs is metastasis-associated lung adenocarcinoma transcript 1 (MALAT1). MALAT1 also known as NEAT2 (nuclear-enriched abundant transcript 2) is a highly conserved nuclear lncRNA and a predictive marker for metastasis development in lung cancer [23]. In this study we found that the expression of another lncRNA BANCR was significantly downregulated in NSCLC tissues. Specifically BANCR expression was significantly lower at the later stages of tumor development and in tumors that had undergone extensive metastasis. Moreover the overall survival time of patients with lower BANCR expression levels was significantly shorter than that for patients with higher BANCR expression levels. Our results indicate that BANCR expression provided a significant independent predictive value for TNM stage (P?=?0.038). We demonstrated that upregulation of BANCR expression led to the significant inhibition of cell viability migration invasion and promotion of apoptosis. Knockdown of BANCR expression promoted cell migration and invasion. BANCR induced cell apoptosis may be partly via P53 which could contribute to the less cells in migration and invasion; however the impaired migration and invasion ability is the main reason which could be supported by wound-healing assay. Moreover increased BANCR expression levels resulted in a significant reduction in the number of metastatic nodules on the lungs in vivo. These findings suggest that BANCR plays a direct role in the modulation of cell metastasis and NSCLC progression and may be useful as a novel prognostic or progression marker for NSCLC. Tumor development and progression is precisely regulated by several subsets of genes that act by either silencing tumor suppressor genes or activating oncogenes [24]. Tumor suppressor genes can negatively regulate cell proliferation by inducing growth arrest and inhibiting cell invasion. In cancer cells tumor suppressor genes are usually silenced by genetic or epigenetic alterations [25]. Whether epigenetic regulatory factors such as histone acetylation or DNA methylation manipulate the expression of lncRNAs remains unclear. Hypermethylation of the promoter or the intergenic differentially methylated region has been found to contribute to reduced lncRNA MEG3 expression in tumors indicating that epigenetic regulation is also involved in the expression of these genes [2627]. Our findings highlight that histone acetylation is a key factor in controlling lncRNA BANCR expression. These results along with those from a recent study [28] highlight the role of epigenetics in regulating lncRNA transcription. To explore the molecular mechanism through which BANCR contributes to the invasion and metastasis of NSCLC we investigated potential target proteins involved in cell motility and matrix invasion. Hallmarks of EMT are the loss of E-cadherin expression and aberrant expression of N-cadherin and Vimentin [29-32]. Therefore we determined the protein levels of these EMT-induced markers following BANCR overexpression. Our results indicated that inhibitory effects on cell migration and invasion were associated with EMT. Matrix metalloproteases (MMPs) are also important to many aspects of biology ranging from cell proliferation differentiation and remodeling of the extracellular matrix (ECM) to vascularization and cell migration. Upregulation of BANCR expression in NSCLC cells led to a significant decrease in MMP2 protein levels. Our findings demonstrated that BANCR mediated NSCLC cell migration invasion and metastasis suppression which possibly also affected EMT. As a central differentiation process EMT allows for remodeling of tissues during the early stages of embryogenesis and is implicated in the promotion of tumor cell invasion and metastasis [733]. It has been proposed and supported by many studies that EMT could be a potent mechanism for promoting the detachment of cancer cells from primary tumors. A characteristic of cells that undergo EMT is increased expression levels of N-cadherin and Vimentin and a loss of E-cadherin expression. Importantly EMT has been reported to be associated with poor clinical outcome in NSCLC [3435]. Therefore lncRNAs as regulators of EMT might be suitable candidates for intervention in the treatment of cancer. Although only a small number of functional lncRNAs have been well characterized to date they have been shown to regulate gene expression at various levels including chromatin modification transcription and post-transcriptional processing. Hox transcript antisense intergenic RNA (HOTAIR) is one of the most studied lncRNAs involved in chromatin modification which can target PRC2 genome-wide to alter H3K27 methylation and gene expression patterns [22]. A muscle-specific lncRNA linc-MD1 may function as competing endogenous RNAs (ceRNAs) to sponge miRNAs thereby modulating the derepression of miRNA targets and impose an additional level of post-transcriptional regulation [36]. Here although we observed BANCR overexpression induced NSCLC cells apoptosis and regulate EMT phenotype the possible mechanisms that underlie such regulatory behaviors still remain to be fully understood. Further investigation of BANCR molecular and biological functions in controlling EMT will undoubtedly be important in understanding the molecular biology of NSCLC metastasis and progression. Conclusions The expression of BANCR was significantly decreased in NSCLC tissues suggesting that its downregulation may be a negative prognostic factor for NSCLC patients and indicative of poor survival rates and a higher risk for cancer metastasis. We showed that BANCR possibly regulates the invasive and metastatic ability of NSCLC cells partially through regulation of EMT. Our findings further the understanding of NSCLC pathogenesis and development and facilitate the development of lncRNA-directed diagnostics and therapeutics against cancers. However the molecular mechanisms through which BACNR regulates EMT requires further investigation. Methods Tissue collection We obtained 113 paired NSCLC and adjacent non-tumor lung tissues from patients who underwent surgery at Jiangsu Province Hospital between 2008 and 2010 and were diagnosed with NSCLC (stages I II and III) based on histopathological evaluation. Clinicopathological characteristics including tumor-node-metastasis (TNM) staging were recorded. No local or systemic treatment was conducted in these patients before surgery. All collected tissue samples were immediately snap-frozen in liquid nitrogen and stored at 80°C until required. Our study was approved by the Research Ethics Committee of Nanjing Medical University China. Written informed consent was obtained from all patients. Cell lines Five NSCLC adenocarcinoma cell lines (A549 SPC-A1 NCI-H1975 NCI-H1299 and NCI-H1650) a NSCLC squamous carcinomas cell line (SK-MES-1) and a normal human bronchial epithelial cell line (16HBE) were purchased from the Institute of Biochemistry and Cell Biology of the Chinese Academy of Sciences (Shanghai China). A549 SK-MES-1 NCI-H1975 NCI-H1299 NCI-H1650 and 16HBE cells were cultured in RPMI 1640; SPC-A1 cells were cultured in DMEM (GIBCO-BRL) medium supplemented with 10% fetal bovine serum (FBS) 100 U/ml penicillin and 100 mg/ml streptomycin (Invitrogen Carlsbad CA USA) at 37ºC/5% CO2. RNA extraction and qPCR assays Total RNA was isolated with TRIzol reagent (Invitrogen) according to the manufacturers instructions. Total RNA (500 ng) was reverse transcribed in a final volume of 10 ?l using random primers under standard conditions for the PrimeScript RT reagent Kit (TaKaRa Dalian China). We used the SYBR Premix Ex Taq (TaKaRa Dalian China) to determine BANCR expression levels following the manufacturers instructions. Results were normalized to the expression of glyceraldehyde-3-phosphate dehydrogenase (GAPDH). The specific primers used are presented in Additional file 3: Table S2. The qPCR assays were conducted on an ABI 7500 and data collected with this instrument. Our qPCR results were analyzed and expressed relative to threshold cycle (CT) values and then converted to fold changes. Plasmid generation The BANCR sequence was synthesized and subcloned into the pCDNA3.1 (Invitrogen Shanghai China) vector. " | Lung_Cancer |
"lung cancer patients undergoing radiation therapy. Before 4DCT-ventilation can be implemented clinically it needs to be validated against an established imaging modality. The purpose of this work was to compare 4DCT-ventilation to nuclear medicine ventilation using clinically relevant global metrics and radiologist observations. Methods and Materials Fifteen lung cancer patients with 16 sets of 4DCT and nuclear medicine ventilation-perfusion (VQ) images were used for the study. The VQ-ventilation images were acquired in planar mode using Tc-99m-labeled diethylenetriamine-pentaacetic acid aerosol inhalation. 4DCT data spatial registration and a density-change-based model were used to compute a 4DCT-based ventilation map for each patient. The percent ventilation was calculated in each lung and each lung third for both the 4DCT and VQ-ventilation scans. A nuclear medicine radiologist assessed the VQ and 4DCT scans for the presence of ventilation defects. The VQ and 4DCT-based images were compared using regional percent ventilation and radiologist clinical observations. Results Individual patient examples demonstrate good qualitative agreement between the 4DCT and VQ-ventilation scans. The correlation coefficients were 0.68 and 0.45 using the percent ventilation in each individual lung and lung third respectively. Using radiologist-noted presence of ventilation defects and receiver operating characteristic analysis the sensitivity specificity and accuracy of the 4DCT-ventilation were 90%0.64 and 81% respectively. Conclusions The current work compared 4DCT with VQ-based ventilation using clinically relevant global metrics and radiologist observations. We found good agreement between the radiologists assessment of the 4DCT and VQ-ventilation images as well as the percent ventilation in each lung. The agreement lessened when the data were analyzed on a regional level. Our study presents an important step for the integration of 4DCT-ventilation into thoracic clinical practice. Korean J Radiol Korean J Radiol KJR Korean Journal of Radiology 1229-6929 2005-8330 The Korean Society of Radiology 24642766 3955798 10.3348/kjr.2014.15.2.295 Thoracic Imaging Case Report A Rare Case of Diffuse Pulmonary Lymphangiomatosis in a Middle-Aged Woman Lim Hyun-ju MD 1 Han Joungho MD 2 Kim Hong Kwan MD 3 Kim Tae Sung MD 1 1Department of Radiology and Center for Imaging Sungkyunkwan University School of Medicine Seoul 135-710 Korea. 2Department of Pathology Sungkyunkwan University School of Medicine Seoul 135-710 Korea. 3Department of Thoracic Surgery Sungkyunkwan University School of Medicine Seoul 135-710 Korea. Corresponding author: Joungho Han MD Department of Pathology Samsung Medical Center Sungkyunkwan University School of Medicine 81 Irwon-ro Gangnam-gu Seoul 135-710 Korea. Tel: (822) 3410-2765 Fax: (822) 3410-0025 joungho.hansamsung.com Mar-Apr 2014 07 3 2014 15 2 295 299 03 1 2013 13 12 2013 Copyright 2014 The Korean Society of Radiology 2014 This is an Open Access distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons./licenses/by-nc/3.0/) which permits unrestricted non-commercial use distribution and reproduction in any medium provided the original work is properly cited. Diffuse pulmonary lymphangiomatosis (DPL) is a rare lymphatic disorder characterized by lymphatic channel proliferation. It is mostly reported in children and young adults. Here we report a case involving a 52-year-old asymptomatic woman who presented with increased interstitial markings as seen on a chest radiograph. Diffuse interstitial septal thickening was found on a serial follow-up chest computed tomography scan and lymphangitic metastasis was the primary radiologic differential diagnosis. However histologic sections of wedge resected lung revealed diffuse pleural and interlobular septal lymphatic proliferation characteristic of DPL. Lymphangiomatosis Interstitial Lung Computed tomography INTRODUCTION Diffuse pulmonary lymphangiomatosis (DPL) is a diffuse lymphatic disease characterized by the proliferation of lymphatic vessels. DPL mostly affects children and young adults with an equal gender prevalence. DPL is a very rare disease and so far only five cases have been reported in middle-aged patients in the English-language literature to our knowledge (1-5). Computed tomography (CT) findings for DPL include increased interlobular septal thickening peribronchovascular thickening patchy ground glass opacities pleural thickening pleural effusion and mediastinal soft tissue infiltration (5). Possible radiologic differential diagnoses include pulmonary edema pulmonary veno-occlusive disease Erdheim-Chester disease lymphangiectasis lymphangitic carcinomatosis sarcoidosis and pulmonary lymphoma. An increase in the size and the number of anastomosing lymphatic channels in interlobular septa or subpleural areas is seen histopathologically (2). Patients with DPL present with various clinical manifestations and usually have a progressive clinical course (2). Here we describe a middle-aged woman with DPL in whom clinical suspicion of lymphangitic metastasis was raised preoperatively. CASE REPORT A 52-year-old woman with abnormal chest radiographs was referred to our hospital. She was asymptomatic and denied having any cough wheezing or hemoptysis. Her past medical history was unremarkable. The findings of a physical examination were normal. Laboratory examination revealed a hemoglobin level of 14.1 g/dL a white blood cell count of 8160/µL (61.7% neutrophils 31.1% lymphocytes 2.6% eosinophils 4.4% monocytes and 0.2% basophils) and a platelet count of 209000/µL. Urine analysis findings blood chemistry findings and erythrocyte sedimentation rates were normal. Posteroanterior chest radiograph showed increased interstitial markings in both lungs (Fig. 1A). Diffuse smooth and nodular interlobular septal thickening and minimal amounts of bilateral pleural effusion were demonstrated on CT scan (Fig. 1B C). Low-density infiltration of mediastinal fat and lymph node enlargement were noted in the right anterior diaphragmatic area of a mediastinal window (Fig. 1D). Although the patient was asymptomatic these imaging findings persisted on the follow-up CT scan taken one month later. Our primary radiologic impression was that this was a case of lymphangitic carcinomatosis. Pulmonary edema sarcoidosis and lymphoma were included in the differential diagnosis. " | Lung_Cancer |
"Methods Data on cancer incidence were obtained from NCI CDC and NAACCR and on mortality from CDC. Long- (1975/92-2010) and short- (2001-2010) term trends in age-standardized incidence and death rates for all cancers combined and for the leading cancers among men and among women were examined by joinpoint analysis. Through linkage with Medicare claims the prevalence of comorbidity among cancer patients diagnosed between 1992 through 2005 residing in 11 Surveillance Epidemiology and End Results (SEER) areas were estimated and compared to those among a 5% random sample of cancer-free Medicare beneficiaries. Among cancer patients survival and the probabilities of dying of their cancer and of other causes by comorbidity level age and stage were calculated. Results Death rates continued to decline for all cancers combined for men and women of all major racial and ethnic groups and for most major cancer sites; rates for both sexes combined decreased by 1.5% per year from 2001 through 2010. Overall incidence rates decreased in men and stabilized in women. The prevalence of comorbidity was similar among cancer-free Medicare beneficiaries (31.8%) breast cancer patients (32.2%) and prostate cancer patients (30.5%) highest among lung cancer patients (52.8%) and intermediate among colorectal cancer patients (40.7%). Among all cancer patients and especially for patients diagnosed with local and regional disease age and comorbidity level were important influences on the probability of dying of other causes and consequently on overall survival. For patients diagnosed with distant disease the probability of dying of cancer was much higher than the probability of dying of other causes and age and comorbidity had a smaller effect on overall survival. Conclusions Cancer death rates in the U.S. continue to decline. Estimates of survival that include the probability of dying of cancer and other causes stratified by comorbidity level age and stage can provide important information to facilitate treatment decisions. cancer comorbidity multiple chronic conditions multiple health conditions incidence mortality survival trends SEER NPCR NAACCR SEER-Medicare United States (U.S.) World J Surg Oncol World J Surg Oncol World Journal of Surgical Oncology 1477-7819 BioMed Central 24885310 4030070 1477-7819-12-149 10.1186/1477-7819-12-149 Case Report Solitary glandular papilloma of the peripheral lung: a report of two cases Kaseda Kaoru 1 3 kasedawb4.so-net.ne.jp Horio Hirotoshi 1 hirohoricick.jp Harada Masahiko 1 msharadara3.so-net.ne.jp Hishima Tsunekazu 2 hishimacick.jp 1Department of Thoracic Surgery Tokyo Metropolitan Cancer and Infectious Diseases Center Komagome Hospital 3-18-22 Honkomagome Bunkyo-ku Tokyo 113-8677 Japan 2Department of Pathology Tokyo Metropolitan Cancer and Infectious Diseases Center Komagome Hospital Tokyo Japan 3Department of Thoracic Surgery Sagamihara Kyodo Hospital Kanagawa Japan 2014 19 5 2014 12 149 149 11 4 2014 6 5 2014 Copyright 2014 Kaseda et al.; licensee BioMed Central Ltd. 2014 Kaseda et al.; licensee BioMed Central Ltd. This is an Open Access distributed under the terms of the Creative Commons Attribution License (http://creativecommons./licenses/by/4.0) which permits unrestricted use distribution and reproduction in any medium provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver (http://creativecommons./publicdomain/zero/1.0/) applies to the data made available in this unless otherwise stated. Solitary papilloma of the lung is thought to be a rare benign epithelial tumor and complete surgical resection is currently the standard treatment for this pathology. However some cases of papilloma have reportedly shown malignant potential. We report two cases of solitary glandular papilloma of the peripheral lung that were treated by thoracoscopic partial resection. The first patient presented with a nodular lesion in the lower lobe of the left lung that was detected on a follow-up chest computed tomography (CT) scan after treatment for laryngeal cancer. Partial lung resection was performed by video-assisted thoracoscopic surgery. In the second patient a nodular lesion was incidentally identified in the lower lobe of the left lung during a health check-up. Partial lung resection was again performed by video-assisted thoracoscopic surgery. The postoperative course in both cases was uneventful and no recurrences have been observed as of 44 months and 41 months postoperatively respectively. To the best of our knowledge malignant transformation has been reported both with the squamous type and the mixed type of solitary papilloma of the lung. The glandular variant has shown no tendency toward local recurrence after local excision and has no apparent malignant potential. Local excision is thus recommended for solitary glandular papilloma in order to preserve pulmonary function. Solitary papilloma Glandular papilloma Surgical resection Background Solitary pulmonary papilloma is a rare neoplasm that is usually derived from bronchial surface epithelium and forms an endobronchial tumor [1-3]. Solitary pulmonary papillomas are subclassified into three categories according to histological type: squamous cell papilloma glandular papilloma and mixed squamous cell and glandular papilloma (mixed papilloma) [2]. Of these glandular papilloma of the peripheral lung is uncommon with only 20 cases reported in the English literature [24-7]. The clinicopathologic features thus remain unclear. Here we report two cases of solitary glandular papilloma of the peripheral lung and discuss the clinical implications of surgery for this. Case presentation Case 1 In January 2010 a 64-year-old man with a smoking history of two packs of cigarettes daily for 40 years was noted to have an abnormal lesion in the left lung on chest computed tomography (CT) performed as follow-up after treatment for laryngeal cancer. He was therefore referred to our department. The previous laryngeal cancer had shown complete clinical response after chemoradiotherapy and the patient had no respiratory symptoms. Laboratory data were unremarkable and serum tumor marker levels were all within normal limits. Chest CT revealed a solitary pulmonary nodule 0.8??0.8 cm in size in segment 9 of the left lung (a). In August 2010 the patient underwent partial resection of the left lower lobe of the lung by video-assisted thoracoscopic surgery (VATS) for treatment and diagnosis. Intraoperative pathological examination using frozen sections suggested inflammatory granuloma without malignant features. Postoperative histological examination demonstrated that the tumor was comprised of a fibrovascular core and papillomatous fronds lined by pseudostratified columnar epithelium (b). The columnar epithelium consisted of ciliated columnar cells goblet cells and basal cells with no cytologic or architectural atypia (c). On the basis of these morphological findings glandular papilloma of the lung was diagnosed. As of 44 months postoperatively the patient remains clinically and radiographically disease-free. Imaging and pathological findings in Case 1. a) Chest computed tomography (CT) shows a 0.8??0.8-cm nodule in segment 9 of the left lung (arrow). b) Low-power histologic view of the resected tumor (hematoxylin-eosin staining). The tumor consists of a fibrovascular core and papillomatous fronds lined by pseudostratified columnar epithelium. c) High-power view of b (hematoxylin-eosin staining). The columnar epithelium consists of ciliated columnar cells goblet cells and basal cells with no cytologic or architectural atypia. Case 2 In August 2010 a 73-year-old woman with no smoking history was noted to have an abnormal lesion in the left lung during a health check-up and was thus referred to our department. She had no relevant past history and no respiratory symptoms. Laboratory data were unremarkable and serum levels of tumor markers were all within normal limits. Chest CT revealed a solitary pulmonary nodule with air and solid components 1.0??0.8 cm in size in segment 9 of the left lung (a). In November 2010 the patient underwent VATS partial resection of the lower lobe of the left lung for treatment and diagnosis. Intraoperative pathological examination using frozen sections suggested glandular papilloma of the lung. Postoperative histological examination showed the tumor was comprised of a fibrovascular core and papillomatous fronds lined by pseudostratified columnar epithelium (b). The pseudostratified columnar epithelium consisted of ciliated columnar cells and numerous mucous cells with no cytologic or architectural atypia (c). As of 41 months postoperatively the patient remains clinically and radiographically disease-free. Imaging and pathological findings in Case 2. a) Chest computed tomography (CT) shows a 1.0??0.8-cm nodule in segment 9 of the left lung (arrowhead). b) Low-power histologic view of the resected tumor (hematoxylin-eosin staining). The tumor is composed of a fibrovascular core and papillomatous fronds lined by pseudostratified columnar epithelium. c) High-power view of b (hematoxylin-eosin staining). The pseudostratified columnar epithelium consists of ciliated columnar cells and numerous mucous cells with no cytologic or architectural atypia. Conclusions Pulmonary papillomas can be classified according to the number of lesions location or histology [2]. With regard to the number of lesions pulmonary papillomas are divided into two types multiple and solitary. Multiple papillomas representing papillomatosis are usually related to infection with papillomavirus most often occurring in children and young adults and involving both the upper and lower respiratory tracts. Solitary papillomas are rarer and predominantly affect adults [8-11]. According to location pulmonary papillomas can be classified as central endobronchial or peripheral bronchiolar types. Flieder et al. reviewed 14 cases of solitary pulmonary papillomas describing 13 as central endobronchial papillomas and only 1 as a peripheral bronchiolar papilloma [2]. The majority of peripheral bronchiolar papillomas are small asymptomatic and only discovered incidentally on chest radiography as in both our cases. In contrast a central endobronchial papilloma often causes a persistent paroxysmal and/or productive cough. Screening for lung cancer using chest radiography has recently gained popularity among healthy people in Japan so opportunities to discover asymptomatic peripheral papillomas may increase. Pulmonary papillomas are histologically divided into three categories: squamous cell glandular and mixed types [212]. Squamous cell papillomas are the most common. Glandular papillomas of the peripheral lung seem to be rare with only 20 cases reported to date in the English literature [24-7]. Peripheral bronchiolar papillomas sometimes grow along alveolar walls and display an appearance similar to peripheral adenocarcinomas of the bronchioloalveolar or papillary type. For differential diagnosis it is noteworthy that endobronchiolar papillomatous fronds are constantly present and spread along the alveolar walls is limited in alveoli adjacent to peripheral papillomas. The presence of ciliated cells and basal cells is considered an important finding for confirming the diagnosis [4]. In both of our cases the patient was successfully treated by local excision. To the best of our knowledge malignant transformation has only been reported with the squamous variant [13]. The glandular variant does not appear to recur locally after local excision and has no proven malignant potential. We therefore recommend local excision for solitary glandular papilloma. Consent Written informed consent was obtained from the patient for the publication of this case presentation and accompanying images." | Lung_Cancer |
"CC Bruns GA Weis JJ Klickstein LB Wong WW Fearon DT A complement receptor locus: genes encoding C3b/C4b receptor and C3d/Epstein-Barr virus receptor map to 1q32 J Immunol 1987 138 312 315 3782802 Wilson JG Wong WW Murphy EE 3rd Schur PH Fearon DT Deficiency of the C3b/C4b receptor (CR1) of erythrocytes in systemic lupus erythematosus: analysis of the stability of the defect and of a restriction fragment length polymorphism of the CR1 gene J Immunol 1987 138 2708 2710 2881967 Xiang L Rundles JR Hamilton DR Wilson JG Quantitative alleles of CR1: coding sequence analysis and comparison of haplotypes in two ethnic groups J Immunol 1999 163 4939 4945 10528197 Birmingham DJ Chen W Liang G Schmitt HC Gavit K Nagaraja HN A CR1 polymorphism associated with constitutive erythrocyte CR1 levels affects binding to C4b but not C3b Immunology 2003 108 531 538 10.1046/j.1365-2567.2003.01579.x 12667215 Holers VM Chaplin DD Leykam JF Gruner BA Kumar V Atkinson JP Human complement C3b/C4b receptor (CR1) mRNA polymorphism that correlates with the CR1 allelic molecular weight polymorphism Proc Natl Acad Sci U S A 1987 84 2459 2463 10.1073/pnas.84.8.2459 3031685 Zhang Q Yu JT Zhu QX Zhang W Wu ZC Miao D Tan L Complement receptor 1 polymorphisms and risk of late-onset Alzheimers disease Brain Res 2010 1348 216 221 20558149 He JR Xi J Ren ZF Qin H Zhang Y Zeng YX Mo HY Jia WH Complement receptor 1 expression in peripheral blood mononuclear cells and the association with clinicopathological features and prognosis of nasopharyngeal carcinoma Asian Pac J Cancer Prev 2012 13 6527 6531 10.7314/APJCP.2012.13.12.6527 23464487 Srivastava A Mittal B Complement receptor 1 (A3650G RsaI and intron 27 HindIII) polymorphisms and risk of gallbladder cancer in north Indian population Scand J Immunol 2009 70 614 620 10.1111/j.1365-3083.2009.02329.x 19906204 Ferreira CG Lung cancer in developing countries Am Soc Clin Oncol Educ Book 2013 327 331 PMID:23714537 23714537 Amos CI Wu X Broderick P Gorlov IP Gu J Eisen T Dong Q Zhang Q Gu X Vijayakrishnan J Sullivan K Matakidou A Wang Y Mills G Doheny K Tsai YY Chen WV Shete S Spitz MR Houlston RS Genome-wide association scan of tag SNPs identifies a susceptibility locus for lung cancer at 15q25.1 Nat Genet 2008 40 616 622 10.1038/ng.109 18385676 Hung RJ McKay JD Gaborieau V Boffetta P Hashibe M Zaridze D Mukeria A Szeszenia-Dabrowska N Lissowska J Rudnai P Fabianova E Mates D Bencko V Foretova L Janout V Chen C Goodman G Field JK Liloglou T Xinarianos G Cassidy A McLaughlin J Liu G Narod S Krokan HE Skorpen F Elvestad MB Hveem K Vatten L Linseisen J A susceptibility locus for lung cancer maps to nicotinic acetylcholine receptor subunit genes on 15q25 Nature 2008 452 633 637 10.1038/nature06885 18385738 Wang Y Broderick P Webb E Wu X Vijayakrishnan J Matakidou A Qureshi M Dong Q Gu X Chen WV Spitz MR Eisen T Amos CI Houlston RS Common 5p15.33 and 6p21.33 variants influence lung cancer risk Nat Genet 2008 40 1407 1409 10.1038/ng.273 18978787 McKay JD Hung RJ Gaborieau V Boffetta P Chabrier A Byrnes G Zaridze D Mukeria A Szeszenia-Dabrowska N Lissowska J Rudnai P Fabianova E Mates D Bencko V Foretova L Janout V McLaughlin J Shepherd F Montpetit A Narod S Krokan HE Skorpen F Elvestad MB Vatten L Nj¸lstad I Axelsson T Chen C Goodman G Barnett M Loomis MM Lung cancer susceptibility locus at 5p15.33 Nat Genet 2008 40 1404 1406 10.1038/ng.254 18978790 Markiewski MM Lambris JD The role of complement in inflammatory diseases from behind the scenes into the spotlight Am J Pathol 2007 171 715 727 10.2353/ajpath.2007.070166 17640961 Ricklin D Lambris JD Complement-targeted therapeutics Nat Biotechnol 2007 25 1265 1275 10.1038/nbt1342 17989689 Hugli TE Biochemistry and biology of anaphylatoxins Complement 1986 3 111 127 3542363 Ostrand-Rosenberg S Cancer and complement Nat Biotechnol 2008 26 1348 1349 10.1038/nbt1208-1348 19060872 Markiewski MM DeAngelis RA Benencia F Ricklin-Lichtsteiner SK Koutoulaki A Gerard C Coukos G Lambris JD Modulation of the antitumor immune response by complement Nat Immunol 2008 9 1225 1235 10.1038/ni.1655 18820683 Markiewski MM Lambris JD Is complement good or bad for cancer patients? A new perspective on an old dilemma Trends Immunol 2009 30 286 292 10.1016/j.it.2009.04.002 19428302 Fan Q He JF Wang QR Cai HB Sun XG Zhou XX Qin HD Shugart YY Jia WH Functional polymorphism in the 5?-UTR of CR2 is associated with susceptibility to nasopharyngeal carcinoma Oncol Rep 2013 30 11 16 23612877 Cerhan JR Novak AJ Fredericksen ZS Wang AH Liebow M Call TG Dogan A Witzig TE Ansell SM Habermann TM Kay NE Slager SL Risk of non-Hodgkin lymphoma in association with germline variation in complement genes Br J Haematol 2009 145 614 623 10.1111/j.1365-2141.2009.07675.x 19344414 Zhang Z Yu D Yuan J Guo Y Wang H Zhang X Cigarette smoking strongly modifies the association of complement factor H variant and the risk of lung cancer Cancer Epidemiol 2012 36 e111 e115 10.1016/j.canep.2011.11.004 22197220 Shen M Vermeulen R Rajaraman P Menashe I He X Chapman RS Yeager M Thomas G Burdett L Hutchinson A Yuenger J Chanock S Lan Q Polymorphisms in innate immunity genes and lung cancer risk in Xuanwei China Environ Mol Mutagen 2009 50 285 290 10.1002/em.20452 19170196 Fearon DT Identification of the membrane glycoprotein that is the C3b receptor of the human erythrocyte polymorphonuclear leukocyte B lymphocyte and monocyte J Exp Med 1980 152 20 30 10.1084/jem.152.1.20 6967510 Besaratinia A Pfeifer GP Second-hand smoke and human lung cancer Lancet Oncol 2008 9 657 666 10.1016/S1470-2045(08)70172-4 18598930 Coyle YM Minahjuddin AT Hynan LS Minna JD An ecological study of the association of metal air pollutants with lung cancer incidence in Texas J Thorac Oncol 2006 1 654 661 10.1097/01243894-200609000-00009 17409932 Garshick E Laden F Hart JE Rosner B Smith TJ Dockery DW Speizer FE Lung cancer in railroad workers exposed to diesel exhaust Environ Health Perspect 2004 112 1539 1543 10.1289/ehp.7195 15531439 Brennan P Buffler PA Reynolds P Wu AH Wichmann HE Agudo A Pershagen G Jockel KH Benhamou S Greenberg RS Merletti F Winck C Fontham ET Kreuzer M Darby SC Forastiere F Simonato L Boffetta P Secondhand smoke exposure in adulthood and risk of lung cancer among never smokers: a pooled analysis of two large studies Int J Cancer 2004 109 125 131 10.1002/ijc.11682 14735478 Lee G Walser TC Dubinett SM Chronic inflammation chronic obstructive pulmonary disease and lung cancer Curr Opin Pulm Med 2009 15 303 307 10.1097/MCP.0b013e32832c975a 19417670 Engels EA Inflammation in the development of lung cancer: epidemiological evidence Expert Rev Anticancer Ther 2008 8 605 615 10.1586/14737140.8.4.605 18402527 Kullo IJ Ding K Shameer K McCarty CA Jarvik GP Denny JC Ritchie MD Ye Z Crosslin DR Chisholm RL Manolio TA Chute CG Complement receptor 1 gene variants" | Lung_Cancer |
" In the current study how miR-21 interplays with PI3K/Akt signaling pathway under our experimental conditions is not clear. However it is reported that molecules such as PTEN have been proposed to be involved in NSCLC cells' radioresistance [36 37] and miR-21 is related to PTEN with high possibility [30 38]. In addition since PTEN PI3K and Akt are closely related it is one of the possible mechanisms that PTEN may play a role in PI3K/Akt signaling pathway mediated radiosensitization of A549 cells by miR-21 knockdown but this still needs further comfirmation in future studies. In summary the present study found that downregulation of miRNA-21 sensitized radioresistant NSCLC A549 cells to IR by inhibiting cell proliferation and enhancing apoptosis through inhibition of PI3K/Akt signaling pathway. This information may be useful to develop new treatments for the clinical therapy of NSCLC patients. Further analysis on targets of miR-21 is still of considerable interest as they may reveal novel radiotherapy sensitization strategies for radioresistant NSCLC. Conflict of Interests The authors declare that there is no conflict of interests regarding the publication of this paper. Authors' Contribution Yongfu Ma and Hui Xia contributed equally to this work. 1 Jemal A Siegel R Ward E Cancer statistics 2008 CA: Cancer Journal for Clinicians 2008 58 2 71 96 2-s2.0-41349099104 2 Siegel R Naishadham D Jemal A Cancer statistics 2012 CA: Cancer Journal for Clinicians 2012 62 1 10 29 2-s2.0-84855792427 3 Fidias P Novello S Strategies for prolonged therapy in patients with advanced non-small-cell lung cancer Journal of Clinical Oncology 2010 28 34 5116 5123 2-s2.0-78650491373 21041704 4 Fuld AD Dragnev KH Rigas JR Pemetrexed in advanced non-small-cell lung cancer Expert Opinion on Pharmacotherapy 2010 11 8 1387 1402 2-s2.0-77952119805 20446853 5 Whitehurst AW Bodemann BO Cardenas J Synthetic lethal screen " | Lung_Cancer |
"IGFBP3 is known to block IGF-1 induced activation of IGF-1R1617. Overall these studies show that the IGF-1R signaling pathway is activated by multiple mechanisms in H3122 XR cells. We evaluated the effects of IGF-1R inhibition in ALK TKI resistant cells. The combination of X-376 with either MAb391 or OSI-906 (Fig. 4de) partially restored X-376 sensitivity in H3122 XR cells. Apoptosis was also enhanced in H3122 XR cells treated with X-376 and the IGF-1R TKI AEW-54118 (Fig. 4f). In accord with these data combination treatment with ALK and IGF-1R inhibitors in H3122 XR cells inhibited AKT phosphorylation to a greater extent than either inhibitor alone (Fig. 4g). The addition of OSI-906 also partially restored the sensitivity of H3122 CR cells to the growth inhibitory effects of crizotinib (Supplementary Fig. 4c). Since IRS-1 levels were increased in H3122 XR cells (Fig. 4c) we examined whether IRS-1 knock-down would also affect signaling and proliferation in the resistant cells (Fig. 4hi). We transfected H3122 XR cells with IRS-1 or control siRNAs and then treated cells with X-376. IRS-1 knockdown sensitized these cells to the anti-proliferative effects of ALK inhibition (Fig. 4h) and resulted in a further decline in phosphorylation of downstream targets compared to X-376 alone or IRS-1 knockdown alone (Fig. 4i). Previous studies have suggested that the IGF-1R pathway can drive EGFR inhibitor resistance1920. We tested the efficacy of combined EGFR/IGF-1R inhibition in 4 different isogenic pairs of EGFR TKI- sensitive and -resistant cell lines2122 (Supplementary ). The addition of the IGF-1R TKI OSI-906 was not synergistic with the EGFR TKI erlotinib in any of these cells (Supplementary Fig. 5ad). Furthermore in contrast to the ALK TKI-resistant cells there was no increase in IGF-1R or IRS-1 in the EGFR TKI-resistant cell lines (Supplementary Fig. 5e). These data suggest that the effects seen with the ALK/IGF-1R inhibitor combinations in the ALK cell lines are true differences. Increased IGF-1R in tumor samples at the time of resistance To validate the clinical implications of our in vitro findings we evaluated phospho-IGF-1R (pIGF-1R) and IRS-1 levels in patient tumor biopsy samples. Three sets of paired pre-/post-crizotinib tumor samples as well as two post-crizotinib tumor samples from five different patients were examined by immunohistochemistry (IHC) for pIGF-1R and blindly evaluated by pathologists. As a control we also performed pIGF-1R IHC on lung cancer tissue microarrays (TMAs); representative examples are shown in Supplementary Fig. 6ac. Four of five tumor biopsies taken at the time of acquired resistance displayed increased levels of pIGF-1R (Fig. 5a patients 14). For two of the paired tumor samples we had sufficient tissue to examine IRS-1 levels by IHC (Fig. 5b); one post-treatment sample (patient 2) had increased IRS-1 expression. These five samples were also assessed for ALK kinase domain mutations associated with crizotinib resistance (Supplementary ). Patient 4's post-crizotinib tumor harbored an ALK G1202R mutation. As an orthogonal approach we performed mRNA expression analysis for IGF-1R and IRS-1 using Nanostring23 on matched patient samples and on isogenic pairs of ALK TKI-sensitive and resistant cell lines. In the one case with enough pre- and post-treatment tissue for available for analysis IGF-1R and IRS-1 (Fig. 5cd) mRNA levels were increased in the post-crizotinib relative to the pre-crizotinib tumor sample. Similar results were obtained with the cell lines. In contrast Nanostring analysis of 11 matched pairs of EGFR mutant lung tumor biopsies revealed no significant change in IRS-1 levels post EGFR TKI therapy (Supplementary Fig. 6df) suggesting that the changes observed in IRS-1 were specific to ALK+ lung cancer. Overall these data validate our pre-clinical findings showing that levels of IGF-1R and IRS-1 can be increased post ALK TKI therapy in patient-derived samples. LDK-378 inhibits phosphorylation of ALK and IGF-1R in vitro The second-generation ALK TKI LDK-378 (ceritinib) has demonstrated a 56% ORR in patients with ALK+ lung cancer who have progressed on crizotinib24. Yet only a minority of patients had ALK alterations suggesting the possibility of alternative bypass mechanisms which are sensitive to LDK-378. Interestingly LDK-378 and the structurally related ALK inhibitor TAE-684 can inhibit both ALK and IGF-1R in vitro25. We hypothesized that the efficacy of LDK-378 may be due to this drug's ability to simultaneously block both ALK and IGF-1R. LDK-378 was more potent than crizotinib in H3122 (Fig. 6a) STE-1 (Supplementary Fig. 7a) and H3122 XR cells (Supplementary Fig. 7b). LDK-378 was also more potent at inducing apoptosis in H3122 cells (Supplementary Fig. 7c). Furthermore LDK-378 was significantly more effective at delaying the growth of H3122 xenografts compared to the equivalent dose crizotinib (Fig. 6b). Next we tested LDK-378's ability to inhibit IGF-1R phosphorylation. H3122 (Fig. 6c) and H2228 (Fig. 6d) cells were treated with LDK-378 alone or in combination with IGF-1. Importantly LDK-378 treatment inhibited ALK phosphorylation and was also able to overcome the IGF-1 ligand induced increase in IGF-1R phosphorylation in both ALK+ cell lines (Figures 6cd compare lanes 4 and 6). These data suggest that LDK-378's potency in vivo may be due to this agent's combined ability to block both ALK and IGF-1R. Discussion We report that ALK and IGF-1R inhibitors have cooperative anti-proliferative effects. IGF-1R inhibitors sensitized tumor cells to the effects of ALK inhibition. The therapeutic synergism between ALK and IGF-1R inhibitors was observed in both the ALK TKI-sensitive and ALK TKI-resistant settings. Chronic ALK inhibition was associated with enhanced IGF-1R signaling. The ALK TKI resistant cells utilized numerous mechanisms to activate IGF-1R signaling. Importantly the addition of an IGF-1R inhibitor sensitized the resistant cells to the effects of ALK blockade. We propose drug combinations co-targeting ALK and IGF-1R as a novel therapeutic approach in patients with ALK+ lung cancer. This rationally selected combination of targeted therapies should be effective in both the ALK TKI-na¯ve and TKI-resistant setting. Our data may also in part explain the surprising 56% ORR for the second generation ALK TKI LDK-378 in patients with ALK+ lung cancer who had progressed on crizotinib24. Since responses to LDK-378 were observed in both patients with and without second-site ALK mutations the increased on-target potency of LDK-378 towards ALK is alone not enough to explain all of the responses seen to this agent. We hypothesize that the potency of this agent is due to its ability to simultaneously inhibit both ALK and IGF-1R and our in vitro experiments confirm that LDK-378 does inhibit phosphorylation of both ALK and IGF-1R. Further studies will be necessary to validate this hypothesis in clinical samples. Mechanisms of acquired resistance to ALK inhibitors are just beginning to be understood. Target alterations have only been found in a minority of resistant tumors examined to date. Bypass signaling has also been reported3-6. Interestingly target alterations and bypass signaling do not appear to be mutually exclusive." | Lung_Cancer |
"METHODS These experiments were conducted on left lungs (n = 6) taken from freshly slaughtered pigs. The laser and the monopolar cutter were fixed in a hydraulic mover. The laser was focused at a distance of 3 cm to the lung tissue and the monopolar cutter was fixed in pressure-free contact with the lung surface. Both instruments were manoeuvred at a speed of 5 10 and 20 mm/s in a straight line at an output of 100 watts over the lung surface. The lung lesions that ensued were then examined macro- and microscopically. The same procedures were repeated at a distance of 1 cm creating parallel lesions in order to analyse the lung tissue in between the lesions for thermal damage. In addition two implanted capsules in the lung tissue simulating a lung nodule were resected with either the laser or the monopolar cutter. The resection surfaces were then examined by magnetic resonance imaging and histology for tissue damage. Finally we created a 2-cm wide mark on the lung surface to test the resection capacity of both instruments within 1 min. RESULTS The laser created sharply delineated lesions with a vaporization and coagulation zone without thermal damage of the surrounding lung tissue. With lowering the working speed each zone was extended. At a working speed of 10 mm/s the mean vaporization depth using the laser was 1.74 ± 0.1 mm and the mean coagulation depth was 1.55 ± 0.09 mm. At the same working speed the monopolar cutter demonstrated a greater cutting effect (mean vaporization depth 2.7 ± 0.11 mm; P < 0.001) without leaving much coagulation on the resection surface (mean coagulation depth 1.25 ± 0.1 mm; P = 0.002). In contrast to the laser the monopolar cutter caused thermal damage of the adjacent lung tissue. The adjacent tissue injury was detected in histological examination as well as in the MRI findings. Adjacent lung tissue after lung metastasectomy using the monopolar cutter was hyper-intensive in T2-weighted MR imaging indicating a severe tissue damage. No significant changes in signal intensity were observed in T2-weighted imaging of the adjacent lung tissue after using the laser for lung resection. One minute of laser applied at a 100-watt output penetrated a lung surface area of 3.8 ± 0.4 cm2 compared with 4.8 ± 0.6 cm2 of surface after application of the monopolar cutter (P = 0.001). S The monopolar cutter possesses indeed a greater cutting capacity than the laser but it also causes more adjacent tissue injury. Thus laser resection might be preferred for lung metastasectomy. Electrosurgical scalpel Laser Lung metastases Lung resection Tissue damage BMC Urol BMC Urol BMC Urology 1471-2490 BioMed Central 24612599 3975282 1471-2490-14-26 10.1186/1471-2490-14-26 Research an-specific and tumor-size-dependent responses to sunitinib in clear cell renal cell carcinoma Tsuchiya Norihiko 1 tsuchiyamed.akita-u.ac.jp Yuasa Takeshi 2 takeshi.yuasajfcr.or.jp Maita Shinya 1 yamightyyahoo.co.jp Narita Shintaro 1 narishindoc.med.akita-u.ac.jp Inoue Takamitsu 1 takamitudoc.med.akita-u.ac.jp Numakura Kazuyuki 1 numakuradoc.med.akita-u.ac.jp Saito Mitsuru 1 mitsaitomed.akita-u.ac.jp Satoh Shigeru 1 shigerusdoc.med.akita-u.ac.jp Yonese Junji 2 jyonesejfcr.or.jp Habuchi Tomonori 1 thabuchidoc.med.akita-u.ac.jp 1Department of Urology Akita University Graduate School of Medicine Akita Japan 2Department of Urology Cancer Institute Hospital Japanese Foundation for Cancer Research Tokyo Japan 2014 11 3 2014 14 26 26 20 7 2013 28 2 2014 Copyright 2014 Tsuchiya et al.; licensee BioMed Central Ltd. 2014 Tsuchiya et al.; licensee BioMed Central Ltd. This is an Open Access distributed under the terms of the Creative Commons Attribution License (http://creativecommons./licenses/by/2.0) which permits unrestricted use distribution and reproduction in any medium provided the original work is properly credited. Background Tyrosine kinase inhibitors (TKIs) have been used as standard therapy for patients with advanced renal cell carcinoma (RCC). However information on factors predicting response to treatment with TKIs is lacking. This study aimed to assess the association between initial tumor size involved ans pre-treatment C-reactive protein (CRP) levels and reduction in tumor size in patients with clear cell RCC (CCRCC) treated with sunitinib. Methods Patients with advanced CCRCC with target lesions with a maximum diameter???10 mm treated with sunitinib were evaluated. The tumor diameter representing the best overall response was designated as the post-treatment tumor diameter. Results A total of 179 lesions in 38 patients were analyzed. an-specific analysis demonstrated that pre-treatment diameter of lung metastatic lesions had a moderate inverse association with percent reduction in post-treatment tumor diameter (R?=?0.341). Lung lesions showed significantly greater percent reductions in diameter than liver and kidney lesions (P?=?0.007 and 0.002 respectively). Furthermore based on a CRP cut-off level of 2.0 mg/dl mean tumor size reduction was significantly greater in patients with low CRP levels than in patients with high CRP levels in lesions with diameters?<?20 mm (P?=?0.002). CRP level had no effect on mean size reduction in lesions with a diameter???20 mm. Conclusions Patients with CCRCC with smaller lung metastatic lesions and lower CRP levels may achieve greater percent reductions in tumor size with sunitinib therapy than patients with extra-pulmonary lesions large lung lesions and/or higher CRP levels. Advanced renal cell carcinoma Sunitinib Tumor size Tumor response C-reactive protein Background In the era of cytokine therapy tumor response to treatment in advanced or metastatic renal cell carcinoma (RCC) has been reported to vary according to the ans involved [12]. Longer overall survival and a higher response rate to therapy with interferon-? or a combination of interleukin-2 and interferon-? were observed in patients with only lung metastasis compared with those with extra-pulmonary metastasis [12]. Complete remission (CR) after treatment with tyrosine kinase inhibitors (TKIs) which mainly target vascular endothelial growth factor receptors remains a rare event but most patients who do achieve CR have either lung metastasis alone or only lymph node involvement [34]. However most cancer clinical trials evaluate tumor response using the response evaluation criteria in solid tumors (RECIST) in which the longest diameters of target lesions in multiple ans are summed. Tumor response in individual metastatic lesions in specific ans has not been delineated. A reduction in tumor size >10% calculated as the sum of the longest diameter of the target lesions was significantly associated with both time to treatment failure and overall survival suggesting that size reduction of target lesions may predict the outcome of treatment with TKIs [5]. In addition Yuasa et al. recently demonstrated that a smaller initial tumor size predicted a good response to TKIs and that the maximum response was achieved in lung lesions [6]. TKIs have shown significant clinical benefit in advanced clear cell RCC (CCRCC) in large randomized trials [7-9]. However the reported objective responses vary according to the different types of TKIs and a recent phase II trial failed to demonstrate any clinical efficacy of sunitinib in non-CCRCC [10]. Tumor size reduction may thus be affected by many factors including initial tumor size involved ans tumor histology tumor aggressiveness or type of TKI used. In this study we evaluated the association between initial tumor size of individual lesions in specific ans and reduction in tumor size in patients with CCRCC treated with sunitinib. Methods Patients and tumor measurement A total of 38 patients with advanced CCRCC who received at least two cycles of sunitinib at Akita University Hospital and at the Cancer Institute Hospital of the Japanese Foundation for Cancer Research were enrolled in this institutional review-board-approved retrospective study. Pathological diagnosis was made by radical nephrectomy in 30 patients and by percutaneous biopsy in eight patients who were not indicated for surgical treatment because of a significantly higher total volume of metastatic lesions compared with the primary lesion. The initial dose of sunitinib was 50 mg/day which was reduced to 37.5 mg/day based on the patients physique age and performance status. Sunitinib was initiated on a 28 days on/14 days off schedule and a dose reduction to 25 mg/day or complete cessation was considered in the event of grade 3 or higher toxicity according to the Common Terminology Criteria for Adverse Events (CTC-AE). All lesions were evaluated using a multidetector computed tomography scanner and lesions???10 mm in diameter were considered target lesions. The maximum diameter of each target lesion was measured before treatment with sunitinib (pre-treatment tumor diameter) and every 23 months thereafter. The tumor diameter at the point when best overall response was achieved based on the RECIST version 1.0 was adopted as the post-treatment tumor diameter. In this study the most common metastatic ans including lung liver and lymph nodes as well as the kidney were subjected to analysis. Statistical analysis The association between pre-treatment tumor diameter and percent change between pre- and post-treatment tumor diameters for each lesion was assessed by Pearsons correlation coefficient. The Kruskal Wallis test was used to compare differences in percent change in tumor diameter between the four different ans. The MannWhitney U test was used to compare differences between two groups. A receiver-operator curve (ROC) was constructed to find the pre-treatment tumor diameter predicting tumor response to sunitinib treatment. A value of P?<?0.05 was considered statistically significant. Results Patients and target lesions The patients included 30 men and eight women with a median age of 62 years (range 2781 years). The patients characteristics are listed in Table 1. The best response to sunitinib treatment was CR in one patient (3%) partial response (PR) in 11 (29%) stable disease (SD) in 23 (61%) and progressive disease (PD) in three (8%). The objective response rate was 32% and the clinical benefit rate (CR?+?PR?+?SD for at least 3 months) was 92%. A total of 179 lesions ranging from 10 to 106 mm were measured and analyzed in 38 patients. These lesions were localized as follows: 124 in the lung 12 in the liver 24 in the lymph nodes and 19 in the kidney. Of the 15 patients with kidney tumors seven who underwent nephrectomy had target lesions in the contralateral kidney including two patients with multiple lesions. The remaining eight patients had primary kidney tumors that were diagnosed by percutaneous needle biopsy. Table 1 Patients characteristics Characteristic No. of patients (%) Sex ??Male 30 (78.9) ??Female 8 (21.1) Age y ??Median [range] 62 [2781] ECOG performance status ??0 25 (65.8) ??1 7 (18.4) ??> 1 6 (15.8) MSKCC risk category ??Favorable 8 (21.1) ??Intermediate 20 (52.6) ??Poor 10 (26.3) Target ans ??Lung 31 (81.6) ??Liver 6 (15.8) ??Lymph node 11 (28.9) ??Kidney 15 (39.5) Nephrectomy ??Yes 30 (78.9) ??No (biopsy) 8 (21.1) Prior treatments ??None 27 (71.1) ??Cytokines alone 4 (10.5) ??Sorafenib?±?cytokines 7 (18.4) Associations between pre-treatment tumor diameter and percent change in target lesion size in different ans The associations between pre-treatment tumor diameter and percent change in size of each target lesion in each of four ans were analyzed separately. an-specific analysis demonstrated that pre-treatment diameter of lung metastatic lesions had a moderately positive association with percent change in post-treatment tumor diameter (R?=?0.341 Figure 1). There were fewer target lesions in the other three ans than in the lung and there was no association between liver lymph node or kidney lesion size and percent change in post-treatment tumor diameter (Figure 1). The percent changes in target lesion size differed significantly between the four individual ans (P?=?0.0007 by the Kruskal Wallis test). The mean (± SD) percent changes in target lesion size in the lung liver lymph nodes and kidney were ?27.1?±?33.5 0.5?±?29.4 ?16.7?±?19.6 and ?2.7?±?21.7 respectively. Target lesions in the lung showed the greatest change in size which was significantly greater than in the liver and kidney (P?=?0.007 and 0.002 respectively). There was no difference in the percent change in target lesion size between the lung and lymph nodes (P?=?0.114) (Figure 2). Figure 1 Association between pre-treatment tumor size and percent change in lesion size after sunitinib treatment. Association between pre-treatment tumor size and percent change in size was analyzed for lesions in the lung (a) liver (b) lymph nodes (c) and kidney (d). The pre-treatment size of lung lesions showed a moderately positive association with percent size change after treatment with sunitinib while no association was observed in the liver lymph nodes and kidney. Figure 2 Percent change in target lesion size in different ans. The reduction in lesion size was significantly greater in lung lesions compared with liver and kidney lesions. Lung lesions with an initial diameter?<?17.3 mm (median) showed a significant percent reduction in size compared with lesions???17.3 mm. No significant differences in relation to initial lesion size were observed in the liver lymph nodes and kidney. Lesions in each an were divided into two groups according to the median pre-treatment diameter and percent changes in tumor diameter were compared between the two groups. Lung lesions with a pre-treatment diameter less than the median value of 17.3 mm showed a significant percent reduction in diameter compared with tumors???17.3 mm (P?=?0.002). There were no differences in the percent change in relation to size above or below the median value in other ans (Figure 2). Cut-off value for pre-treatment tumor diameter predicting response to sunitinib in lung metastasis ROC curves were drawn to determine cut-off values predicting 30% and 50% reductions in the diameter of lung metastatic lesions (Figure 3). The cut-off predicting a 30% reduction in diameter was 16.5 mm with a sensitivity of 69.6% specificity of 58.2% and an area under the curve (AUC) of 0.662. The cut-off predicting a 50% reduction in diameter was also 16.5 mm with a sensitivity of 67.0% specificity of 77.8% and an AUC of 0.752. Using this cut-off value the percent change in lesion size for lesions?<?16.5 mm was ?41.7?±?35.5% while that for lesions???16.5 mm was ?16.2?±?26.9% (P?=?0.0005). Figure 3 Cut-off values of initial lung tumor size for predicting 30% and 50% reductions in diameter after sunitinib treatment. Based on ROC analysis the cut-off values of initial lung lesion size for predicting reductions in diameter of both 30% and 50% were 16.5 mm. Influence of pre-treatment CRP value cytoreductive nephrectomy and treatment line on percent change in target lesion size in the lung Metastatic lung lesions were categorized into two groups based on pre-treatment C-reactive protein (CRP) levels. The mean diameter and percent change in lesion size in patients with CRP?<?2.0 mg/ml were 19.0?±?9.3 mm and ?38.3?±?30.5% respectively while those in patients with CRP???2.0 mg/ml were 28.3?±?20.6 mm and ?9.6?±?33.9% respectively. The lesions were further divided into three subgroups according to pre-treatment diameter?<?20 mm ? 20 to?<?40 mm and???40 mm. Percent changes were compared between lesions in patients with CRP?<?2.0 mg/dl (low CRP) and those with CRP???2.0 mg/dl (high CRP) in each subgroup. For lesions?<?20 mm patients with low CRP had significantly greater reductions in tumor diameter than patients with high CRP (?43.8?±?33.4% vs. ?15.3?±?37.7% P?=?0.0019). In patients with lesions ?20 to?<?40 mm there was a tendency towards a greater reduction in patients with low CRP compared with high CRP though the difference was not significant (?29.0?±?17.3% vs. ?12.4?±?30.2% P?=?0.054) and similarly there was no significant association between tumor reduction and CRP level in patients with lesions???40 mm (?13.3?±?20.6 vs. 6.8?±?17.4 P?=?0.151) (Figure 4). Figure 4 Influence of CRP on percent change in lung lesion size. In patients with lung lesions?<?20 mm the percent reduction in size was significantly greater in patients with low compared with high CRP levels. Meanwhile CRP level had a marginal effect on size reduction in lesions???20 to?<?40 mm and no effect in lesions???40 mm. Percent changes in size were compared between lung lesions in patients in each diameter subgroup who did and did not undergo cytoreductive nephrectomy. There were no lung lesions???40 mm in patients who did not undergo cytoreductive nephrectomy. There was no significant difference between mean percent change in lesion size in patients with and without cytoreductive nephrectomy (?36.1?±?32.6 vs. ?28.2?±?41.9 P?=?0.421 and ?20.4?±?25.1 vs. ?32.0?±?21.9 P?=?0.307 in lesions?<?20 mm and???20 mm respectively). Similarly there was no significant difference in percent change in lesion size between lung lesions in patients treated as first-line therapy and those treated as second-line or later therapy in any diameter subgroup (?38.1?±?37.7 vs. ?32.1?±?33.9 P?=?0.280; ?23.5?±?21.6 vs. ?17.5?±?23.3 P?=?0.803; and 3.5?±?2.6 vs. 1.9?±?22.9 P?>?0.9 in lesions?<?20 mm ? 20 to?<?40 mm and???40 mm respectively). Discussion A previous study on metastatic RCC by Yuasa et al. demonstrated that: 1) smaller initial tumor size predicted a good response to TKIs; 2) the greatest response was achieved in patients with lung lesions; and 3) there was no difference in tumor response between patients treated with sorafenib and sunitinib [6]. However these results raised several specific questions. First tumor histology and progression risk may affect the response to TKIs. TKIs are associated with a good response in patients with CCRCC but are less effective against non-CCRCC [10]. Similarly patients with favorable risk factors have a greater chance of a good tumor response than those with poorer risk factors. Second there is the possibility of bias in terms of the types of TKI selected; given that sunitinib showed a higher response rate than sorafenib [78] patients with larger or more rapidly-growing tumors may be allocated sunitinib rather than sorafenib in clinical practice. Third efficacy based on initial tumor size may differ between different ans; although the previous study compared mean lesion-size reductions between different ans they did not compare the effect of initial tumor size in individual ans. It is therefore unclear if the association between initial lesion size and tumor response was observed in each an or if the association could be attributed to the fact that most of the small lesions were lung metastases which showed a good response to TKIs. The current study only included CCRCC patients treated with sunitinib. We found that lung lesions showed the greatest response to sunitinib and detected a modest correlation between initial tumor diameter and reduction in lesion size while even small lesions in other ans failed to respond. However the number of extra-pulmonary tumors assessed was too small to determine statistical significance and further studies with larger numbers of tumors are needed to obtain conclusive results. Only lesions with an initial diameter?<?20 mm achieved a CR in this study indicating that a lung-tumor reduction of?>?50% might be limited to smaller lesions. The cut-off value of 16.5 mm for a?>?50% reduction in diameter was calculated using ROC analysis with a sensitivity of 67.0% and a specificity of 77.8%. Some physicians may prefer conservative therapies without TKIs or a watchful waiting strategy in CCRCC patients with only small lung metastatic lesions [11]. Furthermore cytokine therapies are still employed in CCRCC patients especially in Japan because of their low toxicity and ability to achieve long-term stable disease [12]. However the present results suggest that smaller lung lesions are associated with a greater chance of response to TKIs and it is therefore important not to miss the opportunity for early initiation of TKI treatment in patients with PD during watchful waiting periods or cytokine therapy. Several studies have investigated the response of primary kidney lesions to TKIs [13-15]. Kroon et al. reported that smaller primary lesions were more responsive to treatment and that tumors of 57 cm may benefit from neoadjuvant treatment followed by nephron-sparing surgery. In contrast our results showed that the response of kidney lesions to sunitinib was independent of initial tumor size and many smaller lesions exhibited no response. A possible explanation for this difference may be the selection of patients; most of the kidney lesions were investigated in the neoadjuvant setting in Kroon et al.s study while all the patients with kidney lesions in the current study had an extensive metastatic tumor burden. The different patient backgrounds may have led to different responses to TKIs particularly in small kidney lesions. CRP is an acute phase protein produced by the liver in response to various conditions such as inflammation infection and malignancy [16]. In the cytokine era elevated serum CRP level has been suggested as a biomarker for predicting poor survival in RCC patients [17-19]. Yasuda et al. recently demonstrated that CRP was a significant predictive marker for prognosis in metastatic RCC patients treated with TKIs [20]. In the current study the size reduction of lung lesions in patients with high serum CRP levels was lower than that in patients with low CRP levels irrespective of the initial size. This lower response to sunitinib in patients with higher serum CRP levels may be attributed to an aggressive disease status reflected by higher CRP levels the acquisition of resistance to therapeutic agents through an increase in inflammatory mediators in the cancer-cell microenvironment or compromised drug metabolism induced by such mediators associated with CRP [21]. Tumor response to treatment is currently assessed by imaging based on RECIST criteria [22]. However although marked central necrosis is often detected in lesions with a small size reduction after treatment with TKIs RECIST only considers one-dimensional lesional size changes suggesting that it may substantially underestimate the actual tumor response. Several studies recently reported novel criteria which may improve response assessment by evaluating changes in tumor attenuation and morphology on contrast-enhanced computed tomography scans in addition to size changes [522-26]. The results of this study therefore need to be interpreted carefully because lesions in different ans may exhibit distinct response patterns in imaging. Moreover the current study did not demonstrate an association between tumor response and patient survival and it is possible that percent change in tumor size might not correlate directly with survival. Further studies are needed to determine the influence of an-specific response patterns to TKI treatment on survival. Conclusions The results suggest that tumor-size reduction depends on initial tumor size and the ans involved as well as systemic reaction to the lung tumor as indicated by CRP levels. CCRCC patients with lung metastatic lesions?<?20 mm in diameter and lower CRP levels may achieve greater reductions in tumor size with sunitinib therapy than those with extra-pulmonary lesions lung lesions???20 mm in diameter" | Lung_Cancer |
" This delay was largely influenced by the interests of Metropolitan Life Insurance Company (MetLife) and other asbestos mining and product manufacturing companies. Objectives: To understand the ongoing corporate influence on the science and politics of asbestos and silica exposure including litigation defense strategies related to historical manipulation of science. Methods: We examined previously secret corporate documents depositions and trial testimony produced in litigation; as well as published literature. Results: Our analysis indicates that companies that used and produced asbestos have continued and intensified their efforts to alter the asbestoscancer literature and utilize dust-exposure standards to avoid liability and regulation. anizations of asbestos product manufacturers delayed the reduction of permissible asbestos exposures by covering up the link between asbestos and cancer. Once the decline of the asbestos industry in the US became inevitable the companies and their lawyers designed the state of the art (SOA) defense to protect themselves in litigation and to maintain sales to developing countries. Conclusions: Asbestos product companies would like the public to believe that there was a legitimate debate surrounding the dangers of asbestos during the twentieth century particularly regarding the link to cancer which delayed adequate regulation. The asbestoscancer link was not a legitimate contestation of science; rather the companies directly manipulated the scientific literature. There is evidence that industry manipulation of scientific literature remains a continuing problem today resulting in inadequate regulation and compensation and perpetuating otherwise preventable worker and consumer injuries and deaths. asbestos mesothelioma state-of-the-art corporate corruption MetLife industry knowledge 9421547 4136 Hum Pathol Hum. Pathol. Human pathology 0046-8177 1532-8392 24746212 4271837 10.1016/j.humpath.2014.01.003 NIHMS648391 Y-chromosome status identification suggests a recipient origin of posttransplant nonsmall cell lung carcinomas: chromogenic in situ hybridization analysis??? Chen Wei MD PhD a Brodsky Sergey V. MD PhD a Zhao Weiqiang MD PhD a Otterson Gregory A. MD b Villalona-Calero Miguel MD b Satoskar Anjali A. MD a Hasan Ayesha MD b Pelletier Ronald MD c Ivanov Iouri MD PhD a Ross Patrick MD PhD c Nadasdy Tibor MD a Shilo Konstantin MD a * aDepartment of Pathology The Ohio State University Wexner Medical Center Columbus OH 43210 bDepartment of Medicine The Ohio State University Wexner Medical Center Columbus OH 43210 cDepartment of Surgery The Ohio State University Wexner Medical Center Columbus OH 43210 *Corresponding author. Department of Pathology The Ohio State University Wexner Medical Center E412 Doan Hall 450 West 10th Ave Columbus OH 43210. Konstantin.ShiloOSUMC.edu (K. Shilo) 13 12 2014 23 1 2014 5 2014 19 12 2014 45 5 1065 1070 2014 Elsevier Inc. All rights reserved. 2014 Summary Owing to the need of lifelong immunosuppression solid-an transplant recipients are known to have an increased risk of posttransplant malignancies including lung cancer. Posttransplant neoplastic transformation of donor-derived cells giving rise to hematopoietic malignancies Kaposi sarcoma and basal cell carcinoma in nongraft tissues has been reported. The goal of this study was to assess the cell origin (donor versus recipient derived) of posttransplant nonsmall cell lung carcinomas (NSCLCs) in kidney and heart transplant recipients. An institutional database search identified 2557 kidney and heart transplant recipients in 8 consecutive years. Among this cohort 20 (0.8%) renal and 18 (0.7%) heart transplant recipients developed NSCLC. The study cohort comprised 6 of 38 NSCLCs arising in donor-recipient sex-mismatched transplant patients. The tumor cell origin was evaluated by chromogenic in situ hybridization with Y-chromosome probe on formalin-fixed paraffin-embedded tissues. Y-chromosome was identified in 97% ± 1% (range from 92% to 99%) of all types of nucleated cells in male control tissues. In all 5 NSCLCs from male recipients of female donor an Y-chromosome was identified in 97% ± 2% (range from 92% to 100%) of tumor cells statistically equivalent to normal control (P < .001). No Y-chromosome was identified in NSCLC cells from a female recipient of male kidney. These findings suggest a recipient derivation of NSCLC arising in kidney and heart transplant recipients. A combination of histologic evaluation and chromogenic in situ hybridization with Y-chromosome analysis allows reliable determination of tissue origin in sex-mismatched solid-an transplant recipients and may aid in management of posttransplant malignancy in such cases. Postsolid-an transplantation lung cancer Chromogenic in situ hybridization for Y-chromosome 15030100R 648 Ann Thorac Surg Ann. Thorac. Surg. The Annals of thoracic surgery 0003-4975 1552-6259 24576597 4008142 10.1016/j.athoracsur.2013.12.043 NIHMS571118 Accuracy of FDG-PET within the clinical practice of the ACOSOG Z4031 trial to diagnose clinical stage I NSCLC Grogan Eric L. MD MPH a b c Deppen Stephen A. MA MS PhD b c * Ballman Karla V. f Andrade Gabriela M. b Verdial Francys C. b Aldrich Melinda C. b d Chen Chiu L. e Decker Paul A. f Harpole David H. MD g Cerfolio Rrobert J. MD h Keenan Robert J. MD i Jones David R. MD j DAmico Thomas A. MD g Shrager Joseph B. MD k Meyers Bryan F. MD l Putnam Joe B. Jr. MD a b aVeterans Affairs Medical Center Nashville TN bDepartment of Thoracic Surgery; Department of Medicine Vanderbilt University Medical Center Nashville TN cInstitute for Medicine and Public Health Vanderbilt University Medical Center Nashville TN dDivision of Epidemiology Vanderbilt University Medical Center Nashville TN eCenter for Quantitative Sciences Vanderbilt University Medical Center Nashville TN fDivision of Biomedical Statistics and Informatics Mayo Clinic Rochester MN gDepartment of Surgery Duke University Durham NC hDepartment of Surgery University of Alabama Birmingham AL iDepartment of Surgery Allegheny General Hospital Pittsburgh PA jDepartment of Surgery University of Virginia Charlottesville VA kDepartment of Surgery Stanford University Stanford CA lDepartment of Surgery Washington University St. Louis MO Corresponding Author/Request for Reprints: Eric Grogan M.D. M.P.H. Department of Thoracic Surgery 609 Oxford House 1313 21st Ave. South Nashville TN 37232 Phone: 615-322-0064 Fax: 615-343-9194 eric.groganvanderbilt.edu * Equal shared co-first author 23 4 2014 25 2 2014 4 2014 01 4 2015 97 4 1142 1148 2014 The Society of Thoracic Surgeons. Published by Elsevier Inc. All rights reserved. 2014 Background Fluoro-deoxyglucose positron emission tomography (FDG-PET) is recommended for diagnosis and staging of NSCLC. Meta-analyses of FDG-PET diagnostic accuracy demonstrated sensitivity and specificity of 96% and 78% respectively but were performed in select centers introducing potential bias. This study evaluates the accuracy of FDG-PET to diagnose NSCLC and examines differences across enrolling sites in the national ACOSOG Z4031 trial. Methods 959 eligible patients with clinical stage I (cT1-2N0M0) known or suspected NSCLC were enrolled between 2004 and 2006 in the Z4031 trial and 682 had a baseline FDG-PET. Final diagnosis was determined by pathological examination. FDG-PET avidity was categorized into four levels based on radiologist description or reported maximum standard uptake value (SUV). FDG-PET diagnostic accuracy was calculated for the entire cohort. Accuracy differences based on preoperative size and by enrolling site were examined. Results Preoperative FDG-PET results were available for 682 participants enrolled at 51 sites in 39 cities. Lung cancer prevalence was 83%. FDG-PET sensitivity was 82% (95% CI: 7985) and specificity was 31% (95% CI: 23%40%). Positive and negative predictive values were 85% and 26% respectively. Accuracy improved with lesion size. Of 80 false positive scans 69% were granulomas. False negative scans occurred in 101 patients with adenocarcinoma being the most frequent (64%) and eleven were ?10mm. The sensitivity varied from 68% to 91% (p=0.03) and the specificity ranged from 15% to 44% (p=0.72) across cities with > 25 participants. Conclusions In a national surgical population with clinical stage I NSCLC FDG-PET to diagnose lung cancer performed poorly compared to published studies. Tumour Biol Tumour Biol Tumour Biology 1010-4283 1423-0380 Springer Netherlands Dordrecht 24510347 4053595 1674 10.1007/s13277-014-1674-x Research The diagnostic and prognostic value of serum human kallikrein-related peptidases 11 in non-small cell lung cancer Xu Chun-Hua Zhang Yu Yu Li-Ke +86-25-8372-8558 +86-25-83728558 yulike_doctor163.com Department of Respiratory Medicine Nanjing Chest Hospital 215 Guangzhou Road Nanjing 210029 China Nanjing Clinical Center of Respiratory Diseases Nanjing China 9 2 2014 9 2 2014 6 2014 35 6 5199 5203 6 12 2013 22 1 2014 The Author(s) 2014 Open Access This is distributed under the terms of the Creative Commons Attribution License which permits any use distribution and reproduction in any medium provided the original author(s) and the source are credited. The aim of this study was to explore the diagnostic and prognostic value of serum human kallikrein-related peptidases 11 (KLK11) level in non-small cell lung cancer (NSCLC). Serum specimens from 138 patients with NSCLC and 40 healthy controls were collected. The concentration of KLK11 was measured by enzyme-linked immunosorbent assay (ELISA). The concentration of KLK11 in NSCLC was significantly higher compared to that in the controls (P?<?0.01). The serum KLK11 levels decreased with stage presence of lymph node and distant metastases regardless of histology age and sex. With a cutoff point of 1.05 ng/ml KLK11 showed a good diagnostic performance for NSCLC. Univariate analysis revealed that NSCLC patients with serum high KLK11 had a longer overall survival (OS) and progression-free survival (PFS) than those with low KLK11 (HR of 0.36 P?=?0.002; HR of 0.46 P?=?0.009). Cox multivariate analysis indicated that KLK11 was an independent prognostic indicator of PFS and OS (HR of 0.53 P?=?0.042; HR of 0.48 P?=?0.037). KaplanMeier survival curves further confirmed that patients with high KLK11 have longer PFS and OS (P?=?0.003 and P?=?0.018 respectively). In conclusion the measurement of KLK11 might be a useful diagnostic and prognostic test for NSCLC patients. Keywords Kallikrein-related peptidases 11 Non-small cell lung cancer Diagnosis Prognosis issue-copyright-statement International Society of Oncology and BioMarkers (ISOBM) 2014 Introduction Lung cancer is the leading cause of cancer-related death worldwide with more than 1.2 million deaths each year [1]. Non-small cell lung cancer (NSCLC) accounts for 8085 % of total lung malignancies [2]. Although advances in noninvasive methods have improved our ability to detect lung cancer more than 75 % of lung cancer patients present an advanced stage of disease [3] and they have little prospect of effective and curative treatment with 5-year survival rates of less than 15 % [4]. Tumor markers play a key role in patient management for many malignancies. The potential uses of serum tumor markers include aiding early diagnosis determining prognosis prospectively predicting response or resistance to specific therapies and monitoring therapy in patients with advanced disease. Kallikrein-related peptidases 11 (KLK11) is a member of the human kallikrein gene family which localized on chromosome 19q13.4 [5]. Recent studies have reported that KLK11 has been expressed in many cancers including prostate cancer [6] ovarian cancer [7] gastric cancer [8] as well as rectal carcinoma [9]. An immunofluorometric assay study demonstrated that KLK11 expression in ovarian cancer tissues is a marker of favorable prognosis since patients with KLK-positive tumors exhibit a longer progression-free survival (PFS) and overall survival (OS) [10]. Additionally Sasaki et al. [11] reported that lower KLK11 mRNA expression in lung cancer is an indicator of poor prognosis in patients with lung cancer. However there seems to be a paucity of research concerned with serum KLK11 expression in NSCLC. For this reason the goal of the present study was to investigate the baseline serum levels of KLK11 in patients with NSCLC to determine its potential diagnostic and prognostic roles. Materials and methods Patients A total of 138 patients with NSCLC were examined at the Nanjing Chest Hospital between January 2006 and May 2008. The cohort of patients included 80 (58.0 %) male and 58 (42.0 %) female subjects with a median age of 56 years (range 4568 years). The clinical features of the patients are summarized in Table 1. Follow-up lasted through December 2012 with a median follow-up period of 22 months for living patients (range 380 months). PFS was defined as the time interval between the date of diagnosis and the date of disease relapse. OS was defined as the time interval between the date of diagnosis and the date of death.Table 1Clinical characteristics of NSCLC patients and controlsVariablesNSCLCControl P valueSubject no.13840Age year57.8?±?10.254.6?±?7.80.614Male/Female80/5826/140.325Histology?AC78?SCC60 AC adenocarcinoma SCC squamous cell carcinoma The diagnosis of lung cancer was made using various methods: sputum cytology fine-needle aspiration or bronchoscopy as dictated by the patients presentation. Pathologists interpreted the cytology or histology of tissue biopsy. Lung cancer was staged using a widely used classification system and the staging procedure included a clinical examination; CT of the chest abdomen and brain; abdominal ultrasonography; bone scanning; and positron emission tomography. The study protocol was approved by the ethics committee of Nanjing Chest Hospital. All patients provided written informed consent before enrollment. Measurement of serum KLK11 levels Serum samples from each individual were obtained at the time of diagnosis before any therapeutic measures were started (surgery chemotherapy or radiation). Samples were centrifuged at 1500Ãg for 10 min at ?4 °C. The supernatant was stored at ?80 °C for assessment of the levels of KLK11. The KLK11 concentration was determined by ELISA with the commercial KLK11 ELISA Ready-SET-Go kit (eBioscience San Diego CA). All samples were blinded to the technologists running the assays and the code was broken to the statisticians after the database was constructed. Statistical analysis Statistical software (SPSS for Windows version 18) was used for the analysis. Differences between independent groups were examined by the MannWhitney U test. To determine the diagnostic accuracy of KLK11 receiver operating characteristic (ROC) curves were retrieved from logistic regression analysis and the area under the curve (AUC) was calculated. Univariate survival analysis was performed using the KaplanMeier method and the log-rank test. Multivariate analysis was conducted to determine an independent impact on survival using the Cox proportional hazard method. P?<?0.05 was considered statistically significant. Results Comparison of serum KLK11 levels between NSCLC patients and controls As shown in Fig. 1 the concentration of KLK11 was significantly higher in patients with NSCLC (2.04?±?0.86 ng/ml) than in those with the controls (0.93?±?0.52 ng/ml) (P?<?0.01).Fig. 1Levels of KLK11 in NSCLC. Among 138 NSCLC patients the serum levels of KLK11 were 2.04?±?0.86 ng/ml which were significantly higher than 0.93?±?0.52 ng/ml in healthy controls (P?<?0.01) Diagnostic value of KLK11 in NSCLC A ROC curve analysis was carried out to assess the value of KLK11 in NSCLC. The area under the ROC curve was 0.892 (confidence interval (95 % CI) 0.8410.942). With a cutoff point of 1.05 ng/ml which was defined as the normal value based on the mean value plus two standard deviation obtained from healthy controls serum KLK11 has a sensitivity of 65.9 % (91/138) a specificity of 82.5 % (33/40) an accuracy of 69.7 % (124/178) a positive predictive value of 92.9 % (91/98) and a negative predictive value of 41.3 % (33/80) (Fig. 2).Fig. 2ROC of KLK11 for the diagnosis of NSCLC. Serum levels of KLK11 among 138 NSCLC patients and 40 healthy controls were determined. The diagnostic potentials of KLK11 were " | Lung_Cancer |
"NSCLC and 40 healthy controls were collected. The concentration of KLK11 was measured by enzyme-linked immunosorbent assay (ELISA). The concentration of KLK11 in NSCLC was significantly higher compared to that in the controls (P?<?0.01). The serum KLK11 levels decreased with stage presence of lymph node and distant metastases regardless of histology age and sex. With a cutoff point of 1.05 ng/ml KLK11 showed a good diagnostic performance for NSCLC. Univariate analysis revealed that NSCLC patients with serum high KLK11 had a longer overall survival (OS) and progression-free survival (PFS) than those with low KLK11 (HR of 0.36 P?=?0.002; HR of 0.46 P?=?0.009). Cox multivariate analysis indicated that KLK11 was an independent prognostic indicator of PFS and OS (HR of 0.53 P?=?0.042; HR of 0.48 P?=?0.037). KaplanMeier survival curves further confirmed that patients with high KLK11 have longer PFS and OS (P?=?0.003 and P?=?0.018 respectively). In the measurement of KLK11 might be a useful diagnostic and prognostic test for NSCLC patients. Keywords Kallikrein-related peptidases 11 Non-small cell lung cancer Diagnosis Prognosis issue-copyright-statement International Society of Oncology and BioMarkers (ISOBM) 2014 Introduction Lung cancer is the leading cause of cancer-related death worldwide with more than 1.2 million deaths each year [1]. Non-small cell lung cancer (NSCLC) accounts for 8085 % of total lung malignancies [2]. Although advances in noninvasive methods have improved our ability to detect lung cancer more than 75 % of lung cancer patients present an advanced stage of disease [3] and they have little prospect of effective and curative treatment with 5-year survival rates of less than 15 % [4]. Tumor markers play a key role in patient management for many malignancies. The potential uses of serum tumor markers include aiding early diagnosis determining prognosis prospectively predicting response or resistance to specific therapies and monitoring therapy in patients with advanced disease. Kallikrein-related peptidases 11 (KLK11) is a member of the human kallikrein gene family which localized on chromosome 19q13.4 [5]. Recent studies have reported that KLK11 has been expressed in many cancers including prostate cancer [6] ovarian cancer [7] gastric cancer [8] as well as rectal carcinoma [9]. An immunofluorometric assay study demonstrated that KLK11 expression in ovarian cancer tissues is a marker of favorable prognosis since patients with KLK-positive tumors exhibit a longer progression-free survival (PFS) and overall survival (OS) [10]. Additionally Sasaki et al. [11] reported that lower KLK11 mRNA expression in lung cancer is an indicator of poor prognosis in patients with lung cancer. However there seems to be a paucity of research concerned with serum KLK11 expression in NSCLC. For this reason the goal of the present study was to investigate the baseline serum levels of KLK11 in patients with NSCLC to determine its potential diagnostic and prognostic roles. Materials and methods Patients A total of 138 patients with NSCLC were examined at the Nanjing Chest Hospital between January 2006 and May 2008. The cohort of patients included 80 (58.0 %) male and 58 (42.0 %) female subjects with a median age of 56 years (range 4568 years). The clinical features of the patients are summarized in . Follow-up lasted through December 2012 with a median follow-up period of 22 months for living patients (range 380 months). PFS was defined as the time interval between the date of diagnosis and the date of disease relapse. OS was defined as the time interval between the date of diagnosis and the date of death.Clinical characteristics of NSCLC patients and controlsVariablesNSCLCControl P valueSubject no.13840Age year57.8?±?10.254.6?±?7.80.614Male/Female80/5826/140.325Histology?AC78?SCC60 AC adenocarcinoma SCC squamous cell carcinoma The diagnosis of lung cancer was made using various methods: sputum cytology fine-needle aspiration or bronchoscopy as dictated by the patients presentation. Pathologists interpreted the cytology or histology of tissue biopsy. Lung cancer was staged using a widely used classification system and the staging procedure included a clinical examination; CT of the chest abdomen and brain; abdominal ultrasonography; bone scanning; and positron emission tomography. The study protocol was approved by the ethics committee of Nanjing Chest Hospital. All patients provided written informed consent before enrollment. Measurement of serum KLK11 levels Serum samples from each individual were obtained at the time of diagnosis before any therapeutic measures were started (surgery chemotherapy or radiation). Samples were centrifuged at 1500g for 10 min at ?4 °C. The supernatant was stored at ?80 °C for assessment of the levels of KLK11. The KLK11 concentration was determined by ELISA with the commercial KLK11 ELISA Ready-SET-Go kit (eBioscience San Diego CA). All samples were blinded to the technologists running the assays and the code was broken to the statisticians after the database was constructed. Statistical analysis Statistical software (SPSS for Windows version 18) was used for the analysis. Differences between independent groups were examined by the MannWhitney U test. To determine the diagnostic accuracy of KLK11 receiver operating characteristic (ROC) curves were retrieved from logistic regression analysis and the area under the curve (AUC) was calculated. Univariate survival analysis was performed using the KaplanMeier method and the log-rank test. Multivariate analysis was conducted to determine an independent impact on survival using the Cox proportional hazard method. P?<?0.05 was considered statistically significant. Results Comparison of serum KLK11 levels between NSCLC patients and controls As shown in Fig. 1 the concentration of KLK11 was significantly higher in patients with NSCLC (2.04?±?0.86 ng/ml) than in those with the controls (0.93?±?0.52 ng/ml) (P?<?0.01).Fig. 1Levels of KLK11 in NSCLC. Among 138 NSCLC patients the serum levels of KLK11 were 2.04?±?0.86 ng/ml which were significantly higher than 0.93?±?0.52 ng/ml in healthy controls (P?<?0.01) Diagnostic value of KLK11 in NSCLC A ROC curve analysis was carried out to assess the value of KLK11 in NSCLC. The area under the ROC curve was 0.892 (confidence interval (95 % CI) 0.8410.942). With a cutoff point of 1.05 ng/ml which was defined as the normal value based on the mean value plus two standard deviation obtained from healthy controls serum KLK11 has a sensitivity of 65.9 % (91/138) a specificity of 82.5 % (33/40) an accuracy of 69.7 % (124/178) a positive predictive value of 92.9 % (91/98) and a negative predictive value of 41.3 % (33/80) (Fig. 2).Fig. 2ROC of KLK11 for the diagnosis of NSCLC. Serum levels of KLK11 among 138 NSCLC patients and 40 healthy controls were determined. The diagnostic potentials of KLK11 were assessed by ROC curves. The AUC value was 0.892 Relationship between serum KLK11 levels and clinicopathologic factors The relationships between KLK11 levels and clinicopathologic factors of lung cancer patients are shown in . The serum KLK11 levels did not differ significantly with age (P?=?0.569) sex (P?=?0.505) or histology (P?=?0.713). The levels of KLK11 were significantly correlated with tumor-node-metastasis (TNM) stage (P?=?0.000) lymph node metastases (P?=?0.000) and distant metastases (P?=?0.000).The clinicopathological factors of NSCLC and the association with KLK11 levelsFactorsnKLk11 (ng/ml) P- valueAge year0.569??60622.07?±?0.77?<60762.12?±?0.66Gender0.505?Male802.16?±?0.82?Female581.99?±?0.53Histology0.713?AC782.05?±?0.85?SCC602.01?±?0.53TNM stage0.000?III882.51?±?0.61?IIIIV501.76?±?0.63Lymph node metastases0.000?Absent682.41?±?0.64?Present701.65?±?0.57Distant metastases0.000?Absent982.38?±?0.59?Present401.89?±?0.71 AC adenocarcinoma SCC squamous cell carcinoma Association of serum KLK11 levels with survival Finally we determined whether the baseline serum concentration of KLK11 would be a prognostic marker in NSCLC. The cutoff point of 1.05 ng/ml was selected to categorize patients as KLK11-high or low. Univariate analysis showed that serum KLK11 level was significantly correlated OS (P?=?0.002) and PFS (P?=?0.009) (Table 3).Table 3Univariate and multivariate analysis of KLK11 status with regard to PFS and OSVariablesPFSOSHR95 % CI P valueHR95 % CI P valueUnivariate analysis?KLK11 (Low vs. High)0.460.250.820.0090.360.190.690.002?Age (?60 vs. <60)1.230.672.280.5061.180.592.130.792?Gender (Male vs. Female)1.320.711.820.7821.190.691.980.673?Histology (AC vs. SCC)1.830.592.130.7921.340.651.980.546?Stage (III vs. IIIIV)1.330.652.210.0010.931.093.440.025?Lymph node metastases (absent vs. present)1.421.041.940.2711.770.321.660.347?Distant metastases (absent vs. present)1.981.033.010.0391.871.042.990.075Multivariate analysis?KLK11 (low vs. high)0.530.29-0.970.0420.480.24-0.950.037?Age (?60 vs. <60)0.980.52-1.940.8341.061.28-3.010.128?Gender (male vs. Female)1.280.67-1.890.6721.140.46-2.140.542?Histology (AC vs. SCC)1.371.04-2.330.3151.260.64-2.560.424?Stage (III vs. IIIIV)1.250.56-2.260.0011.961.02-3.770.043?Lymph node metastases (absent vs. present)1.130.81-1.570.1481.840.33-1.720.334?Distant metastases (absent vs. present)1.440.85-1.970.0981.890.99-2.350.051 HR hazard ratio CI confidence interval In multivariate analysis high KLK11 was found to be significantly associated with a longer PFS and OS (HR 0.53 and 0.48; P?=?0.042 and P?=?0.037 respectively). KaplanMeier survival curves (Fig. 3) further demonstrate that lung cancer patients with high KLK11 have substantially longer PFS and OS (P?<?0.05) compared to those with low KLK11 cancer. As expected disease stage was found to be strongly associated with decreased PFS and OS in both univariate and multivariate analyses (P?<?0.05).Fig. 3KaplanMeier survival curves for PFS and OS in patients with KLK11-high and -low NSCLC. Log-rank test determined that the PFS and OS in high KLK11 group were significantly longer than those in the low KLK11 group (P?=?0.003; P?=?0.018) Discussion During the last few years numerous studies have been published which attempt to refine our understanding of determinants of prognosis in lung cancer by analyzing tumor-associated markers thought to be of biologic relevance in the carcinogenic process. Proteolytic enzymes of several catalytic classes have emerged as important prognostic factors in cancer [12]. Among these enzymes are many members of human tissue kallikrein family of secreted serine proteases including KLK11 a promising biomarker for lung cancer diagnosis and prognosis [1113]. In the present study serum KLK11 levels were significantly elevated in patients with lung cancer compared with control subjects making them potential adjunctive tools for diagnosis of lung cancer. Furthermore at a cutoff point of 1.05 ng/ml KLK11 had a sensitivity of 91.3 % and a specificity of 72.5 % for the prediction of lung cancer. Importantly the serum KLK11 levels did not differ significantly with age gender and histology. The levels of KLK11 were significantly correlated with TNM stage the presence of lymph node and distant metastases. Several previous studies have reported an association between kallikrein mRNA expression and cancer prognosis [1416]. KLK5 and KLK4 have been associated with poor prognosis in ovarian cancer and KLK5 has also been shown to be associated with poor prognosis in breast cancer [1718]. In contrast KLK8 and KLK9 expression have been reported to be favorable prognosis in ovarian cancer [1920]. In addition KLK12 is reported to be an independent and favorable prognostic marker for breast cancer [21]. Sasaki et al. [11] have indicated that there is a significant correlation between decreased KLK11 mRNA expression level and poor prognosis in lung cancer. This study supports the increasing body of literature demonstrating the expression of kallikrein family gene involvement in the prognosis of human cancers. The most striking association we observed in NSCLC patients was a significant correlation between increased KLK11 level and favorable prognosis. We have demonstrated that high KLK11 was significantly associated with an increased PFS and OS in univariate analysis. This relationship was further illustrated in the KaplanMeier survival curves. Multivariate analysis also indicated that KLK11 was an independent indicator of PFS and OS. In our data suggest that serum KLK11 may be a useful diagnostic biomarker and shows a promising potential as prognostic marker in NSCLC patients. More large-scale prospective studies are warranted to confirm the findings. Conflicts of interest None. References 1. Chen Z Wang T Cai L Su C Zhong B Lei Y Clinicopathological significance of non-small cell lung cancer with high prevalence of Oct-4 tumor cells J Exp Clin Cancer Res 2012 31 10 10.1186/1756-9966-31-10 22300949 2. Smith RA Cokkinides V Brawley OW Cancer screening in the United States 2009: a review of current American Cancer Society guidelines and issues in cancer screening CA Cancer J Clin 2009 59 27 41 10.3322/caac.20008 19147867 3. Oguz A Unal D Tasdemir A Karahan S Aykas F Mutlu H Lack of any association between blood groups and lung cancer independent of histology Asian Pac J Cancer Prev. 2013 14 453 456 10.7314/APJCP.2013.14.1.453 23534772 4. Jemal A Siegel R Xu J Ward E Cancer statistics 2010 CA Cancer J Clin 2010 60 277 300 10.3322/caac.20073 20610543 5. Sano A Sangai T Maeda H Nakamura M Hasebe T Ochiai A Kallikrein 11 expressed in human breast cancer cells releases insulin-like growth factor through degradation of IGFBP-3 Int J Oncol 2007 30 1493 1498 17487371 6. Luo LY Shan SJ Elliott MB Soosaipillai A Diamandis EP Purification and characterization of human Kallikrein 11 a candidate prostate and ovarian cancer biomarker from seminal plasma Clin Cancer Res 2006 12 742 750 10.1158/1078-0432.CCR-05-1696 16467084 7. McIntosh MW Liu Y Drescher C Urban N Diamandis EP Validation and characterization of human Kallikrein-11 as a serum marker for diagnosis of ovarian carcinoma Clin Cancer Res 2007 13 4422 4428 10.1158/1078-0432.CCR-06-2224 17671125 8. Unal D Tasdemir A Oguz A Eroglu C Cihan YB Turak EE Is human Kallikrein-11 in gastric cancer treated with surgery and adjuvant chemoradiotherapy associated with survival? Pathol Res Pract 2013 209 779 783 10.1016/j.prp.2013.09.004 24169449 9. Yu X Tang HY Li XR He XW Xiang KM Overexpression of human kallikrein 11 is associated with poor prognosis in patients with low rectal carcinoma Med Oncol 2010 27 40 44 10.1007/s12032-009-9167-2 19184568 10. Diamandis EP Borgo±o CA Scorilas A Harbeck N Dorn J Schmitt M Human kallikrein 11: an indicator of favorable prognosis in ovarian cancer patients Clin Biochem 2004 37 823 829 10.1016/j.clinbiochem.2004.04.009 15329323 11. Sasaki H Kawano O Endo K Suzuki E Haneda H Yukiue H Decreased Kallikrein 11 messenger RNA expression in lung cancer Clin Lung Cancer 2006 8 45 48 10.3816/CLC.2006.n.032 16870045 12. Lei KF Liu BY Zhang XQ Jin XL Guo Y Ye M Development of a survival prediction model for gastric cancer using serine proteases and their inhibitors Exp Ther Med 2012 3 109 116 10.1084/jem.20110399 22969854 13. Planque C Li L Zheng Y Soosaipillai A Reckamp K Chia D A multiparametric serum kallikrein panel for diagnosis of non-small cell lung carcinoma Clin Cancer Res 2008 14 1355 1362 10.1158/1078-0432.CCR-07-4117 18316555 14. Alexopoulou DK Papadopoulos IN Scorilas A Clinical significance of kallikrein-related peptidase (KLK10) mRNA expression in colorectal cancer Clin Biochem 2013 46 1453 1461 10.1016/j.clinbiochem.2013.03.002 23499583 15. Talieri M Alexopoulou DK Scorilas A Kypraios D Arnogiannaki N Devetzi M Expression analysis and clinical evaluation of kallikrein-related peptidase 10 (KLK10) in colorectal cancer Tumour Biol 2011 32 737 744 10.1007/s13277-011-0175-4 21487810 16. Patsis C Yiotakis I Scorilas A Diagnostic and prognostic significance of human kallikrein 11 (KLK11) mRNA expression levels in patients with laryngeal cancer Clin Biochem 2012 45 623 630 10.1016/j.clinbiochem.2012.03.005 22429520 17. Xi Z Kaern J Davidson B Klokk TI Risberg B Trop C Kallikrein 4 is associated with paclitaxel resistance in ovarian cancer Gynecol Oncol 2004 94 80 85 10.1016/j.ygyno.2004.03.044 15262123 18. Yousef GM Scorilas A Kyriakopoulou LG Rendl L Diamandis M Ponzone R Human kallikrein gene 5 (KLK5) expression by quantitative PCR: an independent indicator of poor prognosis in breast cancer Clin Chem 2002 48 1241 1250 12142380 19. Kountourakis P Psyrri A Scorilas A Markakis S Kowalski D Camp RL Expression and prognostic significance of kallikrein-related peptidase 8 protein levels in advanced ovarian cancer by using automated quantitative analysis Thromb Haemost 2009 101 541 546 19277417 20. Borgo±o CA Kishi T Scorilas A Harbeck N Dorn J Schmalfeldt B Human kallikrein 8 protein is a favorable prognostic marker in ovarian cancer Clin Cancer Res 2006 12 1487 1493 10.1158/1078-0432.CCR-05-2106 16533772 21. Talieri M Devetzi M Scorilas A Pappa E Tsapralis N Missitzis I Human kallikrein-related peptidase 12 (KLK12) splice variants expression in breast cancer and their clinical impact Tumour Biol 2012 33 1075 1084 10.1007/s13277-012-0347-x 22351561 9502500 8794 Clin Cancer Res Clin. Cancer Res. Clinical cancer research : an official journal of the American Association for Cancer Research 1078-0432 24423612 4136748 10.1158/1078-0432.CCR-13-2195 NIHMS556385 Article HEDGEHOG-GLI signaling inhibition suppresses tumor growth in squamous lung cancer Huang Lingling 1 Walter Vonn 2 Hayes D. Neil 2 Onaitis Mark 1 1Duke University Department of Surgery 2University of North Carolina Department of Medicine Corresponding Author: Mark Onaitis DUMC Box 3305 Durham NC 27710 mwo@duke.edu phone: 919-684-6974 fax: 919-684-8508 4 4 2014 14 1 2014 15 3 2014 15 3 2015 20 6 1566 1575 Purpose Lung squamous cell carcinoma (LSCC) currently lacks effective targeted therapies. Previous studies reported overexpression of HEDGEHOG (HH)-GLI signaling components in LSCC. However they addressed neither the tumor heterogeneity nor the requirement for HH-GLI signaling. Here we investigated the role of HH-GLI signaling in LSCC and studied the therapeutic potential of HH-GLI suppression. Experimental Design Gene expression datasets of two independent LSCC patient cohorts were analyzed to study the activation of HH-GLI signaling. Four human LSCC cell lines were examined for HH-GLI signaling components. Cell proliferation and apoptosis were assayed in these cells after blocking the HH-GLI pathway by lentiviral-shRNA knockdown or small molecule inhibitors. Xenografts in immunodeficient mice were used to determine the in vivo efficacy of GLI inhibitor GANT61. Results In both cohorts activation of HH-GLI signaling was significantly associated with the classical subtype of LSCC. In cell lines genetic knockdown of SMO produced minor effects on cell survival while GLI2 knockdown significantly reduced proliferation and induced extensive apoptosis. Consistently the SMO inhibitor GDC-0449 resulted in limited cytotoxicity in LSCC cells whereas the GLI inhibitor GANT61 was very effective. Importantly GANT61 demonstrated specific in vivo anti-tumor activity in xenograft models of GLI-positive cell lines. Conclusion Our studies demonstrate an important role for GLI2 in LSCC and suggest GLI inhibition as a novel and potent strategy to treat a subset of LSCC patients. Squamous cell lung cancer HEDGEHOG GLI J Korean Med Sci J. Korean Med. Sci JKMS Journal of Korean Medical Science 1011-8934 1598-6357 The Korean Academy of Medical Sciences 24431917 3890464 10.3346/jkms.2014.29.1.129 Original Article Medical Imaging Computed Tomography Guided Percutaneous Injection of a Mixture of Lipiodol and Methylene Blue in Rabbit Lungs: Evaluation of Localization Ability for Video-Assisted Thoracoscopic Surgery Jin Kwang Nam 1 Lee Kyung Won 2 Kim Tae Jung 2 Song Yong Sub 3 Kim Dong Il 4 1Department of Radiology Seoul Metropolitan Government-Seoul National University Boramae Medical Center Seoul Korea. 2Department of Radiology Seoul National University Bundang Hospital Seongnam Korea. 3Department of Radiology Seoul National University Hospital Seoul Korea. 4Department of Pathology Green Cross Laboratories Yongin Korea. Address for Correspondence: Kyung Won Lee MD. Department of Radiology Seoul National University Bundang Hospital 82 Gumi-ro 173beon-gil Bundang-gu Seongnam 463-707 Korea. Tel: +82.31-787-7604 Fax: +82.31-787-4011 lkwrad@radiol.snu.ac.kr 1 2014 26 12 2013 29 1 129 136 13 5 2013 22 10 2013 2014 The Korean Academy of Medical Sciences. 2014 This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted non-commercial use distribution and reproduction in any medium provided the original work is properly cited. Preoperative localization is necessary prior to video assisted thoracoscopic surgery for the detection of small or deeply located lung nodules. We compared the localization ability of a mixture of lipiodol and methylene blue (MLM) (0.6 mL 1:5) to methylene blue (0.5 mL) in rabbit lungs. CT-guided percutaneous injections were performed in 21 subjects with MLM and methylene blue. We measured the extent of staining on freshly excised lung and evaluated the subjective localization ability with 4 point scales at 6 and 24 hr after injections. For MLM radio-opacity was evaluated on the fluoroscopy. We considered score 2 (acceptable) or 3 (excellent) as appropriate for localization. The staining extent of MLM was significantly smaller than methylene blue (0.6 vs 1.0 cm P<0.001). MLM showed superior staining ability over methylene blue (2.8 vs 2.2 P=0.010). Excellent staining was achieved in 17 subjects (81%) with MLM and 8 (38%) with methylene blue (P=0.011). An acceptable or excellent radio-opacity of MLM was found in 13 subjects (62%). An appropriate localization rate of MLM was 100% with the use of the directly visible ability and radio-opacity of MLM. MLM provides a superior pulmonary localization ability over methylene blue. Lung Ethiodized Oil Methylene Blue Tomography X-Ray Computed Radiology Interventional Seoul National University College of Medicine 800-20120036 INTRODUCTION Preoperative localization is necessary for video-assisted thoracoscopic surgery (VATS) when pulmonary nodules are too small or distant from the visceral pleura to be detected (1-3). A failure to localize nodules disturbs the success of the thoracoscopic resection and leads to conversion to thoracotomy (4 5). There are two kinds of localizing procedures: marking with thoracoscopically directly visible materials and marking with radio-opaque materials. Examples of directly visible materials are hook wire methylene blue and indocyanine green. Ethiodized oil (lipiodol) barium and iodine contrast agents are used for radio-opaque markers. Each marking method has strong and weak points. Localization with a hook wire is easy to perform but carries a high risk of pneumothorax and a propensity to dislodge during transport and surgical preparation (6 7). Methylene blue and indigo carmine have a tendency to diffuse over a large area by the time the operation is done and render localization features inadequate (8 9). The use of a radio-opaque marker (such as barium or lipiodol) requires an intraoperative fluoroscopy to confirm an adequate excision as well as lead to increased radiation exposure (10-13). The use of mixture has been reported to make up for the weakness of marking materials. For example the problem of dye diffusion has led to attempts to use a mixture of dye with various materials such as cyanoacrylate adhesive or collagen or autologous blood (14-16). However they have not been widely used for localization due to difficulties in making and manipulation. Lipiodol and methylene blue are commonly used materials for localization (17-20). We hypothesized that lipiodol reduces the spread of methylene blue and provides additional localization opportunities by its radio-opacity. The use of a mixture of lipidol and methylene blue (MLM) for a percutaneous injection material requires a high success rate for appropriate localization and a low complication rate. To our knowledge there have been no reports that evaluate the availability of MLM as a percutaneous injection material in human lungs. This study compared MLM with methylene blue as a percutaneous injection material for pulmonary localization in rabbit lungs. MATERIALS AND METHODS Animal preparation This study was performed after approval by the Institutional Animal Care and Use Committee (IACUC) in Seoul National University Hospital biomedical research institute (IACUC approval No. 11-0356). Twenty-four adult New Zealand White rabbits were used. We recorded their weight before the procedures. The animals were randomly divided into two groups: Group A (n=12) and Group B (n=12) each sacrificed at about 6 hr and 24 hr after percutaneous injections respectively (Fig. 1). Six hours after percutaneous injections were same day operations of the preoperative localization; and 24 hr after percutaneous injections were next day operations of the preoperative localization. The injection of each material was done in all 24 subjects because we injected methylene blue and MLM at two different lung sites for each subject. Percutaneous injection materials: mixture of lipiodol and methylene blue versus methylene blue A pilot study was performed to decide the optimal amount of materials for percutaneous injections. Methylene blue (1% 100 mg/mL TERA Pharmaceuticals Buena Park CA USA) of 0.3 to 0.9 mL was used for human lung localization in previous studies by Wicky et al. (18) and Vandoni et al. (19). In the pilot study with rabbit lungs we injected 0.1 mL and 0.05 mL of methylene blue and MLM in four subjects. We found that staining was extensive (more than half height of one lobe) with 0.1 mL and localized (about 1 cm of staining diameter) with 0.05 mL for both methylene blue and MLM. Extensive dispersion made it difficult to find exact injecting sites; subsequently 0.05 mL of methylene blue was administered. We made variable mix ratios of lipiodol and methylene blue in vitro; 1:1 1:2 1:3 1:4 and 1:5 in order to find an appropriate mixing ratio of lipiodol (480 mg Iodine/mL Andre Guerbet Aulnay-sous-Bois France) and methylene blue. The separation of two materials occurred instantly after mechanical blending to the fat-soluble character of lipiodol and the water-soluble character of methylene blue. A higher concentration of lipiodol in MLM resulted in increased uneven blending and rapid separation. A mixture with a 1:6 (or lower) mixing ratio contained a minimal amount of lipiodol and it might make it difficult to be detected on the fluoroscopy; subsequently we decided that 1:5 was an appropriate mixing ratio for injection. A total of 0.06 mL of MLM (0.01 mL of lipiodol plus 0.05 mL of methylene blue) was administrated in each subject to avoid the effect of different volumes of methylene blue to the diffusion extent of the materials. CT guided percutaneous injections Percutaneous injection was performed with computed tomography (CT) guidance (Discovery CT750 HD; GE Healthcare Waukesha WI USA). We performed pre-procedural CT scans in order to determine an appropriate skin entry site for the successful placement of a needle in the desired location. The desired location was the basal portion of both caudal lobes around the mid-scapula line. We tried to situate the needle tip at 5 mm depth from the visceral pleura and avoid passing through the pulmonary vessels. We placed the needle of 20 gauze and 3.5 cm length in the lung parenchyma after marking the appropriate skin entry site. The parameters of CT used in our study were: tube voltage of 120 kV tube current of 25 mA slice thickness of 2 mm thickness and gantry rotation speed of 350 milliseconds. We connected 1 mL syringe to the needle hub and retracted the syringe piston to confirm that no blood was aspirated after the needle tip was accurately located within the desired location. We then injected the materials and immediately removed the needle. On the procedural CT scan we measured the distance from the skin-entry to the needle tip and the depth from visceral pleura to the needle tip. A post-procedural CT scan identified procedure-related complications that included the leakage of injecting materials and pneumothorax; in addition we recorded the extent shape and density of radio-opacity of MLM after injection. The extent of MLM was defined as a maximum diameter of the radio-opacities. The shape of radio-opacity was categorized into 3 groups (small faint nodular scattered nodular and discrete compact nodular). We recorded the injection time to measure the time interval between injection and sacrifice. Fluoroscopic examinations A successful localization of lipiodol was determined by fluoroscopic examination; subsequently we evaluated the radio-opacity of MLM using the fluoroscopy X-ray unit (BV Pulsera; Philips Medical Systems Best The Netherlands) at the immediate post-procedure session and the follow up session at 6 hr in Group A and 24 hr in Group B. The parameters of fluoroscopy were: tube voltage of 59 kV and tube current of 946 mA. We obtained anteroposterior fluoroscopic images of the thorax of the rabbit with a 17 cm of field of view. A radio-opaque ruler of 5 cm was located near the rabbit in order to estimate the exact size of lipiodol opacity. We recorded the time of the fluoroscopic examinations and the radiographic findings of MLM (size and shape of the radio-opacity). Evaluation of the staining and radio-opacity We assessed the directly visible staining on the freshly excised lung surface and radio-opacity of MLM on the fluoroscopic examinations using 4-point scoring in order to compare the localization ability of MLM and methylene blue as a percutaneous injection material. A blind reviewer who was unaware of the injection materials assessed the staining ability. In order to evaluate the staining ability the blind reader reviewed the photographic images of the freshly excised lung specimens obtained before formalin fixations and rated the staining by 4-point scores: 0=non-visualization of staining 1=inappropriate; extensive dispersion made it difficult to find accurate injecting locations 2=acceptable; available to estimate injecting locations in spite of the dispersion and 3=excellent definitely localized staining (Fig. 2). The maximum diameter of the staining extent on the lung surface was measured. We calculated and compared scores and extent of staining between two materials. For the fluoroscopic findings the radio-opacity of MLM was evaluated using 4-point scoring: 0=no detectable radio-opacity 1=inappropriate minimally increased opacity 2=acceptable low density of increased opacity 3=excellent compact nodular increased opacity (Fig. 3). We compared the average scores of initial and follow up fluoroscopic examinations. We considered a score of 0 or 1 as inappropriate and a score of 2 or 3 as appropriate for localization for both staining and radio-opacity. We compared the number of appropriate or excellent localization between MLM and methylene blue. Sacrifice and histopathologic examinations Both freshly excised entire lungs were used as fi" | Lung_Cancer |
"As these series of processes maintained the normal cell-cell adhesion connection and inhibited EMT there was increased E-cadherin expression and decreased N-cadherin vimentin and snail expression as well as inhibited cell invasiveness in H1299 cells. Previous studies have shown that although p120ctn isoform 1A could bind E-cadherin in the cytoplasm they could not form effective adhesion complexes on the membrane between epithelial cells [33]. Furthermore the cytoplasmic E-cadherin is likely not to be the full-length E-cadherin but instead cleaved E-cadherin fragments such as E-cad/sE-cad (80 kDa) and E-cad/CTF2 (33 kDa) [34]. The E-cad/CTF2 fragment can bind to p120 in the cytoplasm and then translocate into the nucleus and bind the transcriptional repressor of Kaiso to activate the Wnt/b-catenin pathway [35] [36] finally promoting the EMT of tumor cells and enhancing cell invasion and metastasis [37]. Moreover others have shown that p120ctn-1A is related to abnormal expression of E-cadherin and poor prognosis [38]. These studies illustrated that the cytoplasmic p120ctn isoform 1A can play a role in promoting tumor cell EMT invasion and metastasis. Based on the above we observed on the one hand that the effect of p120ctn isoform 1A to promote tumor cell EMT invasion and metastasis would be lifted by its ablation resulting in increased E-cadherin expression decreased N-cadherin vimentin and snail expression and inhibited invasiveness in SPC cells. On the other hand transfection of the p120ctn isoform 1A plasmid into LK2 cells expressing cytoplasmic E-cadherin resulted in decreased E-cadherin expression increased N-cadherin vimentin and snail expression and enhanced cell invasiveness. Although the precise role of p120ctn during EMT induction is still unclarified previous studies suggested that knockdown of all isoforms of p120ctn could induce EMT indirectly [27] [28] [43] [44]. All inductions were based on decreased E-cadherin expression and intercellular adhesion in previous studies which were also confirmed by our study in H460 cells with E-cadherin membrane localization. Unlike the H460 cells knockdown of the p120ctn isoform 1A in SPC cells with E-cadherin cytoplasmic expression could not decrease E-cadherin expression and intercellular adhesion. Instead we found increased E-cadherin expression and decreased cell invasiveness indicating that the EMT could not be induced by this pathway in SPC cells. It was worth noting that the same result was observed in LK2 and H1299 cells transfected with the p120ctn isoform 3A plasmid both showing increased E-cadherin expression decreased N-cadherin vimentin and snail expression and inhibited cell invasiveness. These results suggested that p120ctn isoform 3A has the function of inhibiting EMT of lung cancer cells and this function is independent of the cellular E-cadherin localization. Past research had also confirmed a shift from p120ctn isoform 3A to p120ctn isoform 1A expression after the induction of EMT [9] [10] [11] which indirectly indicates that p120ctn isoform 3A may inhibit EMT while p120ctn isoform 1A promotes EMT. In addition we also noticed that p120ctn and E-cadherin protein expression levels were significantly increased after transfection of the p120ctn-3A plasmid into LK2 and H1299 cells but p120ctn and E-cadherin were still mainly restricted to the cell membrane at cell-cell adherens junctions in H1299 cells. By contrast E-cadherin and p120ctn were almost exclusively located in the cytoplasm in LK2 cells (E). As a cell adhesion molecule E-cadherin is known to be only located on the cell membrane with the potential to inhibit EMT while in the cytoplasm it is often cleaved into fragments and therefore functions differently from the molecules located on the cell membrane [34]. Thus the cytoplasmic E-cadherin would theoretically not play a role in inhibiting EMT. Based on the above analysis we speculated that there may be some interaction between p120ctn isoform 3A and snail which plays a role in suppressing EMT in lung cancer cells expressing cytoplasmic E-cadherin but this hypothesis requires further study. Importantly we also found that knockdown of p120ctn-1A in SPC cells with cytoplasmic E-cadherin resulted in decreased twist expression (B). Meanwhile transfection of LK2 cells which also showed cytoplasmic localization of E-cadherin with the p120ctn isoform 1A plasmid resulted in increased twist expression (B). However no changes in twist expression were observed in the rest of the experiments (A 4A). As a transcription factor and master gene regulator of EMT [39] [40] twist can downregulate E-cadherin expression [41] and upregulate N-cadherin and other mesenchymal biomarkers [42]. Increased twist expression in LK2 cells transfected with the p120ctn isoform 1A plasmid indicated that transcriptional activation took place and further suggested that the p120ctn isoform 1A may have translocated into the nucleus upon binding of E-cad/CTF2 in the cytoplasm consequently activating the Wnt signaling pathway to promote EMT. Decreased twist expression in SPC cells transfected with p120ctn-1A-siRNA indicated that transcriptional activity was downregulated and suggested that ablation of p120ctn isoform 1A resulted in the inhibtion of EMT by removing the stimulatory effect of the Wnt signaling activity by p120ctn isoform 1A. In the H460 and H1299 cells with E-cadherin localized in the membrane the unchanged twist expression confirmed that p120ctn isoforms 1A and 3A could bind to E-cadherin and maintain effective cell-cell adhesion in order to suppress EMT instead of affecting the Wnt/twist pathway. Intriguingly overexpression of p120ctn isoform 3A did not change twist expression in LK2 cells expressing cytoplasmic E-cadherin indicating that p120ctn isoform 3A did not activate transcription. Therefore we firmly believe in the above hypothesis that p120ctn isoform 3A may interact with snail in some manner to influence E-cadherin expression and suppress EMT in lung cancer cells carrying cytoplasmic E-cadherin. Previous studies have observed that p120ctn-1A restored the cytoplasmic expression of E-cadherin whereas p120ctn-3A could not [20] which seems to be contradictory with the results of this study. However the method in previous studies of knocking down p120ctn expression and then transfecting p120ctn isoforms 1A and 3A plasmids into cells is different from that in the current study in which cells were only transiently transfected with p120ctn isoforms 1A and 3A plasmids. Therefore the different research methods may have led to different effects on E-cadherin. We also noted that in previous studies decreased and almost undetectable levels of E-cadherin by ablation of p120ctn resulted in the failure of exogenous p120ctn-1A to translocate into the nucleus to activate the Wnt/b-catenin pathway and decrease E-cadherin expression due to the deletion of the binding partner E-cad/CTF2. However the LK2 and H1299 cell lines used in these experiments expressed E-cadherin in the present study. E-cadherin binds primarily to unphosphorylated p120ctn isoform 3A whereas tyrosine-phosphorylated p120ctn isoform 1A interacts exclusively with N-cadherin [23]. In the previous studies exogenous p120ctn isoform 3A was prevented from binding and stabilizing E-cadherin after its ablation while in the present study the exogenous p120ctn isoform 3A could stabilize E-cadherin expression directly on the membrane or indirectly by increasing its cytoplasmic expression via regulation of snail expression. Of course all of these findings will need to be further investigated. In we for the first time found that p120ctn isoforms 1A and 3A to have different functions in EMT of lung cancer cells with E-cadherin expressed in different subcellular locations. When E-cadherin was localized on the cell membrane p120ctn isoforms 1A and 3A both could inhibit EMT and reduce the cell invasiveness phenotype. When E-cadherin was localized in the cytoplasm p120ctn isoform 1A promoted EMT and enhanced cell invasion while p120ctn isoform 3A inhibited EMT and reduced cell invasiveness. We thank Dr. Albert B. Reynolds (Department of Cancer Biology
Lung_Cancer In biomedical research a health effect is frequently associated with protracted exposures of varying intensity sustained in the past. The main complexity of modeling and interpreting such phenomena lies in the additional temporal dimension needed to express the association as the risk depends on both intensity and timing of past exposures. This type of dependency is defined here as exposureâlagâresponse association. In this contribution I illustrate a general statistical framework for such associations established through the extension of distributed lag non-linear models originally developed in time series analysis. This modeling class is based on the definition of a cross-basis obtained by the combination of two functions to flexibly model linear or nonlinear exposure-responses and the lag structure of the relationship respectively. The methodology is illustrated with an example application to cohort data and validated through a simulation study. This modeling framework generalizes to various study designs and regression models and can be applied to study the health effects of protracted exposures to environmental factors drugs or carcinogenic agents among others. © 2013 The Authors. Statistics in Medicine published by John Wiley & Sons Ltd. latency distributed lag models exposureâlagâresponse delayed effects splines 1. Introduction In biomedical research it is commonly appreciated that an exposure event produces effects lasting well beyond the exposure period with an increase in risk occurring from few hours to many years later depending on the physiological processes linking the exposure and the health outcome. The problem is made even more complicated in the presence of protracted time-varying exposures when the health effect measured at a given time can be described as the result of multiple exposure events of different intensities sustained in the past. This phenomenon common to various research fields has been associated for example with peak 1 or chronic exposures 2 to environmental stressors drug intake 34 or occupational exposures to carcinogenic substances 5. The main complexity of modeling and interpreting such dependencies lies in the additional temporal dimension needed to express the association beyond the usual exposureâresponse relationship as the risk depends on both intensity and timing of past exposures. Nonetheless the appropriate representation of the temporal pattern of risks may provide further insights on the association of interest in particular regarding the underlying pathophysiological mechanisms and prevent biases in estimates and predictions. Revising previous terminology 6 I define these dependencies as exposureâlagâresponse associations. In particular this issue has been debated in cancer epidemiology 7â9. Analytical approaches extend simple indices such as cumulative exposure in order to accommodate the temporal variation in risk because of protracted exposures. In particular the pioneering work by Thomas 106 helped develop sophisticated statistical methods on the basis of weighting past exposures through specific functions whose parameters are estimated by the data. Vacek 11 Langholz and colleagues 12 and Richardson 13 provided interesting applications in case-control studies with weights represented through simple parametric functions. The methodology was improved by Hauptmann and colleagues in a series of papers 14â16 by using flexible and smooth spline functions. Sylvestre and Abrahamowicz 17 and Abrahamowicz and colleagues 18 extended the spline methods to the analysis of time-to-event data with a cohort design and presented their applications in pharmaco-epidemiology. The main limitation of the statistical techniques described in these papers is the assumption of a linear exposureâresponse relationship. Models for nonlinear dependencies introduce further nontrivial complexities from both statistical and interpretational perspectives as the problem becomes inherently bidimensional. Abrahamowicz and Mackenzie 19 proposed a model for analyzing the nonlinear time-dependent effects of fixed exposures while Vacek 11 and Berhane and colleagues 20 extended this scheme to the case of protracted time-varying exposures. However the modeling techniques illustrated in these other papers still face some limitations as they are based on complex estimation routines with convergence issues and problems in producing uncertainty measures such as standard errors and confidence intervals. Interestingly equivalent approaches were previously established in time series analysis on the basis of distributed lag models (DLMs) a methodology originally formulated in econometrics 21 then applied in epidemiological research 22. These models involve the definition of a distributed lag function analogous to the weighting function described before. In particular Armstrong 23 generalized the method to distributed lag non-linear models (DLNMs) a class of models with different options for the functions applied to model nonlinearity and distributed lag effects. The theory of DLMs and DLNMs have been recently re-evaluated 24 offering a well-grounded statistical tool and a comprehensive scheme for interpretation. In this paper I aim to establish a general conceptual and statistical framework for modeling exposureâlagâresponse associations built upon the paradigm of DLMs and DLNMs. This modeling class extended beyond time series analysis provides a unified methodology applicable in different study designs data structures and regression models including most of the previous methods as specific cases. Also the statistical framework is defined by completely parametric functions and fitted through standard regression methods with measures of uncertainty and fit statistics easily available. The R package dlnm originally developed for time series data 25 is extended in parallel offering a easy-to-use implementation of the modeling approach. The manuscript is structured as follows. The development and algebraic definition of the modeling framework is described in Section 2. As an illustrative example in I apply the method for investigating the relationship between occupational exposure to radon and lung cancer mortality by using the data from the Colorado Plateau miners cohort. The modeling framework is then validated in a simulation study n. A final discussion is provided in. Information on data and software implementation is included in. The R code and data are included in the supporting information together with additional details making the results of the illustrative example and of the simulation study entirely reproducible. 2. Modeling framework The modeling skeleton is derived by extending the class of DLNMs beyond the time series context. This extension provides a neat algebraic representation and a comprehensive statistical definition. The focus is on a function here defined s(xt) which describes the dependency in terms of the exposure history to x evaluated at time t. The function s(xt) is commonly included in regression models in order to estimate the association while controlling for potential confounders. Although the regression model varies depending on the study design and the type of data the definition of s(xt) provided later and the related modeling framework generally apply. 2.1. Models for linear exposureâresponse relationships Previous studies on the topic have defined the function s(xt) by using slightly different algebraic formulae 1026111417. Assuming a linear exposureâresponse relationship a general notation can be given by (1a) (1b) (1c) In (1a) the increase in risk at time t is defined as the integral of the instantaneous exposure intensity xu over the period ?t = [t0t1] with t0 and t1 representing the times of the first and last relevant exposures. Here w(t ? u) is the weighting function previously described in which assigns weights to past exposures experienced at time t ? u on the basis of their contribution to the risk at time t. The model can be reparameterized as in (1b) where the risk is now expressed along the lag with ? ? [?0L]. Here L ? ?0 = t1 ? t0 is interpreted as the lag period over which an exposure to x is assumed to affect the risk at time t usually with ?0 = 0. This parameterization offers the advantage that the function w is now directly defined in the new dimension of lag ? and it is independent of the time axis chosen for t which may represent different time scales depending on the study design. The function w(?) termed from here on as the lagâresponse function models the lagâresponse curve associated with exposure x. Finally for computational purposes the integral is approximated in (1c) by a sum of terms derived by partitioning the lag interval in equally spaced discrete units and assuming the protracted exposure as a sequence of exposure events xt ? ? at lags ? = ?0 ⦠L. A statistical model for (1) can be defined by expressing the lagâresponse function w(?) as a linear combination of terms obtained through basis transformation with related parameters. By using matrix notation let the vector qxt of exposure history be defined by (2) Such exposure history changes along time depending on the time t at which the vector qxt is computed. Given (2) the cumulative function s(xt) in (1) can be written using a compact and general matrix notation as (3) The (L ? ?0 + 1) à v? matrix C is obtained from the transformation of the lag vector ? = [?0 ⦠? ⦠L]T by choosing a specific basis with dimension v? for w(?) which defines the related basis functions. In this parameterization the function s(xt) representing the integral of x · w(?) over the interval [?0L] is defined as a lagâbasis function with parameters ?. Interestingly the equation in (3) is almost identical to that defining DLMs 24 Eq. (4). The different indexing in the original version reflects the specific application in time series where the data are perfectly ordered in time and the matrix Q has a structure such that qt? ? qt + 1? + 1. However this is a specific case of the general representation in (2)â(3). The theory and software already developed for DLMs can be therefore extended in parallel. Alternative lagâbasis functions for representing s(xt) are derived through different lagâresponse functions w(?) in (1). In particular the traditional index of unweighted cumulative exposure is a specific case of (3) where reduces to with w(?) equal to a constant c. " | Lung_Cancer |
"Nucleosome positioning: multiple mechanisms toward a unifying goal Molecular cell 2012 48 1 2 23062951 24. Hughes A.L. Jin Y. Rando O.J. Struhl K. A functional evolutionary approach to identify determinants of nucleosome positioning: a unifying model for establishing the genome-wide pattern Molecular cell 2012 48 5 15 22885008 25. Nelson J.D. Denisenko O. Bomsztyk K. Protocol for the fast chromatin immunoprecipitation (ChIP) method Nat. Protoc. 2006 1 179 185 17406230 26. Li H. Ruan J. Durbin R. Mapping short DNA sequencing reads and calling variants using mapping quality scores Genome Res. 2008 18 1851 1858 18714091 27. Hartsough M.T. Steeg P.S. Nm23/nucleoside diphosphate kinase in human cancers J. Bioenerg. Biomembr. 2000 32 301 308 11768314 28. Ouatas T. Salerno M. Palmieri D. Steeg P.S. Basic and translational advances in cancer metastasis: Nm23 J. Bioenerg. Biomembr. 2003 35 73 79 12848344 29. Vogelstein B. Kinzler K.W. Cancer genes and the pathways they control Nat. Med. 2004 10 789 799 15286780 30. Thompson W.A. Newberg L.A. Conlan S. McCue L.A. Lawrence C.E. The Gibbs Centroid Sampler Nucleic Acids Res. 2007 35 W232 W237 17483517 31. Postel E.H. Berberich S.J. Rooney J.W. Kaetzel D.M. Human NM23/nucleoside diphosphate kinase regulates gene expression through DNA binding to nuclease-hypersensitive transcriptional elements J. Bioenerg. Biomembr. 2000 32 277 284 11768311 32. Ozanne B.W. McGarry L. Spence H.J. Johnston I. Winnie J. Meagher L. Stapleton G. Transcriptional regulation of cell invasion: AP-1 regulation of a multigenic invasion programme Eur. J. Cancer 2000 36 1640 1648 10959050 33. Weiner A. Hughes A. Yassour M. Rando O.J. Friedman N. High-resolution nucleosome mapping reveals transcription-dependent promoter packaging Genome Res. 2010 20 90 100 19846608 34. Chorley B.N. Campbell M.R. Wang X. Karaca M. Sambandan D. Bangura F. Xue P. Pi J. Kleeberger S.R. Bell D.A. Identification of novel NRF2-regulated genes by ChIP-Seq: influence on retinoid X receptor alpha NucleicAcids Res. 2012 40 7416 7429 35. Lin B. Wang J. Hong X. Yan X. Hwang D. Cho J.H. Yi D. Utleg A.G. Fang X. Schones D.E. Integrated expression profiling and ChIP-seq analyses of the growth inhibition response program of the androgen receptor PLoS One. 2009 4 e6589 19668381 36. Kaplan N. Moore I.K. Fondufe-Mittendorf Y. Gossett A.J. Tillo D. Field Y. LeProust E.M. Hughes T.R. Lieb J.D. Widom J. The DNA-encoded nucleosome anization of a eukaryotic genome Nature 2009 458 362 366 19092803 37. Zawadzki K.A. Morozov A.V. Broach J.R. Chromatin-dependent transcription factor accessibility rather than nucleosome remodeling predominates during global transcriptional restructuring in Saccharomyces cerevisiae Mol. Biol. Cell 2009 20 3503 3513 19494041 38. Casadio F. Lu X. Pollock S.B. Leroy G. Garcia B.A. Muir T.W. Roeder R.G. Allis C.D. H3R42me2a is a histone modification with positive transcriptional effects Proc.Natl. Acad. Sci. U.S.A. 2013 110 14894 14899 23980157 39. Smolle M. Workman J.L. Transcription-associated histone modifications and cryptic transcription Biochim. Biophys. Acta 2013 1829 84 97 22982198 40. Suganuma T. Workman J.L. Chromatin and signaling Curr. Opin. Cell Biol. 2013 25 322 326 23498660 41. Dou Y. Milne T.A. Tackett A.J. Smith E.R. Fukuda A. Wysocka J. Allis C.D. Chait B.T. Hess J.L. Roeder R.G. Physical association and coordinate function of the H3 K4 methyltransferase MLL1 and the H4 K16 acetyltransferase MOF Cell 2005 121 873 885 15960975 42. Cheadle C. Vawter M.P. Freed W.J. Becker K.G. Analysis of microarray data using Z score transformation J. Mol. Diagn. 2003 5 73 81 12707371 43. Fang F. Chang R. Yang L. Heat shock factor 1 promotes invasion and metastasis of hepatocellular carcinoma in vitro and in vivo Cancer 2012 118 1782 1794 22009757 44. Goodarzi H. Elemento O. Tavazoie S. Revealing global regulatory perturbations across human cancers Mol. Cell 2009 36 900 911 20005852 45. Katiyar P. Aplin A.E. FOXD3 regulates migration properties and Rnd3 expression in melanoma cells Mol. Cancer Res. 2011 9 545 552 21478267 46. Milde-Langosch K. Janke S. Wagner I. Schroder C. Streichert T. Bamberger A.M. Janicke F. Loning T. Role of Fra-2 in breast cancer: influence on tumor cell invasion and motility Breast Cancer Res. Treat. 2008 107 337 347 17393299 47. Subramanian A. Tamayo P. Mootha V.K. Mukherjee S. Ebert B.L. Gillette M.A. Paulovich A. Pomeroy S.L. Golub T.R. Lander E.S. Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles Proc. Natl. Acad. Sci. U.S.A. 2005 102 15545 15550 16199517 BMC Cancer BMC Cancer BMC Cancer 1471-2407 BioMed Central 24575749 3996062 1471-2407-14-138 10.1186/1471-2407-14-138 Research Stage and tissue-specific prognostic impact of miR-182 in NSCLC Stenvold Helge 1 2 Helge.Stenvolduit.no Donnem Tom 1 2 Tom.Donnemuit.no Andersen Sigve 1 2 Sigve.Andersenuit.no Al-Saad Samer 3 4 Samer.Al-Saadunn.no Busund Lill-Tove 3 4 Lill-Tove.Busundunn.no Bremnes Roy M 1 2 Roy.Bremnesunn.no 1Institute of Clinical Medicine University of Tromso Tromso Norway 2Department of Oncology University Hospital of North Norway Tromso 9038 Norway 3Institute of Medical Biology University of Tromso Tromso Norway 4Department of Clinical Pathology University Hospital of North Norway Tromso Norway 2014 27 2 2014 14 138 138 25 4 2013 12 2 2014 Copyright 2014 Stenvold et al.; licensee BioMed Central Ltd. 2014 Stenvold et al.; licensee BioMed Central Ltd. This is an Open Access distributed under the terms of the Creative Commons Attribution License (http://creativecommons./licenses/by/2.0) which permits unrestricted use distribution and reproduction in any medium provided the original work is properly credited. Background MicroRNA (miR)-182 is frequently upregulated in cancers has generally been viewed as an oncogene and is possibly connected to angiogenesis. We aimed to explore what impact miR-182 has in non-small cell lung cancer (NSCLC) and more explicitly its correlation with angiogenic markers. Methods From 335 unselected stage I to IIIA NSCLC carcinomas duplicate tumor and tumor-associated stromal cores were collected in tissue microarray blocks (TMAs). In situ hybridization (ISH) was used to detect the expression of miR-182 in tumor cells and immunohistochemistry (IHC) was used to detect the expression of angiogenesis related protein markers. Results In univariate analyses high tumor cell expression of miR-182 was a positive prognostic factor for patients with squamous cell carcinoma (SCC P?=?0.042) and stage II patients (P?=?0.003). Also in the multivariate analysis high tumor cell miR-182 expression was associated with a good prognosis in the same groups (SCC: HR 0.57 CI 95% 0.33-0.99 P?=?0.048; stage II: HR 0.50 CI 95% 0.28-0.90 P?=?0.020). We found significant correlations between miR-182 and the angiogenesis related markers FGF2 HIF2? and MMP-7. Conclusion In patients with SCC and in stage II patients high tumor cell miR-182 expression is an independent positive prognostic factor. NSCLC Stage I-IIIA Survival Prognostic impact miR-182 miRNA Background Lung cancer is despite a small decline in mortality recent years still the number one killer among cancers [1]. Non-small cell lung cancer (NSCLC) accounts for 8085% of all lung cancers. Optimization of treatment with better surgery cytotoxic agents and radiation therapy has not altered the prognosis much. We are now in an era where personalized medicine and targeted therapies may give new hope for this patient group [23]. Identification of novel molecular markers which can improve diagnosis and prognostic stratification and serve as possible therapeutic targets will be of great importance in the near future. MicroRNAs (miRNAs) are small non-coding nucleotides. They post-transcriptionally control the stability and translation of mRNAs. Today we know more than 1500 different miRNAs and each miRNA can regulate several genes [4]. Many miRNAs are located at sites of the genome known to be altered in cancers and are frequently up- or down regulated [5]. The differences in miRNA expression between cancers make it possible to develop specific miRNA profiles for different cancer types [6]. miR-182 is one of the miRNAs often seen up-regulated in cancers. Also in NSCLC several studies have reported miR-182 to be up-regulated and it is generally regarded as an oncogene [7-11]. However results are conflicting concerning its role as an oncogene or tumor suppressor. In NSCLC and other malignancies high miR-182 expression has been associated with cell migration metastatic properties of cancer cells and poor survival [11-13]. Recent studies have however found miR-182 to suppress lung cancer cell proliferation and growth of melanoma cells [14-16]. In a recent study we screened tumor tissues from 10 worst and 10 best prognosis NSCLC cases as well as 10 normal lungs for the expression of several angiogenesis-related miRNAs [17]. miR-182 was the only miRNA among 281 tested to be up-regulated in all three comparisons: worst prognosis versus normal lung best prognosis versus normal lung and worst prognosis versus best prognosis [17]. Besides miR-182 appeared to be connected to angiogenesis according to the Gene Set Enrichment Analyses (GSEA) [17]. Based on these pilot data we have explored the impact of miR-182 in our large unselected cohort of 335 NSCLC cases. In situ hybridization was performed on tissue micro array slides for high-throughput exploration of miR-182s prognostic impact. Since it is known that miRNAs are highly tissue- and stage specific and miR-182 in particular possibly connected to angiogenesis according to the GSEA we aimed to explore 1) the prognostic impact of miR-182 also in the NSCLC subgroups and 2) its association with relevant angiogenic and hypoxia molecular markers. Methods Patients and clinical samples Between 1990 and 2004 371 patients with pathological stage I to IIIA non-small cell lung cancer were diagnosed at the University Hospital of North Norway and Nordland Central Hospital and treated with curative intent. Resected tissues from the primary tumors in these patients were used in our retrospective study. Out of 371 patients 36 were excluded from the study due to radiotherapy or chemotherapy prior to surgery (n?=?10) other malignancy within 5 years before NSCLC diagnosis (n?=?13) or inadequate paraffin-embedded fixed tissue blocks (n?=?13). Adjuvant chemotherapy was not introduced in Norway during this period (1990 2004). Thus 335 patients with complete demographic and clinicopathological data were eligible for this study. Of these postoperative radiotherapy was offered to 55 patients with non-radical surgical margins or mediastinal lymph node disease (N2). This report includes follow-up data as of January 10 2011. The median follow-up time of survivors was 105 months (range 73234). Formalin-fixed paraffin-embedded tumor specimens were obtained from the archives of the Departments of Clinical Pathology at the University Hospital of North Norway and Nordland Central Hospital. The pathological data were revised according to the 7th edition of UICC TNM classification of lung cancer [18]. If the morphological characteristics for adeno- and squamous cell carcinomas were easily recognizable it was not always necessary to do further examinations (IHC) of the tumor samples. If the tumors were not well differentiated IHC was necessary. CK7 TTF1 p63 and CK5/6 was the markers most frequently used. The National Data Inspection Board and the Regional Ethics Committee North (REC North) approved this study. Microarray construction We used a 0.6 mm-diameter stylet to sample two cores with neoplastic tissue and two cores with tumor stroma from different areas of the primary tumors from each patient. Normal lung tissue localized distant from the tumor and lung tissue sample from 20 patients without cancer diagnosis were used as controls. The TMAs were assembled using a tissue-arraying instrument (Beecher Instruments Silver Springs Md). Eight tissue microarray blocks were made to include all the tissue samples. Multiple 4-?m-sections were cut with a Micron microtome (HM355S) and stained by specific antibodies for immunohistochemical analyses or stained by in situ hybridization. The detailed methodology has been previously reported [19]. In situ hybridization (ISH) In situ hybridization was performed following the protocol developed by Exiqon Vedbaek Denmark [20]. Digoxigenin (DIG) labelled locked nucleic acid (LNA) modified probes from Exiqon for miR-182 (hsa-miR-182) positive control (U6 hsa/mmu/rno) and negative control (scramble-miR) were used in this study. Some adjustments were done to get a specific and sensitive detection of miRNA in our sections from formalin-fixed paraffin-embedded (FFPE) TMA blocks. We placed 4 ?m sections of the TMA blocks in a heater at 59?C over night to attach cores to Super Frost Plus slides. Sections were deparaffinised with xylene (3 Ã 5 min) and then rehydrated with ethanol solutions (99.9% - 96% - 70%) ending up in PBS pH 7.4. Proteinase-K (20 ?g/ml) (Exiqon Vedbaek Denmark) treatment was done in PK-buffer (5 mM TrisHCl pH 7.5 1 mM EDTA 1 mM NaCl autoclaved) at 37?C for 20 min in a HYBrite automated hybridizer (Abbot laboratories IL US). After a PBS wash the sections were dehydrated through increasing gradient of ethanol solutions and air-dried. The LNA-probes were denatured by heating to 90?C for 4 min. Hybridization of the LNA-probe miR-182 (100nM) and scramble miR (50nM) control was carried out in the HYBrite automated hybridizer at 50?C for 60 min. The positive control U6 (1nM) was hybridized at 55?C for 60 min. Stringent washes was performed in pre-heated SSC buffers 1 Ã 5 min in 5x SSC 2 Ã 5 min in 1Ã SSC and 02Ã SSC. Sections were blocked against unspecific binding in blocking solution from DIG wash and Block Buffer set (Roche Mannheim Germany) for 15 min at room temperature (RT). Alkaline phosphatase (AP)-conjugated anti-DIG (Roche) 1:800 was incubated for 60 min at RT for immunologic detection. After PBS-T wash the substrate enzymatic reaction was carried out with NBT/BCIP (Roche) at 30?C in the hybridizer for 120 min. The reaction was stopped with a 2 Ã 5 min wash in KTBT buffer (50 mM TrisHCl 150 mM NaCl 10 mM KCl). Sections were counter stained with nuclear fast red (WALDECK ZE-012-250) at RT for 1 min and then rinsed in tap water. Dehydration followed through increasing gradient of ethanol solutions and finally mounting with Histokitt mounting medium (Assistant-Histokitt 1025/250). Immunohistochemistry (IHC) We used data from previous publications with the following antibodies for correlation analyses: VEGF (?A C -D R-1 R-2 R-3) PDGF (?A -B C -D R-? R-?) FGF (?2 R-1) Notch (?1 -2) Jagged1 DLL4 Hif (?1? -2?) GLUT-1 LDH5 CAIX PHD (?1-2 -3) FIH Ang (?1-2 -4) Tie-2 and MMP (?2-7 -9). Detailed IHC procedures for the antibodies which correlated significantly with miR-182 (FGF2 Hif2? and MMP-7) have been previously published [21-23]. Scoring of ISH Representative viable tissue sections were scored semi-quantitatively by light microscopy. The dominant staining intensity in tumor cells was scored as 0?=?negative 1?=?weak 2?=?intermediate or 3?=?strong (Figure 1). The TMA cores were scored anonymously and independently by one experienced pathologist and one oncologist. In case of disagreement the slides were reexamined and consensus was reached by the observers. Figure 1 In situ hybridization (ISH) analysis of non-small-cell lung cancer. Scoring intensities based on blue cytoplasmatic staining graded from 03 in tumor cells. A: score 0; B: score 1; C: score 2; D; score 3. Mean score for duplicate cores from each individual was calculated in tumor epithelial cells. We then categorized the staining into high and low expression. High expression in tumor cells was defined as score >0. Statistical methods All statistical analyses were performed using the statistical package SPSS (Chicago IL) version 19.0. The chi-square test and the Fisher exact test were used to examine the association between molecular marker expression and the clinicopathological markers. Correlations between markers were assessed using Spearmans rank correlation. Univariate analyses were done using the Kaplan-Meier method and statistical significance between survival curves was assessed by the log-rank test. Disease-specific survival (DSS) was defined as time from surgery to lung cancer death. Variables of significant value from the univariate analyses were entered into multivariate analysis using the backward stepwise Cox regression analysis. A P?<?0.05 was considered statistically significant. Ethics The National Data Inspection Board and the Regional Ethics Committee North (REC North) approved this study. Information and subsequent written consent from patients was considered but as this was a retrospective study with more than half of patients deceased the rest of the patients having to be reminded about the death rate of the disease and the possible raising of unrealistic hope for the individual The Norwegian Data Inspection Board and REC North specifically waived the need for consent. All the patient data were anonymized after collecting the clinicopathological variables for each patient and before doing the statistical analyses. Results Patient characteristics Demographic" | Lung_Cancer |
"FISH analysis was performed on the 297 cases to evaluate ALK gene rearrangement status. Two hundred and eighty-six out of 297 cases were informative for FISH analysis and 33 cases were identified with ALK+?(E). Thirty of the 33 ALK+?cases showed strong ALK expression and the other 3 showed weak ALK expression. Therefore there were 11 cases that showed ALK expression but were ALK-. We re-reviewed the FISH slides of the 11 discordant cases (2 cases with strong and 9 cases with weak ALK expression) and 3 cases (1 with strong and 2 with weak ALK expression) were identified as ALK+?while 8 (1 case with strong and 7 with weak ALK expression) were still ALK- ( F). Regarding the 3 ALK+?cases which were not identified by the original FISH analysis a case-by-case analysis revealed the following: Case 1 The dominant FISH signal pattern in this case was more than one copy of a single green signal without a corresponding orange signal in addition to fused signals (D). According to the ALK signal enumeration guide this indicated a deletion of the orange portion of the ALK probe which targeted the drug targeting area. Therefore we initially considered this case as negative. After re-reviewing the FISH analysis we found there were some areas containing scattered ALK+?cells with one or more copies of single green signals in addition to fused signals and a single red signal. The first 50 cells counted revealed 8 ALK+?cells. The second and third cell count in another 100 cells by different readers revealed 6 and 7 ALK+?cells respectively. If the first and third 50-cell count was considered the average percentage of positive cells reached 15%. Therefore this sample should be considered positive. Case 1 and 3 For these two cases originally constructed on TMA and IHC analysis showed strongly positive staining in one core and weakly positive staining in the other. After re-reviewing the FISH slides we found that there was indeed a small area of each core with a few cells containing subtle break-apart signals. As cell counts were difficult to perform in small areas containing not many cancer cells we cut the tissue sections. The IHC analysis still demonstrated strongly and weakly positive ALK expression respectively. The FISH analysis in the tissue sections showed ALK+. According to the final result of FISH analysis 36 out of the 286 lung adenocarcinoma cases were identified with ALK+. None of IHC negative cases were ALK+ demonstrating 100% sensitivity. Eight IHC-positive cases (1 strongly and 7 weakly positive cases) did not show ALK gene rearrangement resulting in 81.8% specificity. The concordance rate of IHC and FISH is 97.2% (). qRT-PCR and VENTANA ALK IHC analysis of discordant cases To further identify whether eight discordant cases of IHC and FISH carried ALK fusion at the RNA level a qRT-PCR analysis was applied. Positive qRT-PCR results were observed in 5 cases (1 strongly and 4 weakly positive cases) (). Among the 5 cases 3 (1 strongly and 2 weakly positive cases) were shown to have ALK expression using VENTANA ALK IHC analysis (G). The ALK fusion in these 3 cases was detected at around 14 of 30 qRT-PCR cycles (J). Regarding the other two cases although weak staining in cancer cells could be observed (H) they were considered negative according to the manufacturers scoring algorithm (details in Materials and Method section). The ALK fusion in these 2 cases was detected at around 28 of 30 qRT-PCR cycles (K). The remaining 3 of the 8 discordant cases showed neither VENTANA ALK staining nor ALK fusion (Figures 1I and 1L). VENTANA IHC and qRT-PCR analysis of all weakly positive and discordant cases detected by CST ALK (D5F3) Sample ID FISH IHC (CST) IHC (VENTANA) qRT-PCR Variant type 9 Positive 1+ Positive EML4-ALK variant 1/2/3a/3b 37 Positive 1+ Positive EML4-ALK variant 1/2/3a/3b 67 Positive 1+ Positive EML4-ALK variant 1/2/3a/3b 94 Positive 1+ Positive EML4-ALK variant 1/2/3a/3b 98 Positive 1+ Positive EML4-ALK variant 1/2/3a/3b 28 Negative 2+ Positive EML4-ALK variant 1/2/3a/3b 171 Negative 1+ Positive EML4-ALK variant 1/2/3a/3b 203 Negative 1+ Positive EML4-ALK variant 1/2/3a/3b 21 Negative 1+ Negative EML4-ALK variant 1/2/3a/3b 36 Negative 1+ Negative EML4-ALK variant 1/2/3a/3b 41 Negative 1+ Negative Negative 39 Negative 1+ Negative Negative 74 Negative 1+ Negative Negative VENTANA ALK IHC and qRT-PCR assays were also applied to the remaining 5 of the 12 ALK weakly expressed cases which were concordant with FISH analysis. These 5 cases were shown to have ALK expression detected by VENTANA ALK IHC and ALK fusion revealed by qRT-PCR analysis (). Clinicopathological characteristics of patients with ALK+ Using FISH analysis as a standard detection method the clinicopathological characteristics of the ALK+?and ALK- patients were compared and the results are shown in . As the median ages of the positive and negative groups were 48 and 58 years respectively the ALK+ patients were significantly younger (p <0.001). Patients with ALK+ were more likely to have lymph node metastasis compared to ALK- patients (p = 0.002). No correlation was observed between ALK+ and ALK- cases in terms of sex smoking habit tumor size pT M factors or pathologic TNM stage." | Lung_Cancer |
"In the present study however a subset of pure GGNs were pathologically diagnosed as invasive adenocarcinoma. This discrepancy between radiological and pathological findings could be explained by a partial volume effect which means that when the slice thickness is relatively high (22.5 mm) detection of small nonaerated components may be difficult because of inadequate spatial resolution [9] [10] [11]. Although all CT images were acquired by using high resolution CT at a 1.25-mm slice thickness in the present study a much higher resolution may be needed to detect small nonaerated invasion. Meanwhile in some invasive adenocarcinomas sparsely proliferated areas are histologically recognized in papillary or acinar lesions and these sparsely invasive lesions could be aerated and thus depicted as nonsolid portions on CT images. Recently limited resection for early-stage lung cancers has been advocated for preserving lung function [12]. However there are currently no established criteria for the indication of limited resection. Suzuki et al. demonstrated the prognostic importance of the extent of central fibrosis. In their study the 5-year survival rate was reported to be 100% if the region of central fibrosis was ?5 mm 72% if the region was between 5 and 15 mm and 40% if the region was >15 mm [13]. In the new adenocarcinoma classification proposed by IASLC/ATS/ERS in 2011 a new concept of minimally invasive adenocarcinoma for lepidic predominant tumors with ?5-mm invasion was recommended in order to distinguish these tumors from invasive adenocarcinomas in which invasion is >5 mm [8]. Yoshizawa et al. reported in their analysis of 514 stage I adenocarcinoma cases that AIS and MIA were associated with a 100% 5-year disease-free survival rate after complete resection [14]. These findings suggest that limited resection might be indicated for adenocarcinoma cases classified as AIS/MIA. For feasibility in clinical practice accurate preoperative differentiation of AIS/MIA from invasive adenocarcinoma is important. In the present study upon ROC curve analyses for predicting invasive adenocarcinoma tumor size and mean CT attenuation yielded AUC values of 0.75 and 0.77 respectively. AUC values between 0.7 and 0.9 are thought to indicate a moderately accurate test [15] suggesting that these two parameters may represent useful predictors of invasive adenocarcinoma in cases of pulmonary pure GGNs. Moreover ROC curve analysis of the combination of the two factors resulted in an AUC of 0.82 suggesting that the use of this combination may facilitate more accurate prediction of invasive adenocarcinoma than the use of these factors individually. However the usefulness of tumor size and CT attenuation as predictive factors for the invasiveness of pure GGNs should be confirmed in further large-scale studies and additional accurate tests should be established in order to facilitate preoperative decision making regarding surgical procedures for pulmonary pure GGNs. This present study has a number of limitations. First the small number of patients analyzed and the retrospective nature of the analysis may have affected our results. A second limitation of our study was that the mean CT attenuation value of pure GGNs was evaluated only in the slice containing the part of the lesion with its maximum diameter and thus this value could potentially be quite different from that of the entire tumor. Conclusions A subset of pulmonary pure GGNs have histological invasive areas that cannot be recognized as solid components on CT and in this study we found that tumor size and CT attenuation in cases of pure GGNs could successfully predict pathological invasiveness. The combination of tumor size and CT attenuation might enable a more accurate prediction of invasive adenocarcinoma than the two factors individually and further large-scale studies should be conducted to confirm these results. References 1 KondoR YoshidaK KawakamiS ShiinaT KuraiM et al (2011) Efficacy of CT screening for lung cancer in never-smokers: " | Lung_Cancer |
"A single intratumoral injection of Ad-REIC significantly inhibited the tumorigenic growth of A549 cells in vivo. As predictive factors of sensitivity for Ad-REIC treatment in NSCLC we examined the expression status of GRP78 and coxsackievirus and adenovirus receptor (CAR). We found that the combination of the GRP78 and CAR expressional statuses may be used as a predictive factor for Ad-REIC sensitivity in NSCLC cells. Conclusion Ad-REIC induced JNK activation and subsequent apoptosis in NSCLC cells. Our study indicated that Ad-REIC has therapeutic potential against NSCLC and that the expression statuses of GRP78 and CAR may predict a potential therapeutic benefit of Ad-REIC. No current funding sources for this study. Introduction Lung cancer is the most common cause of death from cancer worldwide and the metastatic form is a major factor leading to mortality [1]. There are two major histological subtypes of lung cancer: non-small cell lung cancer (NSCLC) and small cell lung cancer. Recent intensive studies have identified causative molecular alterations that have directly led to the development of new therapeutic strategies and have improved patient prognosis [2]. For example mutations of the epidermal growth factor receptor gene (EGFR) are found in approximately 30% of NSCLCs especially in lung adenocarcinomas and EGFR-tyrosine kinase inhibitors (TKIs) are particularly effective in these tumors [3] [4]. More recently crizotinib has been shown to be effective for NSCLCs with an EML4-ALK fusion gene [5] [6]. However the number of patients with these alterations is limited and little improvement in prognosis has been obtained in NSCLCs without these drug-sensitive alterations. Furthermore acquired resistance eventually occurs in the majority of EGFR-mutant tumors which had previously responded to EGFR-TKI after an average of 10 months of treatment [7]. Thus a new therapeutic modality is needed to improve the clinical outcome of patients with lung cancer. REIC/Dkk-3 a member of the Dickkopf (Dkk) gene family is originally found in immortalized cells and has been reported to be a tumor suppressor; its expression is significantly down-regulated in a broad range of cancer cell types including lung cancer [8]. The heatmap image of messenger RNA (mRNA) expression of REIC/Dkk-3 gene from the UCSC Cancer Genome Browse which is freely available public database (://genome-cancer.ucsc.edu/) (we downloaded the data on July 16 2013) showed that REIC/Dkk-3 gene expression was reduced in majority of examined samples of both lung adenocarcinomas and squamous cell carcinomas compared with normal lung tissues (Figure S1). In addition it could be confirmed from a public database that expression of REIC/Dkk-3 was also low in many NSCLC cell lines (Gene Expression Omnibus repository [http://www.ncbi.nlm.nih.gov/geo GEO accession GSE4824]). REIC/Dkk-3 is known to interfere with Wnt signaling via Wnt receptors [9] [10] and was previously reported to play a distinct role in the induction of apoptosis and the inhibition of metastasis [11] [12]. The induction of apoptosis in cancer cells is mainly caused by endoplasmic reticulum (ER) stress induced by the overproduction of REIC/Dkk-3 in the cells. ER stress triggers the activation of c-Jun N-terminal kinase (JNK) which is a critical event in apoptosis induced by the overproduction of REIC/Dkk-3 using an adenovirus vector (Ad-REIC) [11] [13]. In our previous studies we found that Ad-REIC had a therapeutic effect on various types of human cancer including the prostate testis pleura and breast carcinomas [11] [13][15]. Ad-REIC infection and REIC/Dkk-3 protein are also known to up-regulate the anti-tumor immunosystem [16]. Based on preclinical data a clinical trial using Ad-REIC for human prostate cancer has been ongoing in Japan and the USA (NCT01197209). In this study we investigated the therapeutic effect of Ad-REIC on NSCLC cells in vitro and in vivo. We also examined factors related to the sensitivity of cell lines to Ad-REIC as a step toward the development of customized Ad-REIC therapy for patients with NSCLC. Materials and Methods Ethics Statement This study was carried out in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. The protocol was approved by the Animal Care and Use Committee of Okayama University (Permit Number: OKU-2012-549)." | Lung_Cancer |
"Thymidylate synthase (TS) gene expression in primary lung cancer patients: a large-scale study in Japanese population Ann Oncol 2011 22 1791 1797 10.1093/annonc/mdq730 21321092 Bosch-Barrera J Gazta±aga M Ceballos J Prez-Gracia JL Lpez-Picazo JM Garca-Foncillas J Ferrer M Sanz ML Pretel M Idoate MA Gil-Bazo I Toxic epidermal necrolysis related to pemetrexed and carboplatin with vitamin B12 and folic acid supplementation for advanced non-small cell lung cancer Onkologie 2009 32 580 584 10.1159/000232315 19816075 Bosch-Barrera J Montero A Lpez-Picazo JM Garca-Foncillas J Ferrer M Yuste JR Gil-Bazo I Adult onset Still's disease after first cycle of pemetrexed and gemcitabine for non-small cell lung cancer Lung Cancer 2009 64 124 126 10.1016/j.lungcan.2008.09.013 19008012 Michels J Spano JP Brocheriou I Deray G Khayat D Izzedine H Acute tubular necrosis and interstitial nephritis during Pemetrexed therapy Case Rep Oncol 2009 2 53 56 10.1159/000208377 20740145 Lurje G Manegold PC Ning Y Pohl A Zhang W Lenz HJ Thymidylate synthase gene variations: predictive and prognostic markers Mol Cancer Ther 2009 8 1000 1007 19383851 Salgado J Zabalegui N Gil C Monreal I Rodrguez J Garca-Foncillas J Polymorphisms in the thymidylate synthase and dihydropyrimidine dehydrogenase genes predict response and toxicity to capecitabine-raltitrexed in colorectal cancer Oncol Rep 2007 17 325 328 17203168 Bosch-Barrera J Garca-Franco C Guilln-Grima F Moreno-Jimnez M Lpez-Picazo JM Gºrpide A Prez-Gracia JL Aristu J Torre W Garca-Foncillas J Gil-Bazo I The multimodal management of locally advanced N2 non-small cell lung cancer: is there a role for surgical resection? A single institution's experience Clin Transl Oncol 2012 14 835 841 10.1007/s12094-012-0874-3 22855163 Takezawa K Okamoto I Okamoto W Takeda M Sakai K Tsukioka S Kuwata K Yamaguchi H Nishio K Nakagawa K Thymidylate synthase as a determinant of pemetrexed sensitivity in non-small cell lung cancer Br J Cancer 2011 104 1594 1601 10.1038/bjc.2011.129 21487406 Shintani Y Ohta M Hirabayashi H Tanaka H Iuchi K Nakagawa K Maeda H Kido T Miyoshi S Matsuda H New prognostic indicator for non-small-cell lung cancer quantitation of thymidylate synthase by real-time reverse transcription polymerase chain reaction Int J Cancer 2003 104 790 795 10.1002/ijc.11014 12640689 Hu Q Li X Su C Chen X Gao G Zhang J Zhao Y Li J Zhou C Correlation between thymidylate synthase gene polymorphisms and efficacy of pemetrexed in advanced non-small cell lung cancer Exp Ther Med 2012 4 1010 1016 23226765 Shi Q Zhang Z Neumann AS Li G Spitz MR Wei Q Casecontrol analysis of thymidylate synthase polymorphisms and risk of lung cancer Carcinogenesis 2005 26 649 656 15579479 Wang X Wang Y Wang Y Cheng J Wang Y Ha M Association of thymidylate synthase gene 3?-untranslated region polymorphism with sensitivity of non-small cell lung cancer to pemetrexed treatment: TS gene polymorphism and pemetrexed sensitivity in NSCLC J Biomed Sci 2013 20 5 10.1186/1423-0127-20-5 23350714 Giovannetti E Lemos C Tekle C Smid K Nannizzi S Rodriguez JA Ricciardi S Danesi R Giaccone G Peters GJ Molecular mechanisms underlying the synergistic interaction of erlotinib an epidermal growth factor receptor tyrosine kinase inhibitor with the multitargeted antifolate pemetrexed in non-small-cell lung cancer cells Mol Pharmacol 2008 73 1290 1300 10.1124/mol.107.042382 18187583 Cancer Cancer 10.1002/(ISSN)1097-0142 CNCR Cancer 0008-543X 1097-0142 Wiley 24501009 4164026 10.1002/cncr.28561 CNCR28561 Original Original s Disease Site Chest and Lung Disease A phase 2 trial of dacomitinib (PF?00299804) an oral irreversible pan?HER (human epidermal growth factor receptor) inhibitor in patients with advanced nonsmall cell lung cancer after failure of prior chemotherapy and erlotinib Dacomitinib After Chemotherapy and Erlotinib Reckamp et al Reckamp Karen L. MD * 1 Giaccone Giuseppe MD 2 Camidge D. Ross MD 3 Gadgeel Shirish M. MD 4 Khuri Fadlo R. MD 5 Engelman Jeff A. MD 6 Koczywas Marianna MD 1 Rajan Arun MD 2 Campbell Alicyn K. MPH 7 11 Gernhardt Diana 7 Ruiz?Garcia Ana PharmD PhD 8 Letrent Stephen PharmD 8 12 Liang Jane PhD 7 Taylor Ian PhD 7 O'Connell Joseph P. MD 9 Jnne Pasi A. MD 10 1 City of Hope Duarte California 2 National Cancer Institute Bethesda Maryland 3 University of Colorado Denver Aurora Colorado 4 Karmanos Cancer Institute/Wayne State University Detroit Michigan 5 Winship Cancer Institute of Emory University Atlanta Geia 6 Massachusetts General Hospital Cancer Center Boston Massachusetts 7 Pfizer Oncology Groton Connecticut 8 Pfizer Oncology La Jolla California 9 Pfizer Oncology New York New York 10 Dana?Farber Cancer Institute Boston Massachusetts 11 Genentech San Francisco California 12 Kyowa Hakko Kirin Co. Ltd. San Diego California *Corresponding author: Karen L. Reckamp MD City of Hope 1500 East Duarte Road Duarte CA 91010; Fax: (626) 930?5461; kreckampcoh. 08 4 2014 05 2 2014 120 8 10.1002/cncr.v120.8 1145 1154 23 9 2013 15 11 2013 12 12 2013 2014 The Authors. Cancer published by Wiley Periodicals Inc. on behalf of American Cancer Society. This is an open access under the terms of the Creative Commons Attribution?NonCommercial?NoDerivs License which permits use and distribution in any medium provided the original work is properly cited the use is non?commercial and no modifications or adaptations are made. BACKGROUND This phase 2 trial (ClinicalTrials.gov identifier NCT00548093) assessed the efficacy safety and impact on health?related quality of life of dacomitinib (PF?00299804) an irreversible tyrosine kinase inhibitor (TKI) of human epidermal growth factor receptors (EGFR)/HER1 HER2 and HER4 in patients with KRAS wild?type nonsmall cell lung cancer (NSCLC). METHODS Patients with advanced NSCLC progression on 1 or 2 regimens of chemotherapy and erlotinib KRAS wild?type or known EGFR?sensitizing mutant tumor and Eastern Cooperative Oncology Group performance status of 0 to 2 received 45 mg of dacomitinib once daily continuously in 21?day cycles. RESULTS A total of 66 patients enrolled (adenocarcinoma n?=?50; those without adenocarcinoma [nonadenocarcinoma] n?=?16)." | Lung_Cancer |
"which was then transferred to a polyvinylidene difluoride membrane (Millipore Billerica MA) by using a transfer apparatus according to the manufacturer's protocols. Membranes were blocked with 3% nonfat milk in TBST buffer (10 mM Tris-HCl pH 8.0 150 mM NaCl and 0.05% Tween 20) for 1 h washed in the same buffer and incubated with antibodies against Sp1 (Millipore) GFP (Clontech Palo Alto CA) FOXO3 (Genetex Hsinchu Taiwan) tubulin (Sigma-Aldrich St. Louis MO) N-cadherin (Cell Signaling Technology Beverly MA) ?-catenin (Cell Signaling Technology) and vimentin (Epitomics Burlingame CA) at 4? overnight. Membranes were washed three times for 10 min and incubated with the secondary antibody (goat anti-rabbit or anti-mouse immunoglobulin G linked with horse radish peroxidase (Millipore)) for 1 h at room temperature. After three more washes the protein bands were detected with the ECL Western blotting Detection System (Millipore) and recorded with the FluorChem image analysis system (Alpha Innotech San Leandro CA). Band intensities were quantified with Scion image software (Scion Frederick MD). Luciferase reporter assay Cells were transiently cotransfected with reporter plasmids (pGL2-miR-182 pGL2-miR-182 mutants pGL3-FOXO3-3'UTR or pGL2-FOXO3) and expression plasmids of interest using Lipofectamine 2000. Luciferase activity in cell lysates was determined by luminometer (LB9506; Berthold Technologies Bad Wildbad Germany) and normalized to total protein concentration. For construction genomic DNA of A431 cells were prepared. The miR-182 promoter (-1000/+50) was produced by PCR using primers: F 5'-GGG CAG GCA GCC TGC ACC CT-3' and R 5'-CAC CAG TGT GAG TTC TAC CAT TGC-3'. The FOXO3 (-1000/+50) promoter was produced by PCR using primers: F 5'-ACG CGT CGA GCT GAC AGG CGG TTC-3' and R 5'-AGA TCT CGC CCC CCG GCC AGG CCG-3'. After amplification and purification the DNA fragments were ligated to pGL2 vector using restriction enzymes KpnI and BglII for pGL2-miR-182 MluI and BglII for pGL2-FOXO3 (New England Biolabs Ipswich MA). For construction of pGL3-FOXO3-3'UTR cDNA of H1299 cells was prepared. The FOXO3 3'UTR was produced by PCR using primers: F 5'-TCT AGA AGG ATC ACT GAG GAA GGG-3' and R 5'-TCT AGA TCT GCA AAG CAA AAC AGG-3'. After amplification and purification the DNA fragments were ligated to pGL3 vector using restriction enzymes XbaI. For construction of pGL2-miR-182 mutants the pGL2-miR-182 plasmid was used as the template for mutagenesis of Sp1-binding sites. Primers for mutations of site 1 (-433C/-434G to?433A/-434A): F 5'-CTT AGT AAA TAG CAA AAC CCA AAC CAC ATT AGC CAT CTC TTC CC-3' and R 5'- GGG AAG AGA TGG CTA ATG TGG TTT GGG TTT TGC TAT TTA CTA AG-3'; and for site 2 (-398C/-399G to?398A/-399A): F 5''-CCA GCG CCC AGG GAA AGG GCT CTC TGG C-3' and R 5'- GCC AGA GAG CCC TTT CCC TGG GCG CTG G?3'. Mutagenesis was performed by PCR using plaque-forming unit DNA polymerase (Agilent Technologies Santa Clara CA). Chromatin immunoprecipitation (ChIP) assay The protocol for ChIP was performed as described previously [23]. Briefly formaldehyde-fixed DNAprotein complex was immunoprecipitated with 5 mg of normal rabbit IgG anti-acetyl-Histone H3 (Millipore) or anti-Sp1 antibodies. Immunoprecipitated DNA was analyzed by PCR. The primer sequences for promoter of miR-182 in PCR analyses were as follows: F 5'-ACT TCC CTC TCT CCC TTT GG-3' and R 5'-CAC CTG ACA GCA GGG ACT CA-3'. The primer sequences for promoter of miR-212 in PCR analyses were as follows: F 5'-AGC GGA GCT GTC CTC TCA G-3' and R 5'-CCG GGC AGT AAG CAG TCT A-3'. The primer sequences for promoter of p21 in PCR analyses were as follows: F 5'- ACC AAC GCA GGC GAG GGA CT-3' and R 5'- CCG GCT CCA CAA GGA ACT GA?3'. DNA affinity precipitation assay (DAPA) The DNA oligonucleotides (miR-182 5'-AAA ACC CAG CCC ACA TTA GCC ATC TCT TCC CCA GCG CCC AGG GGC AGG GCT CT-3'; miR-212 5'-GAC CGG GGG GGC GGG GCC TCC CAG GTC CCG CCC CGC CCC CAC GCC CCC GCC GG-3'; and p21 5'- CCC GCC TCC TTG AGG CGG GCC CGG GCG GGG CGG-3') were biotinylated at 5' end and then annealed with their complementary strands. The assay was performed by incubating 1 ?g of biotin-labeled probe with cell extract in 1 ml of DAPA buffer (60 mM KCl 12 mM HEPES pH 7.9 4 mM Tris-HCl 5% glycerol 0.5 mM EDTA and 1 mM dithiothreitol). After incubation for 1 h at 4? DNAprotein complexes were then incubated with 20 ?l of streptavidin-agarose (Sigma-Aldrich) for 1 h at 4?. DNAprotein complexes were then washed three times in the DAPA buffer. Clinical specimens of patients with lung adenocarcinoma Human clinical specimens used in this study were approved by the Clinical Research Ethics Committee at the Medical Center of National Cheng Kung University (Tainan Taiwan). After surgical resection at National Cheng Kung University Hospital specimens of patients with lung adenocarcinomas were collected for immunohistochemical analysis RT-PCR or Western blotting. shRNA lentivirus production We purchased scramble Sp1 and FOXO3 shRNA from National RNAi Core Facility in Academia Sinica of Taiwan (Taipei Taiwan) and miRZip and miRZip-182 from SBI (System Biosciences CA). The lentiviruses were obtained from RNAi Core of Research Center of Clinical Medicine National Cheng Kung University Hospital. (The protocol is described below-293T cells were cotransfected with 5 ?g of packaging plasmid (pCMV?R8.91) 0.5 ?g of envelop plasmid (pMD.G) and 5 ?g of pLKO.1 shRNA using Lipofectamine 2000 for 6 h. After 24 h incubation the supernatants containing viral ps were harvested and filtered through 0.45 mm filters.) Fluorescence-activated cell sorting (FACS) The miRZip and miRZip-182 stable expression H1299 cells were washed with PBS and fixed in cold 70% ethanol overnight at 4 Cells were then washed with cold PBS and permeabilized with 0.1% Triton X-100 for 10 min. After treatment with 10 ?g/ml RNase A (Qiagen Germantown MD) at 37 for 1 h cells were stained with 50 ?g/ml propidium iodide (Sigma-Aldrich) at room temperature for 2 h. Finally cells were analyzed by flow cytometer on the FACSCalibur (BD Biosciences Franklin Lakes NJ). Xenograft study The animal experiment was approved by the Institutional Animal Care and Use Committee at National Cheng Kung University. Female SCID mice were purchased from National Laboratory Animal Center in Taiwan. The miRZip and miRZip-182 stable expression H1299 cells (106 cells) were suspended in 100 ?l of PBS and implanted into the back of SCID mice. Immunohistochemistry (IHC) The experimental process of IHC was performed as described in our previous study [32]. Briefly blocked histological sections were stained with the anti-Sp1 or anti-FOXO3 antibodies. The immunoreactivity was detected by a Vectastain ABC kit (Vector Laboratories Burlingame CA). Quantitative PCR Quantitative Real-time PCR was performed using SYBR Premix Ex Taq (Takara Bio Otsu Shiga Japan) in a CFX96TM Real-Time System and C1000 TM Thermal Cycler (BIO-RAD Hercules CA). The primers for quantitative PCR were as follows: Firefly luciferase F 5'-TCA AAG AGG CGA ACT GTG TG-3' R 5'-GGT GTT GGA GCA AGA TGG AT-3'. Immunofluorescent staining The miRZip and miRZip-182 stable expression H1299 cells were seeded onto coverslips (with a thickness of 0.17 mm) and incubated for 24 h. After fixation with 4% paraformaldehyde (Sigma-Aldrich) in PBS for 15 min and permeabilization with 1% Triton X-100 for 5 min cells on the coverslip were blocked with 1% bovine serum albumin (Sigma-Aldrich) for 1 h and stained with the antibody against F-Actin by using Alexa Fluor 568-conjugated phalloidin (Invitrogen) for 1 h at room temperature. Subsequently cells on the coverslip were washed with PBS three times. Finally cells were mounted in Prolong Gold antifade reagent with DAPI (Invitrogen) and examined using immunofluorescence microscope (Delta Vision Personal DV). The images were analyzed with softWoRx software (Applied Precision). Wound-healing assay The miRZip and miRZip-182 stable expression H1299 cells (1.5 x 106) were seeded in 6 cm dish and cultured for 24 h the linear wound of cellular monolayer was created by scratching confluent cell monolayer using a plastic pipette tip. The monolayer of Scratched cell was washed by PBS to remove debris. After incubation at 37? with 5% CO2 for 16 h area of migration was photographed under light microscope for evaluation. Transwell migration assay The cell migration assay was performed using Transwell system with an 8 mm pore size polycarbonate filter membrane (Corning Costar Cambridge MA). Cells were trypsinized and suspended in serum-free DMEM. Upper wells were filled with cell suspensions in serum-free DMEM and lower wells were filled with DMEM containing 10% fetal bovine serum. After incubation for 14 h at 37? with 5% CO2 the lower side of filter membrane was fixed with methanol and stained with DAPI. The migrated cells were counted under a fluorescent microscope and quantified by Image J software " | Lung_Cancer |
" Patient characteristics in the thoracic surgery and non-thoracic surgery groups All cases (n?=?185) Non-surgery (n?=?50) Surgery (n?=?135) p value Cases 100 (185) 27.0 (50) 73.0 (135) 0.0001 # Age years a 70.3 (3988) 74.6 (6280) 68.7 (3986) 0.0001 # Sex male 72.4 (134) 76.0 (38) 71.1 (96) 0.581 History of smoking 78.9 (213) 82.0 (41) 77.0 (104) 0.549 COPD diagnosed b 49.7 (92) 66.0 (33) 43.7 (59) 0.012 # COPD managed c 9.2 (17) 20.0 (10) 5.2 (7) 0.004 # COPD-related systemic comorbidities 57.3 (106) 60.0 (30) 56.3 (76) 0.739 Diabetes 20.0 (37) 30.0 (15) 16.3 (22) 0.061 Ischemic disease 7.6 (14) 10.0 (5) 6.7 (9) 0.532 Hypertension 40.5 (75) 40.0 (20) 40.7 (55) 1.000 Hyperlipidemia 11.4 (21) 10.0 (5) 11.8 (16) 0.799 n indicates number. aData are shown as mean (range). bindicates the patients who were firstly diagnosed as COPD at bronchoscopy. cindicates the patients who had been diagnosed as COPD before bronchoscopy. All other data are shown as% (numbers). #p?<?0.05. COPD: chronic obstructive pulmonary disease. Physical assessment variables among patients having thoracic surgery and non-thoracic surgery All cases (n?=?185) Non-surgery (n?=?50) Surgery (n?=?135) p value BMI (kg/m 2 ) a 22.2 (3.0) 22.3 (2.4) 22.1 (3.2) 0.760 Spirometric variables %VC a 108.8 (20.6) 104.5 (20.4) 110.4 (19.6) 0.031 FEV1 (ml) a 2126 (612) 1810 (591) 2242 (580) 0.0001 # FEV1/FVC a 67.6 (13.0) 62.7 (17.0) 69.5 (10.7) 0.01 # %FEV1 predicted a 101.4 (25.5) 93.7 (28.7) 104.3 (23.7) 0.020 # %IC a 87.8 (18.9) 85.3 (19.7) 88.7 (18.6) 0.314 Severity of airway obstruction 0.002 # Non-COPD 50.2 (93) 34.0 (17) 56.3 (76) ## GOLD grade 1 34.6 (64) 44.0 (22) 31.1 (42) GOLD grade 2 10.8 (20) 10.0 (5) 11.1 (15) GOLD grade 3 4.3 (8) 12.0 (6) 1.5 (2) ## GOLD grade 4 0 (0) 0 (0) 0 (0) Chest CT finding Emphysema 30.8 (57) 36.0 (18) 28.9 (39) 0.374 n indicates number. aData are shown as mean (SD). All other data are shown as% (numbers). #p?<?0.05. ##indicates a significant difference compared with the non-surgery group. BMI: body mass index; VC: vital capacity; FEV1: forced expiratory volume in 1 second; FVC: forced vital capacity; IC: inspiratory capacity; GOLD: the Global Initiative for Chronic Obstructive Lung Disease. Characteristics of lung cancer among patients having thoracic surgery and non-thoracic surgery All cases (n?=?185) Non-surgery (n?=?50) Surgery (n?=?135) p value Lung cancer histology 0.028 # Adenocarcinoma 58.4 (108) 44.0 (22) 63.7 (86) ## Sq 30.8 (57) 38.0 (19) 28.1 (38) NSCLC 5.4 (10) 10.0 (5) 7.4 (10) SCLC 3.2 (6) 8.0 (4) 1.5 (2) ## Large 2.2 (4) 0 (0) 3.0 (4) Clinical stage 0.0001 # 1A 37.3 (69) 26.0 (13) 41.5 (56) 1B 19.4 (36) 14.0 (7) 21.5 (29) 2A 14.6 (27) 10.0 (5) 16.3(22) 2B 11.4 (21) 8.0 (4) 12.6 (17) 3A 17.3 (32) 42.0 (21) 8.1 (11) ## EGFR status 0.0001 # Yes 16.2 (30) 8.0 (4) 19.3 (26) No 61.6 (114) 28.0 (14) 74.1 (100) ## ND 22.2 (41) 64.0 (32) 6.7 (9) ## n indicates number. aData are shown as mean (range). bData are shown as mean (SD). All other data are shown as% (numbers). ND indicates not determined. #p?<?0.05. ##indicates a significant difference compared with the non-surgery group. Sq: squamous cell carcinoma; NSCLC: non-small cell lung carcinoma; SCLC: small cell lung carcinoma; Large: large cell carcinoma; EGFR: epidermal growth factor receptor. Multivariate analysis of independent factors in decision-making process for proposing thoracic surgery with curative intent Variables Odds ratio 95% CI p value Severity of airflow obstruction 0.002 # Non-COPD versus GOLD grade 1 0.920 0.3702.289 0.858 Non-COPD versus GOLD grade 2 1.085 0.2684.386 0.909 Non-COPD versus GOLD grade 3 0.025 0.0040.167 <0.0001 # Clinical staging <0.0001 # Stage 1A versus stage 1B 1.084 0.3263.602 0.895 Stage 1A versus stage 2A 0.679 0.1852.491 0.559 Stage 1A versus stage 2B 0.705 0.1722.895 0.628 Stage 1A versus stage 3A 0.062 0.0190.202 <0.0001 # Age (per one year) 0.858 0.8020.917 <0.0001 # #p?<?0.05. Discussion This is the first study to evaluate the clinical impact of the prevalence and severity of COPD on a large cohort of Japanese patients with lung cancer who underwent bronchoscopy. Mounting evidence suggests that there is a close association between COPD and lung cancer [91013]. For example a case-control study by Young et al. demonstrated a high prevalence of COPD in patients with newly diagnosed lung cancer [10]; however their study population comprised only Caucasian ancestry and nonsmokers with lung cancer were also excluded [10]. Although many lines of evidence suggest that EGFR mutations are more common among women never-smokers patients with adenocarcinoma-type lung cancer and patients of East Asian ethnicity including Japanese [1119] the association of COPD prevalence with EGFR mutations has not been fully evaluated. Indeed 21.1% of our Japanese study population was non-smokers 42.1% of whom had adenocarcinoma with EGFR mutation. Compatible with the distribution of pathological findings there was significantly higher rate of EGFR mutation in the non-COPD group than in the COPD group (). Although a recent study by Loganathan et al. also showed that 67% of 436 patients with newly diagnosed lung cancer had undergone spirometry prior to receiving treatment [9] our study analyzed the prevalence of COPD and its severity in 84.4% of patients with newly diagnosed lung cancer mainly by performing spirometry at bronchoscopy. Furthermore almost 50% of Loganathan et al.s population were women [9] whereas only 26.7% of our population were women. Epidemiologic surveys of cancers in Japan and the United States of America might support the different proportion of women patients with lung cancer between our study and their studies [2021]. Although we previously demonstrated that 43.2% of the patients undergoing major lung resection had COPD (178/412 cases) [14] here the prevalence of COPD was found to be 54.4% in Japanese patients with lung cancer who underwent bronchoscopy. In the present population 61.3% of men had COPD (122/199 cases) whereas only 35.2% of women had COPD (25/71 cases). In addition 95.5% of men had a history of smoking in our population whereas 67.6% of women were non-smokers. In contrast the percentage of non-smokers among women with lung cancer was only 10.5% in the study of Loganathan et al. Thus the lower prevalence of COPD in women with lung cancer might be explained by the high rate of non-smokers among women in our Japanese population [1322]." | Lung_Cancer |
"Adenocarcinoma including cases with bronchioloalveolar carcinoma. Expression of miR-182 and correlations miR-182 was homogenously expressed mainly in the cytoplasm of tumor cells. There was also some unspecific nuclear staining (). The scoring was based on cytoplasmic staining. There was no staining of stromal cells except for weak nuclear staining of some fibroblasts. We tested correlations between miR-182 and angiogenic and hypoxia molecular markers. We found significant correlations between miR-182 and FGF2 (r?=??0.147; P?=?0.010) HIF2? (r?=?0.115; P?=?0.047) and MMP-7 (r?=?0.172; P?=?0.003). Univariate analysis As shown in the clinicopathological variables performance status (P?=?0.016) histology (P?=?0.028) tumor differentiation (P?<?0.001) surgical procedure (P?=?0.007) pathological stage (P?<?0.001) tumor status (P?<?0.001) nodal status (P?<?0.001) and vascular infiltration (P?=?0.001) were significant prognostic indicators for DSS. The results from the univariate analyses on miR-182 are presented in and Figures 2 and 3. In the whole cohort there was a tendency towards a better prognosis for those with tumors overexpressing miR-182 (P?=?0.062 ). In subgroup analyses patients with stage II disease had a significantly improved prognosis if they overexpressed miR-182 (P?=?0.003 E). In the histological subgroup SCC high tumor cell miR-182 expression was associated with superior prognosis when compared to low expression (P?=?0.042 A) while for large cell carcinomas the trend was opposite (C). miR-182 in tumor cells and stroma as predictors for disease-specific survival in NSCLC patients (univariate analysis; log-rank test) and results of Cox regression analysis summarizing significant independent prognostic factors Characteristics Pts (n) Pts (%) Median survival (months) 5-year survival (%) Univariate (P) Multi-variate (P) HR (95% CI) Total (n?=?335) 0.062 0.098 0.73 ??Low 190 57 98 55 (0.50-1.06) ??High 115 34 NR 62 ??Missing 30 9 Pathological stage Stage I (n?=?143) 0.97 NE NE ??Low 87 61 190 73 ??High 56 39 NR 73 Stage II (n?=?127) 0.003 0.020 0.50 ??Low 80 63 33 39 0.28-0.90 ??High 47 37 NR 63 Stage III (n?=?35) 0.69 NE NE ??Low 23 66 23 39 ??High 12 34 15 17 Histology ??SCC (n?=?172) 0.042 0.048 0.57 ??Low 104 60 NR 58 0.33-0.99 ??High 68 40 NR 74 AC (n?=?106) 0.316 NE NE ??Low 69 65 47 45 ??High 37 35 57 50 LCC (n?=?27) 0.285 NE NE ??Low 17 63 NR 80 ??High 10 37 58 39 Statistically significant results in bold font. Abbreviations:NR not reached PS performance status SCC squamous cell carcinoma AC adenocarcinoma LCC large-cell carcinoma NE not entered due to insignificance. Adenocarcinoma including cases with bronchioloalveolar carcinoma. Disease-specific survival curves according to tumor cell expression of miR-182 in the whole cohort of patients. Disease-specific survival curves according to tumor cell expression of A) miR-182 in SCC B) miR-182 in AC C) miR-182 in LCC D) miR-182 in stage I patients E) miR-182 in stage II patients F) miR-182 in stage III patients. Multivariate analysis In the total cohort performance status (P?=?0.008) histology (P?=?0.001) tumor differentiation (P?=?0.007) tumor status (P?=?0.007) nodal status (P?=?0.022) and vascular infiltration (P?=?0.004) all were independent prognostic factors. Results of the multivariate analysis for miR-182 expression are presented in . Examining the total material high miR-182 expression tended towards an independent association with a better prognosis (HR 0.73 CI 95% 0.50-1.06 P?=?0.098). Among stage II patients however high tumor cell expression of miR-182 was an independent positive prognostic factor (HR 0.50 CI 95% 0.28-0.90 P?=?0.020). Also in SCC patients with a high miR-182 expression had an independent favorable outcome (HR 0.57 CI 95% 0.33-0.99 P?=?0.048). Co-expression of miR-182 with FGF2 and MMP-7 Among markers examined for correlations with miR-182 FGF2 and MMP-7 showed the strongest correlations. We assessed the co-expression combinations between miR-182 and FGF2 and MMP-7 respectively. The co-expression of low miR-182/high FGF2 was associated with poor survival (P?=?0.017) as shown in A. The combination showed an independently significant adverse prognosis compared to high miR-182/low FGF2 (HR 1.92 P?=?0.015 ). Patients expressing high miR-182/high MMP-7 had a better survival than other combinations (P?=?0.036 B). In the multivariate analyses high miR-182/high MMP-7 showed an independently better prognosis than low miR-182/low MMP-7 (HR 0.49 P?=?0.015 ). In the SCC subgroup we found an even bigger difference between these groups both in univariate and multivariate analyses (C ). Disease-specific survival curves according to tumor cell co-expression of miR-182 and A) FGF2 in the whole cohort of patients B) MMP-7 in the whole cohort of patients C) MMP-7 in SCC and D) MMP-7 in AC. Results of Cox regression analysis summarizing co-expressions of miR-182 with FGF2 and MMP-7 respectively Hazard ratio 95% CI P Co-expression of miR-182/FGF2 0.021 ??High miR-182/low FGF2 1.00 ??High miR-182/high FGF2 and low miR-182/low FGF2 1.26 0.74-2.13 0.39 ??Low miR-182/high FGF2 1.92 1.14-3.24 0.015 Co-expression of miR-182/MMP-7 0.032 ??Low miR-182/low MMP-7 1.00 ??Low miR-182/high MMP-7 and high miR-182/low MMP-7 0.71 0.48-1.05 0.086 ??High miR-182/high MMP-7 0.49 0.27-0.87 0.015 Co-expression of miR-182/MMP-7 squamous cell carcinoma 0.040 ??Low miR-182/low MMP-7 1.00" | Lung_Cancer |
"The estimate of the OR of each individual trial corresponds to the middle of the squares and horizontal line gives the 95% CI.On each linethe numbers of events as a fraction of the total number randomized are shown for both treatment groups.For each subgroupthe sum of the statistics along with the summary OR is represented by the middle of the solid diamonds.A test of heterogeneity between the trials within a subgroup is given below the summary statistics. .0085329.g004 5-year survival rate. Forest plot of the Odds Ratio(OR) of the 5-year survival rate following VATS versus open thoracotomy for metastatic lung cancer.The estimate of the OR of each individual trial corresponds to the middle of the squares and horizontal line gives the 95% CI.On each linethe numbers of events as a fraction of the total number randomized are shown for both treatment groups.For each subgroupthe sum of the statistics along with the summary OR is represented by the middle of the solid diamonds.A test of heterogeneity between the trials within a subgroup is given below the summary statistics. Four studies compared the 1-year disease free survival rate (OR?=?1.31; 95% CI 0.792.19; p?=?0.30)finding no significant heterogeneity among these studies (x2?=?1.82P?=?0.61I2?=?0%) (Fig 5) and four studies compared the 3-year disease free survival rate (OR?=?0.59; 95% CI0.380.91; p?=?0.02) finding no significant heterogeneity (x2?=?1.82P?=?0.61I2?=?0%) between the patients who underwent VATS and those who underwent open thoracotomy (Fig 6). Because of the heterogeneity in the sample size sensitivity analyses were conducted using larger sample size studies; however there was no difference between the two surgical methods with an OR of 1.71 (95% CI1.022.89) and with heterogeneity (?2?=? 3.07P ?=?0.22 I2?=?35%). There were significant 3-year disease free survival rate benefits with open thoracotomy. We attempted to evaluate the 5-year disease free survival rate.Only two studies reported these ratesand the published data were not sufficient for the combined analysis. .0085329.g005 1-year disease-free survival rate. Forest plot of the Odds Ratio(OR) of the 1-year disease free survival rate following VATS versus open thoracotomy for metastatic lung cancer.The estimate of the OR of each individual trial corresponds to the middle of the squares and horizontal line gives the 95% CI.On each linethe numbers of events as a fraction of the total number randomized are shown for both treatment groups.For each subgroupthe sum of the statistics along with the summary OR is represented by the middle of the solid diamonds.A test of heterogeneity between the trials within a subgroup is given below the summary statistics. .0085329.g006 3-year disease-free survival rate. Forest plot of the Odds Ratio(OR) of the 3-year survival rate following VATS versus open thoracotomy for metastatic lung cancer.The estimate of the OR of each individual trial corresponds to the middle of the squares and horizontal line gives the 95% CI.On each linethe numbers of events as a fraction of the total number randomized are shown for both treatment groups.For each subgroupthe sum of the statistics along with the summary OR is represented by the middle of the solid diamonds.A test of heterogeneity between the trials within a subgroup is given below the summary statistics. Publication bias Publication bias might exist when nonsignificant findings remain unpublishedthus artificially inflating the apparent magnitude of an effect.The funnel plots of the study are shown in .The funnel plots of the 1-year survival rate following VATS and thoracotomy for the treatment of metastatic lung cancer showed asymmetry which suggested that there was some publication bias. .0085329.g007 Funnel plot of the outcome of 1-year survival rate. Discussion Many tumors can metastasize to the lungand colorectal and breast tumors are the most common primary tumors[9].Pulmonary resection has been shown to be beneficial for patients with resectable and isolated pulmonary metastases[10]. Traditional open thoracotomy and VATS are two principally different surgical methods for pulmonary metastasectomy.The selection of an approach depends more on the theoretical knowledge and personal experience of the surgeon than on the evidence. Over the past two decades several studies have demonstrated the benefits of VATS that included less postoperative pain shorter hospital stays a smaller degree of immunosuppression and enhanced recovery and the ability to tolerate adjuvant therapy[11][13]. Whether the long-term advantages are comparable to those of open thoracotomy is not well documented. The major deficiency of the VATS approach is that nodules might be undetected by VATS that might be detected by manual palpation during thoracotomy; such missing nodules are not imaged on a preoperative CT scan. The VATS approach has long been controversial because VATS does not consistently detect all the metastases and it is recognized that complete resection remains a major determining factor of survival [14].The detection rate of HRCT for pulmonary metastases is 7884%[15][17].Kayton[18]found that 35% of the pathologically verified metastases were missed by CT. In the International Registry of Lung Metastases study of 5206 patients the 5-year survival rate was 36% for complete resection compared with 13% incomplete resectoin[19]. It is not certain whether the nodule imaged on a CT scan and resected by VATS is the correct one [14]. Those who disagree with the use of VATS hypothesize that VATS-related recurrence is commonly observed including port-site recurrence and resection stump recurrence[20]. Johnstone reported 23 cases of port-site chest wall recurrence related to VATS[21]. They hypothesized that the thoracoscopic approach should only be used in patients with a solitary lesion and when resection is requried for diagnostic purposes. The surgeons who favor the VATS approach advocate that VATS minimizes pain and trauma to the patients and that the VATS group might have an improved tolerance of chemotherapy which would likely ensure delivery of planned post-resection adjuvant therapy without a reduction in dosage or delay. The standard surgical procedure for pulmonary metastases is wedge resection that usually does not require manipulation of the pulmonary hilum which is appropriate for the VATS approach.They hypothesiezd that a lesion overlooked by CT but detected by palpation might not result in a survival gain[22] [23] and may be partially compensated for by carefully follow-up.Flores[24] hypothesized that the VATS group might demonstrate a great number of metachronous tumors over time;however the metachronous lesions in each group was similar. Our work suggests that thoracoscopic resection of metastatic lung cancer is a safe and curative procedure with 13 and 5-year survival rates comparable to those of thoracotomy. Patients with metastatic lung cancer are likely to relapse in the lung and after lung metastasectomy by VATS patients might benefit from a second metastasectomy. We hypothesize that earlier chemotherapy and radiation are essential to maximizing survival. Our study might be subject to pretreatment selection bias because most of the patients selected for open thoracotomy had multiple lesions and high risk and were not suitable for treatment with VATS.The missing lesions perhaps skewed the data more toward VATS as an equivalent procedure. We were also interested in the recurrence of cancerand the disease-free survival rates were evaluated. This study demonstrates a similar 1-year disease-free survival rate;however the 3-year disease-free survival rate is inferior for three reasons. First unrelated cancer deaths were included in our analysis of the 13 and 5-year overall survival which might account for VATS having a comparable overall survival rate but an inferior disease-free survival rate. Secondthe patients in the VATS group might have lesions that are missed and there are more likely to relapse in the lung leading to the inferior 3-year disease-free survival rate.Third some of our included studies were in the early period of VATS development when the technology was immature and some of the complications can now be prevented with more experience. Schaeff[25] reported 23 cases of port-site recurrence associated with VATS that occurred before 1998.The number of cases studied was small and the observation period was limitied. Spiral computed tomography has a far higher detection rate today than it did 20 years ago;so small lesions can be accurately localized before surgery[26] which ensures the success of VATS. With advances in imaging technology palpaiton during open thoracotomy is becoming less important.The latest VATS technology has a high-definition resolution and the flexible-tip thoracoscope enables complete inspection of the pleural cavity.These advancements ensure that VATS is an ideal method for patients with a solitary and relatively small peripheral lesions.Tamas[27] hypothesizes that palpation is necessary in a therapeutic metastasectomy as opposed to a diagnostic procedure.Whether patients with multiple lesions should be treated with open thoracotomy or VATS is controversial. This study is the first meta-analysis of the oncological outcome of thoracoscopic surgery for the treatment of metastatic lung cancer. In our work we observed that VATS might be a promising treatment for metastatic lung cancer. No randomized trials existing to guide doctors in the field of metastatic lung cancer currently. A prospective randomized study of the different surgical strategies is needed. Limitation No randomized controlled trials existing to comparing VATS with thoracotomy have been conducted. Heterogeneity was observed between the sample size and the years covered. Most studies are limited to small observational studies and single-institution case series. For these reasonsthere are only a total of 546 patients were included in the two groups for a study period spans more than a decade. Two of the studies comprise almost 65% of the patients and one study has only 20 patients; there are potential sources of bias in our work.Additional randomized controlled trials in the studies we accessed would have increased the strength of our results.There is a bias for the English language. Conclusion In our meta-analysis we found that for patients with metastatic lung cancer comparing VATS with thoracotomy showed almost equivalent survival rates. The VATS can not replace open thoracotomy completely. Further study is neededand a large multicenter randomized trial comparing VATS and thoracotomy would be ideal. Supporting Information Checklist S1 PRISMA Checklist. (DOC) Click here for additional data file. References 1 RuschVW (2010) Pulmonary metastasectomy: a moving target. J Thorac Oncol5: S13013120502246 2 CassonAG PutnamJB NatarajanG JohnstonDA MountainC et al (1992) Five-year survival after pulmonary metastasectomy for adult soft tissue sarcoma. Cancer69: 6626681730117 3 van HalterenHK van GeelAN HartAA ZoetmulderFA (1995) Pulmonary resection for metastases of colorectal origin. Chest107: 152615317781341 4 KandiolerD KromerE TuchlerH EndA MullerMR et al (1998) Long-term results after repeated surgical removal of pulmonary metastases. Ann Thorac Surg65: 9099129564899 5 McCormackPM BainsMS BeggCB BurtME DowneyRJ et al (1996) Role of video-assisted thoracic surgery in the treatment of pulmonary metastases: results of a prospective trial. Ann Thorac Surg62: 213216 discussion 216217.8678645 6 SaishoS NakataM SawadaS YamashitaM SaekiH et al (2009) Evaluation of video-assisted thoracoscopic surgery for pulmonary metastases: 11-years of experience. Surg Endosc23: 556118437482 7 CerfolioRJ BryantAS McCartyTP MinnichDJ (2011) A prospective study to determine the incidence of non-imaged malignant pulmonary nodules in patients who undergo metastasectomy by thoracotomy with lung palpation. Ann Thorac Surg91: 16961700 discussion 17001691.21619965 8 DownsSH BlackN (1998) The feasibility of creating a checklist for the assessment of the methodological quality both of randomised and non-randomised studies of health care interventions. J Epidemiol Community Health52: 3773849764259 9 KondoH OkumuraT OhdeY NakagawaK (2005) Surgical treatment for metastatic malignancies. Pulmonary metastasis: indications and outcomes. Int J Clin Oncol10: 818515864692 10 PorterGA CantorSB WalshGL RuschVW LeungDH et al (2004) Cost-effectiveness of pulmonary resection and systemic chemotherapy in the management of metastatic soft tissue sarcoma: a combined analysis from the University of Texas M. D. Anderson and Memorial Sloan-Kettering Cancer Centers. J Thorac Cardiovasc Surg127: 1366137215115994 11 PetersenRP PhamD BurfeindWR HanishSI TolozaEM et al (2007) Thoracoscopic lobectomy facilitates the delivery of chemotherapy after resection for lung cancer. Ann Thorac Surg83: 12451249 discussion 1250.17383320 12 PaulS AltorkiNK ShengS LeePC HarpoleDH et al (2010) Thoracoscopic lobectomy is associated with lower morbidity than open lobectomy: a propensity-matched analysis from the STS database. J Thorac Cardiovasc Surg139: 36637820106398 13 WhitsonBA GrothSS DuvalSJ SwansonSJ MaddausMA (2008) Surgery for early-stage non-small cell lung cancer: a systematic review of the video-assisted thoracoscopic surgery versus thoracotomy approaches to lobectomy. Ann Thorac Surg86: 20082016 discussion 20162008.19022040 14 EckardtJ LichtPB (2012) Thoracoscopic versus open pulmonary metastasectomy: a prospective sequentially controlled study. Chest142: 1598160222677347 15 AmbrogiV PaciM PompeoE MineoTC (2000) Transxiphoid video-assisted pulmonary metastasectomy: relevance of helical computed tomography occult lesions. Ann Thorac Surg70: 1847185211156082 16 MargaritoraS PorziellaV D'AndrilliA CesarioA GalettaD et al (2002) Pulmonary metastases: can accurate radiological evaluation avoid thoracotomic approach? Eur J Cardiothorac Surg21: 1111111412048094 17 ParsonsAM DetterbeckFC ParkerLA (2004) Accuracy of helical CT in the detection of pulmonary metastases: is intraoperative palpation still necessary? Ann Thorac Surg78: 19101916 discussion 19161918.15561000 18 KaytonML HuvosAG CasherJ AbramsonSJ RosenNS et al (2006) Computed tomographic scan of the chest underestimates the number of metastatic lesions in osteosarcoma. J Pediatr Surg41: 200206 discussion 200206.16410133 19 Long-term results of lung metastasectomy: prognostic analyses based on 5206 cases. The International Registry of Lung Metastases. J Thorac Cardiovasc Surg113: 37499011700 20 MutsaertsEL ZoetmulderFA RutgersEJ (2001) Port site metastasis as a complication of thoracoscopic metastatectomy. Eur J Surg Oncol27: 32732811373113 21 JohnstonePA RohdeDC SwartzSE FetterJE WexnerSD (1996) Port site recurrences after laparoscopic and thoracoscopic procedures in malignancy. J Clin Oncol14: 195019568656265 22 TreasureT (2007) Pulmonary metastasectomy: a common practice based on weak evidence. Ann R Coll Surg Engl89: 74474817999813 23 RothJA PassHI WesleyMN WhiteD PutnamJB et al (1986) Comparison of median sternotomy and thoracotomy for resection of pulmonary metastases in patients with adult soft-tissue sarcomas. Ann Thorac Surg42: 1341383741009 24 FloresRM IhekweazuUN RizkN DycocoJ BainsMS et al (2011) Patterns of recurrence and incidence of second primary tumors after lobectomy by means of video-assisted thoracoscopic surgery (VATS) versus thoracotomy for lung cancer. J Thorac Cardiovasc Surg141: 596421055770 25 SchaeffB PaolucciV ThomopoulosJ (1998) Port site recurrences after laparoscopic surgery. A review. Dig Surg15: 1241349845574 26 ChenYR YeowKM LeeJY SuIH ChuSY et al (2007) CT-guided hook wire localization of subpleural lung lesions for video-assisted thoracoscopic surgery (VATS). J Formos Med Assoc106: 91191818063512 27 MolnarTF GebitekinC TurnaA (2010) What are the considerations in the surgical approach in pulmonary metastasectomy? J Thorac Oncol5: S14014420502249 28 NakajimaJ TakamotoS TanakaM TakeuchiE MurakawaT et al (2001) Thoracoscopic surgery and conventional open thoracotomy in metastatic lung cancer. Surg Endosc15: 84985311443456 29 MutsaertsEL ZoetmulderFA MeijerS BaasP HartAA et al (2002) Long term survival of thoracoscopic metastasectomy vs metastasectomy by thoracotomy in patients with a solitary pulmonary lesion. Eur J Surg Oncol28: 86486812477479 30 NakasA KlimatsidasMN EntwisleJ Martin-UcarAE WallerDA (2009) Video-assisted versus open pulmonary metastasectomy: the surgeon's finger or the radiologist's eye? Eur J Cardiothorac Surg36: 46947419464921 31 CarballoM MaishMS JaroszewskiDE HolmesCE (2009) Video-assisted thoracic surgery (VATS) as a safe alternative for the resection of pulmonary metastases: a retrospective cohort study. J Cardiothorac Surg4: 1319239710 32 GossotD RaduC GirardP Le CesneA BonvalotS et al (2009) Resection of pulmonary metastases from sarcoma: can some patients benefit from a less invasive approach? Ann Thorac Surg87: 23824319101304 33 ChaoYK ChangHC WuYC LiuYH HsiehMJ et al (2012) Management of lung metastases from colorectal cancer: video-assisted thoracoscopic surgery versus thoracotomya case-matched study. Thorac Cardiovasc Surg60: 39840422228090 101150042 30118 Mol Cancer Res Mol. Cancer Res. Molecular cancer research : MCR 1541-7786 1557-3125 24202705 3946989 10.1158/1541-7786.MCR-13-0300 NIHMS538386 Article NEDD9 Depletion Leads to MMP14 Inactivation by TIMP2 and Prevents Invasion and Metastasis. McLaughlin Sarah L. 5 * Ice Ryan J. 5 * Rajulapati Anuradha 5 Kozyulina Polina Y. 1 Livengood Ryan H. 4 Kozyreva Varvara K. 5 Loskutov Yuriy V. 5 Culp Mark V. 3 Weed Scott A. 2 5 Ivanov Alexey V. 1 5 Pugacheva Elena N. 1 5 # 1Department of Biochemistry West Virginia University School of Medicine Morgantown WV 26506 2Department of Neurobiology and Anatomy West Virginia University School of Medicine Morgantown WV 26506 3Department of Statistics West Virginia University School of Medicine Morgantown WV 26506 4Department of Pathology West Virginia University School of Medicine Morgantown WV 26506 5Mary Babb Randolph Cancer Center West Virginia University School of Medicine Morgantown WV 26506 #Corresponding author: Elena N. Pugacheva Mailing address: Department of Biochemistry and Mary Babb Randolph Cancer Center PO Box 9142 1 Medical Center Drive West Virginia University School of Medicine Morgantown WV 26506. Phone: (304) 293-5295; Fax: (304) 293-4667; epugacheva@hsc.wvu.edu S.L. McLaughlin* and R. J. Ice* contributed equally to this work. 17 12 2013 07 11 2013 1 2014 01 1 2015 12 1 69 81 The scaffolding protein NEDD9 is an established pro-metastatic marker in several cancers. Nevertheless the molecular mechanisms of NEDD9 driven metastasis in cancers remain ill defined. Here using a comprehensive breast cancer (BCa) tissue microarray it was show that increased levels of NEDD9 protein significantly correlated with the transition from carcinoma in situ to invasive carcinoma. Similarly it was shown that NEDD9 overexpression is a hallmark of highly invasive BCa cells. Moreover NEDD9 expression is crucial for the protease-dependent mesenchymal invasion of cancer cells at the primary site but not at the metastatic site. Depletion of NEDD9 is sufficient to suppress invasion of tumor cells in vitro and in vivo leading to decreased circulating tumor cells (CTCs) and lung metastases in xenograft models. Mechanistically NEDD9 localized to invasive pseudopods and was required for local matrix degradation. Depletion of NEDD9 impaired invasion of cancer cells through inactivation of membrane-bound matrix metalloproteinase MMP14 by excess TIMP2 on the cell surface. Inactivation of MMP14 is accompanied by reduced collagenolytic activity of soluble metalloproteinases MMP2 and MMP9. Re-expression of NEDD9 is sufficient to restore the activity of MMP14 and the invasive properties of BCa cells in vitro and in vivo. Collectively these findings uncover critical steps in NEDD9-dependent invasion of BCa cells. Implications This study provides a mechanistic basis for potential therapeutic interventions to prevent metastasis. NEDD9 invasion metastasis breast cancer MMP14 Int J Occup Environ Health Int J Occup Environ Health OEH International Journal of Occupational and Environmental health 1077-3525 2049-3967 Maney Publishing Suite 1C Joseph's Well Hanover Walk Leeds LS3 1AB UK 24999846 4090870 2014_1 10.1179/1077352514Z.000000000104 Original Article Dust diseases and the legacy of corporate manipulation of science and law Dust diseases Egilman David 1 Bird Tess 2 Lee Caroline 2 1 Department of Community Health Brown University Attleboro MA USA 2 Never Again Consulting Attleboro MA USA Correspondence to: David Egilman 8 North Main Street Suite 404 Attleboro MA 02703 USA. Email: degilman@egilman.com 4 2014 20 2 115 125 © W. S. Maney & Son Ltd 2014 2014 Background" | Lung_Cancer |
"The putative RrmJ domains of the 38 protein sequences were aligned with that of E. coli RrmJ using ClustalW and were slightly adjusted according to their predicted secondary structures which were calculated using the PORTER query (distill.ucd.ie/porter/) [27]. The Animals and the Heat Stress Treatment Twelve three-month-old female LandraceYorkshire crossbred (LYC) piglets were purchased from the Animal Industry Division of the Livestock Research Institute of the Council of Agriculture (COA) (Tainan Taiwan). The procedures used in this study were approved by the Institutional Animal Care and Use Committee (IACUC) of the COA Livestock Research Institute (Approval No. 98021). The piglets (n?=?4) were raised at 25°C and 60% humidity in animal houses which were equipped for temperature and humidity control [28] [29]. For the heat stress treatment the piglets that were raised at room temperature (25°C) were exposed to heat shock temperatures of 30°C or 35°C and maintained at 60% humidity for 1 week. The piglets were then sacrificed and tissue samples from 11 ans were isolated for total RNA extraction. Cell Culture The cancer cell lines of HepaG2 (ATCC No. HB-8065) TE671 (ATCC No. CCL-136) and A549 (ATCC No. CCL-185) were purchased from American Type Culture Collection (ATCC; Manassas VA USA). The lung adenocarcinoma CL1 sublines CL1-0 and CL1-5 were kindly provided by Dr. Jeremy J.W. Chen National Chung Hsing University Taichung Taiwan [30]. All of the cell lines were grown in Dulbeccos Modified Eagles Medium (DMEM; Invitrogen Corp. Grand Island NY USA) containing high glucose (4500 mg/L) and supplemented with 10% fetal bovine serum (FBS) at 37°C and 5% CO2. At 80% confluence the cells were subcultured at a ratio of 1?3 to 1?5 and the medium was changed every three days as described previously [31] [32]. Heat Shock Treatment of the Cells In our heat shock response analysis the cancer cells that grew at 37°C and 5% CO2 were subjected to heat shock at 42°C or 45°C and 5% CO2 for 1 hour. After this heat shock treatment the cells were transferred to 37°C for 0 3 or 6 hours and then harvested for total RNA extraction. Cell Transfection via Electroporation The 6.74-kb pCMV-hFTSJ2-IRES2-DsRed plasmid was constructed by inserting the full-length human FTSJ2 (hFTSJ2) protein coding sequence into the EcoRI restriction site of the pIRES2-DsRed2 vector (Clontech Laboratories Inc. Mountain View CA USA). The TE671 and HepG2 cell lines were transfected with this plasmid via electroporation with a BTX ECM2001 system (BTX Holliston MA USA). Briefly 6106 TE671 or 2107 HepG2 cells were suspended in 400 µL of DMEM which contained 5 µg or 50 µg of plasmid DNA respectively and then the cells were subjected to electroporation at 200 V for 4 msec or 100 V for 30 msec respectively. After electroporation the cells were grown in a culture medium containing 400 µg/mL of the antibiotic G418 for the selection of cells that were stably expressing hFTSJ2. Isolation of the Mitochondrial and Cytosolic Protein Fractions The mitochondrial and cytosolic proteins of the TE671 cell fractions were isolated using the reagent-based method of the Mitochondria Isolation Kit (Pierce Rockford IL USA) according to the manufacturers instructions. Western Blot Analysis To analyze the expression of hFTSJ2 stable expression colonies of the TE671-hFTSJ2 and HepG2-hFTSJ2 cells were collected homogenized in 300 µL of RIPA buffer (5 mM Tris-HCl [pH 7.4] 0.15 M NaCl 1% NP-40 0.25% sodium deoxycholate 5 mM EDTA [pH 8.0] and 1 mM EGTA) held on ice for 30 min and then centrifuged at 14000 rpm for 30 min. The supernatants were collected as the total protein lysate. The supernatants (20 µg) were then separated by SDS-PAGE in a 12% acrylamide gel (acryl:bis of 30?0.8) and transferred to a polyvinylidene difluoride (PVDF) membrane [33] [34]. The membrane was blocked with 5% BSA (filtered through a 0.22-µm membrane) and immunoblotted with anti-hFTSJ2 (1?1000) and anti-GAPDH (1?500) antibodies overnight at 4°C. After washing with phosphate-buffered saline containing Tween 20 (PBST) the membrane was incubated with the appropriate horseradish peroxidase-conjugated secondary antibody for 1 hour at 25°C and the protein bands were detected by enhanced chemiluminescence (PerkinElmer Waltham MA USA) and an ImageQuant LAS 4000 mini system (GE Healthcare Biosciences Pittsburgh PA USA). For immunoblotting of the mitochondrial and cytosolic protein fractions 5 µg of protein from each fraction was separated by SDS-PAGE and immunoblotted with anti-hFTSJ2 (1?1000) anti-VDAC (mitochondrial fraction control 1?1000) and/or anti-MEK-1 (cytosolic fraction control 1?1000) antibodies. Immunofluorescence Microscopy The TE671-hFTSJ2 and HepG2-hFTSJ2 cells were grown to 80% confluence in 24-well dishes. Then the cells were fixed with 4% paraformaldehyde for 20 min and permeabilized with 0.10.3% Triton X-100 for 5 min followed by three washes with PBS. The cells were blocked with horse serum for 1 hour and incubated with an anti-hFTSJ2 antibody (1?1000) overnight at 4°C and then with the appropriate fluorescein isothiocyanate (FITC)-conjugated antibody for 1 hour. The cells were counter-stained with MitoTracker Red CMXRos (Invitrogen Corp. Grand Island NY USA) to stain the mitochondria and DAPI to stain the nuclei and then mounted with glycerol. The cells were examined by laser scanning confocal fluorescence microscopy in which FITC was excited at 488 nm MitoTracker Red was excited at 580 nm and DAPI was excited at 358 nm. Real-time RT-PCR and Semi-quantitative RT-PCR The total RNA was isolated from the cell lines or the porcine tissues using the TRIzol reagent (Invitrogen Corp. Grand Island NY USA) according to the manufacturers instructions. The total RNA was treated with DNase I (1 µL of DNase I per 1 µg of total RNA) at 37°C for 30 min to eliminate any genomic DNA contamination. Then 1 µL of a stop solution was added and the sample was incubated at 65°C for 10 min to inactivate the DNase I. The DNase I-treated RNA (1 µg) was used directly as a template for first-strand cDNA synthesis with the ImProm-II Reverse Transcription System (Promega Madison WI USA). Real-time RT-PCR was performed using the relative standard curve method with SYBR Green I (Sigma St. Louis MO USA) as the dsDNA fluorescence dye. The reactions were performed using a Roter-Gene 6000 system (Corbett Life Science Mortlake Australia) under the following conditions: 94°C for 5 min; 40 cycles of 95°C for 30 sec 59°C or 68°C for 30 sec and 72°C for 20 sec; and a melting curve from 65°C to 95°C [35]. Semi-quantitative RT-PCR reactions were performed under the following conditions: 94°C for 5 min and then 25 or 30 cycles at 95°C for 30 sec 59°C or 68°C for 30 sec 72°C for 20 sec and 72°C for 7 min. The amplified products were separated on a 1.5% agarose gel and then quantified using Kodak 1D software (Kodak New Haven CT USA). The primers which were used in real-time RT-PCR or semi-quantitative RT-PCR are listed in . .0090818.t001 Primer sequences for real-time and semi-quantitative RT-PCR. Species Gene Sense (5?-3?) Anti-sense (5?-3?) Human FTSJ2 GCTGGTGTGTGTTTCCTTTCA CAGAATCTGGTGCCTCTCGT HSP70.2 GCACGTTCGACGTGTCCAT GCTTGTTCTGGCTGATGTCCTT ?-actin CCGTCTTCCCCTCCATCGTGGG CGCAGCTCATTGTAGAAGGTGTGG GAPDH GAGAAACCTGCCAAGTATGATG ACCTGGTCCTCAGTGTAGCC Pig Ftsj2 ACGAGTTCCCAGGAGAATCAGA TGCTTTGGCAACGACCTTTAA Hsp70.2 GCACGTTCGACGTGTCCAT GCTTGTTCTGGCTGATGTCCTT ?-actin CATCACCATCGGCAACGA TTCCTGATGTCCACGTCGC Wound Healing Assay The TE671 or TE671-hFTSJ2 cells were grown in 60-mm dishes to 90% confluence. Then a wound was produced by scraping the cell monolayer with a sterile P200 pipette tip. During the wound healing process time-lapse images were obtained every 10 min for 12 hours and the cell migration area was calculated ([healing area/wounding area]100%) using the ImageJ program (http://rsbweb.nih.gov/ij/index.html). Invasion Assay The invasion assay was performed on the TE671 and TE671-hFTSJ2 cells using Trans-well chambers with an 8-µm pore size (Merck Millipore Darmstadt Germany). The upper chamber of the Trans-well was pre-coated with Geltrex matrix gel (30 µL/well) (Invitrogen Corp. Grand Island NY USA) and inserted into the lower chamber which contained DMEM with 10% FBS. The cells (1104) were suspended in 200 µL of DMEM and added to the upper chamber. After 12 hours the cells on the upper surface of the membrane were removed with a cotton swab and the cells on the lower surface of the membrane were fixed with methanol for 10 min and subjected to Giemsa staining. The Giemsa-positive area of the membrane was calculated ([Giemsa positive area/total area]100%) using the ImageJ program. Statistical Analysis All of the data are presented as the means±standard error (SE). The statistical comparisons were performed using Students t-test. The Duncan method of one-way ANOVA was used for multiple group comparisons. The P<0.05 or P<0.01 level was considered significant. Results FTSJ2 is Closely Related to E. coli RrmJ RrmJ is a 23S rRNA 2?-O-ribose MTase and is conserved in nearly all of the different species. To evaluate the relationship among the RrmJ homologs a phylogenic tree with 39 RrmJ homologs was constructed. The NCBI BLASTp program was used to identify the homologs of the E. coli RrmJ protein in M. jannaschii S. cerevisiae Caenorhabditis elegans Drosophila melanogaster and in vertebrates. Using the minimum evolution method the phylogenic tree showed the following three phylogenies: FTSJ1/Trm7p FTSJ2/Mrm2p and FTSJ3/Spb1p (Figure 1). Using the JTT model to calculate the protein distances and comparing these distances within each phylogeny the protein distances within the FTSJ2/Mrm2p group were found to be larger than those within the FTSJ1/Trm7p and FTSJ3/Spb1p groups indicating that the RrmJ homologs FTSJ1 and FTSJ3 are more conserved between species than FTSJ2. However the distance between E. coli RrmJ and the root of the FTSJ2/Mrm2p group (distance: 0.84) was shorter than the roots of the FTSJ1/Trm7p and FTSJ3/Spb1p groups (distance: 1.25 and 1.28) suggesting that the FTSJ2/Mrm2p proteins are the most related to E. coli RrmJ and are presumed to be the orthologs of RrmJ. This assumption is supported by the known function of S. cerevisiae Mrm2p. Mrm2p catalyzes the methylation of 2?-O-ribose in the mitochondrial 21S rRNA [12] which has the same rRNA structure as the substrate of RrmJ. .0090818.g001 Figure 1 Phylogenetic tree of the E. coli RrmJ homologs from Eubacteria to Mammalia. This phylogenetic analysis represents the following three major homolog protein lineages: FTSJ1/Trm7p FTSJ2/Mrm2p and FTSJ3/Spb1p. The out-groups of the tree were catechol-O- methyltransferase VP39 and fibrillarin (PDB code 1VID 1AV6 and 1FBN respectively). These out-groups were chosen because of their similar functions and structures to E. coli RrmJ. The number at each branch node indicates the reliability of the splits (%) through the processing of 1000 bootstrap replicates. The GenBank accession numbers and species are shown for each protein. [F] and [S] denote proteins with known functions and protein structures respectively. The Protein Structures of the FTSJ2 Orthologs are Similar to that of E. coli RrmJ The protein sequence alignment of E. coli RrmJ M. jannaschii FtsJ S. cerevisiae Mrm2p and other FTSJ2 orthologs showed many similarities. The K50 D124 K164 and E199 residues which compose the catalytic center of RrmJ were present in all of the RrmJ orthologs. Furthermore the 19 residues involved in S-adenosylmethionine (S-AdoMet SAM) binding in RrmJ were also highly conserved in FTSJ2 (Figure 2). A comparison of the similarity of the full-length amino acid sequences of human FTSJ2 with E. coli RrmJ S. cerevisiae Mrm2p and porcine FTSJ2 which represented the Eubacteria Eukaryota and Mammalia homologs respectively showed that the E-values (and amino acid identities) were 3e-43 (35%) 3e-33 (29%) and 7e-140 (76%) respectively. .0090818.g002 Figure 2 Protein sequence alignment of E. coli RrmJ with its FTSJ2 orthologs in 7 different species. The ?-helices and ?-strands were based on the RrmJ protein structure (PDB code: 1EIZ). The stars and triangles indicate the K-D-K-E catalytic center and the SAM binding residues in RrmJ respectively. The residues with identical and similar chemical properties are highlighted in black and gray respectively. In addition a comparison of the two published three-dimensional protein structures of E. coli RrmJ and human FTSJ2 and a predicted structure of porcine FTSJ2 showed that these structures contain five ?-helixes and seven ?-strands that compose an open-sheet structure. The positions of the SAM binding residues and the amino acids of the catalytic center showed similar arrangements in the protein structures. Notably the first residue of the catalytic center lysine (K50 in RrmJ) showed an approximately 120° rotation in human FTSJ2 (PDB code: 2NYU) [36] compared with E. coli RrmJ (Figure S1). This rotation may account for the different structures of the rRNA substrates of the E. coli and the human proteins. FTSJ2 is Localized in the Mitochondria of Human Cells Mrm2p the FTSJ2 ortholog in S. cerevisiae is located in the mitochondria and is responsible for the 2?-O-ribose methylation of the 21S rRNA. Thus we detected the subcellular localization of the FTSJ2 protein in the human cell lines. A vector for the overexpression of hFTSJ2 driven by the CMV promoter was constructed (pCMV-hFTSJ2-IRES2-DsRed2; Figure 3A). The rhabdomyosarcoma (TE671) and hepatocarcinoma (HepG2) cell lines were transfected with the pCMV-hFTSJ2-IRES2-DsRed2 vector and the expression of the hFTSJ2 protein was detected by Western blot analysis. The results showed that the TE671-hFTSJ2 and HepG2-hFTSJ2 cells had higher expression levels of hFTSJ2 than the non-transfected cells (Figure 3B). Immunofluorescence showed that most of the hFTSJ2 protein was located in the cytoplasm but not in the nuclei in both the TE671-hFTSJ2 and HepG2-hFTSJ2 cells and the mitochondria which were stained with MitoTracker Red showed the same localization as hFTSJ2 (Figure 3C). In the analysis of the mitochondrial and cytosolic protein fractions hFTSJ2 was detected in the mitochondrial protein fraction but not in the cytosolic fraction (Figure 3D). These results indicated that human FTSJ2 as its ortholog in S. cerevisiae is a mitochondrial protein. .0090818.g003 Figure 3 Subcellular localization of human FTSJ2 in TE671 and HepG2 cells. (A) Schematic of the hFTSJ2 over-expression vector. (B) Over-expression of the hFTSJ2 protein in the TE671-hFTSJ2 and HepG2-hFTSJ2 stable clones. (C) Immunofluorescence staining with anti-hFTSJ2 (green) MitoTracker for mitochondria (red) and DAPI for nuclei (blue) in the TE671-hFTSJ2 and HepG2-hFTSJ2 cells. (D) Mitochondrial localization of the hFTSJ2 protein in non-transfected TE671 cells. VDAC and MEK-1 were used as the mitochondrial and cytosolic fraction controls respectively in the Western blot analysis. Ftsj2 mRNA is Expressed in all of the Porcine Tissues but at Different Levels Because of the higher similarity between human and porcine FTSJ2 (amino acid identity?=?76% and RrmJ domain identity?=?81%; Figure 2) and the similar physiological responses of humans and pigs we further analyzed the expression of the porcine Ftsj2 gene and sequenced the coding region of the porcine Ftsj2 mRNA (GenBank accession number: EU694400). Then 13 tissues from a female piglet were analyzed for the expression of porcine Ftsj2 mRNA by RT-PCR. The results showed that all of the 13 tissues expressed Ftsj2 mRNA at different levels. The heart and kidney showed the highest expression; the large intestine muscle lung spleen and liver showed mid-level expression; and the small intestine ovary brain stomach mammary gland and bladder showed the lowest expression (Figure S2). The Level of Ftsj2 mRNA Expression Increases in Several Tissues after Heat Shock Stress Previous studies have shown that the mRNA of E. coli rrmJ increased nearly 20-folds under heat shock stress [3] and was involved in the thermal adaptation of E. coli [7]. Thus the heat shock protein characteristics of mammalian FTSJ2 were also evaluated in piglets which are known to be thermally sensitive in the livestock industry. Three-month-old female piglets were raised at room temperature (25°C) and to produce enough heat shock stress in the warm-blooded piglets temperatures of 30°C or 35°C were used to stimulate the heat shock response for at least 1 week. The porcine Ftsj2 mRNA expression in 11 tissues from these piglets was detected and Hsp70.2 mRNA expression was used as the heat shock response positive control (Figures 4A and 4B). The results showed that Ftsj2 mRNA expression was up-regulated in the large intestine stomach lung and bladder and down-regulated in the small intestine muscle heart mammary gland kidney spleen and liver in the 30°C and 35°C environments (Figure 4A). Notably the only tissue that showed an up-regulation of both Ftsj2 mRNA expression and Hsp70.2 mRNA expression which corresponds to a positive heat shock response was the lung (Figure 4B). This result may have been caused by direct exposure of the lung tissue to the increased temperature through inhalation of the hot air. .0090818.g004 Figure 4 FTSJ2 mRNA expression after in vivo and in vitro heat shock treatments. Porcine Ftsj2 (A) and Hsp70.2 (B) mRNA expressions in piglets which were raised at 25°C 30°C or 35°C for 1 week. Human FTSJ2 (C) and HSP70.2 (D) mRNA expressions in A549 lung cells after 1 hour of heat shock at 42°C or 45°C followed by 0 3 or 6 hours of recovery at 37°C. Porcine Hsp70.2 or human HSP70.2 mRNA expression was used as the heat shock response control. The values are equal to?=?the means±SE; n?=?4. The bars with different letters represent a significant difference (P<0.05). The Level of Human FTSJ2 mRNA Expression Increases after Heat Shock in A549 Cells Our results showed that Ftsj2 mRNA was overexpressed in the porcine lung after heat shock; therefore a human lung adenocarcinoma epithelial cell line (A549) was used to further confirm the heat shock response in vitro to eliminate the systematic effects observed in the piglets. A549 cells were first grown at 37°C and 5% CO2. For the heat shock treatment the cells were grown at 42°C or 45°C 5% CO2 for 1 hour and then returned to 37°C for 03 or 6 hours respectively. Human FTSJ2 mRNA was detected by real-time RT-PCR. The results revealed that after both the 42°C and 45°C heat shock treatments the hFTSJ2 mRNA expression increased by more than 50% (50.6% and 52.6% at 3 hours and 0 hours respectively) (P<0.05) (Figure 4C) compared with the non-heat shock control. The up-regulation of the HSP70.2 mRNA indicated a positive heat shock response after the 42°C and 45°C treatments in the A549 cells (Figure 4D). FTSJ2 Inhibits Cancer Cell Migration and Invasion In a recent study in clinical samples of NSCLC the human FTSJ2 gene was located in a novel oncogenic locus of NSCLC. These results indicate that FTSJ2 may also be involved in the growth of cancer cells. To evaluate the roles of FTSJ2 in cancer the gene expressions in the NSCLC cell lines were detected. A human lung adenocarcinoma cell line (CL1) which was isolated from an adenocarcinoma from the lung of a 64-year-old man has been cloned and passed on for more than 60 generations. Using the Transwell invasion chamber the CL1 cell line was separated into six sublines according to their metastatic ability (CL1-0 to CL1-5 from lowest to highest invasiveness) [41]. The hFTSJ2 mRNA expression was detected in two of these sublines (CL1-0 and CL1-5). Surprisingly the more invasive CL1-5 cells showed a 50% decrease in the hFTSJ2 mRNA expression than the less invasive CL1-0 cells (Figures 5B and 5C). .0090818.g005 Figure 5 Comparison of the hFTSJ2 mRNA expression levels in two lung cancer sublines (CL1-0 and CL1-5). (A) Morphology of CL1-0 and CL1-5 cells. (B) Determination of the hFTSJ2 mRNA expression levels in the CL1-0 and CL1-5 cells in triplicate. (C) Relative quantification of the hFTSJ2 mRNA expression. GAPDH mRNA was used as an internal control. The values are equal to?=?the means±SE; n?=?3; **P<0.01 vs. the non-heat shock group. In addition to the down-regulation FTSJ2 increased cell invasion in the CL1-5 cells. To further evaluate the abilities of FTSJ2 to influence cell migration and metastasis the hFTSJ2-overexpressed cell line (TE671-hFTSJ2) previously mentioned was used in the cell migration and invasion assay and was compared with the non-transfected TE671 cells. The results of our wound healing assay showed that at 12 hours after wounding the migration area of the TE671-hFTSJ2 cells was significantly decreased (P<0.01) compared with the non-transfected TE671 cells (Figures 6A and 6B). The same results were also observed in our invasion assay in which the quantity of invaded TE671-hFTSJ2 cells per Trans-well was significantly lower than that of the non-transfected TE671 cells (Figures 6C and 6D)." | Lung_Cancer |
"As this was designed to ascertain proof of principle we did not apply a measure of successful laboratory performance. The pilot established that the scheme design and methods used were acceptable for use in a larger scheme. Second round One hundred and seventeen laboratories from 30 countries registered and 101 participated in the second round (due to customs issues we were not able to get samples to 16 labs) run in the second quarter of 2012. Ninety-one laboratories submitted results within the 8-week time frame the remaining 10 labs gave no reason why they did not submit results. A different set of samples from those used in the pilot first round were sent to the laboratories with the emphasis being on the inclusion of mutations at allelic frequencies that would challenge the analytical sensitivity of all the commonly used technologies (; samples B1B10). A code number different from the one assigned in the first round was given to the samples. In addition to the genotype results all participating laboratories were also required to submit for assessment copies of their clinical reports for three samples (B1 B4 and B9). The main methodology used by the participants was PCR/sequencing (n=35 laboratories; 39%) and real-time PCR (n=17; 18.6% ). It was common for labs to use a combination of different methodologies in their testing process (). A variety of different errors were detected by the second scheme round including 74 (8.1%) genotype errors (false-positive (n=13; 1.5%) false-negative (n=61; 82.4%) and a combination of false-negative and -positive results (n=1; 1.4%)) as well as analytical test failures (n=31; 3.4%) mispositioning of the genotype (n=7; 0.8%) and significant errors in the mutation nomenclature (n=36; 3.9%). Two samples (B2 and B8) gave a disproportionately high error rate compared with the other samples used in this round () with 94.1% of errors for B2 made by labs using PCR/sequencing vs 40.7% of errors for sample B8 made by labs using a version of the Therascreen EGFR kit (Qiagen). Laboratories did not lose marks if the declared limitations of their assay meant that they would not detect a particular mutation at the given frequency used in the EQA materials. Eighteen laboratories (19.8%) from 13 countries with a total score below 18 did not pass the second round and were thus classified as poor performers 72.2% of these labs used PCR/Sequencing as their main diagnostic test for EGFR mutation status. The interpretation of the test result relative to the clinical referral was reviewed with laboratories receiving comments on their performance but no marks assigned. Overall 46 (50.5%) of the laboratories had a score ?18 in the second round and passed the EQA. All laboratories received a certificate of participation that displayed their performance in the scheme. Third round The 18 laboratories that did not pass the second round were given the opportunity to participate in a third round. One laboratory was unable to participate due to problems with customs sample import permissions. The same set of samples used in the second round was sent to the laboratories in the third quarter of 2012 (; samples C1C10). To obscure the sample identity from the labs a different code number from the one assigned in the second round was given to the samples. Only the genotyping result was assessed for each of the 17 laboratories that returned results. A total of 18 (10.6%) genotyping errors (reported false-positive (n=1; 5.5%) and false-negative results (n=13; 94.4%)) were made as well as analytical test failures (n=3; 1.8%). Eight laboratories (47.1%) missed the same mutation in identical samples in rounds 2 and 3 (for example B3/C9 n=1; B9/C5 n=2; B8/C10 n=5) indicating a failure of their assay for a particular mutation. Three laboratories (17.6%) had a pattern of errors indicating a more general assay validation problem. Four laboratories (23.5%) did not pass the third round and scored <18. Overall all 17 laboratories (100%) improved their performance compared with the second round with 6 (35.3%) labs getting the correct result for all 10 samples. Discussion The clinical significance of somatic aberrations in oncology has seen rapid progression in the last couple of years with the correlation of treatment-related outcomes to gene alterations (Normanno et al 2013). The rapid development and approval for use of therapeutic drugs based on mutational tests has represented a significant innovation for medical oncology but also a major challenge for oncologists pathologists and clinical scientists. Companion diagnostics and related guidelines have traditionally lagged behind such clinical indications for a variety of reasons. Although EQA schemes are running for the KRAS (sporadic colorectal cancer) and BRAF (malignant melanoma) genes such schemes for EGFR are further complicated by the diverse spectrum of mutations tumour heterogeneity and issues pertaining to the availability of appropriate biological material for use as EQA samples. For this reason ESMO ETOP ESP and other stakeholders collaborated with the EMQN to develop an integrated approach to offer EQA for EGFR mutation testing in NSCLC to laboratories around the world. The purpose of the scheme is the provision of accurate and reliable EGFR testing for patients by assuring parity of test outcomes among participating laboratories from around the world. Different types of samples can be used for this type of EQA (van Krieken et al 2013). In the majority of existing schemes FFPE patient biopsy samples have been used (Bellon et al 2011; Deans et al 2011; Thunnissen et al 2011; Normanno et al 2013). Although this type of sample enables the complete analytical pathway to be assessed ensuring a closer relationship between the EQA and routine clinical activity it is limited by the amount of human tissue that is available and issues related to transport of samples across national borders. For this scheme we developed a different approach and used artificial materials composed of FFPE cell lines to allow us to provide exactly the same sample to all the participating laboratories even when these were numerous. In addition it was possible to generate homogenous samples with variable content of mutant alleles by mixing wild-type and mutant cells and to use them to uncover hidden weaknesses in test performance (sensitivity specificity). This EQA scheme assessed both the genotyping and the interpretation of the clinical significance of the results. Other EQA schemes that employed tumour samples have also addressed the pre-analytical phase with laboratories being required to assess the percentage of neoplastic cells and to perform dissection if needed. However scoring of this phase is not easy as no consensus on the estimation of tumour cell content has been reached and a huge variability has been reported in previous EQA schemes (Thunnissen et al 2011; van Krieken et al 2013). Our approach is similar to that described by Normanno et al (2013) as it reduces the inter-laboratory variability related to the type of technique used for the dissection and allows a comparative evaluation of the sensitivity and specificity of the methods used for the mutational analysis." | Lung_Cancer |
"They are designed to determine which subjects have quit smoking or cut down and which subjects who have failed to quit still plan to do so. There is a section that asks about general motivators and components of the smoking cessation programme. The subjects will be asked to score these motivators and smoking cessation aids for their efficacy in helping them to quit. The questions in this section are almost identical to a validated questionnaire [24]. There are also further questions on whether the subject would recommend the Respiragene test to a relative or friend and an open ended question for subjects to add their own comments about the concept of a test that predicts susceptibility to lung cancer in a smoker. Data quality assurance The study has been designed and will be reported in accordance with CONSORT (Consolidated Statement of Reporting Trials) [25]. Data will be controlled in accordance with data protection legislation institutional protocols of Sussex NHS Research Consortium and NHS policies for research and information governance for ensuring patient confidentiality [26]. Data will be analysed in SPSS (Statistical Package for Social Sciences) version 15 using an intention to treat approach. Outcome measures Primary endpoint Comparison of smoking cessation rates (7 day point abstinence and continuous abstinence) in Clinic A and Clinic B at 8 weeks and six months. Secondary endpoints A. Personal data: 1. Number of smokers still smoking who state that they still plan to stop. 2. Daily cigarette consumption of those still smoking. 3. Mean scores for ranking of smoking cessation aids (gene-based test - Clinic A only salivary cotinine lung cancer facts - controls in Clinic B only and general counselling from NHS smoking counsellors). B. Analyse questions about whether subjects would recommend the test to a member of family or a friend. C. Analyse last (open ended) question using qualitative research methodology. Statistics Primary end point The difference between smoking cessation between Clinic A and Clinic B will be estimated from the four week and six month follow up for the primary endpoint (smoking status confirmed by carbon monoxide breathalyser and salivary cotinine tests). If there is the expected higher rate of smoking cessation for Clinic A compared with Clinic B statistical significance will be demonstrated by the ?2 test. Since there are as yet no case-control studies that compare quit rate following the gene-based test versus quit rate without the test the expected difference in quit rate between Clinic A and Clinic B is difficult to estimate. Two case-control studies showing only a 5-10% increase in smoking cessation involved just a single gene of small effect [1112]. In a randomised control trial patients were given either a full explanation of the results of spirometry testing including an estimation of lung age or just the FEV1 without explanation (control group). The group of patients who were given the full explanation had a 7.2% higher quit rate than the control group. However data from Auckland suggest a larger uplift of quit rate with Respiragene. This can be explained by the superior predictive power of a 20-gene test combined with clinical history (personal history of COPD and family history of lung cancer) to give a rather more impressive estimate of cancer risk than anything previously available. The adequacy of sample size was tested using data from smoking cessation trials that showed: ¢30-40% smoking cessation at 6-months with similar protocols [2728]. ¢A 48% quit rate at 2-4 weeks in subjects with high and very high lung cancer risk scores but this difference shrinks to 27% at 6 months. ¢Data from Young et al [1518] (independently verified by McBride et al [11]) that even being given an average score for lung cancer susceptibility increases smoking cessation by approximately 10%. Therefore with a minimum sample sizes of 30 per group the following calculations based on these estimated quit rates apply (). Statistical power of 87.1% is generally acceptable for publication (for alpha error of 5% - i.e. 5% probability of incorrectly rejecting the null hypothesis that there is no difference in the percentage values). For further detailed statistical analysis refer to Additional file 1. Summary of values from which the power of the study are estimated Control group expected quit rate as %ge Respiragene group expected quit rate as %ge ? 2 calculated from four-some table P value based on ? 2 Power calculations* 8 weeks Sample size 30/30* 70% 94% 5.9 <0.05 79.3% Sample size 60/60* 11.7 <0.01 96.9% 6 months Sample size 30/30** 35% 52% 1.7 NS 36.5% Sample size 60/60** 6.2 <0.05 87.1% *Telephone (alone) quit rate (see ) assumed to be 20%. **Telephone (alone) quit rate (see ) assumed to be 10-15%. Secondary outcome measures Similarly the significance of secondary endpoints on intention to stop smoking cigarette consumption uptake of invitation to cessation adherence to cessation course and self-reported smoking cessation will be calculated by the ?2 test but the p value for the ranking scores for information on lung cancer risk and other smoking cessation aids and motivators will be estimated from the unpaired student t-test. The open ended question: How do you feel now about having had a genetic test that estimates the probability that you will develop lung cancer at some future date? will have to be analysed by qualitative analysis to determine the main recurrent themes in responses. Discussion Overview Smoking cessation is one of the most cost effective interventions that can be achieved in primary care [29]. However many smokers are very reluctant to commit to a smoking cessation programme (precontemplative and contemplative) and about half of those that attend for smoking cessation intervention (action stage of change) are likely to drop out or give up trying. Therefore any methodology that increases motivation in both unmotivated and motivated smokers could be very valuable. The gene-based test we are offering has shown promise as a smoking cessation motivator in precontemplative-contemplative smokers in a hospital outpatient setting [1518] and now needs to be tested out as a motivator for improving adherence in a primary care smoking cessation clinic using a randomised controlled study. Strengths The main strengths of this study are that it is being carried out on subjects from a large primary care population and should therefore be more representative of the general population than previous studies recruited from hospital patients and other special groups. We also have the advantage of being able to carry out this research within the established framework of the local stop smoking service. Limitations and assumptions Although we have estimated based on previous smoking cessation work using this gene-based test that the primary endpoint will show that having the test improves quit rate by 20-25% this was based on a cohort of hospital outpatients in Auckland New Zealand and subjects recruited from primary care may respond differently. Although we plan to recruit a minimum of 60 subjects this may not be enough to balance unexpected and unknown confounding factors. What we might find We aim to recruit a minimum of 60 subjects to randomise 30 into group A (test group) and 30 into Group B (control group). The normal experience in NHS smoking cessation clinics is a drop-out rate of 40-50% [30-32]. We need therefore to attempt to recruit about 120 subjects in order to get a statistically significant result based on the assumptions in our power calculations. We may however have underestimated the 6-month quit rate using the NHS local stop smoking guidelines [22] which typically involves a multi-interventional programme which includes combinations of varenicline prescriptions
Lung_Cancer breath carbon monoxide monitoring and intensive counselling giving a quit rate of 70-80% at 6-weeks.There are however no Surrey data for 6-month quit rate which we assume on the basis of similar smoking cessation data to be about half the 6-week figure [33] ? 35%. An unknown and unpredictable factor that could skew results significantly is the possibility that our multi-interventional approach could help to reinforce the health risk message equally for subjects in both groups. Also the Auckland study design involved recruitment of precontemplative-contemplative smokers from a hospital outpatient setting compared to this study that will involve primary care subjects who have volunteered to participate in a smoking cessation programme (ie smokers in the action stage of quitting). This population therefore could be sufficiently different to give unexpected results. However the results of this trial will inform as to the acceptability of this approach as well as its effectiveness. Abbreviations CONSORT: Consolidated statement of reporting trials; COPD: Chronic obstructive pulmonary disease; DNA: Deoxyribonucleic acid; NHS: National health service UK; SNP: Single nucleotide polymorphism; SAE: Stamped addresses envelope. Competing interests JN and PG are in receipt of research grants from Lab 21 Cambridge who are marketing the Respiragene test in the UK and Synergenz Bioscience Ltd. who financed the development of the test from its origins in New Zealand. We initially purchased SmokeScreen kits (for salivary cotinine estimation) from GFC Diagnostics Ltd. But they subsequently supplied 30 kits free of charge. Authors contributions JN and PG developed the idea of a control trial of the Respiragene test after discussions with Aino Telaranta-Keerie of Lab 21 Cambridge. WK was involved in helping to write the protocol and her experience in running smoking cessation clinics was very helpful. PW was our statistical adviser and SdeL helped us to write the protocol in accordance with CONSORT principles and in development of trial methodology. All authors read and approved the final manuscript. Authors information PG is a Visiting Professor of Primary Care at The University of Surrey. SdeL is Professor of Health Care and Clinical Informatics at The University of Surrey. JN is a primary care physician and visiting research fellow at The University of Surrey. WK is a visiting research fellow at The University of Surrey and an experienced smoking cessation nurse. PW is a Statistics Consultant in the Department of Mathematics at The University of Surrey. Pre-publication history The pre-publication history for this paper can be accessed here: http://www.biomedcentral.com/1471-2466/14/77/prepub Supplementary Material Additional file 1 Detailed statistical analysis. Click here for file Acknowledgements We are grateful for the help of Aino Telaranta-Keerie and the staff of Lab 21 for their support and for carrying out the Respiragene tests. We are also indebted to Kevin Murphy of Synergenz for his encouragement and support. Professor Robert Young and his team of Auckland New Zealand developed the Respiragene test and the risk score formula. His advice and guidance has been invaluable. Wetterstrand KA DNA Sequencing Costs Data from the NHGRI Large-Scale Genome Sequencing Program http://en.wikipedia.org/wiki/Personal_genomics#cite_note-18 Smerecnik C Grispen JEJ Quaak M Effectiveness of testing for genetic susceptibility to smoking-related diseases on smoking cessation outcomes: a systematic review and meta-analysis Tob Control 2012 21 3 347 354 10.1136/tc.2011.042739 21948804 Smith SM Campbell MC Macleod U Factors contributing to the time taken to consult with symptoms of lung cancer: a cross sectional study Thorax 2009 64 1953 531 Sanderson SC ONeill SC White DB Bepler G Bastian L Lipkus IM McBride CM Responses to online GSTM1 genetic test results among smokers related to patients with lung cancer: a pilot study Cancer Epidemiol Biomarkers Prev 2009 18 7 1953 1961 10.1158/1055-9965.EPI-08-0620 19567511 Young RP Hopkins R Black PN Eddy C Wu L Gamble GD Mills GD Garrett JE Eaton TE Rees MI Functional variants of antioxidant genes in smokers with COPD and in those with normal lung function Thorax 2006 61 5 394 399 10.1136/thx.2005.048512 16467073 Young RP Hopkins RJ Christmas T Black PN Metcalf P Gamble GD COPD prevalence is increased in lung cancer independent of age sex and smoking history Eur Respir J 2009 34 2 380 386 10.1183/09031936.00144208 19196816 Young RP Hopkins RJ Hay BA Epton MJ Mills GD Black PN Gardner HD Sullivan R Gamble GD Lung cancer susceptibility model based on age family history and genetic variants PLoS ONE [Electronic Resource] 2009 4 4 e5302 10.1371/journal.pone.0005302 Young RP Hopkins RJ Hay BA Gamble GD GWAS And Candidate SNPs For COPD And Lung Cancer Combine To Identify Lung Cancer Susceptibility: Validation In A Prospective Study Am J Respir Crit Care Med 2010 181 A3738 Young RP Hopkins RJ Hay BA Epton MJ Mills GD Black PN Gardner HD Sullivan R Gamble GD A gene-based risk score for lung cancer susceptibility in smokers and ex-smokers Postgrad Med J 2009 85 515 524 10.1136/pgmj.2008.077107 19789190 Young RP Hopkins RJ Hay BA Epton MJ Black PN Gamble GD Lung cancer gene associated with COPD: triple whammy or possible confounding effect? Eur Respir J 2008 32 5 1158 1164 10.1183/09031936.00093908 18978134 McBride CM Bepler G Lipkus IM Lyna P Samsa G Albright J Datta S Rimer BK Incorporating genetic susceptibility feedback into a smoking cessation program for African-American smokers with low income Cancer Epidemiol Biomarkers Prev 2002 11 6 521 528 12050092 Sanderson SC Humphries SE Hubbart C Hughes E Jarvis MJ Wardle J Psychological and Behavioural Impact of Genetic Testing Smokers for Lung Cancer Risk: A Phase II Exploratory Trial J Health Psychol 2008 13 481 494 10.1177/1359105308088519 18420756 Wells S de Lusignan S Does screening for loss of lung function help smokers give up? Br J Nurs 2003 12 12 744 750 12829957 Parkes G Greenhalgh T Griffin M Dent R Effect on smoking quit rate of telling patients their lung age: The Step2quit randomised control trial BMJ 2008 336 598 600 10.1136/bmj.39503.582396.25 18326503 Hopkins RJ Young RP Hay B Gamble GD Lung cancer risk testing enhances NRT uptake and quit rates in randomly recruited smokers offered a gene based risk test Am J Respir Crit Care Med 2012 185 A2590 Hopkins RJ Young RP Hay B Gamble GD Gene-based lung cancer risk score triggers smoking cessation in randomly recruited smokers Am J Respir Crit Care Med 2011 183 A5441 West R Shiffman S McLean D Fast Facts: Smoking Cessation (Fast Facts series) Paperback 2007 London: Health Press Young RP Hopkins RJ Smith M Hogarth DK Smoking cessation: the potential role of risk assessment tools as motivational triggers [Review] Postgrad Med J 2010 86 1011 26 33 10.1136/pgmj.2009.084947 20065338 Cabebe E Recruitment details: REACT Clinical Trial Lung Cancer Detection Study http://www.elcaminohospital.org/Cancer_Center/Clinical_Trials/Lung_Cancer_Detection_Study McClure JB Ludman EJ Grothaus L Pabiniak C Richards J Impact of spirometry feedback and brief motivational counseling on long-term smoking outcomes: a comparison of smokers with and without lung impairment Patient Education & Counseling 2010 80 2 280 283 10.1016/j.pec.2009.11.002 20434863 Sanderson SK Humphries SE Hubbart C Psychological and behavioural impact of genetic testing smokers for lung cancer risk J Health Psychol 2010 13 4 481 494 18420756 Croghan E NHS Local stop smoking services services delivery and monitoring guidance 2011/12" | Lung_Cancer |
"A. Proliferation assay in Mero-14 cells. The graph shows the effect of the treatments with 5 µM cisplatin and 40 nM siMSLN-1 used as single agents or in combination. On day 6 MANOVA shows a statistically significant effect both for cisplatin (P?=?0.0168) and siMSLN-1 (P<10?4) in reducing proliferation. However the interaction term for the effect of both agents in combination is not statistically significant (P?=?0.145). Error bars represent SEM of three independent experiments each performed in quadruplicate. B. Flow cytometry analysis. The graph shows the percentage of cells in phase S+G2+M in Mero-14 cells treated with 40 nM of the siCtrl or siMSLN-1 in combination with imatinib (25 µM) or gemcitabine (1 µM) (alone) or imatinib+gemcitabine (10 µM and 1 µM respectively). The transfection with siMSLN-1 was accompanied with a marked decrease of cells in S+G2+M phase as compared with the respective cultures transfected with siCtrl irrespectively of the drugs employed (P?=? 0.00033). Error bars represent SEM of two independent experiments. C. Caspase activity measured on Mero-14 cells transfected with 40 nM of siCtrl or siMSLN-1 with or without cisplatin 5 µM. A marked increase in apoptosis is observed when siMSLN-1 and cisplatin are administered together compared to cultures treated with cisplatin and transfected with siCtrl (*P?=?0.018) suggesting a synergistic effect. Error bars represent SEM of three independent experiments each performed in triplicate. D. Western blotting analysis of MSLN p53 and PARP under different combinations of siRNAs and cisplatin (at 5 10 and 20 µM). ?-actin was used as reference. The protein levels were confirmed with three independent experiments. Legend to figure 5: Dark line: cells trated with siCtrl; gray line and triangles: cells treated with siCtrl plus cisplatin; gray line and dark spots: cells treated with siMSLN plus cisplatin; dark line and white spots: cells treated with siMSLN-1. Role of MSLN in cell cycle progression and apoptosis following treatments with chemotherapeutic drugs Following flow cytometry analysis Mero-14 cells treated with siMSLN-1 in combination with cisplatin or imatinib or gemcitabine (each as a single agent) or imatinib+gemcitabine showed a statistically significant decreased share of cells in S+G2+M phase as compared to their respective cultures where siMSLN-1 were replaced with siCtrl (B). This finding further confirmed the activity of siMSLN-1 in slowing the progression through cell cycle. In treatments where siRNA was combined with chemotherapeutic drugs activities of caspases-3 and -7 were measured as markers for apoptosis. The addition of siMSLN-1 in cultures treated with imatinib or gemcitabine (each as a single agent) or imatinib+gemcitabine was not associated with an increased rate of apoptosis as compared to cultures treated with the chemotherapeutic drugs together with siCtrl. Interestingly a synergistic effect was observed when cisplatin was used in combination with siMSLN-1. In fact siMSLN-1 or cisplatin alone did not induce apoptosis whereas they markedly (and in a statistically significant way) induced increased apoptosis rates when used together (C). This observation was further corroborated by the induction of p53 and by the cleavage of PARP both additional markers for apoptosis (D). The effect was dose-dependent and visible from 5 µM of cisplatin. Discussion The present work provides evidence on the importance of MSLN for cell growth and invasiveness in MPM. The transient MSLN-silencing caused a decrease in the proliferation rate of the MSLN-overexpressing cell line Mero-14. These data are in agreement with those observed on PC cells [24]. Similar findings were also reported by Wang et al. in the MSLN-overexpressing MPM cell lines H2373 [25]. As with the H2373 MPM cells the substantial arrest of the proliferation rate observed in the Mero-14 cells was underlined by the shift of the phosphorylation status of AKT and ERK (used as a marker of proliferation). The results on MPM cells were in agreement with the findings observed in PC and OC cells [25] suggesting that all the MSLN-expressing cancer cells show a significant loss of viability upon MSLN depletion. In addition to the reduced proliferation Mero-14 cells also showed a reduced capacity of sphere formation in a three-dimensional context. Concerning the cell cycle a significant increase (50%) of MPM H2373 cells in the S-phase was observed portraying a blockade in progression from S to G2 phase [25]. The results obtained in Mero-14 cells were different since a reduction of cells in S-phase was observed paralleling an increase of cells in G1 phase. The differences could be ascribed to the different methods of siRNA administration (electroporation in H2373 versus chemical transfection in Mero-14) involving different time of observation (48 versus 72 hours respectively). However the overall decrease of cells in G2/M was consistent in both cell lines. Moreover a significant reduction in invasiveness was observed in both Mero-14 and H2373 cells in the trans-well assay. With regard to apoptosis no assays were reported for H2373. In general MPM cell lines are quite refractory to undergo apoptosis and this was also observed in Mero-14 cells after MSLN depletion or a treatment with cisplatin. By contrast MSLN silencing was able to promote apoptosis in PC AsPC-1 Capan-1 and Capan-2 cells [24]. However MSLN depletion triggered a marked increase in apoptosis in Mero-14 cells when used in combination with cisplatin thereby suggesting a synergistic effect. In Mero-14 cells the activation of caspases-3 and 7 was associated with the induction of p53 and with the cleavage of PARP both markers of a pro-apoptotic activity. In summary paralleling previous studies our findings confirm that MSLN should not be regarded only as an interesting diagnostic marker for MPM or a promising target for immunotherapies. Despite the limited knowledge on the biological role of MSLN in normal and cancer cells MSLN should also be considered a key molecular target for novel gene-based targeted therapies of cancer. Supporting Information Table S1 Genes analysed for their mRNA expression in the present work. The table reports in the order the gene name the gene bank ID code the ID numbers of the TaqMan® assays the melting temperatures (in C°) and the lengths of the amplicons. (DOC) Click here for additional data file. Table S2 Silencing-RNAs tested in the present work. The table reports in the order the targeted gene the siRNAs codes and the targeted sequences. (DOC) Click here for additional data file. The authors thank Prof. Antonio Lucacchini and Prof. Maria Rosa Mazzoni (Department of Pharmacy University of Pisa) and Dr. Roberto Favoni (IRCCS A.O.U. San Martino-IST Laboratory of Gene Transfer) for the donation of the cell lines. The authors wish to thank Sandra Lindon for the proofreading of the . References 1 YamaguchiN HattoriK Oh-edaM KojimaT ImaiN et al (1994) A novel cytokine exhibiting megakaryocyte potentiating activity from a human pancreatic tumor cell line HPC-Y5. . J Biol Chem. 269(2): 80588288629 2 ChangK PastanI (1996) Molecular cloning of mesothelin a differentiation antigen present on mesothelium mesotheliomas and ovarian cancers. . Proc Natl Acad Sci U S A. 93(1): 136408552591 3 HassanR BeraT PastanI (2004) Mesothelin: a new target for immunotherapy. . Clin Cancer Res. 10(12 Pt 1): 39374215217923 4 HassanR HoM (2008) Mesothelin targeted cancer immunotherapy. . Eur J Cancer. 44(1): 465317945478 5 ArganiP Iacobuzio-DonahueC RyuB RostyC GogginsM et al (2001) Mesothelin is overexpressed in the vast majority of ductal adenocarcinomas of the pancreas: identification of a new pancreatic cancer marker by serial analysis of gene expression (SAGE). . Clin Cancer Res. 7(12): 3862811751476 6 ChangK PastanI (1996) Molecular cloning of mesothelin a differentiation antigen present on mesothelium mesotheliomas and ovarian cancers. Proc Natl Acad Sci USA93: 136408552591 7 SapedeC GauvritA BarbieuxI PadieuM CellerinL et al (2008) Aberrant splicing and protease involvement in mesothelin release from epithelioid mesothelioma cells. . Cancer Sci. 99(3): 590418167128 8 RobinsonBW CreaneyJ LakeR NowakA MuskAW et al (2003) Mesothelin-family proteins and diagnosis of mesothelioma. Lancet362: 16121614630441 9 HassanR RemaleyAT SampsonML ZhangJ CoxDD et al (2006) Detection and quantitation of serum mesothelin a tumor marker for patients with mesothelioma and ovarian cancer. Clin Cancer Res12: 4475316428485 10 GrigoriuBD ScherpereelA DevosP ChahineB LetourneuxM et al (2007) Utility of osteopontin and serum mesothelin in malignant pleural mesothelioma diagnosis and prognosis assessment. Clin Cancer Res13: 29283517504993 11 BeraTK PastanI (2000) Mesothelin is not required for normal mouse development or reproduction. . Mol Cell Biol. 20(8): 2902610733593 12 RumpA MorikawaY TanakaM MinamiS UmesakiN et al (2004) Binding of ovarian cancer antigen CA125/MUC16 to mesothelin mediates cell adhesion. J Biol Chem279: 9190919814676194 13 ChenSH HungWC WangP PaulC KonstantopoulosK (2013) Mesothelin binding to CA125/MUC16 promotes pancreatic cancer cell motility and invasion via MMP-7 activation. Sci Rep. 3: 187023694968 14 BharadwajU LiM ChenC YaoQ (2008) Mesothelin-induced pancreatic cancer cell proliferation involves alteration of cyclin E via activation of signal transducer and activator of transcription protein 3. Mol Cancer Res6: 1755176519010822 15 TangZ QianM HoM (2013) The role of mesothelin in tumor progression and targeted therapy. . Anticancer Agents Med Chem. 13(2): 2768022721387 16 HassanR VinerJL WangQC MarguliesI KreitmanRJ et al (2000) Anti-tumor activity of K1-LysPE38QQR an immunotoxin targeting mesothelin a cell-surface antigen overexpressed in ovarian cancer and malignant mesothelioma. . J Immunother. 23(4): 473910916757 17 HungCF CalizoR TsaiYC HeL WuTC (2007) A DNA vaccine encoding a single-chain trimer of HLA-A2 linked to human mesothelin peptide generates anti-tumor effects against human mesothelin-expressing tumors. . Vaccine. 25(1): 1273516930783 18 HungCF TsaiYC HeL WuTC (2007) Control of mesothelin-expressing ovarian cancer using adoptive transfer of mesothelin peptide-specific CD8+ T cells. . Gene Ther. 14(12): 921917377599 19 BreidenbachM ReinDT EvertsM GlasgowJN WangM et al (2005) Mesothelin-mediated targeting of adenoviral vectors for ovarian cancer gene therapy. . Gene Ther. 12(2): 1879315526007 20 YuL FengM KimH PhungY KleinerDE et al (2010) Mesothelin as a potential therapeutic target in human cholangiocarcinoma. . J Cancer. 1: 141920922056 21 TangZ FengM GaoW PhungY ChenW et al (2013) A human single-domain antibody elicits potent antitumor activity by targeting an epitope in mesothelin close to the cancer cell surface. . Mol Cancer Ther. 12(4): 4162623371858 22 HassanR EbelW RouthierEL PatelR KlineJB et al (2007) Preclinical evaluation of MORAb-009 a chimeric antibody targeting tumor-associated mesothelin. . Cancer Immun. 7: 2018088084 23 ImamuraO OkadaH TakashimaY ZhangD KobayashiT et al (2008) siRNA-mediated Erc gene silencing suppresses tumor growth in Tsc2 mutant renal carcinoma model. . Cancer Lett. 268(2): 2788518490101 24 ZhengC JiaW TangY ZhaoH JiangY et al (2012) Mesothelin regulates growth and apoptosis in pancreatic cancer cells through p53-dependent and -independent signal pathway. . J Exp Clin Cancer Res. 31: 8423034174 25 WangK BodempudiV LiuZ Borrego-DiazE YamoutpoorF et al (2012) Inhibition of mesothelin as a novel strategy for targeting cancer cells. PLOS ONE7(4): e3321422485139 26 VersnelMA HoogstedenHC HagemeijerA BoutsMJ van der KwastTH et al (1989) Characterization of three human malignant mesothelioma cell lines. Cancer Genet Cytogenet. 42(1): 115282790740 27 OrengoAM SpoletiniL ProcopioA FavoniRE De CupisA et al (1999) Establishment of four new mesothelioma cell lines: characterization by ultrastructural and immunophenotypic analysis. Eur Respir J. 13(3): 5273410232421 28 VandesompeleJ De PreterK PattynF PoppeB Van RoyN et al (2002) Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol3(7): RESEARCH003412184808 29 VichaiV KirtikaraK (2006) Sulforhodamine B colorimetric assay for cytotoxicity screening. Nat Protoc1: 1112111617406391 30 De LucaA MaielloMR D'AlessioA PergamenoM NormannoN (2012) The RAS/RAF/MEK/ERK and the PI3K/AKT signalling pathways: role in cancer pathogenesis and implications for therapeutic approaches. Expert Opin Ther Targets16 Suppl 2S172722443084 31 LiangCC ParkAY GuanJL (2007) In vitro scratch assay: a convenient and inexpensive method for analysis of cell migration in vitro. Nat Protoc2: 32933317406593 32 MarshallJ (2011) Transwell(®) invasion assays. Methods Mol Biol769: 9711021748672 Radiat Oncol Radiat Oncol Radiation Oncology (London England) 1748-717X BioMed Central 24479954 3922961 1748-717X-9-41 10.1186/1748-717X-9-41 Research Pretreatment SUVmax predicts progression-free survival in early-stage non-small cell lung cancer treated with stereotactic body radiation therapy Horne Zachary D 1 hornezd@upmc.edu Clump David A 1 clumpda2@upmc.edu Vargo John A 1 vargoja2@upmc.edu Shah Samir 1 shahs3@upmc.edu Beriwal Sushil 1 beriwals@upmc.edu Burton Steven A 1 burtons@upmc.edu Quinn Annette E 1 quinnae@upmc.edu Schuchert Matthew J 2 schuchertmj@upmc.edu Landreneau Rodney J 2 landreneaurj@upmc.edu Christie Neil A 2 christiena@upmc.edu Luketich James D 2 luketichjd@upmc.edu Heron Dwight E 1 herond2@upmc.edu 1Department of Radiation Oncology University of Pittsburgh Cancer Institute 5230 Centre Ave Pittsburgh PA 15232 USA 2Division of Thorcic and Foregut Surgery Department of Cardiothoracic Surgery University of Pittsburgh Medical Center 200 Lothrop St Suite C-816 Pittsburgh PA 15213 USA 2014 30 1 2014 9 41 41 24 9 2013 2 1 2014 Copyright © 2014 Horne et al.; licensee BioMed Central Ltd. 2014 Horne et al.; licensee BioMed Central Ltd. This is an Open Access distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0) which permits unrestricted use distribution and reproduction in any medium provided the original work is properly cited. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this unless otherwise stated. Background This retrospective study aims to assess the usefulness of SUVmax from FDG-PET imaging as a prognosticator for primary biopsy-proven stage I NSCLC treated with SBRT. Methods This study includes 95 patients of median age 77 years with primary biopsy-confirmed peripheral stage IA/IB NSCLC. All patients were treated with 60Gy in 3 fractions with a median treatment time of six days. Local regional and distant failures were evaluated independently according to the terms of RTOG1021. Local regional and distant control overall- and progression-free survival were estimated by the Kaplan-Meier method. Cox proportional hazards regression was performed to determine whether SUVmax age KPS gender tumor size/T stage or smoking history influenced outcomes. SUVmax was evaluated as both a continuous and as a dichotomous variable using a cutoff of <5 and ?5. Results Median follow-up for the cohort was 16 months. Median OS and PFS were 25.3 and 40.3 months respectively. SUV with a cutoff value of 5 predicted for OS and PFS (p?=?.024 for each) but did not achieve significance for LC (p?=?.256). On Cox univariate regression analysis SUV as a dichotomous variable predicted for both OS and PFS (p?=?.027 and p?=?.030 respectively). Defined as a continuous variable SUVmax continued to predict for OS and PFS (p?=?.032 and p?=?.003) but also predicted LC (p?=?.045) and trended toward significance for DC (p?=?.059). SUVmax did not predict for OS as a dichotomous or continuous variable. It did however predict for PFS as a continuous variable (p?=?.008) neared significance for local control (p?=?.057) and trended towards significance for distant control (p?=?.092). Conclusions SUVmax appears to be a statistically and clinically significant independent prognostic marker for progression-free survival in patients with stage I NSCLC treated with SBRT. Prospective studies to more accurately define the role of tumor FDG uptake in the prognosis of NSCLC are warranted. Introduction [18?F]-Fluorodeoxyglucose positron emission tomography (FDG-PET) is an important tool in the initial staging and subsequent assessment of patients diagnosed and treated for non-small cell lung cancer (NSCLC) [12]. FDG-PET imaging relies on the functional properties that define malignancies including increased glucose metabolism. This uptake is linked to tumor proliferation and metastatic potential and recent investigations demonstrate the usefulness of PET imaging as a prognosticator for eventual outcomes. The International Association for the Study of Lung Cancer (IASLC) reviewed 21 studies that assessed the utility of the maximum standardized uptake value (SUVmax) in NSCLC and determined that tumors with higher SUVmax have poorer prognoses [3]. Other recent studies have attempted to determine the utility of SUVmax under a more narrow scope including that of early-stage NSCLC treated with stereotactic body radiation therapy (SBRT) an emerging technique typically reserved for patients who are medically-inoperable or who refuse surgery [45]. Multiple studies demonstrate that pretreatment SUVmax predicts for clinical outcomes in patients with early-stage NSCLC treated with SBRT [6-8]. To the contrary studies from Cleveland Clinic and Indiana University failed to find a correlation between pre-treatment SUVmax and survival [910]. As early-stage NSCLC is a potentially curable disease with SBRT here an SUVmax cutoff that predicts for more aggressive disease in patients with solitary peripheral primary stage I NSCLC is identified. Methods and materials Patients and workup This study includes 95 non-consecutive patients treated for biopsy-confirmed peripheral stage IA/IB between October 2005 and May 2011 [11]. This research was determined to have exemption status by our Institutional Review Board. All patients were staged according to the 7th edition of the AJCC criteria. No tumor was located within 2 cm of the proximal bronchial tree and no patient was previously treated for lung cancer. All patients had a pre-SBRT FDG-PET-CT scan with a documented SUVmax. Of these patients 14 were operable candidates but refused surgical therapy while the remaining 81 patients had significant pulmonary or cardiac comorbidity that precluded definitive surgical management (Table 1). As a part of the staging all patients underwent a PET-CT scan. The SUVmax was obtained from review of the formally dictated radiology report. Table 1 Patient characteristics n?=?95 Median Age 77 (48-91) years Sex Male 49 (51.6%) Female 46 (48.4%) Operable 14 (14.7%) Inoperable 81 (85.3%) KPS 80-100 63 (66.3%) <70 32 (32.7%) Clinical follow-up 16.33 (1.13-64.2) months Simulation and treatment Each patient was positioned supine with arms raised above the head for the CT simulation. A thin-slice 4-D high resolution CT (2.5 mm) and 1.25 mm helical CT with intravenous contrast was obtained while the patient was immobilized in a custom BodyFIX vacuum bag (Electa). For patients treated with CyberKnife¢ Synchrony Respiratory Tracking System (Accuray Inc Sunnyvale CA) was utilized in conjunction with the 4D-CT to ensure fiducial movement in sync with the GTV. For Trilogy¢ and Trubeam¢ patients image-guided respiratory cycle motion was accounted for via Varian Real-Time Position Management System (Varian Medical Systems Palo Alto CA). Respiratory gating was incorporated for patients with tumor motion?>?0.5 cm. The acquired images were then transferred to the treatment planning workstation using either Accuray MulitPLAN¢ (Accuray Inc Sunnyvale CA) or Varian Eclipse¢ (Varian Medical Systems Palo Alto CA). The AAA planning algorithm was utilized for patients treated on Trilogy¢ and Trubeam¢ and the pencil beam algorithm for patients treated on CyberKnife¢. The tumor volume and any surrounding critical structures including the spinal cord heart esophagus brachial plexus and normal lung were manually delineated by a radiosurgical team consisting of a radiation oncologist a medical physicist and a thoracic surgeon. The gross tumor volume (GTV) was defined as the tumor alone. To account for setup error and residual motion detected on end-exhalation 4D-CT a minimum expansion of 5 mm margin was added to create the planning target volume (PTV). An additional margin based on motion assessment was added to create an internal target volume (ITV) to be used with gating. Dose-volume histograms were calculated for the target volume and nearby critical structures to select the optimal treatment plan which provided at least 95% of the prescription dose to the PTV while sparing surrounding organs-at-risk. If surrounding organs-at-risk were deemed to be at excess risk for toxicity a plan with lower PTV coverage was accepted. SBRT was performed using CyberKnife¢ Robotic Radiosurgery System (Accuray Inc Sunnyvale CA for 39 patients Trilogy¢ Radiosurgery System (Varian Medical Systems Palo Alto CA) for 54 patients and Trubeam¢ Radiosurgery System (Varian Medical Systems Palo Alto CA) for 2 patients. All lesions were treated with heterogeneity correction to 60 Gy in 3 fractions every other day with a median of 6 elapsed days from beginning of treatment to end (range 3-21 days). For patients treated on the Trilogy¢ and Trubeam ¢ platforms cone-beam CT (CBCT) was performed daily to separate setup error from tumor reposition error. The treating physician checked and modified the alignment based on target relocalization in the fused imaging. Disease assessment and clinical follow-Up After treatment patients were scheduled to have either a CT or PET/CT scan every 3 months with a clinical evaluation. Response to treatment was evaluated by the RECIST v1.1 criteria and documented as a complete response partial response (greater than 30% decrease in the longest axis) progressive disease (greater than 20% increase in the longest axis) or stable disease (neither partial response nor progressive disease) [12]. Follow-up imaging was re-evaluated to classify local regional and distant failures similar to the definitions of RTOG 1021 [13]. Local failures were defined as recurrence within the originally involved lobe or within 2 cm of the initial primary but located outside the originally involved lobe. Regional failure included non-involved ipsilateral lobes as well as ipsilateral hilar mediastinal and subcarinal lymph nodes. Distant failures enveloped ipsilateral supraclavicular and contralateral lymph nodes and all other distant sites. Progression-free survival was defined as the time to a specified recurrence and was measured from the last day of treatment to that event. Death was not included as an endpoint for PFS. Local regional and distant control overall- and progression-free survival were estimated by the Kaplan-Meier method. The ANOVA test was utilized to determine correlations between SUVmax tumor histology and stage. Forward conditional Cox proportional hazards regression was performed to determine whether SUVmax (continuous/dichotomous) age (continuous) KPS (continuous) gender tumor T stage tumor histology or smoking pack years (continuous) influenced outcomes. SUVmax was evaluated in univariate and multivariate analyses as both a continuous and as a dichotomous variable using a cutoff of <5 and ?5 as described in previous reports [691415]. All statistics were completed using SPSS version 20 (IBM Corp Armonk NY). Significance was set at p???0.05. Results A total of 95 patients with a median age 77 years (range: 48-91 years) were identified between October 2005 and May 2011 (Table 1). All patients had biopsy-confirmed NSCLC with 38 (40%) having squamous cell carcinoma and 33 (34.7%) having adenocarcinoma. " | Lung_Cancer |
"Study for Epidermal Growth Factor Receptor and KRAS Mutation Detection in 74 Blinded Non-small Cell Lung Carcinoma Samples: A Total of 5550 Exons Sequenced by 15 Molecular French Laboratories. J Thorac Oncol6: 1006101521532509 39 BellonE LigtenbergMJ TejparS CoxK de HertoghG et al (2011) External quality assessment for KRAS testing is needed: setup of a European program and report of the first joined regional quality assessment rounds. Oncologist16: 467478 Br J Cancer Br. J. Cancer British Journal of Cancer 0007-0920 1532-1827 Nature Publishing Group 24921918 4119981 bjc2014308 10.1038/bjc.2014.308 Epidemiology Possible pro-carcinogenic association of endotoxin on lung cancer among Shanghai women textile workers Pro-carcinogenic association of endotoxin on lung cancer Checkoway H 1 * Lundin J I 2 Costello S 3 Ray R 4 Li W 4 Eisen E A 3 Astrakianakis G 5 Seixas N 2 Applebaum K 6 Gao D L 7 Thomas D B 4 1Department of Family and Preventive Medicine University of California San Diego La Jolla CA 92093 USA 2Department of Environmental and Occupational Health Sciences University of Washington Seattle WA 98195 USA 3Department of Environmental Health Sciences University of California Berkeley CA 94720 USA 4Division of Public Health Sciences Fred Hutchinson Cancer Research Center Seattle WA 98109 USA 5School of Population and Public Health University of British Columbia Vancouver BC V6T1Z4 Canada 6Department of Environmental and Occupational Health Gee Washington University Washington DC 20052 USA 7Zhong Shan Hospital Cancer Center Shanghai 200030 China *E-mail: hcheckowayucsd.edu 29 07 2014 12 06 2014 111 3 603 607 20 02 2014 05 05 2014 11 05 2014 Copyright 2014 Cancer Research UK 2014 Cancer Research UK From twelve months after its original publication this work is licensed under the Creative Commons Attribution-NonCommercial-Share Alike 3.0 Unported License. To view a copy of this license visit http://creativecommons./licenses/by-nc-sa/3.0/ Background: Endotoxin (lipopolysaccharide) is a widespread contaminant in many environmental settings. Since the 1970s there has been generally consistent evidence indicating reduced risks for lung cancer associated with occupational endotoxin exposure. Methods: We updated a casecohort study nested within a cohort of 267?400 female textile workers in Shanghai China. We compared exposure histories of 1456 incident lung cancers cases diagnosed during 19892006 with those of a reference subcohort of 3022 workers who were free of lung cancer at the end of follow-up. We applied Cox proportional hazards modelling to estimate exposureresponse trends adjusted for age and smoking for cumulative exposures lagged by 010 and 20 years and separately for time windows of ?15 and >15 years since first exposure. Results: We observed no associations between cumulative exposure and lung cancer irrespective of lag interval. In contrast analyses by exposure time windows revealed modestly elevated but not statistically significant relative risks (?1.27) at the highest three exposure quintiles for exposures that occurred >15 years since first exposure. Conclusions: The findings do not support a protective effect of endotoxin but are suggestive of possible lung cancer promotion with increasing time since first exposure. endotoxin lipopolysaccharide lung cancer epidemiology textile industry occupational health Br J Cancer Br. J. Cancer British Journal of Cancer 0007-0920 1532-1827 Nature Publishing Group 24651386 3992504 bjc2014146 10.1038/bjc.2014.146 Clinical Study A multicentre randomised controlled trial of reciprocal lung cancer peer review and supported quality improvement: results from the improving lung cancer outcomes project Improving lung cancer outcomes project results Russell G K 1 Jimenez S 1 Martin L 1 Stanley R 2 Peake M D 1 3 Woolhouse I 1 4 * 1Clinical Standards Department Royal College of Physicians London NW14LE UK 2Clinical Audit Support Unit NHS Information Centre for Health and Social Care Leeds LS16AE UK 3Department of Respiratory Medicine Glenfield Hospital Leicester LE39QP UK 4Department of Respiratory Medicine Queen Elizabeth Hospital Birmingham Birmingham B152WB UK *E-mail: ian.woolhouseuhb.nhs.uk 15 04 2014 20 03 2014 110 8 1936 1942 19 12 2013 11 02 2014 24 02 2014 Copyright 2014 Cancer Research UK 2014 Cancer Research UK From twelve months after its original publication this work is licensed under the Creative Commons Attribution-NonCommercial-Share Alike 3.0 Unported License. To view a copy of this license visit http://creativecommons./licenses/by-nc-sa/3.0/ Background: Results from the National Lung Cancer Audit demonstrate unexplained variation in outcomes. Peer review with supported quality improvement has been shown to reduce variation in other areas of health care but has not been formally tested in cancer multidisciplinary teams. The aim of the current study is to assess the impact of reciprocal peer-to-peer review visits with supported quality improvement and collaborative working on lung cancer process and outcome measures. Methods: English lung cancer teams were randomised to usual care or facilitated reciprocal peer review visits followed by 12 months of supported quality improvement. The primary outcome was change in the following national audit indicators; mulitdisciplinary team discussion histological confirmation active treatment surgical resection small-cell chemotherapy and specialist nurse review. Patient experience was measured using a new lung cancer patient questionnaire in the intervention group. Results: Thirty teams (31 trusts) entered the intervention group and 29 of these submitted a total of 67 quality improvement plans. Active treatment increased in the intervention group (n=31) by 5.2% compared with 1.2% in the control group (n=48 mean difference 4.1% 95% CI ?0.1 to 8.2% P=0.055). The remaining audit indicators improved similarly in all groups. Mean patient experience scores in the intervention group did not change significantly during the study but a significant improvement was seen in the scores for the five teams with the worst baseline scores (0.86 to 0.22 P<0.001). Conclusions: Reciprocal peer review with supported quality improvement was feasible and effective in stimulating quality improvement activity but resulted in only modest improvements in lung cancer treatment rates and patient experience. lung cancer multidisciplinary quality improvement peer Lung cancer is the commonest cause of cancer death in England and Wales with around 38?000 cases diagnosed each year and ?35?000 deaths. Data from the National Lung Cancer Audit (NLCA) demonstrate significant variation in process and outcome measures across England. In 2009 there was a three-fold difference in survival and active treatment rates which persisted following case mix adjustment (Beckett et al 2012). Furthermore reported lung cancer outcomes in the UK are worse than other comparable European countries (Walters et al 2013) and have improved little in recent years (Khakwani et al 2013). It has been estimated that if survival rates were increased to that of the best in Europe around 1300 lives could be saved each year in the United Kingdom (Abdel-Rahman et al 2009). Variation in health care is not unique to lung cancer and addressing unwarranted variation is challenging (Wise 2010). Although external regulation may have a role in some areas this approach is more difficult to apply to the complex pathways involved in lung cancer diagnosis and treatment. Peer review with supported quality improvement offers a promising alternative but the evidence for its effectiveness is limited. The Washington State's Surgical Care and Outcomes Assessment Program utilised a peer support programme to share the best practice which led to a significant reduction in post-operative complications (Kwon et al 2012). Within the United Kingdom the national COPD resources and outcomes project demonstrated that reciprocal peer-to-peer review led to only limited quantitative differences in the quality of services offered (Roberts et al 2012). A qualitative analysis of this study identified a number of barriers to improvement including difficulties in establishing effective working relationships funding changes and service re-design. In 2003 the Institute for Healthcare Improvement described the collaborative model to achieve a breakthrough improvement (Institute for Healthcare Improvement 2003). Collaboratives allow teams working on the same issue to share good practice and innovation permitting others to take these ideas and implement them in the context of their own anisation resources and case mix. Pronovost et al (2006) successfully employed this collaborative approach together with supported quality improvement to implement five evidence-based interventions on the intensive care unit resulting in the reduction in catheter-related bloodstream infections to zero. These studies offer a persuasive proof of concept but the absence of a control group or of patient-specific outcomes measures limits their implementation in other disease areas such as cancer. The aim of the current study is to determine whether a programme of reciprocal peer-to-peer review visits with supported quality improvement and collaborative working can significantly improve lung cancer process and outcome measures and thus reduce unwarranted variation in outcomes. Materials and methods Study design We conducted a prospective randomised controlled trial. Study population One hundred and sixty-two English NHS trusts were identified from the 2008 NLCA annual report. Centres only providing treatment (not diagnostics) orthopaedic hospitals and ambulance trusts were excluded. Invitations to participate were sent to the remaining 152 trusts. Trusts who agreed to participate and who had 2008 NLCA case ascertainment rates of > 50% expected were paired before randomisation on the basis of contrasting results for four key indicators from the NLCA. The indicators were active treatment rates surgical resection rates median survival and the proportion of patients assessed by a clinical nurse specialist. Each trust was colour coded for each indicator red if below the national average and green if above. By placing each trust with its colour-coded indicators on a map we were able to pair trusts on the basis of a contrasting mixture of red and green indicators and a travel time between centres of around 2?h. On the basis of data from the national COPD resources and outcomes project we determined that we would be able to complete 30 peer review visits during the lifetime of the project thus allowing 30 lung cancer multidisciplinary teams (15 pairs) to be randomised into the intervention arm. Randomisation was performed in a blinded fashion by assigning a random number to each pair of trusts and then allocating pairs numbered 115 to the intervention group. The remaining trusts formed either the control group (if they had agreed to participate) or the non-participant group and had no further contact with the study team but continued to submit data to the NLCA as usual. Intervention The study timeline is shown in Figure 1. Following introductory workshops the multidisciplinary teams within each pair undertook facilitated reciprocal site visits. The visits consisted of observation of the host team's multidisciplinary team meeting three discussion sessions focusing on the functioning of the mulitdisciplinary team meeting the host team's NLCA data and patient experience questionnaire results. The final session aimed to identify the focus of improvement work to be undertaken by the host team. The quality improvement facilitator introduced a structured template for the quality improvement plans and provided a short introduction to using the model of improvement to guide implementation of the plans. Over the next 12 months the quality improvement facilitator provided support via electronic mail telephone and follow-up visits where required. Teams within the intervention group supported each other via mini-collaboratives in the form of web-based teleconferences and two face-to-face workshops. Outcomes Changes in process and outcome were assessed using data from local quality-improving plans and the following indicators from the NLCA: the proportion of patients discussed at a multidisciplinary team meeting histological confirmation rate active treatment rate surgical resection rate the proportion of patients with small-cell lung cancer receiving chemotherapy and the proportion of patients seen by a lung cancer nurse specialist. Patient experience was assessed in the intervention group using a new lung cancer-specific patient experience questionnaire designed in collaboration with the Roy Castle Lung Cancer Foundation. The questionnaire included 11 questions selected with permission from the previously validated 2004 national cancer patient survey. The questions covered the following domains: communication privacy respect and dignity and three free text questions (see Appendix I). Participating teams were asked to distribute 30 questionnaires to patients recently seen in their services. The clinical nurse specialists distributed the questionnaires to patients who anonymously returned them to the Royal College of Physicians. An independent qualitative ethnographic evaluation of the study was undertaken by the Social Science Applied to Healthcare Improvement Research Group at the University of Leicester. Statistical methods Data were tested for normality using the ShapiroWilk test. Baseline NLCA indicators were taken from the 2009 NLCA report and the intervention control and non-participant groups were compared using a ?2- test. The changes in NLCA indicators from 2009 to 2011 were compared using an independent t-test. Patient experience questionnaire responses for each question were labelled and re-coded to separate them into the worst patient experience category (score 1) vs all other responses (score 0). These scores were then summated to create a domain and a total patient experience score with a possible range of 011 whereby a higher score indicates a worse patient experience. Analyses were performed using the statistical software package SPSS (International Business Machines Corp. Armonk NY USA). Funding and ethics The study was funded by a Closing the Gap' grant from the Health Foundation. The National Research Ethics Service confirmed that the study was service evaluation and quality improvement and did not require ethical review. Results One hundred trusts (66%) replied to the invitation to participate and 91 (61%) agreed to participate in the study. Eighty-one trusts had 2008 NLCA data of sufficient quality to allow pairing. Two trusts provided a joint multidisciplinary team allowing 40 pairs of multidisciplinary teams to be created. One pair agreed to act as a pilot and was excluded from further analysis. Of the remaining 39 pairs 15 pairs (31 trusts) were randomised to the intervention group. The remaining 24 pairs formed the control group. During the study two trusts in the control group amalgamated to form one trust so the total number of trusts in the control group was 47 (Figure 2). Quality improvement plans Two hundred and thirty medical professionals from 31 trusts participated in the review visits. Twenty-nine teams submitted a total of 67 quality improvement plans. The issues identified in the quality improvement plans are shown in Table 1. Eighteen teams collected local data to measure impact. An example of such data is shown in Figure 3. This trust identified small-cell lung cancer chemotherapy as an area for improvement. They introduced a number of changes to their diagnostic and treatment pathways including prioritisation of small-cell pathology reporting faxing of the results to the multidisciplinary team coordinator and lung nurse specialist to allow early booking of oncology appointments. These changes were monitored using a run chart that demonstrated a reduction in the time from multidisciplinary team meeting to chemotherapy treatment and an increase in the proportion of small-cell lung cancer patients receiving chemotherapy from 60% in 2009 to 71% in 2011. National lung cancer audit indicators Baseline (2009) NLCA indicators for the intervention control and non-participant groups were similar (Table 2). The mean change for each NLCA indicator from baseline to 2011 in the intervention and control group is shown in Figure 4. The proportion of patients receiving active anti-cancer treatment in the intervention group increased by 5.2% compared with 1.2% in the controls (mean difference 4.1% 95% CI ?0.1 to 8.2% P=0.055). The remaining NLCA indicators improved similarly both in the intervention and control groups. Patient experience In the intervention group patient experience questionnaires were returned by 438 patients from 30 multidisciplinary teams at baseline (return rate 49%) and 372 patients from 27 trusts following the intervention (return rate 41%). Baseline total scores were low (01.31) indicating high levels of patient satisfaction with the care received although there was a statistically significant (P<0.001) variation in results by the multidisciplinary team (Figure 5). In particular the proportion of patients responding yes to the question did you find that the person who told you about your diagnosis did so with sufficient sensitivity/care?' varied significantly by 57%100% (P<0.001). The total questionnaire scores did not change significantly during the study (0.220.17 P=0.377) however the variation by the multidisciplinary team reduced (Figure 5). Given that the study aimed to bring the standard of the lower performing trusts to that of the best we performed a post hoc analysis for the five trusts with the worst baseline patient experience scores. This demonstrated that the mean total score improved significantly for these trusts from 0.86 to 0.22 P<0.001. The biggest improvement in this group was seen in the proportion of patients responding yes to the question did you find that the person who told you about your diagnosis did so with sufficient sensitivity/care?' which increased from 75% to 90% (P=0.05). One multidisciplinary team in this group achieved this improvement by using their baseline questionnaire results as a lever to encourage attendance at an advanced communications skills course. The questionnaire domain-specific scores did not change significantly during the study. Of the individual questions a significant improvement was seen in the rating of the quality of information provided as excellent which rose from 53%59% P<0.05. Qualitative evaluation Participants' experiences were overwhelmingly positive. The reciprocal peer-to-peer visits with supported quality improvement were seen as a strong driver to change. The method of pairing multidisciplinary teams was important. In particular pairing teams with different results not just good' with bad' and allowing teams to visit each other's sites to ensure a two-way sharing of best practice. The independent quality improvement facilitator role was seen as crucial to ensure the visits remained focussed and that the engagement with quality improvement plans was maintained. Finally the involvement of senior managers was crucial to the successful implementation of the quality improvement plans. The detailed findings from the independent evaluation of this project have been reported elsewhere (Aveling et al 2012). Discussion Lung cancer outcomes remain relatively poor and reducing unexplained variation is an attractive proposition to promote improvement. There are a number of ways that clinical teams may share best practice and innovative service delivery models however studies formally evaluating their impact are limited. To our knowledge this is the first study to formally test a national quality improvement strategy which aimed to bring the standard of all lung cancer teams to that of the best. We have demonstrated that reciprocal peer-to-peer review with supported quality improvement is both feasible and effective at stimulating local quality improvement activity but had a relatively modest and somewhat disappointing impact on process and outcome measures as measured by NLCA indicators and a new lung cancer patient experience questionnaire. The facilitated reciprocal visits represented a new and unique opportunity for all members of a lung cancer team to exchange ideas in a supported environment and to formally design then implement quality improvement plans. Nearly two-thirds of lung cancer multidisciplinary teams in England agreed to take part in the study and reassuringly baseline NLCA indicators did not differ significantly between participants and non-participants suggesting that the willingness to participate in quality improvement activity is not related to baseline performance. There were a wide range of areas identified for improvement but nearly half of the teams identified multidisciplinary team meeting effectiveness as a key issue. This is not surprising given that these meetings are pivotal in the lung cancer pathway. Live observation of each multidisciplinary team meeting followed by facilitated feedback proved to be a strong driver to improve on problems such as ensuring weekly presence of all the treatment specialists as well as more simple issues such as room layout. The need to streamline diagnostic and treatment pathways was also identified as a common problem. Recent NICE guidance on the management of lung cancer (National Institute for Health and Care Excellence 2011) recommended a paradigm shift in the diagnostic algorithm from performing multiple diagnostic and staging investigations to performing a single test that will provide both diagnostic and staging information. A number of teams within our study were able to introduce such pathways and demonstrate impressive reductions in diagnostic times and more prompt treatment. This together with more effective multidisciplinary team working may have led to the small increase in the active anti-cancer treatment rates seen within the intervention group. However an alternative explanation for the improvement is regression to the mean given that treatment rates in the intervention group were lower at baseline and overall the lack of significant improvement across the range of NLCA indicators in the intervention group was disappointing. One possible explanation for this is the challenge that some participating teams encountered converting enthusiastic quality improvement plans into tangible improvements for patients over a relatively short time period. The qualitative evaluation confirmed that participants often underestimated the time and energy required to implement and sustain change and highlighted the importance of early engagement with hospital managers to maintain momentum (Aveling et al 2012). Alternatively other national lung cancer initiatives implemented at the time of the study may have driven coexistent improvements in the control group. For example the drive to encourage all lung cancer patients to be referred for clinical nurse specialist support has subsequently been shown to increase the probability that a lung cancer patient receives active treatment. Although even small improvements in lung cancer treatment rates are very welcome it is recognised that undergoing investigation for suspected lung cancer generates high levels of patient anxiety and many patients will remain too unwell to benefit from currently available drugs. The assessment of patient experience is therefore of particular importance in lung cancer. This has proved challenging in detailed national cancer surveys owing to the advance in age poor health and short median survival of lung cancer patients. The response rate to our short questionnaire was relatively high at 4149% compared with the 2011 national survey in which only 7% of lung cancer patients responded (Department of Health 2012) but still represents the views of less than half of lung cancer patients and is a relative limitation in terms of generalisability of the results. It was reassuring to note that at entry to the study patients in the intervention group generally rated their experience as highly satisfactory. This may explain the low number of teams who specifically identified patient experience as an area for quality improvement. In terms of assessing the impact of the reciprocal peer-to-peer review visits and supported quality improvement on patient experience it is likely that this high-baseline satisfaction and the lack of patient experience data for the control group limited our ability to detect a significant change. However our results suggest that those teams with poor scores may be able to use patient experience data to promote significant improvements particularly in areas such as communication skills. Further work is required to develop a lung cancer patient experience measure that is both acceptable to patients and able to detect small but clinically important changes in experience. Although similar in name to the national cancer peer review process there are a number of important differences between the reciprocal peer-to-peer review and supported quality improvement process employed in the current study and national cancer peer review. The latter predominantly performs a quality assurance role ensuring that cancer teams meet a minimum standard via compliance with a number of process measures. Support with quality improvement is not provided and site visits are now rarely performed. The qualitative evaluation of our study highlighted the importance of an independent quality improvement facilitator to the success of the peer review visits and the subsequent implementation of the quality improvement plans. Integration of facilitated reciprocal peer-to-peer review and supported quality improvement into national cancer peer review both for lung cancer and other tumour sites is an attractive proposition and requires further study. However our results suggest that this strategy alone is unlikely to have a major impact on lung cancer treatment rates. This phenomenon is not new in lung cancer for example the introduction and NICE approval of gefitinib treatment for the first-line treatment of lung cancer in 2010 was associated with only a 1% increase in active anti-cancer treatment rates over the following year (Health and Social Care Information Centre 2012). Achieving a stepwise increase in lung cancer treatment rates and survival is likely to require a multi-targeted approach including earlier diagnosis streamlined lung cancer pathways new treatments and a reduction in unexplained variation via supported quality improvement programmes. This project was funded by a Health Foundation Closing the Gap award. (grant number: 7797/5557). Appendix I Improving lung cancer outcomes project: patient experience questionnaireWhat is this survey about? This questionnaire asks about your experience of lung cancer treatment and care at the hospital. It was developed in 2010 and it has been used by Lung Cancer Nurse Specialists in 30 hospital across participating in the Improving Lung Cancer Outcomes Project' led by the Royal College of Physicians and several other anisations. The project aims to improve the quality of services and care for people affected by lung cancer. Why should I complete the survey? We need to know your opinion of the current services and care to help improve these for people affected by lung cancer. Your participation in this survey is voluntary and your answers will be treated in confidence. If you choose not to take part in this survey it will not affect the care you receive from the NHS in any way. Please do not write your name and address anywhere on the questionnaire as this information is not required. No information you give in this questionnaire will be shared in a way that allows you to be identified. How to complete the survey and how long it will take. The questionnaire is short and will take 510?min to complete. Please try to answer every question. Please return your questionnaire even if you have not answered every question. If English is not your first language or if you if you have difficulty understanding the questions then please ask a relative or carer to help you complete the questionnaire. Questions or help? If you have any questions please contact your local lung clinical nurse specialist team. Please select one answer to each question by placing a in the appropriate box. There is space at the end of the survey for you to write any comments. This work is published under the standard license to publish agreement. After 12 months the work will become freely available and the license terms will switch to a Creative Commons Attribution-NonCommercial-Share Alike 3.0 Unported License. Abdel-Rahman M Stockton D Rachet B Hakulinen T Coleman MP 2009 What if cancer survival in Britain were the same as in Europe: how many deaths are avoidable Br J Cancer 101 (Suppl 2 S115 S124 19956155 Aveling EL Martin G JimÃnez GarcÃa S Martin L Herbert G Armstrong N Dixon-Woods M Woolhouse I 2012 Reciprocal peer review for quality improvement: an ethnographic case study of the Improving Lung Cancer Outcomes Project BMJ Qual Saf 21 1034 1041 Beckett P Woolhouse I Stanley R Peake MD 2012 Exploring variations in lung cancer care across the UK-the story so far' for the National Lung Cancer Audit Clin Med 12 14 18 22372213 Department of Health2012National Cancer Patients' Experience Survey Programme 2012/13. England. Health And Social Care Information Centre2012National Lung Cancer Audit Report. Institute for Healthcare Improvement2003The Breakthrough Series: IHI's Collaborative Model for Achieving Breakthrough Improvement. Boston. Khakwani A Rich AL Powell HA Tata LJ Stanley RA Baldwin DR Duffy JP Hubbard RB 2013 Lung cancer survival in England: trends in non-small-cell lung cancer survival over the duration of the National Lung Cancer Audit Br J Cancer 109 (8 2058 2065 24052044 Kwon S Florence M Grigas P Horton M Horvath K Johnson M Jurkovich G Klamp W Peterson K Quigley T Raum W Rogers T Thirlby R Farrokhi E Flum D 2012 Creating a learning healthcare system in surgery: Washington State's Surgical Care and Outcomes Assessment Program (SCOAP) at 5 years Surgery 151 146 152 22129638 National Institute for Health and Care Excellence 2011 The Diagnosis And Treatment Of Lung Cancer (Update Of Nice Clinical Guideline 24) Clinical guidelines CG121 London UK Pronovost P Needham D Berenholtz S Sinopoli D Chu H Cosgrove S Sexton B Hyzy R Welsh R Roth G Bander J Kepros J Goeschel C 2006 An intervention to decrease catheter-related bloodstream infections in the ICU N Engl J Med 355 2725 2732 17192537 Roberts CM Stone RA Buckingham RJ Pursey NA Lowe D Potter JM 2012 A randomized trial of peer review: the UK National Chronic Obstructive Pulmonary Disease Resources and Outcomes Project: three-year evaluation J Eval Clin Pract 18 (3 599 605 21332611 Walters S Maringe C Coleman MP Peake MD Butler J Young N Bergström S Hanna L Jakobsen E Kölbeck K Sundstrøm S Engholm G Gavin A Gjerstorff ML Hatcher J Johannesen TB Linklater KM McGahan CE Steward J Tracey E Turner D Richards MA Rachet B ICBP Module 1 Working Group 2013 Lung cancer survival and stage at diagnosis in Australia Canada Denmark Norway Sweden and the UK: a population-based study 2004-2007 Thorax 68 551 564 23399908 Wise J 2010 Health atlas shows large variations in care in England BMJ 341 c6809 c6809 Figure 1 Study timelines. Figure 2 Consort diagram disposal of eligible trusts including screening randomisation and follow-up. Figure 3 Run chart showing the waiting times from the multidisciplinary team meeting to the first treatment for 10 consecutive small-cell lung cancer patients following the implementation of the quality improvement plan at one trust in the intervention group. Figure 4 Mean change in national lung cancer audit metrics from baseline (2009) to 2011. P=0.055 active treatmentintervention vs controls. Intervention n=31 trusts control n=47 trusts and non-intervention (control and non-participants combined) n=66 trusts. Abbreviations: CNS clinical nurse specialist; MDT multidisciplinary team; SCLC small-cell lung cancer." | Lung_Cancer |
"The clinical data for all patients were summarized in Additional file 1: Table S1. Relative BANCR expression in NSCLC tissues and its clinical significance. (A) Relative expression of BANCR in NSCLC tissues (n?=?113) compared with corresponding non-tumor tissues (n?=?113). BANCR expression was examined by qPCR and normalized to GAPDH expression. Results were presented as the fold-change in tumor tissues relative to normal tissues. (B) BANCR expression was classified into two groups. (C D) KaplanMeier disease-free survival and overall survival curves according to BANCR expression levels. *P?<?0.05 **P?<?0.01. Correlation between BANCR expression and clinicopathological characteristics of NSCLC patients (n?=?113) Characteristics BANCR P High no. cases (%) Low no. cases (%) Chi-squared test P-value Age(years) 0.616 ?65 29(54.7) 30(50.0) >65 24(45.3) 30(50.0) Gender 0.232 Male 35(66.0) 33(55.0) Female 18(34.0) 27(45.0) Histological subtype 0.466 Squamous cell carcinoma 30(56.6) 38(63.3) Adenocarcinoma 23(43.4) 22(36.7) TNM Stage <0.001* Ia + Ib 25(47.2) 9(15.0) IIa + IIb 17(32.1) 21(35.0) IIIa 11(20.7) 30(50.0) Tumor size 0.001* ?5cm 35(66.0) 21(35.0) >5cm 18(34.0) 39(65.0) Lymph node metastasis 0.001* Negative 34(64.2) 20(33.3) Positive 19(35.8) 40(66.7) Smoking History 0.127 Smokers 39(64.2) 36(60.0) Never Smokers 14(35.8) 24(40.0) * Overall P?<?0.05. Association of BANCR expression with patients survival Kaplan-Meier survival analysis was conducted to investigate the correlation between BANCR expression and NSCLC patient prognosis. According to relative BANCR expression in tumor tissues the 113 NSCLC patients were classified into two groups: the high BANCR group (n?=?53 fold-change???4); and the low BANCR group (n?=?60 fold-change ?4) (B). With respect to progression-free survival (PFS) this was 35.3% for the high BANCR group and 17.2% for the low BANCR group. Median survival time for the high BANCR group was 31 months and 16 months for the low BANCR group (C). The overall survival rate over 3 years for the high BANCR group was 46% and 27.5% for the low BANCR group. Median survival time for the high BANCR group was 32 months and 18 months for the low BANCR group (D). Univariate analysis identified three prognostic factors: lymph node metastasis; TNM stage; and BANCR expression level. Other clinicopathological features such as gender and age were not statistically significant prognosis factors (). Multivariate analysis of the three prognosis factors confirmed that a low BANCR expression level was an independent predictor of poor survival for NSCLC (p?=?0.031) in addition to TNM stage (p?=?0.038) (). Univariate and multivariate analysis of overall survival in NSCLC patients (n?=?113) Variables Univariate analysis Multivariate analysis HR 95% CI p value HR 95% CI p value Age 1.257 0.712-2.219 0.431 Gender 1.185 0.670-2.098 0.559 Smoker 1.120 0.842-1.491 0.436 Histological subtype 0.982 0.738-1.307 0.902 Chemotherapy 0.787 0.587-1.055 0.110 Tumor size 1.233 0.926-1.640 0.151 Lymph node metastasis 0.424 0.235-0.764 0.004* 0.577 0.311-1.071 0.081 TNM stage (I vs. II or IIIa) 0.320 0.149-0.685 0. 003* 0.431 0.195-0.954 0.038* BANCR expression 0.367 0.201-0.669 0. 001* 0.496 0.262-0.938 0.031* HR hazard ratio; 95 % CI 95 % confidence interval * Overall P?<?0.05. Histone deacetylation is involved in the downregulation of BANCR Expression levels of BANCR in NSCLC cell lines were determined by qPCR. Compared with that in 16HBE cells relative expression levels of BANCR were reduced in NSCLC cells (A). Because of the different expression patterns for BANCR in NSCLC and melanomas we investigated the mechanisms controlling tissue-specific expression of BANCR. We analyzed the promoter region of BANCR and found there were no CpG islands (data not shown). Histone protein modification was thought to play an important role in the transcription of lncRNAs; however knockdown of two core subunits of polycomb repressive complex 2 (SUZ12 and EZH2) had no influence on BANCR expression (Additional file 2: Figure S1A). Histone deacetylation is involved in BANCR downregulation. (A) BANCR expression levels of NSCLC cell lines (A549 SPC-A1 H1299 H1650 H1975 and SK-MES-1) compared with that in normal human bronchial epithelial cells (16HBE). (B) qPCR analysis of BANCR expression levels following the treatment of SPC-A1 and A549 cells with TSA. (C) qPCR analysis of HDAC2 and HDAC3 expression levels following the treatment of SPC-A1 and A549 cells with si-HDAC2 or si-HDAC3.(D E) qPCR analysis of BANCR expression levels following the treatment of SPC-A1 and A549 cells with si-HDAC1 and si-HDAC3. We observed that BANCR expression was upregulated in SPC-A1 and A549 cells following treatment with the histone deacetylase (HDAC) inhibitor trichostatin A (TSA) (B). We sought to determine whether repression of BANCR was mediated by HDACs. Specific anti-HDAC1 and HDAC3 siRNAs were transfected into NSCLC cells and HDAC1 and HDAC3 expression was significantly decreased (C). Expression levels of BANCR were significantly upregulated in cells transfected with si-HDAC3. Transfection with the scrambled siRNA or si-HDAC1 did not induce BANCR expression (D and E). Moreover the HDAC3 expression was upregulated in NSCLC cells and negatively correlated with BANCR expression (Additional file 2: Figure S1B). Furthermore NSCLC cells were treated with RGFP966 which is an seletive inhibitor for HDAC3 with an IC50 of 0.08?M and no effective inhibition of other HDACs at concentrations up to 15?M. The results of qPCR showed that the expression of BANCR was upregulated in NSCLC cells after treated with RGFP966 when compared with control cells (Additional file 2: Figure S1C). " | Lung_Cancer |
"Hispanic black and 130598 white participants ages 4978 at enrollment in the Prostate Lung Colorectal and Ovarian (PLCO) Cancer Screening Trial. BMI at baseline BMI at age 20 and BMI change were calculated using self-reported and recalled height and weight. Relative risks were stratified by race and sex and adjusted for age education marital status and smoking. Results 1495 black and 18236 white participants died during follow-up (mean=13 years). Clear J-shaped associations between BMI and mortality were observed among white men and women. Among black men and women the bottoms of these curves were flatter and increasing risks of death with greater BMI were observed only at higher BMI levels (?35.0). Associations for BMI at age 20 and BMI change also appeared to be stronger in magnitude in whites versus blacks and these racial differences appeared to be more pronounced among women. Conclusion Our results suggest that BMI may be more weakly associated with mortality in blacks particularly black women than in whites. National Cancer Institute : NCI Z99 CA999999 || CA Introduction In the U.S. there are substantial disparities in obesity prevalence across racial and ethnic groups. In 20092010 it was estimated that 38.8% of black men and 58.5% of black women as compared with 36.2% of white men and 32.2% of white women were obese 1. Evidence suggests that differences in obesity between black and white populations has increased in the past decade23 and is likely to continue to increase in the future4. It is of great public health importance to understand how racial and ethnic differences in the burden of obesity might contribute to health disparities. In the white population it has been well-established that there is a J-shaped relation between body mass index (BMI) and all-cause mortality with recent studies showing that mortality is the lowest at BMI 22.525.0 kg/m2 and increases monotonically with increasing levels of BMI above 25.0 56. However the shape of relation between BMI and mortality in the black population is less clear. Several early studies have suggested that the association for higher BMI values may be weaker among blacks than whites especially for black women 710. However in a recent study conducted within a large U.S. cohort of black women 6 Boggs et al. found a J-shaped association between BMI and mortality that was largely similar to that in the white population 11. This and other studies have suggested that the racial difference in the BMI-mortality association may differ according to factors such as sex age and education 1011. BMI in young adulthood and subsequent weight changes may additionally affect health later in life. Previous studies conducted in predominantly white populations have linked excess body weight at young ages to elevated mortality 1214. Recent results from the Atherosclerosis Risk in Communities (ARIC) study showed a positive association between BMI at age 25 and all-cause mortality in African-American women although the authors did not examine the association of BMI change 15. More studies are needed to explore the health effects of weight at young adulthood and long-term weight change in the black population and compare these effects to those in the white population. To further clarify the BMI-mortality association in the black population we investigated the relationship of BMI at baseline and at age 20 as well as BMI change during this period with total and cause-specific mortality among black men and women in a large U.S. cohort. To investigate racial differences in these associations we directly compared the results among blacks to those among whites in this population. Methods Study population The Prostate Lung Colorectal and Ovarian (PLCO) Cancer Screening Trial is a randomized controlled multi-center trial designed to evaluate selected methods for the early detection of prostate lung colorectal and ovarian cancers1617. Briefly between November 1993 and June 2001 over 150000 men and women aged 4978 were enrolled from 10 study sites and were randomly assigned to receive either specific cancer screening regime or standard care. Of the 149980 study participants who completed the self-administered baseline risk factor questionnaire we excluded those who reported to be neither non- Hispanic black nor non-Hispanic White (n=9696) did not provide information on height or weight (n=1723) were not followed up for mortality (n=8) or reported extremely low or high BMI values (below 15 or above 50 kg/m2 n=509). The analytic cohort consisted of 3278 non-Hispanic black men4168 non-Hispanic black women64162 non-Hispanic white men and 66436 non-Hispanic white women. The study protocol was approved by the Institutional Review Board of the National Cancer Institute and the participating centers. All participants provided written information consent upon enrollment. Exposure assessment In the baseline risk factor questionnaire participants were asked to report their current height (in feet and inches) current weight (in pounds) and weight at age 20 (in pounds). We calculated BMI at baseline and at age 20 as the weight at these respective ages in kilograms (kg) divided by current height in meters (m) squared. We additionally calculated the change in BMI between age 20 and baseline for each participant. Other information ascertained from the baseline questionnaire included demographic characteristics; lifestyle factors such as physical activity alcohol intake and smoking history; and medical history including diabetes hypertension heart attack stroke and cancer. Mortality ascertainment Information on deaths and cause of deaths were obtained through periodic linkage of the study population to the National Death Index. We used the International Classification of Diseases Ninth Revision [ICD-9] to define death due to cardiovascular diseases (ICD-9 codes 390459) or cancer (ICD-9 codes 140208). Study staff retrieved death certificates and relevant medical records to confirm deaths occurring during follow-up and to verify the underlying cause of death in a uniform and unbiased manner 17. Statistical analysis Age-standardized mortality rates (number of deaths/1000 person-years) were calculated by direct standardization using five-year age categories. Multivariable-adjusted hazard ratios (HRs) and two-sided 95% confidence intervals (CIs) were calculated using Cox proportional hazards models via the SAS PROC PHREG procedure (SAS 9.3; SAS Institute Cary North Carolina). Person-years were calculated from the date of completion of the baseline questionnaire until the date of death the last date of follow-up the 13th anniversary of randomization or December 312009 whichever occurred first. In multivariable-adjusted models we included age at baseline (continuous) education (less than high school high school post-high school some college college graduate and postgraduate) marital status (married widowed divorced separated and never married) smoking status (never former and current smoker) pack-years (>010 >1020 >2030 and >30) and years since quitting (<5 5<10 10<20 20<30 and 30+). For each covariate missing values (generally <5%) were put into a separate group. Because further adjustment for physical activity alcohol drinking and intervention status had little influence on the results (i.e. <5% change in the HRs for BMI) these variables were not included in the final models. In the main analysis BMI at baseline was categorized into 7 groups: 15.0<22.5 22.5<25.0 25.0<27.5 27.5<30.0 30.0<35.0 35.0<40.0 and 40.050.0. In analyses of cause-specific mortality and subgroup analyses we used consolidated categories and continuous values of BMI to preserve statistical power and participants with BMI values less than 20 were excluded to account for the elevated risks of death observed in this group. Due to the generally lower values of BMI at age 20 we used the following 5 categories for analyses: 15.0<20 20<22.5 22.5<25.0 25.0<27.5 27.550. BMI change between age 20 and baseline was categorized into 4 groups (<0 0<5 5<10 and 10+). In multivariable-adjusted models of BMI change we additionally adjusted for BMI at age 20. Tests for linear trend across BMI categories were performed by modeling median values in each category as a continuous variable. Tests for interaction were performed using the likelihood-ratio test comparing the fit of models having a cross-product term between BMI and the covariate of interest to that of models without this term. Tests for heterogeneity were performed using the Mantel-Haenszel test. To assess the impact of reporting error in self-reported BMI on our results we used race- and sex-specific regression models to calculate adjusted BMI using the self-reported BMI for each participant (BMI adjusted=?2.03+1.07 BMI self-reported + 0.0062 age for black men BMI adjusted=?0.88+1.00 BMI self-reported + 0.0273 age for white men BMI adjusted=? 1.10+1.02 BMI self-reported + 0.0174 age for black women and BMI adjusted=?0.51+1.02 BMI self-reported + 0.0117 age for white women). We generated these equations using data from participants ages 49 years and older in the U.S. National Health and Nutrition Evaluation Survey (NHANES) 1999200618 by regressing BMI calculated from measured height and weight on BMI calculated from self-reported height and weight adjusting for age. Results During an average of 13 years of follow up we identified 1495 deaths in blacks and 18236 in whites. Table 1 describes study characteristics of black and white men and women. The mean age at baseline was 62 for all race and sex groups. Compared with whites both black men and women were less likely to be college educated and married and more likely to be current smokers and have a history of diabetes hypertension heart attack and/or stroke. The mean baseline BMI was higher in blacks than in whites and this race difference was more pronounced in women than in men. The distribution of BMI at age 20 was similar across categories of race and sex. Age-standardized mortality rates were lowest between 27.5 and 29.9 in black men and 25.0 and 27.4 in black women whereas the lowest mortality rates among white participants were generally found between 22.5 and 24.9. Black men and women had higher age-standardized mortality rates in all BMI categories when compared with their white counterparts (Table 2). In multivariable-adjusted models using 22.5<25.0 as the reference category of BMI we observed J-shaped associations between BMI and mortality in both blacks and whites. Additional exclusion of current smokers recent quitters (<5 years) and subjects with a history of cancer heart attack or stroke at baseline generally yielded slightly weaker associations for the lowest BMI category and slightly stronger positive associations at the higher range of BMI (Table 2 Figure 1). " | Lung_Cancer |
"oup A (n = 12) was sacrificed 6 hr after percutaneous injection and Group B (n = 12) was sacrificed 24 hr after a CT guided percutaneous injection of MLM and methylene blue. Fig. 2 Examples of evaluation of staining on the lung surface. Photographs show (A) the extensive staining (score 1) (B) localized dispersion of staining (score 2) and (C) minimal dispersion of staining (score 3). The white lines on the bottom of the figure are markings of the ruler. The distance between two lines is one centimeter. Fig. 3 Examples of assessment of radio-opacity on the fluoroscopic examinations. The fluoroscopic images show (A) a minimally increased opacity (arrow) (score 1) (B) a low density of increased opacity (arrow) (score 2) and (C) a compact nodular increased opacity (arrow) (score 3). Fig. 4 CT and corresponding photomicrograph of lung specimen. MLM in Group B (A-D); (A) discrete and compact nodular opacity (arrowheads) (B) focal neutrophil infiltration necrosis and hemorrhage (arrowheads) (H&E 12.5) (C) scattered small nodular opacities of lipiodol (long arrows) and faint nodular opacity (arrowheads) (D) focal hemorrhage and necrosis (arrowheads) with diffuse neutrophil infiltration (short arrows) (H&E 12.5). MLM in Group A (E F); (E) faint nodular lipiodol opacity (arrows) (F) focal hemorrhage (arrows) with diffuse neutrophil infiltration (arrowheads) (H&E 12.5). Methylene blue in Group A (G H); (G) faint nodular opacity (arrowheads) and (H) focal extent of neutrophil infiltration necrosis and hemorrhage (arrowheads) (H&E 12.5). Staining extent and localization ability of MLM versus methylene blue Data are mean±standard deviation. Numbers in parentheses are ranges. N/A indicates not available. *Non-parametric Mann-Whitney test was performed to compare the average score of MLM and methylene blue. MLM mixture of lipiodol and methylene blue. Localization ability score of staining and radio-opacity for MLM as well as methylene blue Data are numbers of subjects. Numbers in parentheses are percentages. MLM mixture of lipiodol and methylene blue. Comparison of localization ability between MLM and methylene blue in total subjects (n = 42) We considered a score of 2 or 3 as appropriate and 3 as excellent for localization respectively. Numbers in parentheses are percentages. *Fisher's exact test compared the proportion of appropriate or excellent staining between the mixture and methylene blue. MLM mixture of lipiodol and methylene blue. Localization ability of MLM: Evaluation of radio-opacity and staining score Data are given as numbers of subjects. Numbers in parentheses are percentages. MLM mixture of lipiodol and methylene blue. Histopathologic findings of lung specimens after percutaneous injections Data are numbers of subjects. Numbers in parentheses are percentages. N/A indicates not available. *Linear by linear association was performed between material and the extent of the histopathologic findings. Linear by linear association was performed between groups and the extent of the histopathologic findings. MLM mixture of lipiodol and methylene blue. PLoS One one 1932-6203 Public Library of Science San Francisco USA 24819391 4018408 PONE-D-13-46027 .0096911 Research Biology and Life Sciences Biochemistry Biomarkers Genetics Heredity Medicine and Health Sciences Diagnostic Medicine Epidemiology Biomarker Epidemiology Cancer Epidemiology Health Care Environmental Health Oncology Cancer Risk Factors Environmental Causes of Cancer Pathology and Laboratory Medicine Public and Occupational Health Pulmonology Environmental and Occupational Lung Diseases Single Nucleotide Polymorphism in ATM Gene Cooking Oil Fumes and Lung Adenocarcinoma Susceptibility in Chinese Female Non-Smokers: A Case-Control Study ATM Polymorphism and Risk of Lung Adenocarcinoma Shen Li 1 2 Yin Zhihua 1 2 Wu Wei 1 2 Ren Yangwu 1 2 Li Xuelian 1 2 Zhou Baosen 1 2 * 1 Department of Epidemiology School of Public Health China Medical University Heping District Shenyang Liaoning Province China 2 Key Laboratory of Cancer Etiology and Intervention University of Liaoning Province China Chang Jeffrey S. Editor National Health Research Institutes Taiwan * E-mail: bszhoumail.cmu.edu.cn Competing Interests: The authors have declared that no competing interests exist. Conceived and designed the experiments: LS. Performed the experiments: LS YR XL. Analyzed the data: LS WW ZY. Contributed reagents/materials/analysis tools: LS ZY XL BZ. Wrote the paper: LS. Obtained informed consent from subjects: Baosen Zhou. 2014 12 5 2014 9 5 e96911 3 11 2013 12 4 2014 2014 Shen et al This is an open-access distributed under the terms of the Creative Commons Attribution License which permits unrestricted use distribution and reproduction in any medium provided the original author and source are credited. Background The ataxia-telangiectasia mutated (ATM) gene plays an important role in the DNA double-strand breaks repair pathway. Single nucleotide polymorphisms (SNPs) of DNA repair genes are suspected to influence the risk of lung cancer. This study aimed to investigate the association between the ATM -111G>A (rs189037) polymorphism environmental risk factors and the risk of lung adenocarcinoma in Chinese female non-smokers. Methods A hospital-based case-control study of 487 lung cancer patients and 516 matched cancer-free controls was conducted. Information concerning demographic and environmental risk factors was obtained for each case and control by a trained interviewer. After informed consent was obtained 10 ml venous blood was collected from each subject for biomarker testing. Single nucleotide polymorphism was determined by using TaqMan method. Results This study showed that the individuals with ATM rs189037 AA genotype were at an increased risk for lung adenocarcinoma compared with those carrying the GA or GG genotype (adjusted odds ratios (OR) 1.44 95% confidence interval (CI) 1.022.02 P?=?0.039). The stratified analysis suggested that increased risk associated with ATM rs189037 AA genotype in individuals who never or seldom were exposed to cooking oil fumes (adjusted OR 1.89 95%CI 1.033.49 P?=?0.040). Conclusions ATM rs189037 might be associated with the risk of lung adenocarcinoma in Chinese non-smoking females. Furthermore ATM rs189037 AA genotype might be a risk factor of lung adenocarcinoma among female non-smokers without cooking oil fume exposure. This study was supported by grant no. 81272293 from National Natural Science Foundation of China grant no. 81102194 from National Natural Science Foundation of China and grant no. 00726 from China Medical Board. The funders had no role in study design data collection and analysis decision to publish or preparation of the manuscript. Introduction Lung cancer is the leading cause of cancer-related deaths both worldwide and in China. Although cigarette smoke is the major risk factor for lung cancer only a fraction of smokers develop this disease [1] suggesting that host genetic susceptibility may play an important role in the development of lung cancer. Recent genetic susceptibility studies of lung cancer have focused on single nucleotide polymorphisms (SNPs) in candidate genes among which DNA repair genes are increasingly studied because of their critical role in maintain genome integrity. Genetic variations in DNA repair genes are thought to affect DNA repair capacity and deficits in DNA repair capacity may lead to genetic instability and carcinogenesis [2] [3]. As one of the DNA repair genes ataxia-telangiectasia mutated (ATM) gene which is responsible for the multisystem autoxomal recessive disorder ataxia-telangiectasia (AT) plays a crucial role in the recognition signaling and repair of DNA damage especially DNA double-strand breaks (DSBs) [4] [5]. The ATM protein is a member of phosphoinositide 3-kinase (PI-3 kinases) and can be activated by DSBs caused by ionizing radiation or reactive oxygen intermediates [6] [7]. Once activated ATM can phosphorylate various downstream substates that function in cell cycle arrest apoptosis and DNA repair such as p53 NBS1 BRCA1 and Chk2 [8] [9]. Therefore genetic variants in ATM gene may lead to the structure and function change of the protein and act as important factors indicating individual susceptibility to cancer. ATM -111G>A (rs189037) resides in the promoter of ATM gene. Increasing studies have shown that variations in the DNA promoter sequence may potentially alter the affinities of multiple regulatory proteins-DNA interactions or the specificity of the transcriptional process [10][13]. Although this polymorphism makes no amino acid change the alleles may have different binding affinity to the transcription factor and exhibit different levels of mRNA expression [14] [15]. Zhang et al. [16]declared that ATM rs189037 AA genotype was associated with a lower ATM mRNA levels than GG genotype in lung tissue samples. Their results showed that the G-to-A change might create a transcriptional inhibitor-binding site for ATM rs189037 A allele promoter and subsequently reduce the ATM mRNA expression. Consequently lower expression of ATM might cause elevated sensitivity to ionizing radiation defects in the activation of cell cycle checkpoints a reduced capacity for DNA repair and abnormal apoptosis. All of these features would contribute to increased individual cancer susceptibility. In recent years a number of studies have evaluated the association between this polymorphism and cancer risk such as thyroid carcinoma [17] oral cancer [18] breast cancer [19] leukemia [20] nasopharyngeal carcinoma [21] glioma [22] and lung caner [23][25]. Previous studies of ATM rs189037 have included cigarette smokers as cases and controls that made it difficult to judge whether this polymorphism were associated with lung cancer or tobacco use. Considering the facts in China the incidence and death rate of lung cancer in women continues to increase and this phenomenon is frequently occurring in those who have never smoked. In order to have a better control of confounding of gender or smoking we performed a case-control study to identify the association between the polymorphism of ATM rs189037 and the risk of lung cancer in the non-smoking females in Chinese Han population. We also investigated the interaction between genetic polymorphism and environmental exposure in lung cancer. Methods Subjects This hospital-based case-control study included 487 lung cancer patients and 516 cancer-free hospital controls. All subjects were female non-smokers and they were from unrelated ethic Han Chinese. The cases were recruited during January 2002 to November 2012 at Liaoning Cancer Hospital & Institute. All patients were histologically confirmed to have lung cancer before any radiotherapy and chemotherapy. During the same time controls were selected from patients with other lung diseases but free of cancer history and symptom. Controls suffered mainly from bronchitis pneumonias fibrosis sarcoidosis chronic obstructive pulmonary disease and emphysema. Controls were all non-smoking females and frequency-matched to case subjects for age (±5 years). This study was approved by the institutional review board of China Medical University and written informed consent was obtained from each participant or each participant's representatives if direct consent could not be obtained. Data Collection A total of 10 ml of venous blood was collected from each patient. Patients were interviewed to collect information for demographics and environmental exposure at the time they were admitted to hospital. Information concerning demographic characteristics passive smoking cooking oil fume exposure fuel smoke exposure family history of cancer occupational exposure and dietary habit was obtained for each case and control by trained interviewers. An individual was defined as a smoker if she had consumed a total of 100 cigarettes in her lifetime; otherwise she was considered as a non-smoker. About fuel smoke exposure participants who used coal-fuel-burning stoves without chimneys were regarded as fuel smoke exposure. For exposure to cooking oil fumes participants were mainly asked about the method of cooking and eyes or throat irritation. For cooking methods participants were asked whether they cooked food in a stir-frying way and how many times a week; for eyes or throat irritation participants were asked how often they felt eyes or throat irritated by the oily smoke. There were four possible responses ranging from never seldom sometimes and frequently. Subjects were considered as cooking oil fume exposure if they met criteria as follows: (1) have cooked for over 15 years; (2) cooked food in a stir-frying way for more than twice a week; (3) felt eyes or throat irritated by oily smoke. Exposure for cooking oil fume was categorized as an indicator variable equal to 1 if participants reported frequently or sometimes and equal to 0 otherwise. Genotype Analysis Genomic DNA was extracted from peripheral blood samples by the conventional phenol-chloroform extraction method. SNP was genotyped by investigators blinded to case-control status in order to avoid any genotyping bias using TaqMan methodology and read with the Sequence Detection Software on an Applied Biosystems 7500 FAST Real-Time PCR System according to the manufacturer's instructions (Applied Biosystems Foster City CA). Amplification was done under the following conditions: 95°C for 10 min followed by 47 cycles of 92°C for 30 s and 60°C for 1 min. In this study 487 lung cancer patients and 516 controls were all genotyped successfully and 5% duplicated samples were randomly selected to assess the reproducibility for quality control with a concordance rate of 100%. Statistical Analysis The x2 test and t test were applied to estimate differences in demographic variables and distributions of genotypes between cases and controls. The association of genotypes of ATM rs189037 with risk of lung cancer was estimated by computing the odds ratios (ORs) and 95% confidence intervals (CIs) in unconditional logistic regression analysis. The Hardy-Weinberg equilibrium (HWE) was tested using goodness-fit x2 test to compare the genotype frequencies in the control subjects from those expected. A logistic regression model was used to evaluate gene-environment interactions. All data were analyzed with Statistical Product and Service Solutions (SPSS) v13.0 for Windows if not otherwise specified. All statistical analysis were two-sided and the significance level was set at P<0.05. Results Population characteristics A total of 487 lung cancer and 516 age-matched cancer-free controls were enrolled in this study. As shown in the mean ages of cases and controls (mean ±S.D.) were almost identical (56.5±11.7 and 56.3±12.5 respectively). All cases were female non-smoking lung cancer patients. No statistically significant difference was found between cases and controls in terms of age (P?=?0.248) and monthly income (P?=?0.084). Cases included 434 non-small cell lung cancer (NSCLC) patients and 53 small cell carcinoma patients. In the NSCLC cases there were 320 adenocarcinomas 73 squamous cell carcinomas and 41 other tumors with a variety of different pathologies (such as large cell carcinomas mixed cell carcinomas or undifferentiated carcinomas). .0096911.t001 Characteristics of lung cancer cases and controls. Variables Cases(%) Controls(%) P value Female 487 516 Mean age (years) 56.5±11.7 56.3±12.5 0.248a Income (yuan/month) 628.9±419.3 563.5±387.6 0.084a Never smoker 487 516 Histological type NSCLC 434(89.1) Adenocarcinoma 320(65.7) Squamous cell carcinoma 73(15.0) Small cell carcinoma 53(10.9) Other 41(8.4) a Student's t-test was used to compare the frequency distributions of demographic variables between the cases and controls. Association analysis The observed genotype frequencies among the control subjects was in agreement with that expected under the Hardy-Weinberg equilibrium (P?=?0.119). The distribution of ATM rs189037 genotypes among subjects were displayed in . Using subjects with the ATM rs189037 GG genotype as the reference group we calculated the ORs and 95%CIs for heterozygous carriers of GA genotype and homozygous carriers of AA genotype. No significant difference was observed between lung cancer cases and controls in each test (P>0.05). In order to increase the statistical power we combined the GA genotype with the AA genotype to compare with GG genotype as a dominant model and combined the GA genotype with the GG genotype to compare with AA genotype as a recessive model. The results indicated that individuals with AA genotype had a significantly elevated risk of lung adenocarcinoma compared with those carrying the GG or GA genotype (OR?=?1.44 95%CI 1.022.02 P?=?0.039). .0096911.t002 Distribution of ATM rs189037 genotypes and ORs for lung cancer cases and controls. Genotype Cases(%) Controls(%) ORc 95%CI P overall (n?=?487) GG 148(30.4) 152(29.5) ref GA 240(49.3) 272(52.7) 0.91 0.681.20 0.494 AA 99(20.3) 92(17.8) 1.11 0.771.59 0.590 dominant modela 0.96 0.731.25 0.742 recessive modelb 1.18 0.861.61 0.313 NSCLC (n?=?434) GG 129(29.7) 152(29.5) ref GA 213(49.1) 272(52.7) 0.92 0.681.24 0.573 AA 92(21.2) 92(17.8) 1.18 0.811.71 0.397 dominant model 0.98 0.741.30 0.906 recessive model 1.24 0.901.71 0.192 Adenocarcinoma (n?=?320) GG 94(29.4) 152(29.5) ref GA 150(46.9) 272(52.7) 0.89 0.641.23 0.485 AA 76(23.7) 92(17.8) 1.33 0.901.99 0.156 dominant model 1.00 0.741.36 0.987 recessive model 1.44 1.022.02 0.039* Squamous cell carcinoma (n?=?73) GG 24(32.9) 152(29.5) ref GA 39(53.4) 272(52.7) 0.90 0.521.56 0.706 AA 10(13.7) 92(17.8) 0.69 0.321.51 0.355 dominant model 0.85 0.501.43 0.537 recessive model 0.74 0.371.50 0.400 *P<0.05. a GA+AA vs GG. b AA vs GA+GG. c adjusted for age and data were calculated by unconditional logistic regression. According to the results above we assumed that ATM rs189037 AA genotype might affect lung adenocarcinoma risk among non-smoking Chinese females. To test this hypothesis and explore the gene-environment interaction we adopted all the lung adenocarcinoma patients and cancer-free controls whose information about environmental risk factors were completely obtained such as fuel smoke exposure cooking oil fume exposure passive smoking and family history of cancer. Cases and controls were not included in the association analysis if any item of their environmental risk factors data was incomplete. After screening we had 242 lung adenocarcinoma cases and 277 cancer-free controls that were eligible. Selected demographic variables and environmental risk factors for the cases and controls were listed in . .0096911.t003 Basic demographic data and environmental risk factor in lung adenocarcinoma cases and controls. Variable Cases(%) Controls(%) P value Female 242 277 Mean age (±S.D.) 55.7±11.6 56.6±11.0 0.346a Income(yuan/month) 626.5±384.0 558.1±391.4 0.066a Education Never 26(10.7) 26(9.4) 0.305 Elementary school 111(45.9) 141(50.9) Junior school 76(31.4) 69(24.9) Senior school and upwards 29(12.0) 41(14.8) Fuel smoke exposure 66(27.3) 76(27.4) 0.967b Cooking oil fume exposure 86(35.5) 70(25.3) 0.011b* Family history of cancer 26(10.7) 30(10.8) 0.975b Passive smoking exposure 141(58.3) 158(57.0) 0.778b *P<0.05. a Student's t-test was used to compare the frequency distribution of demographic variables between the cases and controls. b Peason's chi square was used to compare the frequency distribution of demographic variables fuel smoke exposure cooking oil fume exposure family history of cancer passive smoking between the cases and controls. As shown in the mean ages of lung adenocarcinoma cases and controls (mean±S.D.) were similar (P>0.05). All cases were female non-smokers. There was no significant difference in the distribution of education fuel smoke exposure family history of cancer and passive smoking status between cases and controls. However the cases were more likely than the controls to report cooking oil fume exposure (P?=?0.011). summarized the relationship between ATM rs189037 genotypes and lung adenocarcinoma risk with the stratification analysis of cooking oil fume exposure. The results indicated that in the recessive model (AA vs GA/GG) individuals carrying AA genotype had a 1.69-fold risk of lung adenocarcinoma compared with those carrying GA or AA genotype (95%CI 1.092.61 P?=?0.019). Considering the difference in the distribution of cooking oil fume exposure between cases and controls we conducted the stratification analysis. Our data revealed that AA homozygous carriers had an increased risk of lung adenocarcinoma among women who were never or seldom exposed to cooking oil fume (OR?=?1.89 95%CI 1.033.49 P?=?0.040). To well-understood the possible interaction between rs189037 polymorphism and cooking oil fumes exposure next we conducted a combined analysis. But there was no significant correlation found between this SNP and cooking oil fumes exposure. .0096911.t004 Overall association stratification analysis and combined analysis between ATM rs189037 polymorphism and lung adenocarcinoma risk. Comparison model Genotype ORc 95%CI P value Overall GG ref GA 0.89 0.591.35 0.592 AA 1.57 0.932.62 0.089 dominant modela 1.05 0.701.55 0.825 recessive modelb 1.69 1.092.61 0.019* Stratified by cooking oil fuel exposure Yes GG ref GA 0.72 0.341.54 0.395 AA 1.19 0.433.24 0.740 dominant modela 0.81 0.391.68 0.573 recessive modelb 1.48 0.623.52 0.381 No GG ref GA 0.94 0.571.56 0.811 AA 1.89 1.033.49 0.040* dominant modela 1.16 0.721.87 0.542 recessive modelb 1.97 1.183.29 0.009* Cooking oil fumes exposure-genotype combined analysis non-exposed GG ref non-exposed GA 0.91 0.551.50 0.714 non-exposed AA 1.71 0.943.09 0.078 exposed GG 1.99 0.964.12 0.063 exposed GA 1.58 0.882.82 0.127 exposed AA 2.07 0.874.93 0.099 *P<0.05. a GA+AA vs GG. b AA vs GA+GG. c the overall test was adjusted for age fuel smoke exposure cooking oil fume exposure family history of cancer and passive smoking and the stratified analysis was adjusted for age fuel smoke exposure family history of cancer and passive smoking. Discussion It is well known that smoking is the most important risk factor for lung cancer but in the past 30years the incidence and death rate of lung cancer continues to increase in women who have a low rate of smoking [26][28]. Adenocarcinoma accounts for about 40% of all lung cancer with a higher incidence in women especially in those who have never smoked. Undoubtedly female non-smokers are the ideal subjects to examine unknown yet important environmental and genetic factors of lung adenocarcinoma. Exposure to cooking oil fume fuel smoke passive smoking and occupational exposures have been implicated as possible risk factors among Chinese women mainly based on Chinese people's traditional diet habits lifestyle and social environment [29] [30]. So we designed this study to evaluate the association between genetic variant and environmental risk factors and lung adenocarcinoma in female non-smokers. To date the association between ATM rs189037 and host susceptibility to lung adenocarcinoma in Chinese female non-smokers has not been well addressed. ATM rs189037 was a common polymorphism in the promoter of ATM gene. Studies have shown that this site possibly may regulate ATM protein activity due to regulation function of promoter as shown in most genes. And specific genotypes or haplotypes of ATM may play an important role in carcinogenesis through expression regulation or alternative splicing of the ATM gene [31]. We searched through NCBI (National Center for Biotechnology Information) dbSNP database to get the allele frequency of this polymorphism. The data indicated that the frequency of wild-type allele G was 61.1% and the frequency of variant allele A was 38.9% in Chinese Han population (http://www.ncbi.nlm.nih.gov/SNP/snp_ref.cgi?rs=rs189037). In this study our results was in accordance with the data from NCBI. In 2006 Kim et al.[25] evaluated the role of ATM rs189037 in lung cancer development In Korean population for the first time. No significant association was found between this polymorphism and lung cancer risk (P>0.05). They recruited 616 lung cancer patients in which 78.4% were male and 79.6% were cigarette smokers. As cigarette smoking might modulate the risk of lung cancer in turn it could be a confounder in the association between ATM rs189037 and lung cancer risk. Besides there was no gene-environment interactions be considered in their research. In 2010 Lo et al.[23] suggested that ATM rs189037 was associated with lung cancer risk among never smokers (AA vs GG: OR?=?1.61 95%CI 1.102.35) and this association might be modified by passive smoking. Although they have eliminated the cofounding effect of cigarette smoking by conducting their study in non-smokers the risk of lung cancer among different histological types still needed to be clarified. Recently Hsia et al.[24] put their attention on the association of ATM rs189037 with lung cancer susceptibility among ever smokers. No genotype frequency difference was found between lung cancer cases and controls among ever smokers (P>0.05). After summing up the omissions of their studies and combining with the current situation that Chinese non-smoking female lung adenocarcinoma incidence and fatality rate was increasingly rising up we performed this case-control study to elucidate the association between ATM rs189037 and lung adenocarcinoma risk. To the best of our knowledge this is the first study that has investigated whether ATM rs189037 was associated with lung adenocarcinoma risk in non-smoking Han-Chinese females. Our results have shown that individuals with exposure to cooking oil fume had a 1.63-fold increased risk of developing lung adenocarcinoma (P?=?0.011). Similar significant associations were observed in our previous studies of Chinese non-smoking females. Experimental studies have presented that fumes from cooking oils could be genotoxic because of the potential carcinogenic components such as polycyclic aromatic hydrocarbons (PAHs) and benzo[a]pyr" | Lung_Cancer |
" Materials and Methods We examined the anti-tumor effect of Ad-REIC on 25 NSCLC cell lines in vitro and A549 cells in vivo. Two of these cell lines were artificially established as EGFR-tyrosine kinase inhibitor (TKI) resistant sublines. Results Ad-REIC-treatment inhibited the cell viability by 40% or more in 13 (52%) of the 25 cell lines at multiplicity of infection (MOI) of 20 (20 MOI). These cell lines were regarded as being highly sensitive cells. The cell viability of a non-malignant immortalized cell line OUMS-24 was not inhibited at 200 MOI of Ad-REIC. The effects of Ad-REIC on EGFR-TKI resistant sublines were equivalent to those in the parental cell lines. Here we demonstrated that Ad-REIC treatment activated c-Jun N-terminal kinase (JNK) in NSCLC cell lines indicating the induction of ER stress with GRP78/BiP (GRP78) up-regulation and resulting in apoptosis. A single intratumoral injection of Ad-REIC significantly inhibited the tumorigenic growth of A549 cells in vivo. As predictive factors of sensitivity for Ad-REIC treatment in NSCLC we examined the expression status of GRP78 and coxsackievirus and adenovirus receptor (CAR). We found that the combination of the GRP78 and CAR expressional statuses may be used as a predictive factor for Ad-REIC sensitivity in NSCLC cells. Conclusion Ad-REIC induced JNK activation and subsequent apoptosis in NSCLC cells. Our study indicated that Ad-REIC has therapeutic potential against NSCLC and that the expression statuses of GRP78 and CAR may predict a potential therapeutic benefit of Ad-REIC. No current funding sources for this study. Introduction Lung cancer is the most common cause of death from cancer worldwide and the metastatic form is a major factor leading to mortality [1]. There are two major histological subtypes of lung cancer: non-small cell lung cancer (NSCLC) and small cell lung cancer. Recent intensive studies have identified causative molecular alterations that have directly led to the development of new therapeutic strategies and have improved patient prognosis [2]. For example mutations of the epidermal growth factor receptor gene (EGFR) are found in approximately 30% of NSCLCs especially in lung adenocarcinomas and EGFR-tyrosine kinase inhibitors (TKIs) are particularly effective in these tumors [3] [4]. More recently crizotinib has been shown to be effective for NSCLCs with an EML4-ALK fusion gene [5] [6]. However the number of patients with these alterations is limited and little improvement in prognosis has been obtained in NSCLCs without these drug-sensitive alterations. Furthermore acquired resistance eventually occurs in the majority of EGFR-mutant tumors which had previously responded to EGFR-TKI after an average of 10 months of treatment [7]. Thus a new therapeutic modality is needed to improve the clinical outcome of patients with lung cancer. REIC/Dkk-3 a member of the Dickkopf (Dkk) gene family is originally found in immortalized cells and has been reported to be a tumor suppressor; its expression is significantly down-regulated in a broad range of cancer cell types including lung cancer [8]. The heatmap image of messenger RNA (mRNA) expression of REIC/Dkk-3 gene from the UCSC Cancer Genome Browse which is freely available public database (://genome-cancer.ucsc.edu/) (we downloaded the data on July 16 2013) showed that REIC/Dkk-3 gene expression was reduced in majority of examined samples of both lung adenocarcinomas and squamous cell carcinomas compared with normal lung tissues (Figure S1). In addition it could be confirmed from a public database that expression of REIC/Dkk-3 was also low in many NSCLC cell lines (Gene Expression Omnibus repository [http://www.ncbi.nlm.nih.gov/geo GEO accession GSE4824]). REIC/Dkk-3 is known to interfere with Wnt signaling via Wnt receptors [9] [10] and was previously reported to play a distinct role in the induction of apoptosis and the inhibition of metastasis [11] [12]. The induction of apoptosis in cancer cells is mainly caused by endoplasmic reticulum (ER) stress induced by the overproduction of REIC/Dkk-3 in the cells. ER stress triggers the activation of c-Jun N-terminal kinase (JNK) which is a critical event in apoptosis induced by the overproduction of REIC/Dkk-3 using an adenovirus vector (Ad-REIC) [11] [13]. In our previous studies we found that Ad-REIC had a therapeutic effect on various types of human cancer including the prostate testis pleura and breast carcinomas [11] [13][15]. Ad-REIC infection and REIC/Dkk-3 protein are also known to up-regulate the anti-tumor immunosystem [16]. Based on preclinical data a clinical trial using Ad-REIC for human prostate cancer has been ongoing in Japan and the USA (NCT01197209). In this study we investigated the therapeutic effect of Ad-REIC on NSCLC cells in vitro and in vivo. We also examined factors related to the sensitivity of cell lines to Ad-REIC as a step toward the development of customized Ad-REIC therapy for patients with NSCLC. Materials and Methods Ethics Statement This study was carried out in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. The protocol was approved by the Animal Care and Use Committee of Okayama University (Permit Number: OKU-2012-549). All surgery was performed under ketamine and xylazine anesthesia and all efforts were made to minimize suffering. Cell lines Sixteen cell lines of human lung adenocarcinoma 3 squamous cell carcinoma 3 large cell carcinoma 1 adenosquamous cell carcinoma 2 EGFR-TKI-resistant sublines from HCC827 and PC-9 cells (HCC827-GR-high2 and RPC-9) the human mesothelioma cell line MSTO-211H (211H) and the normal human fibroblast cell line OUMS-24 were used in this study (). The details of cell lines used in this study are described in Method S1. The HCC827-GR-high2 and RPC-9 cell lines were established as described previously [17] [18]. OUMS-24 was established at our institution [19]. .0087900.t001 Characteristics and the inhibition rate of cell viability on NSCLC cell lines. Cell lines Histological subtypes Genetic alterations Inhibition rate (%) GRP78/Actin ratio (Low/High) CAR/Actin ratio (Low/High) Category 20 MOI 100 MOI 200 MOI H2009 AD KRAS mut 60 - - 0.13 (Low) 0.73 (High) A H2228 AD EML4-ALK fusion 60 - - 0.27 (High) 0.70 (High) B HCC827 AD EGFR mut 56 - - 0.25 (High) 0.66 (High) B HCC827-GR-high2 AD EGFR mut 55 - - 0.12 (Low) 2.12 (High) A H2087 AD BRAF mut 55 - - 0.14 (Low) 1.22 (High) A HCC4006 AD EGFR mut 54 - - 0.15 (Low) 0.60 (High) A HCC4011 AD EGFR mut 54 - - 0.22 (Low) 0.13 (Low) B H522 AD W/t 50 - - 0.27 (High) 1.55 (High) B H157 SQ KRAS mut 50 - - 0.13 (Low) 0.98 (High) A A549 AD KRAS mut 49 - - 0.07 (Low) 0.55 (High) A H838 AD W/t 47 - - 0.10 (Low) 1.33 (High) A H1299 LC NRAS mut 47 - - 0.08 (Low) 0.68 (High) A H661 LC W/t 40 - - 0.42 (High) 1.89 (High) B H1819 AD HER2 amp 23 46 63 0.46 (High) 1.55 (High) B H1993 AD W/t 22 32 40 0.69 (High) 0.09 (Low) C H441 AD KRAS mutation 18 49 61 0.21 (Low) 0.17 (Low) B H2170 SQ W/t 18 28 42 0.65 (High) 0.09 (Low) C HCC15 SQ HER4 mut 17 21 43 0.18 (Low) 0.12 (Low) B H460 LC KRAS PIK3CA mut 17 57 78 0.98 (High) 0.10 (Low) C PC-9 AD EGFR mut 16 24 55 0.20 (Low) 0.16 (Low) B H1975 AD EGFR mut 10 45 63 0.41 (High) 0.19 (Low) C HCC366 ADSQ W/t 8 42 54 0.39 (High) 0.08 (Low) C RPC-9 AD EGFR mut 4 15 40 0.24 (Low) 0.16 (Low) B H358 AD KRAS mut 6 59 73 0.57 (High) 1.21 (High) B H3255 AD EGFR mut 3 16 40 0.54 (High) 0.59 (High) B 211H MM - 5 13 46 - - - OUMS-24 NHF - 5 0 0 - - - NSCLC non-small cell lung cancer; AD adenocarcinoma; SQ squamous cell carcinoma; LC large cell carcinoma; ADSQ adeno-squamous cell carcinoma; MM malignant mesothelioma; NHF normal human fibroblast; mut mutation; W/t. wild type; MOI multiplicity of infection. Adenovirus vector carrying REIC/Dkk-3 REIC/Dkk-3 was overexpressed using an adenovirus (Ad-REIC) that we have previously generated [11]. A full-length cDNA of REIC/Dkk-3 was integrated into a cosmid vector pAxCAwt and transferred into an adenovirus vector by the COS-TPC method (Takara Bio Shiga Japan). An adenovirus vector carrying LacZ gene (Ad-LacZ) was also used as control [11]. Cell viability assay Cells were plated in 96-well plates at a density of 1.5Ã103 cells/well at 48 h after infection with Ad-LacZ or Ad-REIC at a multiplicity of infection (MOI) of 20100 or 200 MOI. Cell viability was evaluated 3 days later using an MTS assay with CellTiter 96 Aqueous One Solution Reagent (Promega Madison WI). Apoptosis assay To examine the in vitro induction of apoptosis after treatment we seeded the cells in 6-well plates and incubated them for 24 h. The cells were treated with Ad-LacZ or Ad-REIC at 20 MOI in serum-free medium (500 µL) for 2 h; the medium was then exchanged for fresh complete medium (2 mL). After an additional 48 h of incubation Hoechst 33342 dye (Sigma-Aldrich St. Louis MO) was added to the medium at a concentration of 2 µg/mL and the cells were incubated in the dark for 10 min. Hoechst 33342 is an intercalating dye that allows the determination of variations in the total chromatin quantity and the degree of chromatin condensation [15]. Using fluorescence microscopy we identified apoptotic cells by the presence of highly condensed or fragmented nuclei. Apoptotic cells were counted in 5 different fields under microscopic observation. Western blot analysis The detailed protocol for the Western blot analysis is described in Method S1. It was performed under conventional conditions using the following antibodies: rabbit anti-human REIC/Dkk-3 antibody raised in our laboratory [11]; rabbit anti-human GRP78/BiP (GRP78) (ab21685; Abcam Cambridge MA); rabbit anti-human SAPK/JNK (#9252) and rabbit anti-human phospho-SAPK/JNK (Thr183/Tyr185; #9251) (Cell Signaling Technology Beverly MA); rabbit anti-human coxsackievirus and adenovirus receptor (CAR) (HPA030411; Atlas antibodies Stockholm Sweden); and mouse anti-actin (MAB1501; Millipore Billerica MA). The following secondary antibodies were used: goat anti-rabbit or anti-mouse IgG-conjugated horseradish peroxidase (Santa Cruz Biotechnology Santa Cruz CA). To detect the specific signals the membranes were examined using ECL plus Western Blotting Detection Reagents (Amersham Biosciences UK Limited Buckinghamshire UK). In addition the band intensities for GRP78 CAR and actin representing their expression levels were measured using ImageQuant TL software (GE Healthcare Bioscience) and quantified by GRP78 or CAR/actin ratio. Tumor growth assay in vivo A549 cells (5Ã106 in 50 µL of phosphate buffered saline [PBS]) mixed with 50 µL of Matrigel (BD Biosciences San Jose CA) were subcutaneously injected into the right flank of adult female BALB/c nu/nu mice (CLEA Japan Tokyo Japan). The tumor volume was calculated using the empirical formula V?=?1/2Ã[(the shortest diameter)2Ã(the longest diameter)]. When the tumors had reached approximately 50100 mm3 mice (n?=?15) were randomly divided into 3 treatment groups: (a) PBS; (b) Ad-LacZ; and (c) Ad-REIC. Viruses (1Ã109 pfu) in 100 µL of serum-free medium were administered intratumorally. At the end of experiments mice were sacrificed after 24-days after the viral injection and tumors were harvested measured and photographed. Statistical analyses All data were analyzed using STATA ver.12 (STATA Corp. College Station TX). Fisher's exact test was applied when appropriate. For a comparison of induction of apoptosis between Ad-REIC-treated and Ad-LacZ-treated A549 cells a Cochran-Mantel-Haenszel statistics was applied for comparing. Repeated measurement ANOVA was applied for the comparison of xenotransplanted NSCLC tumor sizes among PBS Ad-LacZ and Ad-REIC. P<0.05 was considered significant. All tests were two-sided. Results Effect of Ad-REIC on NSCLC cell lines We examined the inhibition of cell viability using Ad-REIC and an MTS assay. In 13 (52%) of 25 NSCLC cell lines Ad-REIC treatment at 20 MOI inhibited the cell viability (40%60% inhibition) compared with Ad-LacZ treatment ( Figure 1). These cell lines were regarded as highly sensitive to Ad-REIC. In contrast 12 cell lines (48%) were not inhibited by Ad-REIC treatment at 20 MOI and were regarded as resistant cells. OUMS-24 was not inhibited at 20 or 200 MOI of Ad-REIC. Of note Ad-REIC treatment at 100 and 200 MOI improved the inhibition of cell viability (100 MOI: 15%59% inhibition 200 MOI: 40%78% inhibition) compared with Ad-LacZ treatment (). Thus we defined 20 MOI as a low MOI value and 200 MOI as a high MOI value. For comparison Ad-REIC treatment was also performed in the human mesothelioma cell line 211H which we previously reported to be Ad-REIC-sensitive [14]. The 211H was not inhibited at 20 MOI but was inhibited at 200 MOI of Ad-REIC (). The known molecular characteristics of each cell line are shown in . The 25 NSCLC cell lines consisted of 8 EGFR-mutant 6 KRAS-mutant 1 HER4-mutant 1 NRAS-mutant 1 PIK3CA-mutant 1 EML4-ALK fusion 1 HER2-amplified and 6 cell lines without gene alterations listed. Nine of the 17 EGFR-wild type cell lines were sensitive to Ad-REIC. HCC827 and its resistant subline HCC827-GR-high2 showed a similar degree of sensitivity to Ad-REIC. No trend in molecular genotype was seen between the sensitive and non-sensitive cell lines. These results suggested that the effect of Ad-REIC does not depend on a known molecular genotype. .0087900.g001 Figure 1 Sensitivity and predictive factors of sensitivity for Ad-REIC treatment in 25 NSCLC cell lines. The inhibition rates of 25 NSCLC cell lines transfected with Ad-REIC compared to Ad-LacZ are shown as black bar in 20 MOI and white bar in 200 MOI. Thirteen cell lines with over 40% inhibition rate in 20 MOI are defined as highly sensitive and 12 cell lines with lower inhibition rate in 20 MOI are defined as resistant. All the resistant cell lines shows over 40% inhibition rate in 200 MOI. The cell lines are classified into 3 categories based on the GRP and CAR protein expression level as follows; category A (low GRP/high CAR) category B (low GRP/low CAR or high GRP/high CAR) category C (high GRP/low CAR). All 8 highly sensitive cell lines were included in category A and all 5 resistant cell lines were included in category C. Sq; squamous cell carcinoma AD; adenocarcinoma LC; large cell carcinoma ADSQ; adenosquamous cell carcinoma MM; malignant mesothelioma NHF; normal human fibroblast. Hoechst 33342 staining was performed in A549 cells to examine the induction of apoptosis. Apoptotic cells were observed in Ad-REIC-treated A549 cells (Figure 2a). The mean rate of apoptosis was 22% and it was significantly (p<0.001 by Cochran-Mantel-Haenszel test) increased in comparison with the control Ad-LacZ treatment. .0087900.g002 Figure 2 Ad-REIC induced JNK activation and subsequent apoptosis in NSCLC cells. (a) Induction of apoptosis after in vitro Ad-REIC treatment as examined in A549 cells using Hoechst 33342 staining. The upper panel indicates the appearance of apoptotic cells after Ad-REIC treatment. The lower panel shows the apoptotic rate of A549 cells after the indicated treatment. A total of 5 different fields were examined under a microscope to determine the apoptotic rate. A significant difference was observed (*p<0.001) between the Ad-LacZ and the Ad-REIC treatment. (bar: 100 µm) (b) Western blot analysis for proteins involved in signal transduction triggered by Ad-REIC. Cells were harvested at 48 h after transfection with Ad-LacZ or Ad-REIC at 20 MOI. (c) H460 cells which are resistant to adenovirus transduction were harvested at 48 h after transfection with Ad-LacZ or Ad-REIC at 20100 and 200 MOI. The effect of recombinant REIC/Dkk-3 protein on NSCLC cell lines was examined in 7 randomly selected cell lines (NCI-H522 NCI-H611 NCI-H1299 NCI-H1819 NCI-H2009 PC-9 and A549). The MTS assay showed that REIC/Dkk-3 protein did not affect cell viability in the examined cell lines when administered at a concentration ranging from 1 to 200 µg/mL (data not shown). Expression of GRP78 and CAR in response to Ad-REIC therapy As predictive factors of Ad-REIC sensitivity in NSCLC we examined the expressions of GRP78 and CAR; these expression statuses were correlated with the inhibition of cell viability by Ad-REIC in 13 cell lines. A previous study reported that the overexpression of GRP78 inhibited ER-stress which may be oppositely correlated with the effect of Ad-REIC. CAR expression is tightly associated with the efficacy of adenovirus infection which may be positively correlated with the effect of Ad-REIC. Western blotting was performed and the expression level was quantified as shown in and Figure 1. The median (range) of GRP78 and CAR expressions were 0.24 (0.0750.98) and 0.60 (0.0802.1) respectively. Based on these data cells with a GRP78 expression level more than 0.25 were defined as High CRP78 expression while those with a GRP78 less than 0.24 were defined as Low GRP78 expression. Regarding the CAR 15 cell lines significantly high level of CAR expression (over 0.50) were defined as High CAR expression while 10 cell lines those with significantly low level of CAR expression (under 0.20) were defined as Low CAR expression. GRP78 expression was low in 8 of the 13 Ad-REIC-sensitive cells (62%) and in 4 of the 12 Ad-REIC-resistant cells (33%). CAR expression was high in 12 of the 13 Ad-REIC-sensitive cells (92%) and in 3 of the 12 Ad-REIC-resistant cells (25%). Next we classified the cell lines into three categories based on the GRP78 and CAR expression statuses; cells with a Low GRP78/High CAR expression were classified as Category A those with Low GRP78/Low CAR or High GRP78/High CAR expression were classified as Category B and those with High GRP78/Low CAR expression were classified as Category C. The high sensitive cell rates were 100% in Category A (8 out of 8 95% confidence interval [CI]: 63100) 42% in Category B (5 out of 12 95% CI: 1572) and 0% in Category C (0 out of 5 95% CI: 052) (Table 2). The categories were significantly associated with the sensitivity to Ad-REIC treatment (p<0.01). .0087900.t002 Table 2 Ad-REIC sensitivity and categories based on predictive factors. (n) Category A (8) Category B (12) Category C (5) Highly sensitive (13) 8 5 0 Resistant in 20 MOI (12) 0 7 5 JNK and GRP78 expression in NSCLC cell lines treated with Ad-REIC A western blotting analysis demonstrated the significant expression of REIC/Dkk-3 protein in 14 NSCLC cell lines treated with Ad-REIC. In 9 cell lines infected with 20 MOI Ad-REIC treatment resulted in the phosphorylation of JNK and the up-regulation of GRP78 (Figure 2b). In the other 8 cell lines which were relatively resistant to Ad-REIC the activation of JNK and GRP78 were observed at higher MOI values (100 and 200 MOI) (Figure 2c). Effect of Ad-REIC on NSCLC tumors in a xenotransplantation model We investigated the effect of Ad-REIC on the growth of A549 cells in vivo. One week after transplantation when the tumor volume reached 50 to 100 mm3 1Ã109 plaque-forming units of Ad-REIC or Ad-LacZ in 100 µL of PBS or 100 µL of PBS alone were injected intratumorally. The tumors grew progressively in the PBS and Ad-LacZ treatment groups during the subsequent 24-day observation period. In contrast the tumor growth in the Ad-REIC treatment group was significantly (p<0.001 by repeated measurement ANOVA) suppressed during the observation period (Figure 3ab). .0087900.g003 Figure 3 Anti-tumor effect of Ad-REIC treatment on A549 tumor growth in vivo. (a) The mean volume of the subcutaneous xenograft tumors was calculated for 5 mice in each group. A significant difference was observed between the results of Ad-REIC and Ad-LacZ treatment (*p<0.001 by repeated measurement of ANOVA). (b) Appearance of the tumors at the time of sacrifice after treatment with PBS Ad-LacZ and Ad-REIC. Discussion In the present study we found that Ad-REIC was directly effective in more than half of the NSCLC cell lines that were examined independent of its known driver alterations such as EGFR and KRAS mutations. An animal xenograft model also showed the therapeutic effect of Ad-REIC. The anti-tumor effect of Ad-REIC depends on ER-stress-mediated JNK activation loaded by the overproduction of REIC/Dkk-3 protein resulting in the induction of apoptosis [14] [20]. The activation of JNK which is an essential step in the induction of ER stress and apoptosis by Ad-REIC was observed at 20 MOI in NSCLC cell lines. On the other hand the anti-tumor effect of recombinant REIC/Dkk-3 protein was not observed as in other types of cancers that were previously examined. Originally REIC/Dkk-3 was identified as a secretory protein and was assumed to exert a physiological function but its cell surface receptor and its role as a secretory protein have not been identified. We defined 20 MOI as a low MOI value and 200 MOI as a high MOI value because the normal human fibroblast cell line OUMS-24 was not inhibited at 20 or 200 MOI of Ad-REIC whereas malignant cell lines were inhibited when the MOI value was elevated to 100 and 200 MOI in cell lines in which Ad-REIC had been ineffective at 20 MOI. In NSCLC Ad-REIC was effective at a low MOI value in more than half of the cell lines that were tested. Considering the result that 211H was inhibited only at a high MOI value Ad-REIC might be more effective in NSCLC than in mesothelioma. Patient selection based on the molecular characteristics of tumor cells is an important theme for maximizing the therapeutic benefit and minimizing adverse effects. For this purpose we focused on the GRP78 expression and CAR expression levels. GRP78 is a member of the Hsp70 family which serves as an ER stress-signaling regulator [21]. A previous study showed that the overexpression of GRP78 conferred resistance to a wide variety of chemotherapeutic agents in various kinds of cells [22]. We also showed that the acquired resistance clone of PC-3 cells to Ad-REIC established after repeated exposure to Ad-REIC exhibited a high expression level of GRP78 compared with parental PC-3 cells [13]. Theoretically Ad-REIC should be effective for tumor cells defined as Category A and not as effective for those defined as Category C. Although sensitive cells in Category B were identified all 8 cells in Category A responded to Ad-REIC treatment. These results suggested that the expression statuses of GRP78 and CAR in tumors might be useful as biomarkers for customized Ad-REIC therapy in NSCLC while further confirmation is needed by a large scaled investigation using various kinds of cell lines. As a recent topic of lung cancer treatment EGFR-TKIs have been shown to be effective for the treatment of EGFR-mutant NSCLCs. However acquired resistance to EGFR-TKIs after TKI treatment is a problem that needs to be overcome. In the current study our results showed that the effect of Ad-REIC against acquired EGFR-TKI-resistant cells was equal to that against the parental cells suggesting that Ad-REIC may be useful after the acquisition of resistance to EGFR-TKIs. Although adenovirus vectors carrying appropriate tumor suppressor genes such as REIC/Dkk-3 have great potential for cancer gene therapy they do not exhibit target specificity and therefore may also infect normal cells in the vicinity of cancer cells. The authors reported that the infection of normal human fibroblasts (NHF) with Ad-REIC did not cause the apoptosis of NHF itself but instead induced the production of interleukin (IL)-7. When Ad-REIC-infected NHF were mixed with untreated cancer cells and the mixture was transplanted into mice the growth of the cancer cells was significantly suppressed suggesting an indirect tumor-suppressive effect of Ad-REIC mediated by IL-7 [20]. These findings show that the mis-targeted infection of cancer stroma cells by Ad-REIC activates the immune system through the production of IL-7. In addition the authors reported that REIC/Dkk-3 protein played a cytokine-like role in monocyte differentiation into dendritic-cell-like features in vitro and that the infiltration of CD11c- and CD8-positive (dendritic and killer T cell markers respectively) cells was observed within the treated tumors in vivo. In the experiment using an orthotopic prostate tumor model with pre-established lung metastasis the number of metastatic lung tumors significantly decreased after the injection of Ad-REIC at the primary tumor site in addition to the inhibition of the growth of orthotopic prostate tumors suggesting that anti-cancer immune up-regulation by Ad-REIC treatment in primary tumor sites triggered anti-tumor effects even at distant tumor site [16]. These facts strongly suggest that REIC/Dkk-3 shows an indirect anti-tumor effect through the anti-tumor immune system that is an important factor in the treatment of metastatic disease. Because Ad-REIC has both direct and indirect effects on cancer therapy it may become a powerful therapeutic option as a one-bullet two-arms anti-cancer agent especially for NSCLCs which often metastasize to other organs. In regards to clinical usage because our data suggest that CAR and GRP78 expression statuses in tumor cells predict the responsiveness of Ad-REIC treatment Ad-REIC treatment should be preferentially performed for patients who are categorized as high sensitive group in early phase of treatment with low dose Ad-REIC. For patients whose tumor cells reveal intermediate or poor effectiveness with low dose Ad-REIC it should be late phase in their treatment with high dose Ad-REIC. For these patients cost effectiveness for treatment and clinical outcome should be carefully considered. As for administration strategy local administration might be preferable rather than systemic administration to minimize the adverse effect in clinical situations. We previously confirmed in mouse model that Ad-REIC could be widely distributed in the bodies after intratumoral local administration and local administration was effective not only directly but also indirectly through the immune system effect [16] [23]. In addition intrapleural local administration could be another administration strategy for the patients with malignant pleural effusions. It has been reported that the intrapleural administration of adenoviral-mediated gene therapy is a useful approach for the generation of anti-tumor immune responses in malignant mesothelioma and metastatic pleural effusion in several clinical trials [24] [25]. In conclusion we demonstrated that Ad-REIC induced JNK activation and subsequent apoptosis in NSCLC cells irrespective of the type of known molecular alterations or the sensitivity to EGFR-TKI. The present study suggests that Ad-REIC has a therapeutic potential for NSCLC and the expression statuses of GRP78 and CAR may be a predictor of Ad-REIC therapy. Supporting Information Figure S1 The heatmap image of mRNA expression of REIC/Dkk-3 gene. The mRNA expression level of REIC/Dkk-3 gene was obtained from the UCSC Cancer Genome Browse which is freely available public database (://genome-cancer.ucsc.edu/) (we downloaded the data on July 16 2013) showed that REIC/Dkk-3 gene expression was reduced in majority of examined samples of both (a) lung adenocarcinomas and (b) squamous cell carcinomas compared with normal lung tissues. (PDF) Click here for additional data file. Method S1 Supporting information for cell lines and Western blot analysis. (DOC) Click here for additional data file. References 1 JemalA SiegelR WardE HaoY XuJ et al (2009) Cancer statistics 2009. CA Cancer J Clin59: 22524919474385 2 LarsenJE CasconeT GerberDE HeymachJV MinnaJD (2011) Targeted therapies for lung cancer: clinical experience and novel agents. Cancer J17: 51252722157296 3 ShigematsuH LinL TakahashiT NomuraM SuzukiM et al (2005) Clinical and biological features associated with epidermal growth factor receptor gene mutations in lung cancers. J Natl Cancer Inst97: 33934615741570 4 Tokumo M Toyooka S Kiura K Shigematsu H Tomii K et al. (2005) The relationship between epidermal growth factor receptor mutations and clinicopathologic features in non-small cell lung cancers. Clin Cancer Res. 5 KwakEL BangYJ CamidgeDR ShawAT SolomonB et al (2010) Anaplastic lymphoma kinase inhibition in non-small-cell lung cancer. N Engl J Med363: 1693170320979469 6 ShawAT YeapBY SolomonBJ RielyGJ GainorJ et al (2011) Effect of crizotinib on overall survival in patients with advanced non-small-cell lung cancer harbouring ALK gene rearrangement: a retrospective analysis. Lancet Oncol12: 1004101221933749 7 OxnardGR JanjigianYY ArcilaME SimaCS KassSL et al (2011) Maintained sensitivity to EGFR tyrosine kinase inhibitors in EGFR-mutant lung cancer recurring after adjuvant erlotinib or gefitinib. Clin Cancer Res17: 6322632821831955 8 TsujiT MiyazakiM SakaguchiM InoueY NambaM (2000) A REIC gene shows down-regulation in human immortalized cells and human tumor-derived cell lines. Biochem Biophys Res Commun268: 202410652205 9 KrupnikVE SharpJD JiangC RobisonK ChickeringTW et al (1999) Functional and structural diversity of the human Dickkopf gene family. Gene238: 30131310570958 10 MaoB WuW DavidsonG MarholdJ LiM et al (2002) Kremen proteins are Dickkopf receptors that regulate Wnt/beta-catenin signalling. Nature417: 66466712050670 11 AbarzuaF SakaguchiM TakaishiM NasuY KuroseK et al (2005) Adenovirus-mediated overexpression of REIC/Dkk-3 selectively induces apoptosis in human prostate cancer cells through activation of c-Jun-NH2-kinase. Cancer Res65: 9617962216266978 12 EdamuraK NasuY TakaishiM KobayashiT AbarzuaF et al (2007) Adenovirus-mediated REIC/Dkk-3 gene transfer inhibits tumor growth and metastasis in an orthotopic prostate cancer model. Cancer Gene Ther14: 76577217599093 13 TanimotoR AbarzuaF SakaguchiM TakaishiM NasuY et al (2007) REIC/Dkk-3 as a potential gene therapeutic agent against human testicular cancer. Int J Mol Med19: 36336817273781 14 KashiwakuraY OchiaiK WatanabeM AbarzuaF SakaguchiM et al (2008) Down-regulation of inhibition of differentiation-1 via activation of activating transcription factor 3 and Smad regulates REIC/Dickkopf-3-induced apoptosis. Cancer Res68: 8333834118922905 15 KawasakiK WatanabeM SakaguchiM OgasawaraY OchiaiK et al (2009) REIC/Dkk-3 overexpression downregulates P-glycoprotein in multidrug-resistant MCF7/ADR cells and induces apoptosis in breast cancer. Cancer Gene Ther16: 657218654608 16 WatanabeM KashiwakuraY HuangP OchiaiK FutamiJ et al (2009) Immunological aspects of REIC/Dkk-3 in monocyte differentiation and tumor regression. Int J Oncol34: 65766319212670 17 ShienK ToyookaS YamamotoH SohJ JidaM et al (2013) Acquired Resistance to EGFR Inhibitors Is Associated with a Manifestation of Stem Cell-like Properties in Cancer Cells. Cancer Res73: 3051306123542356 18 KobayashiN" | Lung_Cancer |
"The lung tissues were fixed in 10% neutral formalin embedded in paraffin and cut into 5 µm thick slices after we took photographs to record staining on the lung surface. We made 4 axial slices that covered the center of the staining. The slices were subjected to hematoxylin-eosin (H-E) stain to the evaluate lung parenchymal change. We evaluated the presence or absence of neutrophil infiltration vasculitis necrosis hemorrhage and foam cell in alveolus. The extent of each histopathologic finding was estimated using visual grading scores as 0 (no) 1 (focal) or 2 (diffuse). Localized parenchymal change (<50% of total area) surrounded by normal lung was defined as focal. Extensive lung parenchymal change (?50% of total area) that replaced normal lung was defined as diffuse. An experienced pathologist with eight years of experience reviewed all slices. The overall severity of the lung parenchymal change was defined as a total score by adding visual grading scores for each histopathologic finding. We compared the overall severity score between MLM and methylene blue as well as between Group A and Group B. Statistical analysis All data are expressed as mean±standard deviation (SD) unless otherwise stated. Comparisons of the average scores were performed by two-tailed unpaired Student's t-test or Mann-Whitney test. We used a Fisher's exact test to compare the number of subjects in the subgroups. Linear by linear association evaluated the association of the extent of lung parenchymal change and materials or groups. Null hypotheses of no difference were rejected if the P values were less than 0.05. The statistical analysis was performed with commercially available statistical software IBM SPSS Statistics version 20.0 (IBM Corp. in Armonk NY USA). RESULTS Subject characteristics procedural records time interval of injection and examinations Among the 24 subjects included in our study successful CT-guided percutaneous injections into the desired location of the lung were achieved in 21 subjects (11 in Group A and 10 in Group B). Three subjects died during anesthesia. Mean weight was 3.2±0.2 kg for Group A and 3.3±0.2 kg for Group B. Injection depth from visceral pleura to needle tip was 0.4±0.1 cm (range: 0.3-0.6 cm) for MLM and 0.4±0.1 cm (range: 0.3-0.7 cm) for methylene blue (P=0.43). Distance from skin to needle tip was 2.8±0.6 cm (range: 2.1-5.0 cm) for MLM and 2.8±0.3 cm (range: 2.2-3.5 cm) for methylene blue (P=0.83). Of 42 CT-guided percutaneous injections total number of procedure related complications was 10 (24%) including 7 leakage (all in MLM) and 3 pneumothorax (2 in MLM 1 in methylene blue). The complication rate in MLM was significantly higher than methylene blue (43% vs 5%) (P=0.004). On post-procedural CT images the extent of the radio-opacity of MLM was 1.3±0.4 cm (range: 0.7-2.0 cm) for Group A and 0.6±0.3 cm (range: 0.3-1.1 cm) for Group B. Discrete compact nodular opacity was achieved in 15 subjects (72%) scattered nodular opacities in 3 (14%) and small faint opacity in 3 (14%) (Fig. 4). The average value of radio-opacity of MLM was 1415±856 HU (range: 307-2768 HU). The interval between injection and sacrifice was 7.9±0.1 hr (range: 7.8-8.0 hr) for Group A and 23.5±0.1 hr (range: 23.4-23.7 hr) for Group B. Time from injection to initial and follow up fluoroscopy was 3.4±0.5 hr (range: 2.5-4.2 hr) and 6.8±0.4 hr (range: 6.3-7.7 hr) for Group A and 1.5±0.4 hr (range: 0.9-2.1 hr) and 22.6±0.4 hr (range: 21.9-23.2 hr) for Group B respectively. Scores and extent of staining and radio-opacity demonstrates the staining extent and localization ability of MLM and methylene blue. In total groups the staining extent of MLM was significant smaller than methylene blue (0.6 cm vs 1.0 cm P<0.001). MLM showed a significantly higher staining ability score than methylene blue (2.8 vs 2.2 P=0.010). Radio-opacity in the initial fluoroscopy was not significantly different from the follow up (2.0 vs 1.9 P=0.49). showed the number of subjects in each score of localization ability of staining or radio-opacity. In Group A appropriate staining was 100% for both MLM and methylene blue. In Group B appropriate staining was 90% for MLM and 70% for methylene blue. Appropriate staining of MLM was not significantly different from that of methylene blue (95% vs 86% P=0.61); however excellent staining in MLM was significantly higher than methylene blue (81% vs 38% P=0.011) (). shows the localization ability of MLM regarding both staining ability and radio-opacity. There was no subject with a score of 0 or 1 in both radio-opacity and staining. MLM achieved appropriate staining or radio-opacity in 21 subjects (100%) with a dual localization feature. Histopathologic findings demonstrates the results of the histopathologic findings. In all lung specimens both methylene blue and MLM showed acute lung parenchymal change that included neutrophil infiltration hemorrhage and foam cell in alveolus (Fig. 4). Comparing the two materials the number of specimen having neutrophil infiltration vasculitis necrosis hemorrhage and foam cell in alveolus was similar in each extent. In terms of all features the number of specimen that showed diffuse extent was more in Group B than Group A for both MLM and methylene blue. The extent of the histopathologic findings was not significantly associated with the materials for all histopathologic features (). Among the histopathologic findings the extent of vasculitis was significantly associated with Group for both MLM and methylene blue (P=0.002 for both MLM and methylene blue). Focal or diffuse extent of vasculitis was more frequently found in Group A than Group B (P=0.001 for both MLM and methylene blue). The overall severity of lung parenchymal change was not different between MLM and methylene blue (5.6±1.6 vs 5.7±1.5 P=0.839); in addition Group B showed a significantly higher overall severity score of lung parenchymal change than Group A (6.6±1.6 vs 4.7±0.9 P=0.005). DISCUSSION The results of this study show that MLM is a useful percutaneous injection material for a successful localization in the lung. The average staining score of MLM was significantly higher than methylene blue (2.8±0.5 vs 2.2±0.7 P=0.010). In terms of staining the appropriate localization rate (acceptable or excellent staining) in our study was 95% using MLM. The result was in close agreement with previous studies that showed a high success performance rate of lipiodol localization (99%-100%) (21-23). An appropriate localization rate (acceptable or excellent staining) of methylene blue injection was 86% in our study. This is lower than the results found in previous studies where the success rate of methylene blue injection was 96%-100% (18 20). We found that an acceptable (or excellent staining rate) of MLM and methylene blue was not significantly different (95% vs 86% P=0.610). However MLM showed excellent staining for localization in 17 (81%) of 21 subjects and was significantly higher than methylene blue (38%) (P=0.011). The results indicate that lipiodol reduced the spread of methylene blue. This is the first study to indicate that MLM is an available percutaneous injection material for localization with superior staining ability compared to methylene blue. The complication rate was 43% in MLM and 5% in the methylene blue (P=0.004). Possible complications after percutaneous injection for pulmonary localization include pneumothorax leakage hemorrhage pain hemoptysis hemothorax and embolism. Previous studies reported that the complication rate was 17-29% for lipiodol and 33% for methylene blue (2023 24). The complication rate of MLM in the current study was higher than the results of previous studies mainly due to the leakage of MLM into the pleural cavity (n=9). This difference was probably because the distance from the pleura to the injecting needle tip (0.4±0.1 cm for MLM) was inadequate to avoid leakage into the pleural cavity. In the previous studies of lipiodol marking for localization the mean distance from the pleura to the target nodule was 1.0-1.9 cm (22-24) more than twice our study. The results indicate that the high complication rate of our study is associated with the inserting procedure of the needle rather than MLM itself. The dispersion of methylene blue throughout the lung parenchyma may lead to unnecessarily large wedge resections; in addition some have reported instances of the dispersion of methylene blue throughout the entire pleural surface or intraoperative identification failure due to severe anthracosis of the visceral pleura. The failure rate was reported to be 0%-13% with the use of methylene blue (1819 25). The results are similar to our study and indicate that inappropriate staining on the lung surface was 14% in methylene blue. In this study we found that the dispersion of methylene blue in MLM through the lung parenchyma was significantly smaller than methylene blue (0.6±0.3 cm vs 1.0±0.4 cm P<0.05). The result implies that lipiodol reduces the spread of methylene blue in lung parenchyma. Regarding the score of radio-opacity 38% of MLM showed non-visualization or minimally increased opacity on the fluoroscopic examinations. It means the proportion of lipiodol in MLM at the time of the percutaneous injection was too small to be detected. Post-procedural CT images also revealed that 3 subjects had small faint radio-opacity after the injection of MLM. It suggests that the uneven blending of lipiodol and methylene blue occurred during the preparation of MLM. Water-insolubility of lipiodol would result in the uneven mixing of water soluble methylene blue after mechanical blending of the two materials. Further research is required to reduce non-homogeneity of MLM at the time of injection. Previous studies reported the availability of a mixture of methylene blue with other materials such as collagen or autologous blood (15 16). They performed VATS resection on the same day as localization. In our study we evaluated the localization ability of MLM on the same day of localization (6 hr) as well as 24 hr after injection. Localization is usually performed on the day of surgery. This requires the simultaneous use of the CT and the operating room which is not always available. Surgeries on the next day of localization were reported in several published articles (26 27). MLM shows a prolonged localization ability of up to 24 hr in terms of staining ability and radio-opacity. Stable localization ability is the advantage of MLM in our study. Due to uneven blending of MLM one subject (10%) showed inappropriate staining and appropriate radio-opacity and required an intraoperative fluoroscopic examination to detect MLM. Possible radiation exposure is a drawback of MLM. We would like to justify the use of intraoperative fluoroscopy because the operator can avoid radiation exposure with a lead apron. In regards to the risk-benefit for patients lowering the risk of detection failure is thought to be more important than radiation exposure. Histopathologic examinations showed lung parenchymal changes in all specimens. Both methylene blue and MLM induced acute lung injury that included neutrophil infiltration vasculitis necrosis hemorrhage and foam cell in alveolus (). The results of our study are similar to those of a previous study by Kwon et al. (28) that showed that lipiodol led to acute lung injury. They described that lipiodol creates the histopathologic feature of acute lung injury such as peripheral endothelial cell damage neutrophil infiltration necrosis hemorrhage alveolar wall destruction vasculitis emboli (or thrombi in arteriole) and macrophages in the alveolar space (28). In our results the extent of lung parenchymal change was not associated with the materials for all histopathologic features. In addition the overall severity score of lung parenchymal change in MLM was not different from methylene blue (5.6 and 5.7 P=0.839). This suggests that MLM shows similar histopathologic effects in the lung parenchyma to methylene blue. The overall severity score of parenchymal change was higher in Group B (follow up interval of 24 hr) than Group A (follow up interval of 6 hr) (6.6 vs 4.7 P=0.005). The extent of lung parenchymal change depends on the time interval. Acute lung injury after the percutaneous injection of lipiodol or methylene blue was reported in animal studies (28 29); however there are no clinical results that show the adverse effect of acute lung injury in human lungs. Injection material (such as barium) can potentially complicate the pathologic diagnosis of the target lesion due to acute inflammation (29 30). To our knowledge no study has indicated that lipiodol or methylene blue hinders the histopathologic diagnosis of target lesions in human lungs. The small amount of material injection in human lungs might not create a significant parenchymal change or disrupt underlying lung disease. It is necessary to avoid directly injecting materials into the target lesion in human lungs in order to avoid the adverse effect of injection materials on underlying lung disease (especially ground glass opacity nodule or potential benign lesion). There were several limitations in our study. First we included only a small number of subjects. Second the overall localization success rate was low and the complication rate was high (compared to the results of previous studies) due to the difficulty in an accurate percutaneous injection at the desired location and depth in the small sized rabbit lung. Third we used a 1 mL syringe with manual administration to inject materials in the lung parenchyma and there were possible individual difference in the administering volume of materials. Fourth we could not evaluate complications such as intractable pain material related anaphylaxis or embolism. Fifth we could not evaluate if the histopathologic changes had any effect on underlying lung disease because the lung parenchyma of the experimental rabbits were normal. Finally we did not evaluate a successful localization for the true target lesion in lung parenchyma. The criteria for appropriate staining and radio-opacity were subjective. We expect that further clinical studies might provide an answer to if MLM can be a useful percutaneous injection material for localization in the human lung. In conclusion MLM is available for percutaneous injection for the pulmonary localization. The results of this study showed that MLM provides superior ability for appropriate localization than that of methylene blue. Further research on human lungs can clarify the availability of MLM as a CT guided percutaneous injection material. This study was supported by grant from the Seoul National University College of Medicine Research Fund 2012 (800-20120036). We have no potential conflicts of interest or commercial involvement to disclose. 1 Nakashima S Watanabe A Obama T Yamada G Takahashi H Higami T Need for preoperative computed tomography-guided localization in video-assisted thoracoscopic surgery pulmonary resections of metastatic pulmonary nodules Ann Thorac Surg 2010 89 212 218 20103238 2 Chen S Zhou J Zhang J Hu H Luo X Zhang Y Chen H Video-assisted thoracoscopic solitary pulmonary nodule resection after CT-guided hookwire localization: 43 cases report and literature review Surg Endosc 2011 25 1723 1729 21181200 3 Ciriaco P Negri G Puglisi A Nicoletti R Del Maschio A Zannini P Video-assisted thoracoscopic surgery for pulmonary nodules: rationale for preoperative computed tomography-guided hookwire localization Eur J Cardiothorac Surg 2004 25 429 433 15019673 4 Suzuki K Nagai K Yoshida J Ohmatsu H Takahashi K Nishimura M Nishiwaki Y Video-assisted thoracoscopic surgery for small indeterminate pulmonary nodules: indications for preoperative marking Chest 1999 115 563 568 10027460 5 Seo JM Lee HY Kim HK Choi YS Kim J Shim YM Lee KS Factors determining successful computed tomography-guided localization of lung nodules J Thorac Cardiovasc Surg 2012 143 809 814 22104686 6 Gossot D Miaux Y Guermazi A Celerier M Friga J The hook-wire technique for localization of pulmonary nodules during thoracoscopic resection Chest 1994 105 1467 1469 8181339 7 Pittet O Christodoulou M Pezzetta E Schmidt S Schnyder P Ris HB Video-assisted thoracoscopic resection of a small pulmonary nodule after computed tomography-guided localization with a hook-wire system: experience in 45 consecutive patients World J Surg 2007 31 575 578 17318707 8 Chen W Chen L Yang S Chen Z Qian G Zhang S Jing J A novel technique for localization of small pulmonary nodules Chest 2007 131 1526 1531 17494801 9 Bernard A Resection of pulmonary nodules using video-assisted thoracic surgery: the Thorax Group Ann Thorac Surg 1996 61 202 204 8561553 10 Martin AE Chen JY Muratore CS Mayo-Smith WW Luks FI Dual localization technique for thoracoscopic resection of lung lesions in children J Laparoendosc Adv Surg Tech A 2009 19 S161 S164 18999984 11 Kawanaka K Nomori H Mori T Ikeda K Ikeda O Tomiguchi S Yamashita Y Marking of small pulmonary nodules before thoracoscopic resection: injection of lipiodol under CT-fluoroscopic guidance Acad Radiol 2009 16 39 45 19064210 12 Yamagami T Miura H Yoshimatsu R Tanaka O Ono S Iehara T Hosoi H Nishimura T Experience of fluoroscopy-aided thoracoscopic resection of pulmonary nodule localised with Lipiodol in a child J Med Imaging Radiat Oncol 2011 55 401 403 21843175 13 Iwasaki Y Nagata K Yuba T Hosogi S Kohno K Ohsugi S Kuwahara H Takemura Y Yokomura I Fluoroscopy-guided barium marking for localizing small pulmonary lesions before video-assisted thoracic surgery Respir Med 2005 99 285 289 15733503 14 Yoshida J Nagai K Nishimura M Takahashi K Computed tomography-fluoroscopy guided injection of cyanoacrylate to mark a pulmonary nodule for thoracoscopic resection Jpn J Thorac Cardiovasc Surg 1999 47 210 213 10402768 15 Nomori H Horio H Colored collagen is a long-lasting point marker for small pulmonary nodules in thoracoscopic operations Ann Thorac Surg 1996 61 1070 1073 8607658 16 McConnell PI Feola GP Meyers RL Methylene blue-stained autologous blood for needle localization and thoracoscopic resection of deep pulmonary nodules J Pediatr Surg 2002 37 1729 1731 12483642 17 Hu J Zhang C Sun L Localization of small pulmonary nodules for videothoracoscopic surgery ANZ J Surg 2006 76 649 651 16813634 18 Wicky S Mayor B Cuttat JF Schnyder P CT-guided localizations of pulmonary nodules with methylene blue injections for thoracoscopic resections Chest 1994 106 1326 1328 7956378 19 Vandoni RE Cuttat JF Wicky S Suter M CT-guided methylene-blue labelling before thoracoscopic resection of pulmonary nodules Eur J Cardiothorac Surg 1998 14 265 270 9761435 20 Lenglinger FX Schwarz CD Artmann W Localization of pulmonary nodules before thoracoscopic surgery: value of percutaneous staining with methylene blue AJR Am J Roentg" | Lung_Cancer |
"In current study a semi-Markov model along with two-parametric Weibull and Log-logistic distribution were used for measuring the time-dependency transition probabilities and calculating the direct medical costs LYGs and QALYs gained of the practice presented in the trial [15]. A cost-effectiveness evaluation was performed to analysis the economic impact of maintenance gefitinib therapy for patients with locally advanced/metastatic NSCLC with unknown EGFR mutations. Base case analyses of 1- 3- 6- and 10-year time horizon showed an unfavorable ICER of $184829 $19214 $19328 and $21308 per QALY gained respectively. OSA and PSA all revealed that the model we applied was robust to the results. Monte Carlo simulations of 1000 cases suggested that all ICERs for maintenance gefitinib therapy were higher than the recommended WTP threshold (3per-capita GDP) of cost-effectiveness guidelines from Word Health anization (WHO). There are 31 province-level administrative units in Chinese mainland the per-capita GDP of which differs significantly. In 2011 for example it ranged from $2495 in Guizhou province to $13392 in Tianjin city [31]. According to the recommended threshold of WHO [25] the WTP threshold of different province-level administrative units extended from $7485 (3$2495) to $40176 (3$13392) per QALY gained which exceeded the sensitivity range of the WTP (about $17700 to $26300) obtained from PSA of the current study. Obviously local government could take fully into account covering maintenance gefitinib treatment following first-line platinum-based chemotherapy for locally advanced/metastatic NSCLC with unknown EGFR mutations in accordance with local economic development level. Cost-effective probability for different economic level provinces displayed in could supply available information for local governments when gefitinib is approved by local governments finance before it has access to the directory of drugs for national basic medical insurance in China. .0088881.t004 The cost-effective probabilities of gefitinib arm for 31 provinces of Chinese mainland. Region Per-capita GDP ($) WTP (3Per-capita GDP $) Cost-effective Probability Mainland China 5449.71 16349 0 More affluent regionsa >8767 >26300 1.00 Guangdong 7819 23457 0.932 Liaoning 7795 23385 0.926 Fujian 7344 22032 0.717 Shandong 7273 21819 0.655 Less affluent regionsb <5900 <17700 0 a Consist of Tianjin Shanghai Beijing Jiangsu Zhejiang and Inner Mongolia. b Consist of Jilin Chongqing Hubei Hebei Shanxi Ningxia Heilongjiang Shangxi Xinjiang Hunan Qinghai Henan Hainan Jiangxi Sichuan Guangxi Anhui Tibet Gansu Yuannan and Guizhou. A number of different survival models such as Weibull Exponential Log-logistic Gompertz et al can be used to perform extrapolation according to the observed trial data [32]. It is therefore very vital to choose the justifiable extrapolation approach to ensure the associated results of economic analysis confident to decision makers. In the current study after the deviance information criterion test (reported by Jackson et al [33] to alternative models introduced by Latimer [32] we chose Weibull and Log-logistic for PFS and OS respectively instead of Weibull for extrapolating both PFS and OS curves like the previous study undertaken by Zhu J et al [23]. In addition a hazard ration (HR) of PFS was applied to derive the PFS curve for the gefitinib strategy in the previous study [23]. Latimer however in the resent published paper pointed out that the HR used may cause bias because of the requirement of the assumptionsthat is the HR was from a related model and was constant over time [34]. Obviously the bias should be considered especially if the HR impacts the results markedly. Unfortunately the HR of PFS was one of the two most influential parameters on the basis of one-way sensitivity analyses performed by Zhu J et al [23]. In view of the above cases independent parametric models were fitted to both control and experimental groups in our study. Utility of PFS played a great role in the results not only in the resent study [23] but also in the current study. Nafees et al [28] reviewed that all toxicities (diarrhoea rash nausea and vomiting neutropenia fatigue and hair loss) were related to pulling utility down significantly. Of the toxicities rash and diarrhoea were associated with maintenance gefitinib strategy as reported the clinical trial [15]. For higher accuracy we weighted the utility of PFS according to the risks of the rash and diarrhoea which were displayed in . In particularly one point revealed by one-way sensitivity analysis () should be highlighted that the price of gefitinib would be the most significant parameter that could reduce the ICER. With the gefitinib price reduction of 20% discount the ICER decreased to $16731 per QALY gained which is very close to the WTP threshold of $16349 per QALY. Therefore if the price of gefitinib decreases >20% maintenance gefitinib therapy after the standard chemotherapy in patients with locally advanced/metastatic NSCLC may be a cost-effectiveness strategy. There are some limitations in the present study. First using Weibull and Log-logistic distribution to extrapolate the survival curves beyond the time scope of the trial was an unavoidable limitation of this process. There is not enough survival data provided by the short follow-ups of the clinical trial to compare the long-term outcomes estimated by the model. Our results should be updated when long-term survival data are available. Another important limitation is that the utility weight parameters originated from the published literature that may not reflect Chinese patients trait. It is an inevitable limitation of the current analysis because utilities data are not yet available for China. Fortunately opinions from Chinese oncologists suggested that quality of life of locally advanced or metastatic NSCLC patients in China should not be of significant difference from abroad patients. Finally because there is no head-to-head clinical trial comparing maintenance gefitinib with other maintenance drugs (eg erlotinib) after the standard chemotherapy of four chemotherapeutic cycles we have not conducted a cost-effectiveness analysis of gefitinib in comparison with other maintenance therapies. Although the current estimates were derived from just one study which is also the only phase III trial compared maintenance gefitinib treatment in patients with locally advanced/metastatic NSCLC according to our literature search we believe that the analysis of our study based on a current Chinese phase III trial and the justifiable extrapolation approach can provide important reference information for decision makers in China. First of all the clinical study itself is a multicentre double-blind randomized controlled-trial (RCT) which represents the best evidence available and is deemed to be the most accepted scientific method of determining the benefit of a drug or a therapeutic procedure. Second the analysis method applied in our study was reliable and widely used in economic evaluations especially in the field of medical and health care. In addition the Log-logistic and two parameters Weibull model matched the survival curves of the clinical trial satisfactorily () which shows that the model we constructed can mirror the effectiveness data of the trial commendably. And then direct medical costs related to each strategy were estimated including maintenance gefitinib therapy treatment of major adverse events routine follow-up treatment for patients without progression follow-up treatment in PS state and terminal-phase cost. Although the costs originated from our previous study [26] the published literature [27] or estimates according to local charges based on expert opinion all of them stemmed from a Chinese health care system perspective as well as in view of patients with advanced NSCLC which echoed the purpose of the current study. Last but not least to reflect substantial uncertainty of the input parameters the sensitivity analyses (including OSA and PSA) were conducted for each key parameter and all sensitivity analyses revealed that the model we applied was robust to the results. In conclusion according to the recommended WTP threshold (3per-capita GDP) of cost-effectiveness guidelines from WHO maintenance gefitinib therapy after the standard chemotherapy of four chemotherapeutic cycles in locally advanced/metastatic NSCLC patients with unknown EGFR mutations is likely to be not cost-effective for Chinese mainland from the Chinese health care system perspective. Local governments with different economic level however could take fully into account covering maintenance gefitinib treatment. Because for rich regions (the per-capita GDP> $8767) the new strategy seems to be a reasonable option and if the per-capita GDP ranges from $5900 to $8767 the maintenance therapy may be favourable in terms of the different cost-effective probabilities. Decreasing the price of gefitinib the most significant parameter that could reduce the ICER should be considered to as a preferential factor for meeting widely treatment demands in China. Prof. L.B. Peng and J.H. Li are the guarantors for the overall content. The authors greatly thank many clinicians and the data managers who have recorded the initial data diligently of medicines over the years. In particular they thank Ouyang Lihui Wang Siying Zhao Ziying and Qiu Zhenhua for their help in the data collection and valuable discussions and advices. References 1 JemalA BrayF (2011) Center MM Ferlay J Ward E et al (2011) Global cancer statistics. CA Cancer J Clin61: 699021296855 2 FathiAT BrahmerJR (2008) Chemotherapy for advanced stage non-small cell lung cancer. Semin Thorac Cardiovasc Surg20: 21021619038730 3 GovindanR PageN MenszternD ReadW TierneyR et al (2006) Changing epidemiology of small-cell lung cancer in the United States over the last 30 years: analysis of the surveillance epidemiologic and end results database. J Clin Oncol24: 4539454417008692 4 Nation Comprehensive Cancer Network (2013) Nonsmall cell lung cancer (version 2.2014). Available: http://www.nccn./professionals/physician_gls/pdf/nscl.pdf Accessed 21 January 2014. 5 AzzoliCG BakerJS TeminS PaoW AliffT et al (2009) American Society of Clinical Oncology Clinical Practice Guideline update on chemotherapy for stage IV non-small-cell lung cancer. J Clin Oncol27: 6251626619917871 6 DAddario G Felip E (2009) Non-small-cell lung cancer: ESMO clinical recommendations for diagnosis treatment and follow-up. Ann Oncol (Suppl 4): 6870. 7 BareschinoMA SchettinoC RossiA MaioneP SaccoPC et al (2011) Treatment of advanced non small cell lung cancer. J Thorac Dis3: 12213322263075 8 BrodowiczT KrzakowskiM ZwitterM TzekovaV RamlauR et al (2006) Cisplatin and gemcitabine first-line chemotherapy followed by maintenance gemcitabine or best supportive care in advanced non-small cell lung cancer: a phase III trial. Lung Cancer52: 15516316569462 9 FidiasPM DakhilSR LyssAP LoeschDM WaterhouseDM et al (2009) Phase III study of immediate compared with delayed docetaxel after front-line therapy with gemcitabine plus carboplatin in advanced non-small-cell lung cancer. J Clin Oncol27: 59159819075278 10 CiuleanuT BrodowiczT ZielinskiC KimJH KrzakowskiM et al (2009) Maintenance pemetrexed plus best supportive care versus placebo plus best supportive care for non-small-cell lung cancer: a randomised double-blind phase 3 study. Lancet374: 1432144019767093 11 CappuzzoF CiuleanuT StelmakhL CicenasS Szcz©snaA et al (2010) Erlotinib as maintenance treatment in advanced non-small-cell lung cancer: a multicentre randomised placebo-controlled phase 3 study. Lancet Oncol11: 52152920493771 12 Paz-AresL de MarinisF DediuM ThomasM PujolJL et al (2012) Maintenance therapy with pemetrexed plus best supportive care versus placebo plus best supportive care after induction therapy with pemetrexed plus cisplatin for advanced non-squamous non-small-cell lung cancer (PARAMOUNT): a double-blind phase 3 randomized controlled trial. Lancet Oncol13: 24725522341744 13 CohenMH JohnsonJR ChattopadhyayS TangS JusticeR et al (2010) Approval summary: erlotinib maintenance therapy of advanced/metastatic non-small cell lung cancer (NSCLC). Oncologist15: 1344135121148614 14 CohenMH CortazarP JusticeR PazdurR (2010) Approval summary: pemetrexed maintenance therapy of advanced/metastatic nonsquamous non-small cell lung cancer (NSCLC). Oncologist15: 1352135821148615 15 ZhangL MaS SongX HanB ChengY et al (2012) Gefitinib versus placebo as maintenance therapy in patients with locally advanced or metastatic non-small-cell lung cancer (INFORM; C-TONG 0804): a multicentre double-blind randomised phase 3 trial. Lancet Oncol13: 46647522512843 16 WalleserS RayJ BischoffH Vergnen¨greA RoseryH et al (2012) Maintenance erlotinib in advanced non-small cell lung cancer: cost-effectiveness in EGFR wild-type across Europe. Clinicoecon Outcomes Res4: 26927523028234 17 Vergnen¨greA RayJA ChouaidC GrossiF BischoffHG et al (2012) Cross-market cost-effectiveness analysis of erlotinib as first-line maintenance treatment for patients with stable non-small cell lung cancer. Clinicoecon Outcomes Res4: 313722347803 18 GreenhalghJ McLeodC BagustA BolandA FleemanN et al (2010) Pemetrexed for the maintenance treatment of locally advanced or metastatic non-small cell lung cancer. Health Technol Assess14: 333921047489 19 KleinR WielageR MuehlenbeinC LiepaAM BabineauxS et al (2010) Cost-effectiveness of pemetrexed as first-line maintenance therapy for advanced nonsquamous non-small cell lung cancer. J Thor Oncol5: 12631272 20 TsuchiyaT FukudaT FuruiyeM KawabuchiK (2011) Pharmacoeconomic analysis of consolidation therapy with pemetrexed after first-line chemotherapy for non-small cell lung cancer. Lung Cancer74: 52152921570734 21 Matter-WalstraK JoergerM K¼hnelU SzucsT PestalozziB et al (2012) Cost-Effectiveness of Maintenance Pemetrexed in Patients with Advanced Nonsquamous-Cell Lung Cancer from the Perspective of the Swiss Health Care System. Value Health15: 657122264973 22 ZengXH PengLB LiJH ChenGN TanCQ et al (2013) Cost-Effectiveness of Continuation Maintenance Pemetrexed after cisplatin and pemetrexed chemotherapy for Advanced Non-squamous Non-small-cell Lung Cancer: estimates from the Chinese Perspective of Health Care System. Clin Ther35: 546523328269 23 ZhuJ LiT WangXH YeM CaiJ et al (2013) Gene-guided Gefitinib switch maintenance therapy for patients with advanced EGFR mutation-positive Non-small cell lung cancer: an economic analysis. BMC Cancer13: 3923360224 24 China Center for Health Economic Research. China Guidelines for Pharmacoeconomic Evaluations (Version 8) [in Chinese] (2010) Available: http://www.cpa..cn/Article/UploadFiles/201011/2010112509052247.pdfAccessed 21 January 2014. 25 WHO. Cost-effectiveness thresholds. Available: http://www.who.int/choice/costs/CER_thresholds/en/ Accessed 21 January 2014. 26 ZengXH KarnonJ WangSY WuB WanXM et al (2012) The cost of treating advanced non-small cell lung cancer: estimates from the Chinese experience. PLoS ONE7: e4832323118985 27 WuB ChenH ShenJ YeM (2011) Cost-effectiveness of adding rh-endostatin to first-line chemotherapy in patients with advanced non-small-cell lung cancer in China. Clin Ther33: 1446145521992806 28 NafeesB StaffordM GavrielS BhallaS WatkinsJ (2008) Health state utilities for non small cell lung cancer. Health Qual Life Out6: 84 29 National Cancer Institute (2013) SEER Stat Fact Sheets: Lung and Bronchus Cancer. Available: http://seer.cancer.gov/statfacts/html/lungb.html Accessed 21 January 2014. 30 LiuQ WangB KongY ChengKK (2011) Chinas primary health-care reform. Lancet377: 2064206621453962 31 National Bureau of Statistics of China (2012) China statistical yearbook 2012. Available: http://www.stats.gov.cn/english/ Accessed 21 January 2014. 32 Latimer N (2011) NICE DSU Technical Support Document 14: Undertaking survival analysis for economic evaluations alongside clinical trialsextrapolation with patient-level data. Available: http://www.nicedsu..uk Accessed 21 January 2014. 33 JacksonCH SharplesLD ThompsonSG (2010) Survival models in health economic evaluations: Balancing fit and parsimony to improve prediction. Int J Biostat6: 34 34 LatimerNR (2013) Survival analysis for economic evaluations alongside clinical trialsextrapolation with patient-level data: inconsistencies limitations and a practical guide. Med Decis Making33: 74375423341049 0374236 2771 Cancer Cancer Cancer 0008-543X 1097-0142 24711210 4219619 10.1002/cncr.28683 NIHMS637693 Article Guideline-Concordant Cancer Care and Survival Among American Indian/Alaskan Native Patients Javid Sara H. MD 1 Varghese Thomas K. MD MS 1 Morris Arden M. MD 2 Porter Michael P. MD MS 3 He Hao PhD 1 Buchwald Dedra MD 4 Flum David R. MD MPH 1 for the Collaborative to Improve Native Cancer Outcomes (CINCO) 1Department of Surgery Surgical Outcomes Research Center School of Medicine University of Washington Seattle Washington 2Department of Surgery School of Medicine University of Michigan Ann 3Department of Urology Surgical Outcomes Research Center School of Medicine University of Washington Seattle Washington 4Division of General Internal Medicine School of Medicine University of Washington Seattle Washington Corresponding author: Sara H. Javid MD University of Washington 1959 NE Pacific Street Box 356410 Seattle WA 98195; Fax: (206) 543-8136; sjavid@uw.edu 27 10 2014 07 4 2014 15 7 2014 04 11 2014 120 14 2183 2190 © 2014 American Cancer Society. 2014 BACKGROUND American Indians/Alaskan Natives (AI/ANs) have the worst 5-year cancer survival of all racial/ethnic groups in the United States. Causes for this disparity are unknown. The authors of this report examined the receipt of cancer treatment among AI/AN patients compared with white patients. METHODS This was a retrospective cohort study of 338204 patients who were diagnosed at age ?65 years with breast colon lung or prostate cancer between 1996 and 2005 in the Surveillance Epidemiology and End Results-Medicare database. Nationally accepted guidelines for surgical and adjuvant therapy and surveillance were selected as metrics of optimal guideline-concordant care. Treatment analyses compared AI/ANs with matched whites. RESULTS Across cancer types AI/ANs were less likely to receive optimal cancer treatment and were less likely to undergo surgery (P ? .025 for all cancers). Adjuvant therapy rates were significantly lower for AI/AN patients with breast cancer (P <.001) and colon cancer (P = .001). Rates of post-treatment surveillance also were lower among AI/ANs and were statistically significantly lower for AI/AN patients with breast cancer (P = .002) and prostate cancer (P <.001). Nonreceipt of optimal cancer treatment was associated with significantly worse survival across cancer types. Disease-specific survival for those who did not undergo surgery was significantly lower for patients with breast cancer (hazard ratio [HR] 0.62) colon cancer (HR 0.74) prostate cancer (HR 0.52) and lung cancer (HR 0.36). Survival rates also were significantly lower for those patients who did not receive adjuvant therapy for breast cancer (HR 0.56) colon cancer (HR 0.59) or prostate cancer (HR 0.81; all 95% confidence intervals were <1.0). " | Lung_Cancer |
"However as in the phase I study a stabilisation of median haemoglobin values for multiple cycles as well as low rate of all-grade anaemia was observed. The result provides some support for the hypothesis that VEGF is a negative regulator of erythropoiesis and its inhibitors may have a role in the management of anaemia. The toxicity profile of this trial was consistent with published data on cisplatin plus pemetrexed and with the known effects of ziv-aflibercept with the exception of a higher than anticipated rate of RPLS (Gadgeel 2012). Hypertension was the third most frequent TEAE and is a known adverse effect of anti-VEGF therapies. However higher response rate was observed among patients who developed hypertension during the treatment than among those who did not in a post hoc analysis. This observation is consistent with data from ECOG 4599 that suggested improved outcomes associated with bevacizumab in patients developing hypertension on therapy (Dahlberg et al 2010). Although cases of RPLS have been observed in other ziv-aflibercept studies the 7% rate observed in this study was much higher. It should be noted that the dose and schedule of ziv-aflibercept in this study at 6?mg?kg?1 every 21 days is different from the one approved in colorectal cancer at 4?mg?kg?1 every 14 days (Van Cutsem et al 2012) although the dose intensity is the same at 2?mg?kg?1 per week. At the recommended phase II dose of 6?mg?kg?1 for ziv-aflibercept no RPLS was reported in the phase I study that used the same regimen (N=7 at that dose level; Diaz-Padilla et al 2012) or in another phase I study of ziv-aflibercept/cisplatin/docetaxel (N=17 at that dose level; Freyer et al 2012) nor in combination with docetaxel in the VITAL study (N=456 in the combination arm; Ramlau et al 2012). A meta-analysis of safety data from three large placebo-controlled studies reported no RPLS among 1333 patients treated with ziv-aflibercept in combination with standard chemotherapy (Allegra et al 2012). It is likely that the development of RPLS may be regimen dependent rather than dose or schedule dependent. Reversible posterior leukoencephalopathy syndrome is described as a brain-capillary leak syndrome frequently related to hypertension fluid retention and possibly the cytotoxic effects of immunosuppressive agents on the vascular endothelium (Hinchey et al 1996). Risk factors include female sex hypertension and renal dysfunction (Vaughn et al 2008) as well as anticancer agents: 75% were diagnosed in women and 71% were associated with combination regimens (Marinella and Markert 2009). Bevacizumab and gemcitabine have been most commonly associated with RPLS. Treatment including cisplatin without concomitant anti-VEGF therapy has been associated with RPLS (Ito et al 1998) whereas pemetrexed before this study was not. Consistent with the literature the three cases of RPLS were all diagnosed in women which may be related to an anticancer drugoestrogen interaction inducing altered cerebral vasoreactivity and endothelial dysfunction. Agents that decrease VEGF signalling increases the risk of RPLS (including bevacizumab sunitinib sorafenib and ziv-aflibercept) suggesting a class effect toxicity (Glusker et al 2006). Clinical features of RPLS are neurological symptoms characterized by headaches altered mental status visual disturbances or seizures and systemic signs such as hypertension. Onset is variable ranging from hours to 1 month after completing therapy (Lee et al 2008). Characteristic findings in brain MRI demonstrate bilateral symmetric parieto-occipital subcortical and cortical vasogenic oedema (Bartynski 2008). Removal of the causative agent and treatment of hypertension and renal insufficiency are indicated for RPLS which is usually but not always reversible clinically. In this phase II study was designed to evaluate ziv-aflibercept in combination with cisplatin and pemetrexed in patients with untreated advanced/metastatic non-squamous NSCLC. However three confirmed and two suspected but unconfirmed cases of RPLS led to the early termination of the trial. The reason for the increased incidence of RPLS might be related to declining CrCL and/or increased BP. Although ORR and median PFS were in accordance with most historical first-line NSCLC studies this combination of ziv-aflibercept/cisplatin/pemetrexed will not be further pursued in NSCLC. Future efforts to identify predictive biomarkers of anti-VEGF agents are warranted. This study was supported by Sanofi and Regeneron Pharmaceuticals. We thank all the patients who participated in this study. We also thank all the participating study sites and the investigators and research staff. This work is published under the standard license to publish agreement. After 12 months the work will become freely available and the license terms will switch to a Creative Commons Attribution-NonCommercial-Share Alike 3.0 Unported License. Drs Liu Gao and DiCioccio are employees of Regeneron Pharmaceuticals Inc. The remaining authors declare no conflict of interest. Allegra CJ Tabernero J Rougier P Scagliotti GV Philip PA Lakomy R Ramlau R Assadourian S Chevalier S Van Cutsem E 2012 Meta-analysis of anti-VEGF class adverse events from three double-blind (Db) placebo (Pbo)-controlled phase III trials with IV aflibercept (Afl) J Clin Oncol 30 (Suppl 4 561 Bartynski WS 2008 Posterior reversible encephalopathy syndrome part 1: fundamental imaging and clinical features AJNR Am J Neuroradiol 29 1036 1042 18356474 Dahlberg SE Sandler AB Brahmer JR Schiller JH Johnson DH 2010 Clinical course of advanced non-small-cell lung cancer patients experiencing hypertension during treatment with bevacizumab in combination with carboplatin and paclitaxel on ECOG 4599 J Clin Oncol 28 949 954 20085937 de Groot JF Lamborn KR Chang SM Gilbert MR Cloughesy TF Aldape K Yao J Jackson EF Lieberman F Robins HI Mehta MP Lassman AB DeAngelis LM Yung WKA Chen A Prados MD Wen PY 2011 Phase II study of aflibercept in recurrent malignant glioma: A North American Brain Tumor Consortium Study " | Lung_Cancer |
"The Creative Commons Public Domain Dedication waiver (http://creativecommons./publicdomain/zero/1.0/) applies to the data made available in this unless otherwise stated. Background Complement receptor 1 (CR1) the receptor for C3b/C4b complement peptides plays a crucial role in carcinogenesis. However the association of genetic variants of CR1 with susceptibility to lung cancer remains unexplored. Methods This case-control study included 470 non-small cell lung cancer (NSCLC) patients and 470 cancer-free controls. Based on the Chinese population data from HapMap database we used Haploview 4.2 program to select candidate tag SNPs. Odds ratios (ORs) and 95% confidence intervals (CIs) were computed by logistic regression to evaluate the association of each tag SNP with NSCLC. Results Multivariate regression analysis indicated that the rs7525160 CC genotype was associated with an increased risk of developing NSCLC (OR?=?1.52 95% CI?=?1.02-2.28; P?=?0.028) compared with the GG genotype. When stratified by smoking status the risk of NSCLC was associated with the rs7525160 C allele carriers in smokers with OR (95% CI) of 1.72 (1.15-2.79) but not in non-smokers with OR (95% CI) of 1.15 (0.81-1.65). When the interaction between smoking status and rs7525160 G?>?C variant was analyzed with cumulative smoking dose (pack-year). Similarly GC or CC genotype carriers have increased risk of NSCLC among heavy smokers (pack-year???25) with OR (95% CI) of 2.01 (1.26-3.20) but not among light smokers (pack-year <25) with OR (95% CI) of 1.32 (0.81-2.16). Conclusion CR1 rs7525160 G?>?C polymorphism was associated with an increased risk of developing NSCLC in Chinese population. The association displays a manner of gene-environmental interaction between CR1 rs7525160 tagSNP and smoking status. CR1 Polymorphism Tag SNPs Lung cancer Background The complement system plays a critical role in the process of carcinogenesis. Despite of significant research controversial viewpoints remain on the exact relationship of complement system with cancer. Classically the complement system fights against cancer by exerting the effects of immunosurveillance in the immunologic microenvironment of tumors [1]. Recently it was found that complement may contribute to tumor growth by a wide variety of mechanisms including dysregulation of mitogenic signaling pathways sustained cellular proliferation angiogenesis insensitivity to apoptosis invasion and migration and escape from complement cytotoxicity [2]. This suggested complement just like a double-edged sword plays a dual role in carcinogenesis. In particular component C3 and its receptors have been demonstrated to be a key link between innate and adaptive immunity [3]. Complement receptor type 1 (CR1 CD35) is a multifunctional polymorphic glycoprotein which binds to C3b fragment of C3 and to C4b with lower affinity [45]. CR1 belongs to the regulators of complement activation (RCA) family of proteins and is expressed in a wide spectrum of cells and involved in T-cell and B-cell mediated immune regulation [67]. CR1 also modulates the complement cascade activation by preventing formation of classical and alternative pathway convertases and by acting as a cofactor for factor I mediated inactivation of C3b and C4b [89]. It has been demonstrated that chronic inflammation can predispose to cancer development and spread [10] as a fundamental component of innate immunity the complement cascade consists of potential proinflammatory molecules especially C3 and C5. Moreover complement activation and abnormal expression in tumor tissues has been demonstrated [11]. Considering the important role of CR1 in complement activation innate immunity and chronic inflammation CR1 has emerged as a molecule of immense interest in gaining insight into the susceptibility to cancer. CR1 gene is located on the Chromosome 1 at the locus 1q32 [12]. Various polymorphisms have been studied including the intronic and exonic density polymorphism for their ability to alter the density of erythrocyte CR1 on the cell membranes [13-15]. There are also the molecular weight variants due to insertion-deletion polymorphisms [16]. Up to now there have been very few studies on the association of genetic variants of CR1 with susceptibility to autoimmune and inflammatory diseases. It has been proposed that genetic variant at CR1 gene (rs6656401) might influence the susceptibility to late-onset Alzheimers disease [17]. CR1 expression in Peripheral Blood Mononuclear Cells (PBMCs) may be a new biomarker for prognosis of nasopharyngeal carcinoma and a potential therapeutic target [18]. Recently it has been indicated that CR1 A3650G (His1208Arg) polymorphism plays a critical role in conferring genetic susceptibility to gallbladder cancer in north Indian population [19]. However the association of genetic variants of CR1 with risk of lung cancer remains unexplored. Worldwide lung cancer is the most common cancer in terms of both incidence and mortality [20]. NSCLC is the most common subtype of lung cancer and less aggressive and metastic than SCLC. Although cigarette smoking is the predominant risk factor for lung cancer inherited genetic characteristics are presumed to account in part for this interindividual variation in lung cancer susceptibility. Recently several genome-wide association studies have demonstrated the common genetic variations associated with susceptibility to lung cancer [21-24]. Given the involvement of the complement system in coordinating innate immunity and inflammatory response [25] further examination of the potential association between genetic variation of CR1 genes and lung cancer is warranted. In the current study we conducted a case-control study to investigate the association of tag SNPs in CR1 gene with the risk of NSCLC and effect of the interaction of gene-environment on the risk of NSCLC. Results Subject characteristics The frequency distributions of select characteristics in cases and control subjects were shown in . The mean age (±SD) was 59.6?±?10.5 years for the cancer patients and 57.2?±?13.3 years for the controls. No significant difference was found in the mean age between cases and controls (P?=?0.470). There was no significant difference in proportion of sex and smoking status between cases and controls (P?=?0.832 and P?=?0.321 respectively). However there was significant difference between cases and controls when compared by pack-year smoked (P = 0.001). The heavy smokers (?25 pack-year) accounted for 61.5% in cases but only 45.5% in controls which suggested that cigarette smoking was a prominent contributor to the risk of lung cancer. Of the 470 case patients 178 (37.9%) were diagnosed as adenocarcinoma 238 (50.6%) as squamous cell carcinoma and 100 (%) as other types including large cell carcinoma (n?=?49) and mixed cell carcinoma (n?=?5). Distributions of select characteristics in cases and control subjects Variables ???Cases (n?=?470) ???Controls (n?=?470) No (%) No (%) P a ???Sex 0.832 ???Male 324 68.9 328 69.8 ???Female 146 31.1 142 30.2 ???Age 0.470 ???<50 84 17.9 96 20.4 ???50-59 177 37.7 187 39.8 ???60-69 129 27.4 111 23.6 ????70 80 17.0 76 16.2 ???Smoking status 0.321 ???Non-smoker 265 56.4 281 59.8 ???Smoker 205 43.6 189 40.2 ???Pack-year smoked 0.001 ???<25 75 36.6 96 50.8 ????25 130 63.4 93 49.2 aTwo-sided ?2 test. Association of CR1 tag SNP with NSCLC risk Total 13 selected tag SNPs of CR1 in HapMap database among Chinese population were analyzed. Except for rs9429782 polymorphism the genotype distributions of other SNPs in controls were consistent to Hardy-Weinberg equilibrium. Therefore we excluded the rs9429782 from further analysis. In order to screen the genetic variants that confer the susceptibility to lung cancer 12 candidate tagSNPs were genotyped in a case-control study consisting of 470 lung cancer patients and 470 cancer-free controls as shown in . Importantly genotype frequency of one intronic SNP (rs7525160 G?>?C) in cases was found to be significantly different from those of controls (?2?=?6.339 P=0.042). Further multivariate regression model with adjustment for age gender and smoking status was used to assess the association between rs7525160 G?>?C polymorphism and the risk of NSCLC. The results indicated that the rs7525160 CC genotype was associated with an increased risk of developing NSCLC with OR (95% CI) of 1.52 (1.02-2.28) compared with the GG genotype. Other tagSNPs of CR1 were not significantly associated with the risk of NSCLC in our study population (P >0.05). Genotype frequencies of CRI among cases and controls and their association with non-small cell lung cancers CRI Genotypes ??Controls (n?=?470) ??Cases (n?=?470) OR (95% CI ) * P No (%) No (%) rs7525160 ??GG 176 37.5 139 29.6 1.00 (ref.) ??CG 228 48.5 256 54.5 1.38 (1.04-1.85) 0.041 ??CC 66 14.0 75 15.9 1.52 (1.02-2.28) 0.028 rs3886100 ??GG 117 24.9 105 22.4 1.00 (ref.) ??AG 223 47.4 253 53.8 1.33 (0.97-1.81) 0.078 ??AA 130 27.7 112 23.8 1.06 (0.73-1.54) 0.755 rs11118167 ??TT 348 74.1 353 75.1 1.00 (ref.) ??CT 111 23.6 102 21.7 0.89 (0.65-1.21) 0.457 ??CC 11 2.3 15 3.2 1.35 (0.61-3.01) 0.461 rs9429782 ??GG 250 53.2 261 55.5 1.00 (ref.) ??GT 220 46.8 209 44.5 0.89 (0.69-1.16) 0.388 rs10494885 ??CC 178 37.9 164 34.9 1.00 (ref.) ??CT 224 47.6 232 49.4 1.11 (0.83-1.47) 0.490 ??TT 68 14.5 74 15.7 1.20 (0.81-1.78) 0.365 rs7542544 ??CC 128 27.2 108 23.0 1.00 (ref.) ??AC 223 47.5 252 53.6 1.21 (0.88-1.67) 0.239 ??AA 119 25.3 110 23.4 0.90 (0.62-1.30) 0.897 rs6691117 ??AA 324 68.9 327 69.6 1.00 (ref.) ??AG 131 27.9 128 27.2 0.98 (0.73-1.31) 0.888 ??GG 15 3.2 15 3.2 0.96 (0.46-2.02) 0.923 rs6656401 ??GG 436 92.8 447 95.1 1.00 (ref.) ??AG 34 7.2 23 4.9 0.68 (0.39-1.18) 0.174 ??AA 0 0.0 0 0.0 NC§ rs2296160 ??CC 185 39.4 194 41.3 1.00 (ref.) ??CT 226 48.1 220 46.8 0.91 (0.69-1.21) 0.521 ??TT 59 12.5 56 11.9 0.90 (0.59-1.37) 0.606 rs9429942 ??TT 452 96.2 457 97.2 1.00 (ref.) ??CT 18 3.8 13 2.8 0.77 (0.37-1.61) 0.482 ??CC 0 0.0 0 0.0 NC§ rs4844600 ??GG 171 36.4 179 38.1 1.00 (ref.) ??AG 230 48.9 228 48.5 0.92 (0.70-1.22) 0.571 ??AA 69 14.7 63 13.4 0.87 (0.58-1.31) 0.513 rs3818361 ??CC 187 39.8 188 40.0 1.00 (ref.) ??CT 224 47.7 224 47.7 0.98 (0.74-1.29) 0.868 ??TT 59 12.5 58 12.3 0.96 (0.63-1.46) 0.848 rs17048010 ??TT 301 64.0 286 60.8 1.00 (ref.) ??CT 154 32.8 164 34.9 1.09 (0.82-1.43) 0.556 ??CC 15 3.2 20 4.3 1.40 (0.70-2.79) 0.343 *Adjusted by age sex and smoking status; §NC not calculated. Table 3 Summary of MDR gene-gene interaction results Models Training bal. acc. (%) Testing bal. acc. (%) P value Cross-validation consistency rs7525160 54.03 50.53 0.828 7/10 rs4844600 rs10494885 55.45 49.32 0.989 3/10 rs4844600 rs10494885 rs7525160 57.60 48.48 0.623 6/10 Generalized Multifactor Dimensionality Reduction (GMDR) was used to evaluate gene-gene interaction. The summary of gene-gene interaction models is listed in Table 3. The SNP rs7525160 in CR1 had the highest testing balanced accuracy among 12 SNPs. The three-way interaction model among rs4844600 rs10494885 and rs7525160 showed high testing balance accuracy and cross validation consistency but the testing balanced accuracy was lower than the two-way gene-gene interaction in NSCLC. For each model the interaction was not significant (P?>?0.05). Table 4 Risk of CR1 genotypes with NSCLC by smoking status Smoking status CR1 genotype GG * OR (95% CI) § P value CG?+?CC * OR (95% CI) § P value Non-smoker 84/99 1.00 (reference) 181/182 1.15 (0.81-1.65) 0.440 Smoker 55/77 0.86 (0.54-1.38) 0.528 150/112 1.72 (1.15-2.59) 0.009 <25 pack-years 19/41 0.59 (0.31-1.10) 0.099 56/55 1.32 (0.81-2.61) 0.266 ?25 pack-years 36/36 1.18 (0.67-2.08) 0.562 94/57 2.01 (1.26-3.20) 0.003 *Number of cases/number of controls. §Data were calculated by logistic regression and adjusted for age and gender. Interaction of CR1 SNP with smoking Cigarette smoking is a well-known risk for lung cancer so stratification by smoking status was performed to investigate the association of rs7525160 G?>?C variant with the risk of NSCLC. As shown in Table 4 the risk of NSCLC was associated with the rs7525160 C allele carriers in smokers with OR (95% CI) of 1.72 (1.15-2.59) but not in non-smokers with OR (95% CI) of 1.15 (0.81-1.65) suggesting that the CR1 rs7525160 G?>?C polymorphism is a smoking-modifying risk factor for susceptibility to NSCLC. When the interaction between smoking status and rs7525160 G?>?C variant was analyzed with cumulative smoking dose (pack-year) consistently GC or CC genotype carriers have increased risk of NSCLC among heavy smokers (pack-year???25) with OR (95% CI) of 2.01 (1.26-3.20) but not among light smokers (pack-year <25) with OR (95% CI) of 1.32 (0.81-2.16). The P value for heterogeneity of the stratification analysis by smoking status is 0.015. However the P value for interaction between rs7525160 polymorphism and smoking is 0.172 and the power for the interaction is 0.49. Discussion The chronic airway inflammation and dysfunctional immune system might promote pulmonary carcinogenesis. Implicated in the immune and inflammatory responses the complement cascade plays a pivotal role in the development of cancer. Thus it is likely that the genetic variants of CR1 in the complement system confer the susceptibility to lung cancer. In this study we have for the first time demonstrated that one intronic SNP (rs7525160 G?>?C) out of 13 tag SNPs of CR1 was associated with the risk of NSCLC in Chinese population. Notably the rs7525160 CC genotype was associated with an increased risk of developing NSCLC (OR?=?1.52 95% CI?=?1.02-2.28; P?=?0.028) compared with the GG genotype. MDR analysis also showed that there was no gene-gene interaction among 12 tag SNPs in CR1 gene. Moreover the risk of NSCLC was associated with the rs7525160 C allele carriers in smokers with OR (95% CI) of 1.72 (1.15-2.59) but not in non-smokers with OR (95% CI) of 1.15 (0.81-1.65) indicating this SNP is a smoking-modifying risk factor for susceptibility to NSCLC. To the best of our knowledge this study shed new insight into the interplay of genetic variation of CR1 with lung cancer risk. More importantly it highlights the potential gene-environmental interaction influences the susceptibility to lung cancer. The complement system has been proposed to get involved in innate immunity with the ability to complement antibody-mediated elimination of immune complex and foreign pathogens [26]. Upon complement activation the biologically active peptides C5a and C3a elicit a lot of pro-inflammatory effects and could be closely associated with tumorigenesis [27]. Complement proteins play a dual role in the tumor microenvironment. On one hand they exert a defensive effect against tumor through complement or antibody-dependent cytotoxicity [128]. On the other hand they may escape from immunosurveillance and facilitate carcinogenesis [2]. Specifically a number of experimental evidence has suggested an association between complement activation and tumor growth [2930] which provides a strong biologically link between the abnormal expression and activity of complement cascade and carcinogenesis. Till now a few studies have been carried out to demonstrate the association of genetic variants in complement proteins with susceptibility to cancer. A significant association of CR2 SNP (rs3813946) with the development of nasopharyngeal carcinoma was indicated in Cantonese population [31] and the genetic variations of complement system genes C5 and C9 plays a potential role in susceptibility to non-Hodgkin lymphoma (NHL) [32]. Recently it has been shown that complement factor H Y402H polymorphism interact with cigarette smoking to confer the susceptibility to lung cancer [33]. Furthermore it has been indicated that CR1 A3650G (His1208Arg) polymorphism plays a critical role in conferring genetic susceptibility to gallbladder cancer in north Indian population [19]. However whether the genetic variants of CR1 are related to the risk of lung cancer remains unknown. In this case-control study we found an intronic SNP (rs7525160 G?>?C) with CC genotype was significantly associated with an increased risk of NSCLC. Consistently our results were in accordance with the study that genetic polymorphisms in innate immunity genes may play a role in the carcinogenesis of lung cancer [34]. It is likely that some genetic variations in strong link disequilibrium with this intronic SNP (rs7525160 G?>?C) are functional which provides a new insight into the hallmarks in susceptibility to lung cancer and further functional experiments are warranted to address the proposal. Functionally human CR1 exists on the surface of almost all peripheral blood cells and plays a key role in immune complex clearance and complement inhibition at the cell surface by binding to activated products C3b and C4b [435]. CR1 also possesses cofactor activity for the serum protease factor I and is thus involved in the generation of further fragments of C3/4b with the activation of complement cascade and the cellular immune response [4]. In our study the association of CR1 polymorphism with lung cancer is biologically plausible in that the intronic polymorphism could affect the density of CR1 molecules on the cell surface thereby contributing to autoimmune disorders and neoplasm. Tobacco smoking is an established risk factor for susceptibility to lung cancer. However not all people who suffer from lung cancer are smokers. Lung cancer in non-smokers can be induced by second hand smoke air pollutants and diesel exhaust [36-39]. Our present data showed significant difference of pack-year smoked but not smoking status between NSCLC cases and controls which suggested the important role of other environmental factors in the development of NSCLC. Tobacco could induce chronic and sustained inflammation in lung microenvironment contributing to pulmonary carcinogenesis in smokers [40]. Support also comes from the epidemiologic data regarding inflammation and lung cancer [41]. CR1 an important molecule implicated in immunity and inflammation could protect the host from invasion of exogenous chemicals derived from cigarette smoking. Genetic variant of CR1 could alter gene function and result in deregulation of the inflammatory and immune responses thereby modulating the susceptibility to lung cancer. More importantly we observed a potential interaction of this SNP (rs7525160 G?>?C) with smoking status suggesting the gene-environmental interaction plays a prominent role in the susceptibility to lung cancer. Our present study has its limitation. Our patients may not be representative of total NSCLC patients at large because they were recruited from only one hospital. In addition due to the relatively small sample size further case-control studies are still needed to replicate and extend our findings. Conclusion We conducted a case-control study in Chinese subjects and found an intronic SNP (rs7525160 G?>?C) of CR1 was significantly associated with lung cancer risk. To the best of our knowledge this study provides the first evidence that genetic variant of CR1 (rs7525160 G?>?C) was a smoking-modifying contributor to the development of lung cancer. Methods Study subjects This case-control study consisted of 470 patients with histopathologically confirmed NSCLC and 470 cancer-free controls. All subjects were genetic unrelated ethnic Han Chinese. Patients were recruited between January 2008 and December 2012 at Tangshan Gongren Hospital (Tangshan China). There were no age gender or stage restrictions however patients with previous malignancy or metastasized cancer from other ans were excluded. The response rate for patients was 94%. The controls were randomly selected from a pool of a cancer-free population from a nutritional survey conducted in the same region. The selection criteria for control subjects included: i) no individual history of cancer; ii) frequency matched to cases according to gender age (±5 years); iii) the residential region; and iv) the time period for blood sample collection. At recruitment informed consent was obtained from each subject and each participant was then interviewed to collect detailed information on demographic characteristics. This study was approved by the institutional review board of Hebei United University. Tag SNPs selection and genotyping Based on the Chinese population data from HapMap database we used Haploview 4.2 program to select candidate tag SNPs with an r2 threshold of 0.80 and minor allele frequency (MAF) greater than 1%. Furthermore we also added two potential functional polymorphisms rs9429942 and rs6691117 [4243]. Therefore we included 13 SNPs in our study which represents common genetic variants in Chinese population. Genotyping was performed at Bomiao Tech (Beijing China) using iPlex Gold Genotyping Asssy and Sequenom MassArray (Sequenom San Diego CA USA). Sequenoms MassArray Designer was used to design PCR and " | Lung_Cancer |
"This is obtained by specifying C as an (L ? ?0 + 1)-dimensional vector of 1's with v? = 1. More sophisticated models with splines or other functions such as those illustrated in publications cited in only require the application of different bases for deriving C but are nevertheless represented by 3). 2.2. Extension to nonlinear exposureresponse relationships The extension to the nonlinear case presents further complexities as anticipated earlier. The model in (1) can be extended by defining an additional exposureresponse function f(x) to express the potentially nonlinear exposureresponse curve along the dimension of the predictor. An intuitive generalization of (1) is: (4) with f(x) as the standard exposureresponse function. However the function f(x) · w(?) in 4) previously proposed 1119 is not easily represented as a linear combination of basis variables and generates models that are not linear in their parameters and thus require ad hoc optimization routines. More importantly this representation is based on the strong assumption of independency between f(x) and w(?) namely that the exposureresponse shape is the same at each lag ? and vice versa that the lag structure is the same at each value of x. This assumption can be relaxed by expressing s(xt) as a truly bivariate function with the more flexible representation: (5) Here the bidimensional function f · w(x?) is defined as the exposurelagresponse function and models simultaneously the exposureresponse curve along x and lagresponse curve along ? namely an exposurelagresponse surface. Differently from 4) the exposurelagresponse function in 5) can be expressed as a linear combination of basis variables and related parameters through a special tensor product. As anticipated earlier Armstrong 23 proposed the same approach for time series data within the DLNM framework generalizing this tensor product parameterization through the concept of cross-basis. Specifically two sets of basis functions are independently chosen to represent f(x) and w(?) respectively. The cross-basis is the bidimensional space of functions obtained by the combination of the two sets integrated over the lag dimension and represents the core of DLNMs. The algebraic representation has been previously presented 24 and a revised version is proposed here. Briefly the simpler lag-basis for DLMs in 3) can be extended by choosing an additional basis with dimension vx for representing f(x). The application of the related basis functions to the vector of exposure history qxt obtained by 2) generates a (L ? ?0 + 1) vx matrix Rxt. Let Axt be: (6) with 1v as a v-dimensional vector of 1's and C defined in 3). The cross-basis function s(xt;?) can be defined as (7) In this case the dimension of the cross-basis is determined by the product of the dimensions of the bases for the two spaces and the association is expressed through vx · v? values W and related parameters ?. The cross-basis function s(xt) represents the integral of f · w(x?) over the interval [?0L] cumulating the contributions of events representing the exposure history. In spite of the relatively complex algebraic form the definition of cross-basis and the specification of DLNMs only amount to the choice of the bases for the functions f(x) and w(?). These can be independently selected between several options such as splines linear threshold or piecewise constant (step) functions. The DLNM modeling class comprises the simpler DLMs from Section 2.1. For example the bidimensional exposurelagresponse function f · w(x?) in 5) reduces to a non-linear function for un-weighted cumulative exposure f(x) · c when w(?) is a constant function c and to the lagresponse function x · w(?) in (1) when f(x) is simply an linear function of the untransformed x. The model proposed by Berhane and colleagues 20 can be written in the form of 6)7) when both f(x) and w(?) are cubic B-splines. 2.3. Estimation and prediction Although the lag-basis and cross-basis functions in (1)(3) and (5)(7) involve a nonstandard parameterization in terms of exposure histories DLMs and DLNMs do not require specialized estimation procedures. The association is entirely expressed by the vx v? parameters ? of the cross-basis values W. The computation of the exposure history in (2) can be extended to all N observations with x measured at time t producing an N (L ? ?0 + 1) matrix of exposure histories Q. The matrix of transformed variables W in (3) and (7) is consequently derived. This matrix can be included in the design matrix of standard regression models to estimate the parameters ?. In the completely parametric development proposed here the number of coefficients vx v? represents the degrees of freedom (df) used to model the association. Inference on the parameters ? and interpretation of the estimated association is aided by the prediction of specific risk measures. For simpler DLMs that assume a linear exposureresponse relationship this step reduces to the computation of a series of estimated risk contributions at lag ?p with ?0 ? ?p ? L and the associated (co)variance matrix . The series of risk contributions is provided by (8) with Cp obtained from the vector of lag ?p used for prediction by applying the same basis functions for w(?) used for estimation. These estimated risk contributions compose the lagresponse curve and can be interpreted using either a forward or backward perspective. Namely represents the risk contribution at time t + ?p in the future from a unit increase in exposure x at time t or the contribution from a unit increase in exposure x occurring at time t ? ?p in the past to a given risk measured at time t. The estimated risk contributions associated with different exposure increases are easily derived. The equations in (8) only apply to DLMs with lag-bases as defined in (3). For DLNMs the association is allowed to vary nonlinearly in the space of x. Moreover the specification in (5)(7) allows the lag-response curve to change depending on the level of the exposure. The prediction of risk contributions corresponding to a specific exposure intensity xp at lag ?p involves a more complex procedure. First let be the (L ? ?0 + 1)-dimensional vector of exposure history with constant exposure xp. The related matrices and are derived from (6) substituting qxt and C with and Cp by applying the same two sets of basis functions for f · w(x?) chosen for estimation. The exposure-specific risk contributions and associated (co)variance matrix are provided by (9) The estimated risk contributions may be interpreted as a lag-response curve similar to in (8) but this time associated with a specific exposure level xp instead of a unit increase. These measures may be used to define a grid of predicted risk contributions defined within the ranges of the exposure x and the lag ? thus obtaining a bi-dimensional representation of the association. From this grid besides above it is also possible to derive the vector of lag-specific risk contributions expressing the exposure-response curve for lag ?p. As noted in Section 2.2 the truly bivariate definition of (7) allows both the lag-response curve and exposure-response curve defined by and respectively to change depending on the specific exposure and lag values xp and ?p. The grid is interpreted as a risk surface along x and ? representing the exposurelagresponse. In addition predictions in (8)(9) may be extended to a generic exposure history qh. Substituting it into in (9) provides the vector of lag-specific risk contributions for each exposure that occurred within the lag period. The overall cumulative effect of such exposure history with associated (co)variance matrix may be computed with: (10) The Equation (10) can be used to estimate the predicted cumulative risk for a given pattern of exposure qh. This method can also be applied to investigate how the risk progressively evolves along an exposure profile computing the cumulative risk at each time associated with the time-varying exposure history qh. 2.4. " | Lung_Cancer |
"The independent quality improvement facilitator role was seen as crucial to ensure the visits remained focussed and that the engagement with quality improvement plans was maintained. Finally the involvement of senior managers was crucial to the successful implementation of the quality improvement plans. The detailed findings from the independent evaluation of this project have been reported elsewhere (Aveling et al 2012). Discussion Lung cancer outcomes remain relatively poor and reducing unexplained variation is an attractive proposition to promote improvement. There are a number of ways that clinical teams may share best practice and innovative service delivery models however studies formally evaluating their impact are limited. To our knowledge this is the first study to formally test a national quality improvement strategy which aimed to bring the standard of all lung cancer teams to that of the best. We have demonstrated that reciprocal peer-to-peer review with supported quality improvement is both feasible and effective at stimulating local quality improvement activity but had a relatively modest and somewhat disappointing impact on process and outcome measures as measured by NLCA indicators and a new lung cancer patient experience questionnaire. The facilitated reciprocal visits represented a new and unique opportunity for all members of a lung cancer team to exchange ideas in a supported environment and to formally design then implement quality improvement plans. Nearly two-thirds of lung cancer multidisciplinary teams in England agreed to take part in the study and reassuringly baseline NLCA indicators did not differ significantly between participants and non-participants suggesting that the willingness to participate in quality improvement activity is not related to baseline performance. There were a wide range of areas identified for improvement but nearly half of the teams identified multidisciplinary team meeting effectiveness as a key issue. This is not surprising given that these meetings are pivotal in the lung cancer pathway. Live observation of each multidisciplinary team meeting followed by facilitated feedback proved to be a strong driver to improve on problems such as ensuring weekly presence of all the treatment specialists as well as more simple issues such as room layout. The need to streamline diagnostic and treatment pathways was also identified as a common problem. Recent NICE guidance on the management of lung cancer (National Institute for Health and Care Excellence 2011) recommended a paradigm shift in the diagnostic algorithm from performing multiple diagnostic and staging investigations to performing a single test that will provide both diagnostic and staging information. A number of teams within our study were able to introduce such pathways and demonstrate impressive reductions in diagnostic times and more prompt treatment. This together with more effective multidisciplinary team working may have led to the small increase in the active anti-cancer treatment rates seen within the intervention group. However an alternative explanation for the improvement is regression to the mean given that treatment rates in the intervention group were lower at baseline and overall the lack of significant improvement across the range of NLCA indicators in the intervention group was disappointing. One possible explanation for this is the challenge that some participating teams encountered converting enthusiastic quality improvement plans into tangible improvements for patients over a relatively short time period. The qualitative evaluation confirmed that participants often underestimated the time and energy required to implement and sustain change and highlighted the importance of early engagement with hospital managers to maintain momentum (Aveling et al 2012). Alternatively other national lung cancer initiatives implemented at the time of the study may have driven coexistent improvements in the control group. For example the drive to encourage all lung cancer patients to be referred for clinical nurse specialist support has subsequently been shown to increase the probability that a lung cancer patient receives active treatment. Although even small improvements in lung cancer treatment rates are very welcome it is recognised that undergoing investigation for suspected lung cancer generates high levels of patient anxiety and many patients will remain too unwell to benefit from currently available drugs. The assessment of patient experience is therefore of particular importance in lung cancer. This has proved challenging in detailed national cancer surveys owing to the advance in age poor health and short median survival of lung cancer patients. The response rate to our short questionnaire was relatively high at 4149% compared with the 2011 national survey in which only 7% of lung cancer patients responded (Department of Health 2012) but still represents the views of less than half of lung cancer patients and is a relative limitation in terms of generalisability of the results. It was reassuring to note that at entry to the study patients in the intervention group generally rated their experience as highly satisfactory. This may explain the low number of teams who specifically identified patient experience as an area for quality improvement. In terms of assessing the impact of the reciprocal peer-to-peer review visits and supported quality improvement on patient experience it is likely that this high-baseline satisfaction and the lack of patient experience data for the control group limited our ability to detect a significant change. However our results suggest that those teams with poor scores may be able to use patient experience data to promote significant improvements particularly in areas such as communication skills. Further work is required to develop a lung cancer patient experience measure that is both acceptable to patients and able to detect small but clinically important changes in experience. Although similar in name to the national cancer peer review process there are a number of important differences between the reciprocal peer-to-peer review and supported quality improvement process employed in the current study and national cancer peer review. The latter predominantly performs a quality assurance role ensuring that cancer teams meet a minimum standard via compliance with a number of process measures. Support with quality improvement is not provided and site visits are now rarely performed. The qualitative evaluation of our study highlighted the importance of an independent quality improvement facilitator to the success of the peer review visits and the subsequent implementation of the quality improvement plans. Integration of facilitated reciprocal peer-to-peer review and supported quality improvement into national cancer peer review both for lung cancer and other tumour sites is an attractive proposition and requires further study. However our results suggest that this strategy alone is unlikely to have a major impact on lung cancer treatment rates. This phenomenon is not new in lung cancer for example the introduction and NICE approval of gefitinib treatment for the first-line treatment of lung cancer in 2010 was associated with only a 1% increase in active anti-cancer treatment rates over the following year (Health and Social Care Information Centre 2012). Achieving a stepwise increase in lung cancer treatment rates and survival is likely to require a multi-targeted approach including earlier diagnosis streamlined lung cancer pathways new treatments and a reduction in unexplained variation via supported quality improvement programmes. This project was funded by a Health Foundation Closing the Gap award. (grant number: 7797/5557). Appendix I Improving lung cancer outcomes project: patient experience questionnaireWhat is this survey about? This questionnaire asks about your experience of lung cancer treatment and care at the hospital. It was developed in 2010 and it has been used by Lung Cancer Nurse Specialists in 30 hospital across participating in the Improving Lung Cancer Outcomes Project' led by the Royal College of Physicians and several other organisations. The project aims to improve the quality of services and care for people affected by lung cancer. Why should I complete the survey? We need to know your opinion of the current services and care to help improve these for people affected by lung cancer. Your participation in this survey is voluntary and your answers will be treated in confidence. If you choose not to take part in this survey it will not affect the care you receive from the NHS in any way. Please do not write your name and address anywhere on the questionnaire as this information is not required. No information you give in this questionnaire will be shared in a way that allows you to be identified. How to complete the survey and how long it will take. The questionnaire is short and will take 510?min to complete. Please try to answer every question. Please return your questionnaire even if you have not answered every question. If English is not your first language or if you if you have difficulty understanding the questions then please ask a relative or carer to help you complete the questionnaire. Questions or help? If you have any questions please contact your local lung clinical nurse specialist team. Please select one answer to each question by placing a in the appropriate box. There is space at the end of the survey for you to write any comments. This work is published under the standard license to publish agreement. After 12 months the work will become freely available and the license terms will switch to a Creative Commons Attribution-NonCommercial-Share Alike 3.0 Unported License. Abdel-Rahman M Stockton D Rachet B Hakulinen T Coleman MP 2009 What if cancer survival in Britain were the same as in Europe: how many deaths are avoidable Br J Cancer 101 (Suppl 2 S115 S124 19956155 Aveling EL Martin G Jiménez GarcÃa S Martin L Herbert G Armstrong N Dixon-Woods M Woolhouse I 2012 Reciprocal peer review for quality improvement: an ethnographic case study of the Improving Lung Cancer Outcomes Project BMJ Qual Saf 21 1034 1041 Beckett P Woolhouse I Stanley R Peake MD 2012 Exploring variations in lung cancer care across the UK-the story so far' for the National Lung Cancer Audit Clin Med 12 14 18 22372213 Department of Health2012National Cancer Patients' Experience Survey Programme 2012/13. England. Health And Social Care Information Centre2012National Lung Cancer Audit Report. Institute for Healthcare Improvement2003The Breakthrough Series: IHI's Collaborative Model for Achieving Breakthrough Improvement. Boston. Khakwani A Rich AL Powell HA Tata LJ Stanley RA Baldwin DR Duffy JP Hubbard RB 2013 Lung cancer survival in England: trends in non-small-cell lung cancer survival over the duration of the National Lung Cancer Audit Br J Cancer 109 (8 2058 2065 24052044 Kwon S Florence M Grigas P Horton M Horvath K Johnson M Jurkovich G Klamp W Peterson K Quigley T Raum W Rogers T Thirlby R Farrokhi E Flum D 2012 Creating a learning healthcare system in surgery: Washington State's Surgical Care and Outcomes Assessment Program (SCOAP) at 5 years Surgery 151 146 152 22129638 National Institute for Health and Care Excellence 2011 The Diagnosis And Treatment Of Lung Cancer (Update Of Nice Clinical Guideline 24) Clinical guidelines CG121 London UK Pronovost P Needham D Berenholtz S Sinopoli D Chu H Cosgrove S Sexton B Hyzy R Welsh R Roth G Bander J Kepros J Goeschel C 2006 An intervention to decrease catheter-related bloodstream infections in the ICU N Engl J Med 355 2725 2732 17192537 Roberts CM Stone RA Buckingham RJ Pursey NA Lowe D Potter JM 2012 A randomized trial of peer review: the UK National Chronic Obstructive Pulmonary Disease Resources and Outcomes Project: three-year evaluation J Eval Clin Pract 18 (3 599 605 21332611 Walters S Maringe C Coleman MP Peake MD Butler J Young N Bergström S Hanna L Jakobsen E Kölbeck K Sundstrøm S Engholm G Gavin A Gjerstorff ML Hatcher J Johannesen TB Linklater KM McGahan CE Steward J Tracey E Turner D Richards MA Rachet B ICBP Module 1 Working Group 2013 Lung cancer survival and stage at diagnosis in Australia Canada Denmark Norway Sweden and the UK: a population-based study 2004-2007 Thorax 68 551 564 23399908 Wise J 2010 Health atlas shows large variations in care in England BMJ 341 c6809 c6809 Figure 1 Study timelines. Figure 2 Consort diagram disposal of eligible trusts including screening randomisation and follow-up. Figure 3 Run chart showing the waiting times from the multidisciplinary team meeting to the first treatment for 10 consecutive small-cell lung cancer patients following the implementation of the quality improvement plan at one trust in the intervention group. Figure 4 Mean change in national lung cancer audit metrics from baseline (2009) to 2011. P=0.055 active treatmentintervention vs controls. Intervention n=31 trusts control n=47 trusts and non-intervention (control and non-participants combined) n=66 trusts. Abbreviations: CNS clinical nurse specialist; MDT multidisciplinary team; SCLC small-cell lung cancer. Figure 5 Total patient questionnaire scores by the multidisciplinary team in the intervention group at baseline (pre) and at the end of the study (post). A low score indicates better experience. Each symbol represents the mean score for each trust in the intervention group. The maximum possible score for the questionnaire is 11. Table 1 Quality improvement plan themes Quality improvement plan theme Number of plans Multidisciplinary team effectiveness 31 Diagnostic pathways 13 Treatment pathways 9 Access to clinical nurse specialists 8 Clinical trial recruitment 4 Patient experience 2 Table 2 Baseline (2009) national lung cancer audit indicators Control ( n =47) Intervention ( n =31) Excluded ( n =67) P -value Mean (%) s.e.m. Mean (%) s.e.m. Mean (%) s.e.m. Control vs intervention vs non-participant control vs intervention Case ascertainment 158.1 38.6 122.0 7.2 107.4 3.6 0.220 0.455 Discussed at the MDT meeting 95.2 0.7 93.7 1.7 90.9 1.9 0.155 0.370 Histological confirmation rate 75.7 1.2 76.4 1.8 78.4 1.6 0.409 0.739 Active treatment 59.5 1.2 55.9 2.2 59.5 1.5 0.305 0.131 Surgery (all cases) 13.4 0.6 13.0 0.8 14.2 0.7 0.469 0.648 SCLC (chemo) 65.1 2.2 66.5 3.9 63.3 2.7 0.746 0.733 Seen by CNS 70.3 3.8 76.6 3.2 58.3 4.2 0.007 0.243 CNS present diagnosis 44.0 3.8 49.4 5.4 38.7 3.8 0.237 0.403 Abbreviations: CNS=clinical nurse specialist; MDT=mulitdisciplinary team; SCLC=small-cell lung cancer. Data are shown as mean and s.e. proportion of patients. BMC Cancer BMC Cancer BMC Cancer 1471-2407 BioMed Central 24386906 3893473 1471-2407-14-3 10.1186/1471-2407-14-3 Study Protocol Study protocol of a randomized controlled trial comparing Mindfulness-Based Stress Reduction with treatment as usual in reducing psychological distress in patients with lung cancer and their partners: the MILON study Schellekens Melanie PJ 1 Melanie.Schellekens@radboudumc.nl van den Hurk Desiree GM 2 Desiree.vandenHurk@radboudumc.nl Prins Judith B 3 Judith.Prins@radboudumc.nl Molema Johan 2 Johan.Molema@radboudumc.nl Donders A Rogier T 4 Rogier.Donders@radboudumc.nl Woertman Willem H 4 Willem.Woertman@radboudumc.nl van der Drift Miep A 2 Miep.vanderDrift@radboudumc.nl Speckens Anne EM 1 Anne.Speckens@radboudumc.nl 1Department of Psychiatry Radboud University Nijmegen Medical Centre Nijmegen The Netherlands 2Department of Pulmonary Diseases Radboud University Nijmegen Medical Centre Nijmegen The Netherlands 3Department of Medical Psychology Radboud University Nijmegen Medical Centre Nijmegen The Netherlands 4Department of Epidemiology Biostatistics and Health Technology Assessment Radboud University Nijmegen Medical Centre Nijmegen The Netherlands 2014 3 1 2014 14 3 3 28 6 2013 19 12 2013 Copyright © 2014 Schellekens et al.; licensee BioMed Central Ltd. 2014 Schellekens et al.; licensee BioMed Central Ltd. This is an open access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0) which permits unrestricted use distribution and reproduction in any medium provided the original work is properly cited. Background Lung cancer is the leading cause of cancer death worldwide and characterized by a poor prognosis. It has a major impact on the psychological wellbeing of patients and their partners. Recently it has been shown that Mindfulness-Based Stress Reduction (MBSR) is effective in reducing anxiety and depressive symptoms in cancer patients. The generalization of these results is limited since most participants were female patients with breast cancer. Moreover only one study examined the effectiveness of MBSR in partners of cancer patients. Therefore in the present trial we study the effectiveness of MBSR versus treatment as usual (TAU) in patients with lung cancer and their partners. Methods/Design A parallel group randomized controlled trial is conducted to compare MBSR with TAU. Lung cancer patients who have received or are still under treatment and their partners are recruited. Assessments will take place at baseline post intervention and at three-month follow-up. The primary outcome is psychological distress (i.e. anxiety and depressive symptoms). Secondary outcomes are quality of life (only for patients) caregiver appraisal (only for partners) relationship quality and spirituality. In addition cost-effectiveness ratio (only in patients) and several process variables are assessed. Discussion This trial will provide information about the clinical and cost-effectiveness of MBSR compared to TAU in patients with lung cancer and their partners. Trial registration ClinicalTrials.gov NCT01494883. Mindfulness-based stress reduction Lung cancer patients Partners Psychological distress Randomized controlled trial Background With an estimated 1.4 million deaths per year lung cancer is the leading cause of death by cancer worldwide. Even with the best available treatment five-year survival is merely 16% and about 60 to 70% of patients die within the first year after diagnosis [1]. This poor prognosis is often caused by a late diagnosis as the presentation usually occurs when the lung cancer is advanced. Patients may develop burdensome symptoms like pain dyspnoea fatigue and cough and they may undergo radical treatment including surgery chemo- and radiotherapy. Not surprisingly lung cancer has a major impact on the psychological wellbeing of patients and their family. Akechi and colleagues [2] showed that 19% of patients with advanced lung cancer meets the criteria of psychiatric disorders especially depressive and adjustment disorders. Of patients who had been successfully treated for lung cancer 15% met the criteria for a minor or major depressive disorder [3]. The prevalence rate of depressive and anxiety symptoms among lung cancer patients ranges from 20 to 47% [4-7]. Compared to patients with other cancer diagnoses lung cancer patients report the highest rates of distress (43 to 58%) [89] resulting in a lower quality of life [10]. Family friends and especially partners of patients with lung cancer also have to deal with its psychological impact [11-14]. Partners not only provide emotional and practical support they also have to cope with their own concerns including the uncertainty regarding the course of the illness and the fear of losing their partner [15]. More than 50% of partners of lung cancer patients report negative emotional effects of caregiving [16]. Around 40% of partners of patients with advanced lung cancer report high levels of distress [17]. The relationship between patient and partner can also be affected by the cancer. It has been shown that some partners report a lower quality of their relationship after the diagnosis of lung cancer [18]. Though numerous studies examined the psychological distress of lung cancer patients and their partners [2-22] not much research is done on how to alleviate distress in these groups [23]. In addition the available studies on managing the psychosocial care needs of cancer patients and their families have focused on care at the very end of life (e.g. [24-26]). Recently studies have demonstrated that palliative care initiated early in treatment improves the quality of life and depressive symptoms of lung cancer patients [1027]. This stresses the importance of integrating psychosocial care for lung cancer patients and their partners early in the treatment rather than instigating it once life-prolonging therapies fail. In the past ten years MBSR has become a promising psychosocial intervention for cancer patients. Mindfulness is defined as intentionally paying attention to moment-by-moment experiences in a non-judgmental way [28]. MBSR is an 8-week group-based training consisting of meditation practices such as the bodyscan gentle yoga sitting and walking meditation. By repeatedly bringing attention back to the current experience participants gradually learn to disengage from dysfunctional thoughts and directly experience the emotions and bodily sensations of the present moment. MBSR aims to provide participants with the ability to step back from ruminating about the past or worrying about the future and simply allow experiences to unfold [2829]. A recent meta-analysis [30] of 13 nonrandomized studies and 9 randomized controlled trials (RCT) concluded there is positive evidence for the use of mindfulness-based interventions in reducing psychological distress in cancer patients. Among the RCTs a reduction in symptom severity was found for both anxiety and depression corresponding to moderate pooled controlled effect sizes (Hedgess g = 0.37 and Hedgess g = 0.44 respectively) [30]. Though mindfulness-based interventions seem to be effective the authors note that across studies the majority of participants were women (85%) and diagnosed with breast cancer (77%). Compared to breast cancer patients patients with lung cancer are more often male older and have a poorer prognosis. Furthermore of these 22 studies only one study included the partners of the patients showing that partners also benefit from the MBSR training [31]. This is quite surprising since partners of cancer patients also report high levels of distress [32]. Aims The aim of the Mindfulness for Lung Oncology Nijmegen (MILON) study is to examine the effectiveness of MBSR compared to TAU in reducing psychological distress in patients with lung cancer and their partners. We hypothesize that patients in the MBSR group will report a lower level of psychological distress (i.e. anxiety and depressive symptoms) higher levels of quality of life quality of relationship and spirituality than those in the TAU group. Medical and societal costs will be lower in the MBSR versus TAU group. We expect partners in the MBSR group to report a lower level of psychological distress and higher levels of caregiver appraisal relationship quality and spirituality than their counterparts in the TAU group. With regard to the working mechanisms of the MBSR programme we will examine changes in mindfulness skills self-compassion rumination intrusion avoidance and adherence to MBSR. Methods/Design Study design The design of the MILON study is a parallel group randomized controlled trial with an embedded process study. Participants are randomized between MBSR and TAU. The study protocol has been approved by our ethical review board (CMO Arnhem-Nijmegen) and registered under number 2011519. Participants and procedure Patients and partners are recruited at the outpatient clinic of the Department of Pulmonary Diseases Radboud University Nijmegen Medical Centre (RUNMC) by a nurse practitioner and the attending physician. Patients and partners are invited to participate together but both are welcome to participate on their own if they do not have a partner or their partner is not willing to participate. Patients and/or partners who are interested are provided with an information leaflet. If they are willing to participate they are invited for a research interview in which in- and exclusion criteria are assessed and informed consent is taken. At other participating hospitals (Department of Pulmonary Diseases Canisius-Wilhelmina Hospital Nijmegen; Department of Pulmonary Medicine Rijnstate Arnhem; Department of Oncology Elkerliek Hospital Helmond; Department of Pulmonary Medicine Jeroen Bosch Hospital; Department of Pulmonary Diseases Maas hospital Pantein Boxmeer) patients and their partners will be sent a letter with the invitation to participate in the study. One week later the researcher calls the patients to answer possible questions and asks whether the patient and partner are interested in participation. If so they are invited for a research interview at the RUNMC. Eligibility We include patients and/or partners of patients who are (a) diagnosed with cytologically or histologically proven non-small cell lung cancer or small cell lung cancer and (b) have received or are still under treatment. Exclusion criteria for both patient and partner include: (a) being under 18 years of age (b) not being able to understand or use the Dutch language (c) former participation in MBSR or Mindfulness-Based Cognitive Therapy (MBCT) (d) current and regular treatment by psychologist or psychiatrist (e) current participation in other psychosocial programme and (f) physical or cognitive (<26 on the Mini-Mental State Examination (MMSE)) impairments hampering participation in MBSR training or completion of questionnaires. Baseline Patients and partners are interviewed to obtain demographics and clinical characteristics after which they are screened for cognitive impairments with the MMSE [33]. After that baseline questionnaires including the Distress Thermometer (DT) [3435] are administered followed by randomization. Table 1 shows the assessment instruments and time points at which the questionnaires are administered to patients and partners. Table 1 Measurements and corresponding time points for patient and partner Measure Target T0 T1 T2 pt pr pt pr pt pr MMSE Cognitive impairments x x DT General distress x x HADS Psychological distress x x x x x x QLQ-C30 Quality of life x x x QLQ-LC13 Quality of life x x x SIP Impact of sickness x x x SPPIC Caregiver burden x x x CRA-SE Caregiver self-esteem x x x IMS-S Relationship satisfaction x x x x x x MIS Communication about cancer x x x x x x SAIL Spirituality x x x x x x FFMQ Mindfulness skills x x x x x x SCS Self-compassion x x x x x x RRS-EXT Rumination x x x x x x IES Psychological stress reaction x x x x x x Diary Health care use work absence Monthly during study period for pt Calendar Mindfulness adherence Monthly during study period for pt and pr Note. T0 = Baseline measurement; T1 = Post-intervention measurement; T2= 3-month follow-up measurement; pt = Patient; pr = Partner; MMSE = Mini Mental State Examination; DT = Distress Thermometer; HADS = Hospital Anxiety and Depression Scale; QLQ-C30 = Quality of Life Cancer; QLQ-LC13 = Quality of Life Lung Cancer; SIP = Sickness Impact Profile; SPPIC = Self-Perceived Pressure from Informal Care; CRA-SE = Caregiver Reaction Assessment Care-Derived Self-Esteem; IMS-S = Investment Model Scale-Satisfaction; MIS = Mutuality and Interpersonal Sensitivity; SAIL = Spiritual Attitude and Involvement List; FFMQ = Five Facet Mindfulness Questionnaire; SCS = Self-Compassion Scale; RRS-EXT = Rumination Response Scale Extended Version; IES = Impact of Event Scale. Randomization Randomization is stratified according to setting and minimized for (a) stage of disease (curative versus palliative) (b) baseline level of anxiety and depressive symptoms (anxiety or depression subscale score of Hospital Anxiety and Depression Scale (HADS) <8 versus ?8) (c) treatment during MBSR (no treatment versus chemo- and/or radiotherapy) and (d) participation (patient alone versus partner alone versus patient and partner together). Randomization is computerized using a randomization website specifically designed for this study on which the researcher can fill out the required data. The researcher communicates treatment allocation to the nurse practitioner who informs the patient and/or partner. Follow-up assessments Follow-up assessments take place post intervention and at three-month follow-up. Participants who have access to the internet and have an email address receive the questionnaires online. If not they receive the questionnaires on paper along with a reply envelope. In case of drop-out the researcher tries to contact the participant by phone to complete a minimum set of outcome measures and to identify the main reason for drop-out. Intervention The MBSR curriculum used is primarily based on the Mindfulness-Based Stress Reduction programme as developed by Kabat-Zinn [28] but contains some elements of the MBCT programme by Segal Williams and Teasdale [29] like psycho-education on the interrelatedness of feelings and thoughts. Moreover some modifications have been made to make the intervention more suitable for patients with lung cancer and their partners such as psycho-education about grief [36]. In addition a mindful communication exercise in which partners talk with each other about the cancer was added. The programme consists of 8 weekly 2.5-hour sessions a silent day between session six and seven and home practice assignments of about 45 minutes 6 days per week. Participants receive a set of CDs with guided mindfulness meditation exercises for home practice and a folder with information and home practice instructions for the forthcoming week. Table 2 shows the content of the MBSR programme per session. The MBSR courses are taught by mindfulness teachers with extensive training in MBSR. They all fulfil the advanced criteria of the Center for Mindfulness of the University of Massachusetts Medical School [37] and maintain a regular personal meditation practice. Teachers were trained supervised and assessed to ensure their competency levels met the qualification criteria to instruct the MBSR classes. During the trial teachers will receive weekly supervision and a number of sessions will be videotaped to evaluate competence and adherence with the Mindfulness-Based Interventions Teaching Assessment Criteria [38]. Table 2 Content of MBSR programme per session Theme of session Meditation exercise Didactic teaching Homework 1. Automatic pilot - Bodyscan - Intention of participating - Bodyscan - Raisin exercise - Eating one meal mindfully - Attention for routine activity 2. Mindfulness of the breath - Bodyscan - Imagery exercise to demonstrate relationship between thoughtsand feelings - Bodyscan - Sitting" | Lung_Cancer |
"contributed to collection of the data. NI: contributed to interpretation of the study data. SI: contributed to interpretation of the radiological data. KW: contributed to the development of the analytic concept data analyses. KI: contributed to interpretation of the study data. KY: contributed to critical revision of the manuscript. All authors read and approved the final manuscript. Pre-publication history The pre-publication history for this paper can be accessed here: http://www.biomedcentral.com/1471-2466/14/14/prepub Acknowledgements This work is partially supported by Aichi Health Promotion Foundation and Grant-in-Aid. We thank an experienced medical editor in NAI Inc. for English check and revision. Mathers CD Loncar D Projections of global mortality and burden of disease from 2002 to 2030 PLoS Med 2006 3 11 e442 17132052 Mannino DM Buist AS Global burden of COPD: risk factors prevalence and future trends Lancet 2007 370 9589 765 773 17765526 Sekine Y Behnia M Fujisawa T Impact of COPD on pulmonary complications and on long-term survival of patients undergoing surgery for NSCLC Lung Cancer 2002 37 1 95 101 12057873 Lopez-Encuentra A Astudillo J Cerezal J Gonzalez-Aragoneses F Novoa N Sanchez-Palencia A Prognostic value of chronic obstructive pulmonary disease in 2994 cases of lung cancer Eur J Cardiothorac Surg 2005 27 1 8 13 15736303 Turner MC Chen Y Krewski D Calle EE Thun MJ Chronic obstructive pulmonary disease is associated with lung cancer mortality in a prospective study of never smokers Am J Respir Crit Care Med 2007 176 3 285 290 17478615 Raviv S Hawkins KA DeCamp MM Jr Kalhan R Lung cancer in chronic obstructive pulmonary disease: enhancing surgical options and outcomes Am J Respir Crit Care Med 2011 183 9 1138 1146 21177883 Fabbri LM Luppi F Beghe B Rabe KF Complex chronic comorbidities of COPD Eur Respir J 2008 31 1 204 212 18166598 Brunelli A Charloux A Bolliger CT Rocco G Sculier JP Varela G Licker M Ferguson MK Faivre-Finn C Huber RM ERS/ESTS clinical guidelines on fitness for radical therapy in lung cancer patients (surgery and chemo-radiotherapy) Eur Respir J 2009 34 1 17 41 19567600 Loganathan RS Stover DE Shi W Venkatraman E Prevalence of COPD in women compared to men around the time of diagnosis of primary lung cancer Chest 2006 129 5 1305 1312 16685023 Young RP Hopkins RJ Christmas T Black PN Metcalf P Gamble GD COPD prevalence is increased in lung cancer independent of age sex and smoking history Eur Respir J 2009 34 2 380 386 19196816 Mitsudomi T Kosaka T Endoh H Horio Y Hida T Mori S Hatooka S Shinoda M Takahashi T Yatabe Y Mutations of the epidermal growth factor receptor gene predict prolonged survival after gefitinib treatment in patients with non-small-cell lung cancer with postoperative recurrence J Clin Oncol 2005 23 11 2513 2520 15738541 Matsuo K Ito H Yatabe Y Hiraki A Hirose K Wakai K Kosaka T Suzuki T Tajima K Mitsudomi T Risk factors differ for non-small-cell lung cancers with and without EGFR mutation: assessment of smoking and sex by a case-control study in Japanese Cancer Sci 2007 98 1 96 101 17054433 Zhang J Zhou JB Lin XF Wang Q Bai CX Hong QY Prevalence of undiagnosed and undertreated chronic obstructive pulmonary disease in lung cancer population Respirology 2013 18 2 297 302 23051099 Matsuo M Hashimoto N Usami N Imaizumi K Wakai K Kawabe T Yokoi K Hasegawa Y Inspiratory capacity as a preoperative assessment of patients undergoing thoracic surgery Interact Cardiovasc Thorac Surg 2012 14 5 560 564 22307392 Pellegrino R Viegi G Brusasco V Crapo RO Burgos F Casaburi R Coates A van der Grinten CP Gustafsson P Hankinson J Interpretative strategies for lung function tests Eur Respir J 2005 26 5 948 968 16264058 Rabe KF Hurd S Anzueto A Barnes PJ Buist SA Calverley P Fukuchi Y Jenkins C Rodriguez-Roisin R Van Weel C Global strategy for the diagnosis management and prevention of chronic obstructive pulmonary disease: GOLD executive summary Am J Respir Crit Care Med 2007 176 6 532 555 17507545 Detterbeck FC Boffa DJ Tanoue LT The new lung cancer staging system Chest 2009 136 1 260 271 19584208 Maeda R Yoshida J Ishii G Hishida T Nishimura M Nagai K The prognostic impact of cigarette smoking on patients with non-small cell lung cancer J Thorac Oncol 2011 6 4 735 742 21258254 Rudin CM Avila-Tang E Harris CC Herman JG Hirsch FR Pao W Schwartz AG Vahakangas KH Samet JM Lung cancer in never smokers: molecular profiles and therapeutic implications Clin Cancer Res 2009 15 18 5646 5661 19755392 Matsuda A Matsuda T Shibata A Katanoda K Sobue T Nishimoto H Cancer incidence and incidence rates in Japan in 2007: a study of 21 population-based cancer registries for the monitoring of cancer incidence in Japan (MCIJ) project Jpn J Clin Oncol 2013 43 3 328 336 23296772 Society AC Cancer facts and figures 2013 2013 http://www.cancer./Research/CancerFactsFigures/CancerFactsFigures/2013-cancer-facts-and-figures.pdf Haiman CA Stram DO Wilkens LR Pike MC Kolonel LN Henderson BE Le Marchand L Ethnic and racial differences in the smoking-related risk of lung cancer N Engl J Med 2006 354 4 333 342 16436765 de Torres JP Marin JM Casanova C Cote C Carrizo S Cordoba-Lanus E Baz-Davila R Zulueta JJ Aguirre-Jaime A Saetta M Lung cancer in patients with chronic obstructive pulmonary disease incidence and predicting factors Am J Respir Crit Care Med 2011 184 8 913 919 21799072 Okada M Nishio W Sakamoto T Harada H Uchino K Tsubota N Long-term survival and prognostic factors of five-year survivors with complete resection of non-small cell lung carcinoma J Thorac Cardiovasc Surg 2003 126 2 558 562 12928658 Colice GL Shafazand S Griffin JP Keenan R Bolliger CT Physiologic evaluation of the patient with lung cancer being considered for resectional surgery: ACCP evidenced-based clinical practice guidelines (2nd edition) Chest 2007 132 3 Suppl 161S 177S 17873167 Baldwin DR White B Schmidt-Hansen M Champion AR Melder AM Diagnosis and treatment of lung cancer: summary of updated NICE guidance Bmj 2011 342 d2110 21525094 Fukuchi Y Nishimura M Ichinose M Adachi M Nagai A Kuriyama T Takahashi K Nishimura K Ishioka S Aizawa H COPD in Japan: the Nippon COPD epidemiology study Respirology 2004 9 4 458 465 15612956 Tashkin DP Celli B Decramer M Liu D Burkhart D Cassino C Kesten S Bronchodilator responsiveness in patients with COPD Eur Respir J 2008 31 4 742 750 18256071 Kobayashi S Suzuki S Niikawa H Sugawara T Yanai M Preoperative use of inhaled tiotropium in lung cancer patients with untreated COPD Respirology 2009 14 5 675 679 19476597 Bolukbas S Eberlein M Eckhoff J Schirren J Short-term effects of inhalative tiotropium/formoterol/budenoside versus tiotropium/formoterol in patients with newly diagnosed chronic obstructive pulmonary disease requiring surgery for lung cancer: a prospective randomized trial Eur J Cardiothorac Surg 2011 39 6 995 1000 20970351 Radiat Oncol Radiat Oncol Radiation Oncology (London England) 1748-717X BioMed Central 24456714 3946177 1748-717X-9-32 10.1186/1748-717X-9-32 Research Clinical outcome of postoperative highly conformal versus 3D conformal radiotherapy in patients with malignant pleural mesothelioma Krayenbuehl Jr´me 1 Jerome.krayenbuehlusz.ch Dimmerling Peter 1 peter.dimmerlingusz.ch Ciernik I Frank 2 3 ilja.ciernikklinikum-dessau.de Riesterer Oliver 1 oliver.riestererusz.ch 1Department of Radiation Oncology Zurich University Hospital Rmistrasse 100 8091 Zurich Switzerland 2Center for Clinical Research University of Zurich Zurich Switzerland 3Department of Radiotherapy and Radiation Oncology Dessau Municipal Hospital Dessau Germany 2014 24 1 2014 9 32 32 6 9 2013 3 1 2014 Copyright 2014 Krayenbuehl et al.; licensee BioMed Central Ltd. 2014 Krayenbuehl et al.; licensee BioMed Central Ltd. This is an Open Access distributed under the terms of the Creative Commons Attribution License (http://creativecommons./licenses/by/2.0) which permits unrestricted use distribution and reproduction in any medium provided the original work is properly cited. The Creative Commons Public Domain Dedication waiver (http://creativecommons./publicdomain/zero/1.0/) applies to the data made available in this unless otherwise stated. Background Radiotherapy (RT) is currently under investigation as part of a trimodality treatment of malignant pleural mesothelioma (MPM). The introduction of highly conformal radiotherapy (HCRT) technique improved dose delivery and target coverage in comparison to 3-dimensional conformal radiotherapy (3DCRT). The following study was undertaken to investigate the clinical outcome of both radiation techniques. Methods Thirty-nine MPM patients were treated with neoadjuvant chemotherapy extrapleural pneumonectomy (EPP) and adjuvant RT. Twenty-five patients were treated with 3DCRT and 14 with HCRT (Intensity modulated radiotherapy or volumetric modulated arc therapy). Overall survival disease free survival locoregional recurrence and pattern of recurrence were assessed. A matched pair analysis was performed including 11 patients of each group. Results After matching for gender age histology tumor stage and resection status HCRT seemed superior to 3DCRT with a local relapse rate of 27.3% compared to 72.7% after 3DCRT (p = 0.06). The median time to local relapse was increased by 49% with HCRT in comparison to 3DCRT from 10.9 ± 5.4 months to 16.2 ± 3.1 months (p = 0.06). The median overall survival was 22.3 ± 15.3 months for HCRT and 21.2 ± 9.2 months for 3DCRT (p = 0.57). Recurrence analysis showed that in-field local relapses occurred in previously underdosed regions of the tumor bed in 16% of patients treated with 3DCRT and in 0% of HCRT patients. Conclusions The use of HCRT increases the probability of local control as compared to 3DCRT by improving target volume coverage. HCRT did not improve overall survival in this patient series due to the high rate of distant recurrences. Mesothelioma Radiation therapy Extrapleural pneumonectomy Volumetric modulated arc therapy Intensity modulated radiotherapy Multimodal therapy Introduction Malignant pleural mesothelioma (MPM) is a rare and aggressive malignancy associated with poor prognosis. Although MPM is often initially confined to the hemithorax it has a high potential for metastatic spread in the course of disease [1]. The mainstay of treatment is surgery consisting of either pleurectomy/decortication (PD) or radical extrapleural pneumonectomy (EPP) in combination with cisplatin/pemetrexed and in selected cases postoperative radiotherapy [2-5]. The rationale to apply postoperative radiotherapy after EPP has been the high rate of local recurrence after EPP alone of about 40% [6]. The pattern of pleural dissemination infiltrative growth and the manipulations within the chest cavity during surgery place the entire ipsilateral chest wall at high risk for post-surgical relapse especially at the diaphragm insertion the pericardium mediastinum and bronchial stump. Technically hemithoracic radiotherapy is challenging due to various reasons. Firstly the size of the volume to be treated is large and may cover up to six liters. Secondly the target lies in close proximity to various ans at risk (OAR) such as the heart ipsilateral kidney liver remaining lung esophagus and/or spinal cord. Thirdly the thoracic cavity has a complex shape with its costodiaphragmatic recess extending around the liver and the kidney. Previous publications showed that highly conformal radiotherapy (HCRT) such as intensity modulated radiotherapy (IMRT) or volumetric modulated arc therapy (VMAT) can improve the dose distribution in respect to target coverage and dose to OAR [78]. However to our knowledge there is no clinical study published that investigated and compared clinical outcome after both radiation techniques. In order to verify if the technical improvements introduced with IMRT or VMAT have translated into a clinical benefit we evaluated the clinical outcome of MPM patients treated with chemotherapy surgery and 3DCRT or HCRT at our institution. Material and methods We reviewed the clinical outcome of 39 consecutive patients treated either with 3DCRT (25 patients) or HCRT (11 IMRT patients and 3 VMAT patients). Patient staging was established using FDG-PET/CT and/or conventional thoraco-abdominal CT. The patients with clinical stage T1-T3 N0-2 M0 R0-2 were treated with 3 cycles of preoperative chemotherapy (pemetrexed and cisplatin) followed by EPP and RT [7]. All histological subtypes were accepted for RT. Patients were not selected for this review if they had metastatic disease or a local relapse before the start of RT. The study was approved by the local ethics committee of the University Hospital of Zurich. Radiation techniques The 3DCRT group was treated between 1999 and 2005. These patients were treated with 25 1.8 Gy?=?45 Gy to the hemithorax and subsequently in a second series a boost of 7 1.8 Gy?=?12.6 Gy was given to the incompletely resected area (total dose 57.6 Gy). Dose calculation was performed on Pinnacle planning system (Philips Medical Systems) for a linear accelerator (Clinac 2100C Varian Medical Systems). Details of the treatment technique have previously been published [7]. HCRT has been used at our institution since 2005 for the treatment of MPM patients. Of the 14 patients treated with HCRT 11 were treated with conventional static field IMRT and 3 patients with rotational IMRT (volumetric arc radiotherapy i.e. Rapid Arc® in the present series). IMRT and VMAT plans achieved similar dose distributions [910]." | Lung_Cancer |
"However because data on the substantial prevalence of COPD and its severity in Asian lung cancer patients remain limited clinical impact of prevalence and severity of COPD among the population has not been fully evaluated. Furthermore patients with COPD often have comorbidities. Thus whether the decision-making process for therapeutic management of lung cancer patients might be independently affected by COPD remains elusive. Methods Clinical impact of prevalence and severity of COPD were evaluated in 270 Japanese patients with newly diagnosed lung cancer who were sequentially registered and underwent bronchoscopy from August 2010 to July 2012 at Nagoya University hospital. Furthermore to explore whether or not the severity of airflow obstruction might affect the decision to propose thoracic surgery with curative intent we evaluated data from patients with lung cancer at stage 1A to 3A who underwent spirometry and bronchoscopy. Results The prevalence rate of COPD was 54.4% among Japanese patients with lung cancer who underwent bronchoscopy. The incidence of Global Initiative for Chronic Obstructive Lung Disease (GOLD) grades 1 and 2 was significantly higher than that of GOLD grade 3. Although COPD-related comorbidities were not independent factors for proposing thoracic surgery the number of thoracic surgeries performed was significantly less in the COPD group than the non-COPD group. Multivariate analysis showed that more severe airway obstruction advanced clinical staging and higher age were independent factors associated with the decision on thoracic surgery. Conclusions We demonstrated a high prevalence of COPD among Japanese lung cancer patients. Based on the knowledge that severity of COPD is one of the most important factors in the therapeutic decision comprehensive assessment of COPD at bronchoscopy might allow us to implement the optimum management for lung cancer patients. Chronic obstructive lung disease Bronchoscopy Spirometry screening assessment Thoracic surgery Japanese population Background Chronic obstructive pulmonary disease (COPD) and lung cancer are projected to continue to increase the burden of disease worldwide until 2020 [12]. Many studies suggest that COPD might be independently related to a worse prognosis for lung cancer [3-6]. A recent review suggests more inclusive consideration for surgical resection with curative intent in lung cancer patients with COPD because limited surgical resections or nonsurgical therapeutic options might provide inferior survival compared with resection [6]. However because older patients with COPD are often known to have much lower pulmonary function as well as other comorbidities [78] whether or not the decision-making process for therapeutic management of lung cancer patients might be independently affected by the coexistence and severity of COPD remains elusive. Recent studies show that the prevalence of COPD is 40-70% of smokers diagnosed with lung cancer [910]. On the other hand many studies suggest that the increasing incidence of adenocarcinoma in Asian populations including the Japanese population might be associated with epidermal growth factor receptor (EGFR) mutation rather than with smoking [1112]. Zhang et al. show a low prevalence of COPD in hospitalized lung cancer patients in China (21.6%; 705/3263 cases) [13] whereas we recently demonstrated that the prevalence of COPD was more than 40% in Japanese patients undergoing thoracic surgery [14]. Because another therapeutic option besides surgery such as chemotherapy and/or radiation might be selected for the older lung cancer patients with COPD [8] substantial prevalence of COPD among Asian patients with newly diagnosed lung cancer might be higher than that in our study [14]. Thus data on the prevalence of COPD and its severity in Asian populations remain limited. Taken together clinical impact of prevalence and severity of COPD among Asian lung cancer patients should be determined. Bronchoscopy is performed for most patients with lung cancer before the decision is made for treatment of lung cancer. In the present study the association of COPD prevalence with lung cancer characteristics was evaluated by spirometry among 270 Japanese patients with lung cancer who underwent bronchoscopy. We also evaluated whether or not the prevalence and severity of COPD might independently affect the decision-making process for the treatment of lung cancer in this population. Methods Population Patients with lung cancer who underwent bronchoscopy at Nagoya University hospital from August 2010 to July 2012 were the subjects of this retrospective study. The study was approved by the Institutional Review Board of Nagoya University Graduate School of Medicine (No 27-2) [14]. Information about patient characteristics pathological diagnosis of lung cancers and clinical staging of lung cancers was obtained from hospital records as previously reported [14]. COPD-related systemic comorbidities were defined as diabetes hypertension hyperlipidemia or ischemic cardiac disease [7]. Spirometry screening assessment was performed on admission of the patients undergoing bronchoscopy. Spirometry was performed with a calibrated dry spirometer a FUDAC-77 (Fukuda Denshi Co. Ltd. Tokyo Japan) according to the American Thoracic Society (ATS) standards applied in our hospital [15]. Subjects were assigned to the COPD group if they had airflow obstruction as determined by an FEV1/FVC ratio was below 0.70 and the remaining subjects were assigned to the non-COPD group [910]. Reversibility for which an improvement of 200 ml in FEV1 and 12% in FEV1 from baseline was defined as positive was also evaluated 15 minutes after a short-acting beta2-agonist was given. Severity of airflow limitation in COPD was determined by using the Global Initiative for Chronic Obstructive Lung Disease (GOLD) grade [16]; that is grade 1 (%FEV1 predicted >80%) grade 2 (50%?<%FEV1 predicted <80%) grade 3 (30%?<%FEV1 predicted <50%) and grade 4 (%FEV1 predicted <30%). When the patients did not undergo spirometry as a screening assessment at a bronchoscopy data were collected from the preoperative pulmonary assessment for those undergoing thoracic surgery or from a spirometric assessment before the bronchoscopy. Information about the existence of emphysema from the chest computed tomography (CT) was obtained from radiological reports. Clinical staging of lung cancer was based on the tumor node metastasis (TNM) staging using the standards of the Union International Contre le Cancer (UICC) 7th edition [17]. Histological type of adenocarcinoma squamous cell carcinoma (Sq) large cell carcinoma (Large) small cell lung carcinoma (SCLC) and non-small cell lung carcinoma (NSCLC) was determined according to the World Health anizations classification [18]. We also collected information about the status of EGFR mutation in lung cancers from patient records. Statistical analysis All data were checked for completeness and the analyzed variables were tested for normality of distribution by the Shapiro-Wilk test. Normally distributed variables were compared by the t test and non-normally distributed ones by the Mann-Whitney test between the COPD and non-COPD group or between the surgery and the non-surgery group. Comparisons between the percentages of patients with each GOLD grade or tumor type were made using the ?2 test or with Fishers exact test. Factors that were found to be predictive for relinquishing surgery in the above-mentioned univariate analyses were entered into a forward-and-backward stepwise logistic regression analysis to identify independent factors for the relinquishment of surgery. Statistical analyses were performed with PASW Statistics version 18.0 (SPSS Inc Chicago IL) and a P value of less than 0.05 was considered statistically significant. Results Demographic distribution of patient characteristics among the study population Data from 320 patients with lung cancer who were sequentially registered and underwent bronchoscopy from August 2010 to July 2012 were obtained from hospital records (). Fifty patients who had not undergone pulmonary assessment by spirometry were subsequently excluded from the study population. In total 234 patients with lung cancers underwent spirometry screening assessment at bronchoscopy. A further 36 patients with lung cancers did not undergo spirometry at bronchoscopy but received it at thoracic surgery or before bronchoscopy. Ultimately the study population included 270 patients who underwent spirometry and bronchoscopy among 320 patients with lung cancer (84.4%) (). Study profile. Schematic diagram showing the study profile. In the present population 54.4% of the patients who underwent bronchoscopy had COPD (147/270 cases). Table 1 shows a comparison of the patient characteristics among the study groups. Only 8.5% of the total study population had been managed as COPD. Overall the 147 patients in the COPD group were older and more likely to be male and to have a more extensive smoking history as compared with the 123 patients in the non-COPD group. When we evaluated the severity of airflow obstruction in the COPD group the incidence of GOLD grade 1 and 2 was significantly higher than that of GOLD grade 3 (Figure 2 and Table 2)." | Lung_Cancer |
"The most stringent quality control for ESC lines is the ability of the chimeras to give germline transmission (GLT). Although strictly speaking not required for an approach in which chimeras serve as an endpoint we decided to maintain this quality control as a means to identify ESC clones with impaired germline-competence caused by loss of pluripotency or the acquisition of genetic defects during culture and manipulation. We observed efficient GLT for chimeras obtained from both the C57BL/6J and the FVB/n ESC clones regardless of the injection procedure (supplementary Table S1). Derivation of germline-competent ESCs from mouse models with complex genotypes Two GEMMs of human lung cancer were selected for the derivation of ESCs: the KrasLSL-G12D non small cell lung cancer (NSCLC) model and the Rb1F/F ;Trp53F/F small cell lung cancer (SCLC) model (Jackson et al 2001; Meuwissen et al 2003). These mice develop lung tumors after switching of the conditional alleles by a Cre recombinase introduced in the target cells via adenovirus (Ad5-Cre) intubation in the lung. ESCs were also derived from Nf2F/F ;Trp53F/F ;Cdkn2a*/* mice which carryin addition to conditional Nf2 and Trp53 allelesa homozygous mutation in Cdkn2a that results in loss of p16Ink4a expression but retention of the alternative reading frame protein p19Arf (Krimpenfort et al 2001). Nf2F/F ;Trp53F/F ;Cdkn2a*/* mice develop invasive mesotheliomas after intrathoracic Ad5-Cre injection due to loss of Nf2 and p53 in the mesothelial lining (Jongsma et al 2008). The NSCLC model was maintained on a C57BL/6J background whereas the SCLC and mesothelioma models were on a mixed FVB/n;129/Ola background. As expected the efficiency of ESC derivation was similar between genotypes and comparable to the two wild-type strains (). The gender of the derived ESC clones was determined by Y-chromosome specific PCR. We observed a strong bias towards male ESC clones () which was likely caused by reduced morphological appearance and growth of female ESC clones resulting in their discontinuation early in the derivation process. Only in cases where we decided to expand all clones e.g. wild-type FVB/n we obtained both male and female clones. At later passage these female ESC clones caught up and were indistinguishable from male ESC clones on basis of growth and morphology. However we restricted ourselves to male ESC clones as it has been reported that female lines derived from inbred strains often loose one of the two X chromosomes during expansion (Barakat & Gribnau 2010). Three Rb1F/F ;Trp53F/F ESC clones two Nf2F/F ;Trp53F/F ;Cdkn2a*/* clones and one KrasLSL-G12D clone were tested for their contribution to chimeras. All clones gave reasonable numbers of chimeric animals relative to the implanted embryos and as expected most of the chimeras were males (supplementary Table S1). Most chimeras were of high quality showing coat-color chimerism of more than 70% (Fig 2A and B supplementary Fig S2A) and efficient GLT in the first litter (supplementary Table S1). Validation of chimeras. AB Three Rb1F/F ;Trp53F/F ESC clones (A) and two Nf2F/F ;Trp53F/F ;Cdkn2a*/* ESC clones (B) were injected into C57BL/6N blastocysts and scored for their chimeric contribution. All ESC clones gave reasonable numbers of chimeric animals relative to the implanted embryos (supplementary Table S1) and as expected most of the chimeras were males as we exclusively used male ESC clones. male female n.d. CD Comparison between chimeric contribution estimated on basis of coat-color versus genetic chimerism tested in various tissues. Southern blot analysis was performed with a probe that distinguishes between a wild-type Trp53 allele or the floxed Trp53 allele reflecting the contribution by the host ESCs or cultured ESCs respectively (example in supplementary Fig S3). Controls are wild-type spleen (0% chimerism expected) and F1 offspring of chimeras (50% chimerism expected). (C) Genetic chimerism of Rb1F/F ;Trp53F/F chimeras with coat color chimerism ranging from 70 to 100% (average 84% n = 7). (D) Genetic chimerism of Nf2F/F ;Trp53F/F ;Cdkn2a*/* chimeras with coat color chimerism ranging from 85 to 100% (average 95% n = 4). E Survival curves of Rb1F/F ;Trp53F/F mice intratracheally injected with Ad5-Cre. Black line conventional mice; red line chimeras. F Survival curves of Nf2F/F ;Trp53F/F ;Cdkn2a*/* mice intrathoracically injected with Ad5-Cre. Black line: conventional mice; Red line: chimeras. G Typical example of a neuroendocrine carcinoma (Small Cell Lung Cancer) in the lung (left panel) and a metastatic lesion in the liver (right panel). H Typical example of a mesotheliomatous lesion in the thoracic cavity. Tumor cells are either spindle sarcomatoid cells (left panel) or vacuolated epithelioid cells (right panel). Contribution of derived ESCs to various ans of chimeric mice is extensive and allows for efficient tumor induction One of the key features of the GEMM-ESC approach is the ability to directly evaluate tumor phenotypes in chimeric mice bypassing the need for any breeding. The success of this approach depends on the contribution of cultured ESCs to the various tissues in the chimeric mice. To assess this we performed Southern blot analysis on genomic DNA extracted from multiple tissues of chimeric mice from two independent GEMMs. To determine the level of genetic chimerism we used a probe that distinguishes between a wild-type Trp53 allele and the floxed Trp53F2-10 allele (Jonkers et al 2001) reflecting the contribution by the host ESCs or cultured ESCs respectively (supplementary Fig S3). The contribution of the cultured ESCs was comparable for most ans with the exceptions of the lung and brain which consistently scored the lowest (Fig 2C and D). In general the percentage of coat-color chimerism was scored higher than the genetic chimerism. A potential limitation of the GEMM-ESC approach is that chimeric mice have a smaller target cell population for oncogenic transformation. To determine whether this influences tumor type latency and incidence a comparison was made between conventional mice and chimeras for the three GEMMs (Fig 2E and F and supplementary Fig S2B). For the SCLC and mesothelioma models the tumor type incidence and latency was identical between the conventional and the chimeric mice (Fig 2EH). All chimeric mice from the SCLC model developed lung neuroendocrine carcinomas resembling SCLC often with invasion to the mediastinum and metastases to the liver (Fig 2G). All chimeric mice from the mesothelioma model developed epithelioid sarcomatoid or biphasic mesotheliomas that were highly invasive into nearby tissues (Fig 2H). In the NSCLC model the incidence and tumor types in the chimeric mice was again identical to the incidence and tumor types observed in the original strain. All NSCLC chimeras developed multiple lesions in the lung ranging from adenomatous or bronchioalveolar hyperplasia to bronchioalveolar adenomas adenocarcinomas and papillary carcinomas (supplementary Fig S2B and C). Surprisingly the tumor latency was shorter for the NSCLC chimeras than for the conventional mice. It is possible that host-derived FVB/n cells in the lung create a tumor-permissive or pro-tumorigenic microenvironment. Alternatively as the NSCLC chimeric cohort was produced from a single ESC clone an unidentified genetic lesion might have been acquired during the re-derivation process that leads to accelerated tumor growth. Combined these data illustrate that tumor induction in chimeras is as efficient as in animals carrying the conditional lesions in all of their cells. The GEMM-ESC approach is therefore a very effective strategy to swiftly generate cohorts of mice for in vivo tumor studies. Targeting of GEMM-ESCs under 2i culture conditions is efficient but requires genetic and phenotypic quality control The second step in the GEMM-ESC approach involves targeting of GEMM-ESCs with a Flp-in module just after the 3?UTR of the Col1a1 locus (Beard et al 2006). This module named Col1a1-frt serves as a docking site for introduction of transgene-coding plasmids by Flp recombinase-mediated integration." | Lung_Cancer |
"In addition how differential TS genotypes may impact on the outcome of patients depending on their smoking status or with Epidermal Growth Factor Receptor (EGFR) activating mutations tumors is to be determined. Finally although the toxicity profile described in most patients receiving pemetrexed in combination or as a single agent is usually favorable there are several reported cases of fundamentally dermatological hematological and potentially serious renal toxicities even when the recommended vitamin prophylaxis guidelines have been followed [13-15]. Nonetheless the tumor TS levels or its polymorphisms in each patient could explain these cases of severe toxicity as it has been suggested in other neoplasms treated with other antifolate drugs [9]. The potential association between different TS genotypes and the toxicity experienced by a European population of patients with NSCLC receiving pemetrexed is also to be studied. Three different types of polymorphisms have been described in the TS gene. In the gene promoter there is a variable number of tandem repeats (VNTR) of 28 pb in the 5?- region. Thus cases of two or three repetitions of this tandem TS gene promoter enhancer region (TSER) have been described [16]. A second type of polymorphism consists in a change in a single nucleotide (G >?C) in one of the sequences of the repetition comprising a single nucleotide polymorphism (SNP) [16]. A third modality of polymorphisms consists in the deletion or insertion of 6 pair of bases (bp) in the 3?-UTR region (untranslated region) [16]. In summary the potential usefulness of TS genotype as an independent prognostic factor or predictor of response to pemetrexed-based regimens in a European NSCLC population has not been studied. Similarly no clear evidence is available about the potential correlation between the different TS genotypes and the toxicity experienced by those patients. Therefore we decided to investigate the three known polymorphisms of TS gene and their correlation with objective response rate (ORR) progression-free survival (PFS) and overall survival (OS) as well as toxicity in European patients with advanced NSCLC treated with pemetrexed-based regimens. Methods Patients and samples Overall 25 consecutive stage III-IV NSCLC patients treated at a single institution from which peripheral blood samples were available were analyzed. All of them received pemetrexed-based regimens in the first second or third line settings according to our institutional therapeutic protocols. After the informed consent was obtained from all patients 10 ml of peripheral blood samples were collected before the administration of the first cycle of a pemetrexed-containing regimen. Blood samples were stored at the Biobank of the University of Navarra and were processed following standard operating procedures approved by the Ethical and Scientific Committees. Tumor ORR to the treatment was assessed using computerized tomography (CT) scans every two pemetrexed-based chemotherapy cycles and categorized according to the Response Evaluation Criteria In Solid Tumors (RECIST) v1.1 as per institutional protocol. The toxicities recorded during pemetrexed-based treatment were graded according to the Common Terminology Criteria for Adverse Events (CTCAE) version 4.0. TS enhancer region genotyping analysis The genomic DNA was extracted from the peripheral leucocytes. The genotypes of the TSER (VNTR) and SNP were determined by polymerase chain reaction (PCR). The variable number tandem repeat (VNTR) of 28 bp polymorphism and the G???C SNP in the first and second repeat were analyzed. A DNA fragment was amplified using previously described PCR conditions and primers [17] and directly sequenced using an ABI PRISM 3100 Genetic Analyzer (Applied Biosystems Foster City CA USA). The forward primer 5?-CGTGGCTCCTGCGTTTCC-3? and the reverse primer 3?-GAGCCGGCCACAGGCAT-5? were used. A modification of conventional conditions was necessary. PCR was performed in a reaction mixture with dNTP: 0.35 ?l Buffer: 0.25 ?l MgCl2: 17.5 ?l Tap polymerase: 0.5 ?l H2O: 18 ?l primers 0.1?+?0.1 ?l DMSO: 1.25 ?l and DNA: 2 ?l. The cycling conditions were denaturation 95°C for 10 minutes and 30 cycles at 95°C for one minute then at 64°C for one minute and 72°C one minute and finally seven minutes at 72?ºC. Aliquots of amplified fragments were separated on a 3% agarose gel and the TS VNTR genotype was determined staining 2R (210 base pairs; bp) and 3R (238 bp) alleles. After that we performed a PCR-restriction fragment length polymorphisms (RFLP) by Hae III digestion. The mixture was PCR product: 10 ?l H2O: 7 ?l Buffer 2 ?l and Hae III: 1 ?l. After that we incubated the mixture at 37°C overnight. Aliquots of digested fragments were separated on 12% acrylamide gel and the SNP genotype was determined. The digestion of fragments showed the different genotypes 2RGC: 664746 44 and 7 bp 2RCC: 11346 44 and 7 bp 3RGGCC (3RG): 66474644 28 and 7 bp 3RGCC (3RC): 944746 44 and 7 bp. TS 3?UTR region genotyping analysis The 3?UTR polymorphisms were analyzed by Restriction Fragment Length Polymorphism (RFLP). A fragment containing the 6 bp deletion/insertion was amplified using the reverse primer 5?-CAGATAAGTGGCAGTACAGA-3?and the forward primer 3?-CAAATCTGAGGGAGCTGAGT-5? in 10 ul of reaction mixture with dNTP: 4 ?l Buffer: 5 ?l MgCl2: 4 ?l Tap polymerase: 0.5 ?l H2O: 26.5 ?l primers 4?+?4 ?l and DNA: 2 ?l. The cycling conditions were denaturation 95°C for 10 minutes and 35 cycles at 95°C for 30 minutes then at 57°C for 30 minutes and 72°C one minute and finally seven minutes at 72°C. The fragments were amplified on 2% agarose gel. Afterwards the products were digested with Dra I and the mixture of PCR product: 20 ?l BSA 10%: 0.5 ?l Buffer: 5 ?l H2O: 23.5 ?l and Dra I: 1 ?l. Posteriorly the product was incubated one hour at 37°C. The final digested product was separated in a 3% agarose gel. The different genotypes were deletion 6 bp/insertion 6 bp insertion 6 bp/insertion 6 bp and deletion 6 bp/deletion 6 bp. The expected fragment sizes by genotyping were deletion 6 bp/insertion 6 bp: 148142 88 and 60 bp insertion 6 bp/insertion 6 bp: 88 and 60 bp and deletion 6 bp/deletion 6 bp: 142 bp. We repeated the PCR three times to ensure final results. EGFR mutations analysis As per institutional protocol all patients with advanced NSCLC were tested for EGFR activating mutations before treatment initiation. In brief after having the samples fixed in alcohol and stained by Papanicolau stain DNA was extracted and amplified by PCR technique using EGFR gene exons 1819 20 and 21 specific primers. ABI PRISM® 310 Genetic Analyzer equipment was used for the analysis of the sequencing reactions with both forward and reverse primers. Statistical analysis Fishers exact test was used to investigate the correlation between each genotype and the response to the treatment and the toxicity presented. Kaplan-Meier curves and log-rank test or Tarone-Ware test when indicated were calculated to correlate each genotype with the survival outcomes (PFS and OS). For the subgroup analysis EGFR mutation status and smoking history were considered in order to analyze potential differences in clinical outcome measures (ORR PFS and OS). The SPSS 15.0 software (SPSS Inc. Chicago IL) was employed to perform the statistical analysis. Results Patients characteristics and treatment The clinical and pathological characteristics of the patients included are summarized in . In brief our cohort was mainly composed by males with a median age of 59 years and a past smoking history showing good performance status. Most of the patients showed adenocarcinoma histology (88%) and showed distant metastasis (M1) at onset (72%). Most of the patients received a pemetrexed-based regimen in first line (84%). After a median follow up of 21 months 80% of patients have already progressed and 52% of them have died due to disease progression (). Patients characteristics N pts % Gender ??Female 11 44 ??Male 14 56 Age ??<60 13 52 ??> r =60 12 48 ECOG ??0 9 36 ??1 15 60 ??2 1 4 Tobacco ??Current smoker 4 16 ??Never smoker 7 28 ??Former smoker 14 56 Histology ??Adenocarcinoma 22 88 ??Adenocarcinoma poorly differentiated 2 8 ??Adeno-squamous 1 4 T ??T1-2 12 48 ??T3-4 13 52 N ??N0 6 24 ??N+ 19 76 M ??M0 7 28 ??M1 18 72 Lung metastases ??Presence 7 28 ??Absence 18 72 Liver metastases ??Presence 2 8 ??Absence 23 92 Bone metastases ??Presence 10 40 ??Absence 15 60 Brain metastases ??Presence 8 32 ??Absence 17 68 EGFR ??Wild type 23 92 ??Mutant 1 4 ??Unknown 1 4 Line of treatment ??First/Induction (stage III) 2 8 ??First 21 84 ??Second 1 4 ??Third 1 4 Response ??Response 18 72 ??Progression?+?Stabilization 7 28 Maintenance ??No maintenance 18 72 ??Maintenance 7 28 Progression ??Not progressed 6 24 ??Progressed 19 76 Clinical status ??Alive 12 48 ??Dead 13 52 Eastern Cooperative Oncology Group (ECOG). Epidermal Growth Factor Receptor (EGFR). In addition in 8 out of the 18 subjects showing multiple brain metastases at onset conventional whole-brain radiotherapy (300 cGy) was administered between first and second chemotherapy cycles following our institutional treatment guidelines. Finally 4 out of the 7 patients showing no distant metastases at onset responded to the pemetrexed-based induction chemotherapy. As per institutional protocol all four subjects underwent a 3-D conformal radiotherapy program with concurrent chemotherapy as previously published [18]. Correlation between ORR to the treatment and polymorphisms We studied the potential correlation between the different polymorphisms observed and the response to the treatment obtained (Table 2). For this purpose any kind of radiological response (complete or partial response) was compared to no response to the treatment (disease stabilization or progression). The presence of 3R/3R polymorphism seemed to predict a higher ORR (100%) compared to the rest of the genotypes with a trend toward statistical significance (p =?0.055). In the subgroup analysis a significantly higher ORR to pemetrexed for wild-type EGFR patients showing a 3R/3R genotype (100%) compared to the 2R/2R (77.8%) 2R/3R (33.3%) and 3R/4R (0%) was observed (p =?0.017). Table 2 Overall response rate to the treatment and polymorphisms observed Global distribution of polymorphisms (Pol) Response N (%) Stabilization or progression N (%) p value VNTR 2R/2R 7 (77.8) 2 (22.2) 0.055 3R/3R 7 (100) 0 (0) 2R/3R 4 (50) 4 (50) 3R/4R 0 (0) 1 (100) Pol VNTR (Subanalysis by EGFR status; group of native EGFR-patients) 2R/2R 7 (77.8) 2 (22.2) 0.017 3R/3R 7 (100) 0 (0) 2R/3R 2 (33.3) 4 (66.7) 3R/4R 0 (0) 1 (100) Global distribution of SNP Absence 6 (85.7) 1 (14.3) 0.626 Presence 12 (66.7) 6 (33.3) Global distribution of polymorphisms in 3?-UTR +6/+6 10 (83.3) 2 (16.7) 0.234 +6/-6 6 (54.5) 5 (45.5) -6/-6 2 (100) 0 (0) Pol 3?-UTR (Subanalysis by smoking habit stratification; group of active and former smokers) +6/+6 8 (100) 0 (0) 0.085 +6/-6 4 (50) 4 (50) -6/-6 2 (100) 0 (0) No statistically significant differences were observed comparing the presence and the absence of a SNP G >?C as shown in Table 2. Overall a non-significant correlation between the different 3?-UTR polymorphisms and the ORR was observed. However the genotype +6/+6 seemed to predict a higher ORR among active/former smokers (A/FS) compared to +6/-6 (100% vs. 50%; p =?0.085). Correlation between PFS and polymorphisms Regarding TSER polymorphisms we found a trend toward statistical significance (p =?0.089) in the differences in PFS observed among the different genotypes in favor of the 3R/3R genotype (Figure 1A). Figure 1 Kaplan-Meier curves for progression-free survival (PFS) in months (mo) associated with the different TS polymorphisms. A: TSER genotypes. B: Presence or absence of SNP. C: 3´UTR genotypes. In the case of the absence or presence of a SNP at the third repetition (3R allele) we observed a non-significant increased PFS in the subgroup of patients showing an absence of SNP (Figure 1B). Finally no significant correlations regarding the 3?UTR genotypes and PFS were observed (Figure 1C). Correlation between OS and polymorphisms In this cohort we found a significant correlation between TSER polymorphisms and OS (Figure 2A). The median OS was not reached for 3R/3R genotype patients whereas 2R/3R genotype subjects showed a 70 m OS followed by 3R/4R and 2R/2R genotypes with a median OS of 15 m and 13 m respectively (p =?0.019) (Figure 2A). Figure 2 Kaplan-Meier curves for overall survival (OS) in months (mo) associated with the different TS polymorphisms. A: TSER genotypes. B: Presence or absence of SNP. C: 3´UTR genotypes. No significant differences in OS were observed with regards to the presence/absence of SNP (Figure 2B) or regarding the 3?-UTR polymorphisms (Figure 2C). Correlation between toxicity and polymorphisms The most frequent toxicity was grade (G)1 anemia (28%) and nausea (20%) and G2 leucopenia (40%). The most commom G3-4 toxicities were leucopenia (16%) asthenia (8%) anemia (4%) neutropenia (4%) and dyspnea (4%). Overall we found no significant correlations between the toxicity profiles experienced by the patients and the different TS genotypes (Table 3). Table 3 Correlation between grades of toxicity and different genotypes Global distribution polymorphisms (Pol) No toxicity Grade 1-2 Grade 3-4 p value VNTR polymorphisms 2R/2R 2 (22.2) 4 (44.2) 3 (33.4) 0.545 3R/3R 2 (25) 5 (75) 0 (0) 2R/3R 2 (25) 4 (50) 2 (25) 3R/4R 1 (100) 0 (0) 0 (0) SNP polymorphisms Absence 3 (42.9) 4 (57.1) 0 (0) 0.3 Presence 4 (22.2) 9 (50) 5 (27.8) 3?-UTR polymorphisms +6/+6 3 (25) 6 (50) 3 (25) > 0.05 +6/-6 3 (27.3) 6 (54.5) 2 (18.2) -6/-6 1 (50) 1 (50) 0 (0) Discussion Pemetrexed a multitargeted antifolate drug is essential for the first and second-line as well as maintenance treatment of NSCLC patients with non-squamous histology [6]. TS is the main biological target of pemetrexed. Some studies have suggested that TS expression could be a predictive factor of response in NSCLC [19]. Moreover some VNTR genotypes have been associated with TS expression and activity in other tumor types such as colorectal cancer [17]. In NSCLC patients a correlation between different genotypes and the TS protein expression has been shown [20]. Shintani et al. [20] also confirmed that the TS mRNA levels were significantly higher in lung cancer tissues with the 3R/3R genotype as compared to those with the 2R/2R genotype. Nonetheless definitive studies addressing the correlation of the different genotypes of TS in circulating genomic DNA with response to the treatment PFS or OS in pemetrexed-treated NSCLC European patients are lacking. The potential influence of the EGFR status on those polymorphisms and their correlation with clinical outcome after pemetrexed-based treatment is also unexplored. A recent study by Hu et al. [21] investigated the different TS polymorphisms in genomic DNA of 90 Asian NSCLC patients. In contrast with our findings no specific genotype regarding the TSER or 3?-UTR polymorphisms studied seemed to correlate with a significant difference in ORR PFS or OS. This could be explained by substantial clinical differences between both populations. Our cohort was constituted by Caucasian patients compared to the Asian population studied by Hu et al. In addition our patients were mostly current or former smokers (72%) compared to the Asian population that showed 62% of never smokers. Also in our cohort the subjects mainly received pemetrexed-based chemotherapy as a first line regimen (92%) whereas the cohort studied by Hu et al. [21] was treated with pemetrexed as a second or further line in 62.2% of the cases. These remarkable differences in basic clinical characteristics and in particular the ethnicity between both cohorts are probably also explaining the differences observed in the 3?-UTR genotype frequency between our population and the one studied by Hu et al. In our cohort +6 bp/+6 bp +6 bp/-6 bp and -6 bp/-6 bp genotypes were found in 48% 44% and 8% of the cases respectively. In contrast0.078 47.8% and 44.4% were respectively found in the population studied by Hu et al. [21]. In a previous analysis performed on another Caucasian NSCLC population evaluated at the M.D. Anderson Cancer Center [22] a similar proportion of 3?-UTR genotypes according to our findings was observed (49.2% of +6 bp/+6 bp 42.4% of +6 bp/-6 bp and 8.4% of -6 bp/-6 bp). Additionally the low prevalence of the +6 bp/+6 bp genotype in an Asian population compared to our cohort may be confirmed by a recent study in which from 106 Asian NSCLC patients investigated none of them showed a +6 bp/+6 bp genotype in genomic circulating DNA [23]. Nontheless in this latter study [23] a significantly higher ORR was observed among patients showing a -6 bp/-6 bp 3?-UTR genotype compared to the ORR reported for patients presenting a -6 bp/+6 bp polymorphism (32.2% vs 12.7%; p =?0.008). Accordingly in our cohort a higher ORR in patients showing a -6 bp/-6 bp genotype compared to those presenting a -6 bp/+6 bp polymorphism was also observed (100% vs. 54.5%). However the statistical significance was not reached probably due to the relatively low number of patients included in our analysis. Interestingly enough in the subgroup analysis of our data the +6 bp/+6 bp genotype seemed to predict a higher ORR only among active/former smokers compared to +6 bp/-6 bp (100% vs. 50%; p =?0.085). This novel observation if validated in future studies could be relevant for selecting specific drugs for each patient in a second or third line setting. With regards to the TSER polymorphisms the presence of a 3R/3R polymorphism seemed to predict a higher ORR with a clear trend toward statistical significance (p =?0.055). Moreover that difference was even greater and statistically significant benefiting the subpopulation of wild-type EGFR patients. To our knowledge this is the first time that such observation has been made. An interesting preclinical study by Giovannetti et al. [24] investigated the activity profile of a combination therapy against NSCLC cell lines with different genotypes with erlotinib and pemetrexed. Remarkably pemetrexed increased EGFR phosphorylation and reduced Akt phosphorylation. Additionally erlotinib significantly reduced TS expression and activity. Thus when erlotinib and pemetrexed were combined a strong synergism in all NSCLC cells regardless of their genetic signature was observed. This potential crosstalk between the EGFR signaling pathway and the TS expression and activity could in part explain our novel findings showing a significantly higher ORR to pemetrexed in those wild-type EGFR patients harboring a 3R/3R polymorphism. However none of the previous studies have described the EGFR status of the patients analyzed and how that status impacted on the ORR to pemetrexed for certain TS polymorphisms. In terms of survival in the present series after a median follow-up of 21 months PFS was superior for those patients showing a 3R/3R genotype with a trend toward statistical significance as expected considering the higher ORR observed for patients with the same TSER genotype. The relatively low statistical power of our clinical cohort may be accounting for the lack of a full statistical significance observed. Regarding OS the advantage in PFS observed in patients showing the 3R/3R genotype translated into a significantly higher median OS in patients with the same polymorphism compared to the rest. Conversely in the study by Hu et al. [21] no specific genotype was significantly correlated with a superior PFS or OS. As aforementioned the dramatic differences in the populations characteristics between both series might possibly explain this discordance. In our study conversely to the observations made by Wang et al. [23] a significantly superior PFS and OS in patients with the -6 bp/-6 bp 3?-UTR genotype has not been confirmed. Most probably this is also due to the differences in the genotype distribution among populations with markedly different ethnicity and epidemiological characteristics. Finally in accordance with Wang et al. [23] the toxicity profile was not significantly correlated with any TS genotype in our series. As aforementioned this study has some limitations due to its retrospective nature and the low number of patients investigated. Both could be responsible for a low statistical power that may impair our ability to find significant differences between subgroups of patients. Conclusions For the first time in a European population of NSCLC patients receiving pemetrexed the presence of the TSER 3R/3R polymorphism significantly correlated with a superior OS. Moreover this same polymorphism when associated to wild-type EGFR was correlated with a higher ORR to pemetrexed. The presence of the +6/-6 bp 3?-UTR genotype among active or former smokers was correlated to a higher ORR showing a trend toward statistical significance. Finally pemetrexed-induced toxicity was not significantly correlated with a specific TS genotype. These novel data warrant further investigation in larger prospective series and may help to patients selection if finally validated. Abbreviations NSCLC: Non-small cell lung cancer; TS: Thymidylate synthase; EGFR: Epidermal Growth Factor Receptor; VNTR: Variable number of tandem repeats; TSER: Thymidylate Synthase gene promoter enhancer region; SNP: Single nucleotide polymorphism; ORR: Overall response rate; PFS: Progression-free survival; OS: Overall survival; CT: Computerized tomography; RECIST: Response Evaluation Criteria in Solid Tumors; CTCAE: Common Terminology Criteria for Adverse Events; PCR: Polymerase chain reaction; RFLP: Restriction fragment length polymorphism; A/FS: Active/former smokers. Competing interests The authors declare that they have no competing interests. Authors contributions EA participated in the design of the study contributed to the patients identification and medical history charts revision and performed samples processing and statistical analyses as well as manuscripts drafting. EC participated in the design of the study contributed to the patients identification and medical history charts revision and performed samples processing and statistical analyses as well as manuscripts drafting. IL carried out samples processing and laboratory analysis. JS participated in the design of the study and contributed to the laboratory analysis. VC contributed to samples processing laboratory analysis and paper drafting. MS contributed to results´ interpretation and manuscript´s drafting. MRR contributed to drafting the manuscript and revising it critically for important intellectual content. PM aided to conceive the study and participated in its design and helped to draft the manuscript. LZ contributed to drafting the manuscript and revising it critically for important intellectual content. APG participated in the design of the study and contributed to the laboratory analysis. CR contributed to drafting the manuscript and revising it critically for important intellectual content. IGB conceived the study and its design contributed to patients selection drafted the manuscript and gave final approval. All authors read and approved the final version of the manuscript. Acknowledgements Blood samples from patients included in the study were kindly provided by the Biobank of the University of Navarra and processed following standard operating procedures approved by the Ethical and Scientific Committees. Funding This work has been funded by UTE project CIMA and by a grant (RD12/0036/0040) from Red Temática de Investigación Cooperativa en Cáncer Instituto de Salud Carlos III Spanish Ministry of Economy and Competitiveness & European Regional Development Fund Una manera de hacer Europa. Siegel R Naishadham D Jemal A Cancer statistics 2012 CA Cancer J Clin 2012 62 10 29 10.3322/caac.20138 22237781 Sánchez MJ Payer T de Angelis R Larrañaga N Capocaccia R Martinez C CIBERESP Working Group Cancer incidence and mortality in Spain: estimates and projections for the period 19812012 Ann Oncol 2010 21 Suppl 3 iii30 iii36 20427358 Brambilla E Travis WD Colby TV Corrin B Shimosato Y The new World Health Organization classification of lung tumours Eur Respir J 2001 18 1059 1068 10.1183/09031936.01.00275301 11829087 Goffin J Lacchetti C Ellis PM Ung YC Evans WK Lung cancer disease site group of cancer care Ontarios program in evidence-based care. First-line systemic chemotherapy in the treatment of advanced non-small cell lung cancer: a systematic review J Thorac Oncol 2010 5 260 274 10.1097/JTO.0b013e3181c6f035 20101151 Cohen MH Johnson JR Wang YC Sridhara R Pazdur R FDA drug approval summary: pemetrexed for injection (Alimta) for the treatment of non-small cell lung cancer Oncologist 2005 10 363 368 10.1634/theoncologist.10-6-363 15967829 Scagliotti GV Parikh P von Pawel J Biesma B Vansteenkiste J Manegold C Serwatowski P Gatzemeier U Digumarti R Zukin M Lee JS Mellemgaard A Park K Patil S Rolski J Goksel T de Marinis F Simms L Sugarman KP Gandara D Phase III study comparing cisplatin plus gemcitabine with cisplatin plus pemetrexed in chemotherapy-naive patients with advanced-stage non-small-cell lung cancer J Clin Oncol 2008 26 3543 3551 10.1200/JCO.2007.15.0375 18506025 Hanna N Shepherd FA Fossella FV Pereira JR De Marinis F von Pawel J Gatzemeier U Tsao TC Pless M Muller T Lim HL Desch C Szondy K Gervais R Shaharyar Manegold C Paul S Paoletti P Einhorn L Bunn PA Jr Randomized phase III trial of pemetrexed versus docetaxel in patients with non-small-cell lung cancer previously treated with chemotherapy J Clin Oncol 2004 22 1589 1597 10.1200/JCO.2004.08.163 15117980 Cohen MH Cortazar P Justice R Pazdur R Approval summary: pemetrexed maintenance therapy of advanced/metastatic nonsquamous non-small cell lung cancer (NSCLC) Oncologist 2010 15 1352 1358 10.1634/theoncologist.2010-0224 21148615 Lecomte T Ferraz JM Zinzindohoué F Loriot MA Tregouet DA Landi B Berger A Cugnenc PH Jian R Beaune P Laurent-Puig P Thymidylate synthase gene polymorphism predicts toxicity in colorectal cancer patients receiving 5-fluorouracil-based chemotherapy Clin Cancer Res 2004 10 5880 5888 10.1158/1078-0432.CCR-04-0169 15355920 Vignoli M Nobili S Napoli C Putignano AL Morganti M Papi L Valanzano R Cianchi F Tonelli F Mazzei T Mini E Genuardi M Thymidylate synthase expression and genotype have no major impact on the clinical outcome of colorectal cancer patients treated with 5-fluorouracil Pharmacol Res 2011 64 242 248 10.1016/j.phrs.2011.04.006 21536130 Zucali PA Giovannetti E Destro A Mencoboni M Ceresoli GL Gianoncelli L Lorenzi E De Vincenzo F Simonelli M Perrino M Bruzzone A Thunnissen E Tunesi G Giordano L Roncalli M Peters GJ Santoro A Thymidylate synthase and excision repair-cross-complementing group-1 as predictors of responsiveness in mesothelioma patients treated with pemetrexed-carboplatin Clin Cancer Res 2011 17 2581 2590 10.1158/1078-0432.CCR-10-2873 21262916 Tanaka F Wada H Fukui Y Fukushima M Thymidylate synthase (TS) gene expression in primary lung cancer patients: a large-scale study in Japanese population Ann Oncol 2011 22 1791 1797 10.1093/annonc/mdq730 21321092 Bosch-Barrera J Gaztañaga M Ceballos J Pérez-Gracia JL López-Picazo JM GarcÃa-Foncillas J Ferrer M Sanz ML Pretel M Idoate MA Gil-Bazo I Toxic epidermal necrolysis related to pemetrexed and carboplatin with vitamin B12 and folic acid supplementation for advanced non-small cell lung cancer Onkologie 2009 32 580 584 10.1159/000232315 19816075 Bosch-Barrera J Montero A López-Picazo JM GarcÃa-Foncillas J Ferrer M Yuste JR Gil-Bazo I Adult onset Still's disease after first cycle of pemetrexed and gemcitabine for non-small cell lung cancer Lung Cancer 2009 64 124 126 10.1016/j.lungcan.2008.09.013 19008012 Michels J Spano JP Brocheriou I Deray G Khayat D Izzedine H Acute tubular necrosis and interstitial nephritis during Pemetrexed therapy Case Rep Oncol 2009 2 53 56 10.1159/000208377 20740145 Lurje G Manegold PC Ning Y Pohl A Zhang W Lenz HJ Thymidylate synthase gene variations: predictive and prognostic markers Mol Cancer Ther 2009 8 1000 1007 19383851 Salgado J Zabalegui N Gil C Monreal I RodrÃguez J GarcÃa-Foncillas J Polymorphisms in the thymidylate synthase and dihydropyrimidine dehydrogenase genes predict response and toxicity to capecitabine-raltitrexed in colorectal cancer Oncol Rep 2007 17 325 328 17203168 Bosch-Barrera J GarcÃa-Franco C Guillén-Grima F Moreno-Jiménez M López-Picazo JM Gúrpide A Pérez-Gracia JL Aristu J Torre W GarcÃa-Foncillas J Gil-Bazo I The multimodal management of locally advanced N2 non-small cell lung cancer: is there a role for surgical resection? A single institution's experience Clin Transl Oncol 2012 14 835 841 10.1007/s12094-012-0874-3 22855163 Takezawa K Okamoto I Okamoto W Takeda M Sakai K Tsukioka S Kuwata K Yamaguchi H Nishio K Nakagawa K Thymidylate synthase as a determinant of pemetrexed sensitivity in non-small cell lung cancer Br J Cancer 2011 104 1594 1601 10.1038/bjc.2011.129 21487406 Shintani Y Ohta M Hirabayashi H Tanaka H Iuchi K Nakagawa K Maeda H Kido T Miyoshi S Matsuda H New prognostic indicator for non-small-cell lung cancer quantitation of thymidylate synthase by real-time reverse transcription polymerase chain reaction Int J Cancer 2003 104 790 795 10.1002/ijc.11014 12640689 Hu Q Li X Su C Chen X Gao G Zhang J Zhao Y Li J Zhou C Correlation between thymidylate synthase gene" | Lung_Cancer |
"55% were male 86% Caucasian and 50% had Eastern Cooperative Oncology Group performance status (ECOG PS)=0. A median of four cycles of ziv-aflibercept was administered. The most common treatment-emergent adverse events (TEAEs) of any grade were nausea (69%) and fatigue (67%) with hypertension (36%) as the most common grade 3/4 TEAE. Of the 38 evaluable patients ORR was 26% and median PFS was 5 months. Conclusion: Cases of RPLS had been observed in other studies in the ziv-aflibercept clinical development programme but the rate observed in this study was higher than previously observed. This might be related to declining renal function and/or hypertension. Although ORR and PFS were in accordance with most historical first-line NSCLC studies this combination of ziv-aflibercept/cisplatin/pemetrexed will not be further explored in NSCLC. ziv-aflibercept non-small cell lung cancer reversible posterior leukoencephalopathy syndrome anti-angiogenesis Cancer growth is dependent upon angiogenesis to maintain a source of nutrition and oxygen (Folkman 1995) and vascular endothelial growth factor (VEGF) has a key role in tumour angiogenesis (Ferrara and Davis-Smyth 1997). Non-small cell lung cancer (NSCLC) produces VEGF and high serum levels of VEGF are correlated with poor prognosis (Korpanty et al 2010). Anti-angiogenic therapy thus aims to disrupt blood supply to tumours and has proven clinical benefit in non-squamous NSCLC (Jain 2001). Combination chemotherapy is used for the first-line treatment of advanced/metastatic NSCLC (Schiller et al 2002). The addition of the anti-VEGF antibody bevacizumab to carboplatin/paclitaxel in this setting improved response rate progression-free survival (PFS) and overall survival (OS; Sandler et al 2006). Similarly bevacizumab improved PFS when added to cisplatin/gemcitabine although OS was not significantly prolonged as a secondary end point in this case (Reck et al 2009). For non-squamous histology cisplatin/pemetrexed is a very active combination chemotherapy (Scagliotti et al 2008) and thus combinations of platinum/pemetrexed with bevacizumab or other anti-angiogenics are of strong interest for the first-line treatment of advanced/metastatic non-squamous NSCLC (Patel et al 2009b). Ziv-aflibercept (ZALTRAP Sanofi Bridgewater NJ USA and Regeneron Pharmaceuticals Tarrytown NY USA) is a recombinant fusion protein consisting of portions of human VEGF receptor extracellular domains fused to the Fc portion of human immunoglobulin (Gaya and Tse 2012). Ziv-aflibercept binds VEGF-A by acting as a high-affinity ligand trap to prevent binding to its endogenous receptor VEGFR-2 thereby inhibiting VEGF-induced angiogenesis in preclinical models (Lassoued et al 2010). Endothelial cells expressing high levels of VEGFR-2 were highly susceptible to blockade by ziv-aflibercept (Sitohy et al 2011). In addition ziv-aflibercept binds PIGF (placental growth factor) and VEGF-B which could potentially inhibit cancer invasion (Dowlati 2010). Studies have investigated ziv-aflibercept as a single agent or in combination with other chemotherapeutic agents in treatment of various types of cancers (Lockhart et al 2010; Tew et al 2010; de Groot et al 2011; Isambert et al 2012). In August 2012 ziv-aflibercept was approved by the US FDA for use in metastatic colorectal cancer based on the results of VELOUR trial (Van Cutsem et al 2012). A phase II study using ziv-aflibercept as monotherapy demonstrated objective responses in heavily pretreated patients with advanced adenocarcinoma of the lung (Leighl et al 2010) and improvement in response and PFS (but not OS) was observed in combination with docetaxel as second-line treatment of NSCLC (Ramlau et al 2012). We report the results of a phase II trial of ziv-aflibercept in combination with cisplatin and pemetrexed in patients with advanced or metastatic non-squamous NSCLC. This study was conducted after a phase I trial using the same regimen of ziv-aflibercept/cisplatin/pemetrexed (Diaz-Padilla et al 2012). That phase I trial determined the recommended dose of ziv-aflibercept (6?mg?kg?1 every 21 days) to be used in the current phase II trial which aimed to evaluate the efficacy and safety of ziv-aflibercept in combination with cisplatin and pemetrexed in the first-line treatment of advanced/metastatic NSCLC. Materials and methods Eligibility Patients eligible for this study had histologically/cytologically confirmed untreated locally advanced/metastatic NSCLC and they had to have measurable disease as per the Response Evaluation Criteria in Solid Tumors (RECIST) criteria (Therasse et al 2000). Patients with squamous histology and/or cavitating lesions were excluded. Patients were 18 years of age or older and had an Eastern Cooperative Oncology Group performance status (ECOG PS) of 0 or 1 with adequate bone marrow renal and hepatic functions and calculated creatinine clearance (CrCL) ?60?ml?min?1. Patients were excluded from the study if they had brain or central nervous system metastases; systolic blood pressure (BP) >150?mm?Hg and/or diastolic blood pressure >100?mm?Hg; bleeding diathesis or evidence of active bleeding; or recent significant cardiovascular cerebrovascular or thromboembolic conditions. " | Lung_Cancer |
"See Supplementary Text for details. Our results show that ModMap produces high quality maps and improves on extant weighted approaches. shows a portion of the map constructed by ModMap where links were restricted to P < 10E-50 (for details see Supplementary Tables S4S6). Each node represents a module and edges represent map links. All modules in the presented map are enriched at 0.05 FDR with at least one GO term. The node labels show the most significantly enriched term. Three major hubs are marked in green: Rpd3L complex (14 genes P = 4.35E-38) Swr1 complex (13 genes P = 1.08E-35) and the mediator complex (17 genes P = 4.89E-43). The Rpd3L and Swr1 complexes are chromatin related and were previously annotated as hubs of GIs in a gene-based study (38). Bandyopadhyay et al. (21) discovered some of the same links; however module annotation there was manual whereas our analysis was completely automatic and produced a much larger map. Moreover our map extends on the previous observations by showing that the three hubs are linked and by providing additional links for the Rpd3L complex. In we focus on the three most significant links in the map (P < 1E-70). A shows the connections between the Rpd3L and Set3 complexes and between the Rpd3L and Swr1 complexes. Rpd3L and Set3 are both histone deacetilases and negative GI between them was reported in (20). The Rpd3L complex was split into two disjoint modules whereas in our map it is detected as a single module containing all 14 Rpd3L genes. B shows a connection between two well-established subunits of the proteasome complex (39). This example shows how joint analysis of PPIs and GIs correctly detects core functional subunits even when they are connected by many PPIs. .The yeast module map. Each node is a module in the yeast PPI network. The name of a node is the most significantly enriched GO term for that module. Each edge represents a highly significant link between two modules in the negative GI network (P < 1E-50). Modules that were not enriched for any GO term at 0.05 FDR are not shown. Three main chromatin-related hubs are marked in green. Some links connect disjoint modules enriched with similar GO terms (e.g. proteasomeproteasome link top right) and other links show epistasis between different biological processes (e.g. nuclear pore and ribosome biogenesis top right). .Examples of linked modules in the yeast module map. The genes of each module are arranged in a circle. Blue edges represent negative GIs and pink edges represent PPIs. For each module the most enriched GO term is shown along with its enrichment P-value. (A) Linkage among different protein complexes. The significance of the links between Rpd3L and the Set3 complexes and between Swr1 and Rpd3L complexes is <10E-70. The link between Swr1 and Set3 is also highly significant (P = 4.29E-59). (B) Detection of subcomplexes. The joint analysis of the PPI and GI networks partitions the proteasome complex into its two subcomplexes: the accessory and the core complex.Analysis of DNA damage response networks in yeastThe module map described earlier in the text was obtained by analyzing the entire set of known negative GIs. Recent studies have gone beyond static analysis to detect changes in the GI network in response to DNA damage (2131). In these studies GIs were measured in untreated cells and following perturbation by the DNA-damaging agent methyl methanesulfonate (MMS) (40). We combined two such data sets (2131) to detect DNA damage-specific positive GIs i.e. differential positive GIs that emerge in the treated cells and are not observed in the untreated cells (see Materials and Methods section). Negative GIs are typically observed between genes working in parallel such as genes that are involved in two compensatory complexes or pathways that backup each other and thus the loss of one is buffered by the other. Positive GIs are more likely to be observed between genes from the same complex or pathway where most of the phenotypic effect is already observed in each single-knockout. Hence DNA damage-specific positive GIs are expected to represent changes of the network in response to MMS revealing DNA damage-specific interactions within pathways or between different pathways or complexes working in series. In total 1078 genes were included in both studies with 2227 DNA damage-specific positive GIs among them (see Supplementary Table S7). There were 6771 PPIs within that gene set.We applied ModMap with the PPI network as H and the DNA damage-specific positive GI network as G. Because these networks were much smaller than in the previous analysis we set the minimal module size to three. The small module sizes also affected the attainable P-values for links. Here a pair of modules was defined as linked if its P-value was < 0.05 after Bonferonni correction considering all statistical tests done by the algorithm during the improvement steps.The generated module map contained 78 genes in 12 modules with 17 links among them. Module sizes ranged between 3 and 15. A complete description of the map is provided in Supplementary Tables S8S10. A map of the modules that were significantly enriched with GO terms is shown in A. The hub in this map is a module enriched with DNA repair genes linked to six modules that cover a large variety of functions. In B we focus on the DNA repair-related module and on three of the modules linked to it. The DNA repair module contains four genes: RAD5 RAD18 HPR5 and UBC13. Interestingly although UBC13 is known to physically interact with the three other genes positive GIs that are consistently stable across experiments (see Materials and Methods section) connect the other three genes providing further evidence that the four genes are involved in a common process. The RAD5 RAD18 and UBC13 genes are known to be involved in post-replication repair (4143) and HPR5 is involved in checkpoint recovery (4445). .A module map of DNA damage-specific positive GIs. (A) A module map of the significantly enriched modules. Nodes represent modules and edges represent significant links (Bonferonni corrected P < 0.05). The name of a node is the most significantly enriched GO term. (B) A closer look at the DNA repair module and three-linked modules. Nodes represent genes and edges represent interactions: blueDNA damage-specific positive GIs pinkPPIs blackstable positive GIs which are observed both in the untreated and in the treated cells. This map shows the emerging connections between functional modules on DNA damage response covering DNA repair and checkpoint responses in the DNA repair module response to damaged replication forks (the DNA damage response module) DNA double-stranded response genes (RAD52 module) and RNA degradation-related genes (SKI complex module). The RAD52 and SKI modules do not appear in A as they reflect functions that do not have established GO terms." | Lung_Cancer |
"Diagnostic assessment programs (DAPs) appear to be a promising model for enabling ICC. The purpose of this study was to explore how DAP structure and function enable ICC and whether that may be associated with anizational and clinical outcomes. Methods A case study approach will be used to explore ICC among eight DAPs that vary by type of cancer (lung breast) academic status and geographic region. To describe DAP function and outcomes and gather information that will enable costing recommendations expressed in DAP standards and clinical guidelines will be assessed through retrospective observational study. Data will be acquired from databases maintained by participating DAPs and the provincial cancer agency and confirmed by and supplemented with review of medical records. We will conduct a pilot study to explore the feasibility of estimating the incremental cost-effectiveness ratio using person-level data from medical records and other sources. Interviews will be conducted with health professionals staff and referring physicians from each DAP to learn about barriers and facilitators of ICC. Qualitative methods based on a grounded approach will be used to guide sampling data collection and analysis. Discussion Findings may reveal opportunities for unique structures interventions or tools that enable ICC that could be developed implemented and evaluated through future research. This information will serve as a formative needs assessment to identify the nature of ongoing or required improvements which can be directly used by our decision maker collaborators and as a framework by policy makers cancer system managers and DAP managers elsewhere to strategically plan for and implement diagnostic cancer services. Inter-professional collaborative care Multidisciplinary care team Inter-professional relations Communication Cooperative behavior Diagnostic assessment program Breast cancer Lung cancer Background Need for collaborative cancer care Most cancer patients require multimodal assessment and treatment including radiologic and pathologic detection confirmation and characterization and surgery chemotherapy and/or radiation for cure or palliation [1]. Following initial treatment patient needs vary as they undergo follow-up surveillance to detect recurrent or secondary cancer with many facing physiological and psychosocial difficulties as a result of their cancer and/or its treatment [2]. In addition most cancer patients require management to prevent or treat co-morbid conditions [3]. Thus cancer management is complex and compounded by the fact that multimodal care is delivered by different professionals in different settings and at different time points. Research has established that coordinated collaborative service delivery improves clinical (i.e. mortality length of stay readmission) and patient-reported (i.e. satisfaction health related quality of life) outcomes for a variety of acute and chronic conditions including cancer [145]. This concept of inter-professional collaborative care (ICC) requires ongoing interaction among various types of health professionals to assess plan negotiate provide and review care for individual patients [6]. Barriers of collaborative cancer care It has been proposed that one-third of cancer cases could be prevented another third cured and the rest effectively treated if management consistently complied with existing guidelines [7]. Most cancer management guidelines recommend ICC but do not specify how this can be achieved [8]. A non-systematic review of the literature on ICC in cancer found that formal policies and structures improved treatment decisions implementation of treatment decisions documentation of treatment decisions attendance at joint meetings professional diversity at meetings completeness of information presented at meetings management according to guideline recommendations time to diagnosis or treatment survival role identification among team members team effectiveness and staff wellbeing [9]. However timely and appropriate ICC was challenged by many patient provider team and system level factors [10]. Other barriers included strategic differences across anizations limited administrative support and identified leads for the collaborative process and anizational and individual provider reluctance to share resources and power [11]. Given multiple associated benefits efforts are needed to promote and support ICC for the clinical management of cancer patients. First improved understanding of which ICC approaches lead to improved patient provider and anizational or system outcomes is required so that we can meaningfully evaluate whether and how cancer patients experience ICC [1213]. Further understanding of how various ICC models lead to beneficial patient provider institutional and health system outcomes will provide insight on when and in what way to implement these models. Our research on collaborative cancer care We have jointly conducted several research studies that identified numerous challenges of ICC for cancer and evaluated the availability and impact of interventions to support ICC. ARG surveyed and interviewed Ontario clinicians and managers involved in cancer care across several studies. Participants identified numerous ICC challenges such as timely access to testing for diagnosis and staging lack of human and technical resources identifying and communicating with specialists coordinating referral to and back from specialists confusion among multidisciplinary team members about who was to coordinate management and the need for system level support [14-19]. Interventions to support ICC suggested by participants included patient held medical records cancer specific medical record standardized referral and reply forms centralized cancer diagnostic facilities regional outreach clinics and use of telemedicine. ARG conceptually analyzed the literature to describe models of ICC [20]. Determinants of positive objective and subjective patient team and anizational outcomes included system or anizational support team structure and team processes. ARG reviewed empirical research evaluating ICC for cancer patients [20]. Twenty-two studies of mixed design published between 2001 and 2009 were eligible. The majority of studies (17/22) assessed the role of general practitioners and supportive/palliative care workers in cancer patient follow-up. Five of 22 studies evaluated ICC for diagnosis or treatment decision making. Apart from tumor boards no studies described interventions to enable ICC. Collectively this research suggests that most cancer providers function through parallel or consultative rather than integrated models of care. FCW spearheaded several investigations to describe and evaluate multidisciplinary cancer conferences (MCCs) as an intervention to support ICC. Also known as tumor boards these are defined as regularly scheduled meetings where healthcare providers discuss the treatment of individual cancer patients [1]. First she chaired a multidisciplinary panel to issue an evidence- and consensus-based guideline describing MCCs [1]. FCW conducted a systematic review of the literature to examine the impact of ICC on clinical outcomes [21]." | Lung_Cancer |
"clinic of the Department of Pulmonary Diseases Radboud University Nijmegen Medical Centre (RUNMC) by a nurse practitioner and the attending physician. Patients and partners are invited to participate together but both are welcome to participate on their own if they do not have a partner or their partner is not willing to participate. Patients and/or partners who are interested are provided with an information leaflet. If they are willing to participate they are invited for a research interview in which in- and exclusion criteria are assessed and informed consent is taken. At other participating hospitals (Department of Pulmonary Diseases Canisius-Wilhelmina Hospital Nijmegen; Department of Pulmonary Medicine Rijnstate Arnhem; Department of Oncology Elkerliek Hospital Helmond; Department of Pulmonary Medicine Jeroen Bosch Hospital; Department of Pulmonary Diseases Maas hospital Pantein Boxmeer) patients and their partners will be sent a letter with the invitation to participate in the study. One week later the researcher calls the patients to answer possible questions and asks whether the patient and partner are interested in participation. If so they are invited for a research interview at the RUNMC. Eligibility We include patients and/or partners of patients who are (a) diagnosed with cytologically or histologically proven non-small cell lung cancer or small cell lung cancer and (b) have received or are still under treatment. Exclusion criteria for both patient and partner include: (a) being under 18 years of age (b) not being able to understand or use the Dutch language (c) former participation in MBSR or Mindfulness-Based Cognitive Therapy (MBCT) (d) current and regular treatment by psychologist or psychiatrist (e) current participation in other psychosocial programme and (f) physical or cognitive (<26 on the Mini-Mental State Examination (MMSE)) impairments hampering participation in MBSR training or completion of questionnaires. Baseline Patients and partners are interviewed to obtain demographics and clinical characteristics after which they are screened for cognitive impairments with the MMSE [33]. After that baseline questionnaires including the Distress Thermometer (DT) [3435] are administered followed by randomization. shows the assessment instruments and time points at which the questionnaires are administered to patients and partners. Measurements and corresponding time points for patient and partner Measure Target T0 T1 T2 pt pr pt pr pt pr MMSE Cognitive impairments x x DT General distress x x HADS Psychological distress x x x x x x QLQ-C30 Quality of life x x x QLQ-LC13 Quality of life x x x SIP Impact of sickness x x x SPPIC Caregiver burden x x x CRA-SE Caregiver self-esteem x x x IMS-S Relationship satisfaction x x x x x x MIS Communication about cancer x x x x x x SAIL Spirituality x x x x x x FFMQ Mindfulness skills x x x x x x SCS Self-compassion x x x x x x RRS-EXT Rumination x x x x x x IES Psychological stress reaction x x x x x x Diary Health care use work absence Monthly during study period for pt Calendar Mindfulness adherence Monthly during study period for pt and pr Note. T0 = Baseline measurement; T1 = Post-intervention measurement; T2= 3-month follow-up measurement; pt = Patient; pr = Partner; MMSE = Mini Mental State Examination; DT = Distress Thermometer; HADS = Hospital Anxiety and Depression Scale; QLQ-C30 = Quality of Life Cancer; QLQ-LC13 = Quality of Life Lung Cancer; SIP = Sickness Impact Profile; SPPIC = Self-Perceived Pressure from Informal Care; CRA-SE = Caregiver Reaction Assessment Care-Derived Self-Esteem; IMS-S = Investment Model Scale-Satisfaction; MIS = Mutuality and Interpersonal Sensitivity; SAIL = Spiritual Attitude and Involvement List; FFMQ = Five Facet Mindfulness Questionnaire; SCS = Self-Compassion Scale; RRS-EXT = Rumination Response Scale Extended Version; IES = Impact of Event Scale. Randomization Randomization is stratified according to setting and minimized for (a) stage of disease (curative versus palliative) (b) baseline level of anxiety and depressive symptoms (anxiety or depression subscale score of Hospital Anxiety and Depression Scale (HADS) <8 versus ?8) (c) treatment during MBSR (no treatment versus chemo- and/or radiotherapy) and (d) participation (patient alone versus partner alone versus patient and partner together). Randomization is computerized using a randomization website specifically designed for this study on which the researcher can fill out the required data. The researcher communicates treatment allocation to the nurse practitioner who informs the patient and/or partner. Follow-up assessments Follow-up assessments take place post intervention and at three-month follow-up. Participants who have access to the internet and have an email address receive the questionnaires online. If not they receive the questionnaires on paper along with a reply envelope. In case of drop-out the researcher tries to contact the participant by phone to complete a minimum set of outcome measures and to identify the main reason for drop-out. Intervention The MBSR curriculum used is primarily based on the Mindfulness-Based Stress Reduction programme as developed by Kabat-Zinn [28] but contains some elements of the MBCT programme by Segal Williams and Teasdale [29] like psycho-education on the interrelatedness of feelings and thoughts. Moreover some modifications have been made to make the intervention more suitable for patients with lung cancer and their partners such as psycho-education about grief [36]. In addition a mindful communication exercise in which partners talk with each other about the cancer was added. The programme consists of 8 weekly 2.5-hour sessions a silent day between session six and seven and home practice assignments of about 45 minutes 6 days per week. Participants receive a set of CDs with guided mindfulness meditation exercises for home practice and a folder with information and home practice instructions for the forthcoming week. shows the content of the MBSR programme per session. The MBSR courses are taught by mindfulness teachers with extensive training in MBSR. They all fulfil the advanced criteria of the Center for Mindfulness of the University of Massachusetts Medical School [37] and maintain a regular personal meditation practice. Teachers were trained supervised and assessed to ensure their competency levels met the qualification criteria to instruct the MBSR classes. During the trial teachers will receive weekly supervision and a number of sessions will be videotaped to evaluate competence and adherence with the Mindfulness-Based Interventions Teaching Assessment Criteria [38]. Content of MBSR programme per session Theme of session Meditation exercise Didactic teaching Homework 1. Automatic pilot - Bodyscan - Intention of participating - Bodyscan - Raisin exercise - Eating one meal mindfully - Attention for routine activity 2. Mindfulness of the breath - Bodyscan - Imagery exercise to demonstrate relationship between thoughtsand feelings - Bodyscan - Sitting mediation with focus on breath - Attention for breath - Awareness of pleasant events - Attention for routine activity 3. Observing limits - Yoga while lying down - Seeing exercise to demonstrate difference between observation and interpretation - Bodyscan or yoga - 3-min breathing space - Sitting meditation - Awareness of unpleasant events - 3-min breathing space 4. Opening up to distress - Sitting mediation with focus on breath body and sound - Interrelatedness of feelings thoughts and bodily sensations - Bodyscan or yoga - Sitting meditation - 3-min breathing space - Psychoeducation about grief - Awareness of stress reactions - 3-min breathing space 5. Responding to distress - Sitting mediation with focus on breath body sound thoughts difficulty - Reacting versus responding - Meditation by choice - Coping with grief - Awareness of reaction in difficult situation - Walking meditation - Awareness of communication difficulties - 3-min breathing space - 3-min breathing space 6. Mindful communication - Yoga in standing position - Mindful communication exercise about effect of lung cancer with their own partner - Sitting meditation or yoga - 3-min breathing space - Awareness of communication - 3-min breathing space during stress Silent day - Varying meditation exercises - Silent lunch and tea break 7. Taking care of yourself - Sitting meditation ending in choiceless awareness - Exercise on taking care of yourself by examining how to improve balance in life - Meditation without CD - Yoga or walking meditation - Reflect on training - 3-min breathing space 8. The rest of your life - Bodyscan - Reflection on training - Further sources of information - Short sitting meditation - Maintaining practice Outcome measures Primary outcome measure Psychological distress The primary outcome measure is the total score on the HADS [39-41] which is developed to measure psychological distress in somatic patient populations. It consists of a 7-item anxiety (HADS-A) and 7-item depression (HADS-D) subscale. The HADS shows good psychometric properties in the general medical population including oncology patients [42]. Internal consistency as measured with Cronbachs ? varied from .84 to .90 [4042].Test-retest reliability was good as Pearsons r > .80 were obtained [4043]. Though the cut-off scores of the HADS vary among populations [44] in lung cancer patients they have found to be <8 versus ?8 on the HADS-A or HADS-D [45]. The HADS has been shown to be highly correlated with the Beck Depression Inventory [42]. It has previously been used in intervention studies of mindfulness and shown to be sensitive to change (e.g. [46]). Secondary outcome measures Quality of life (only for patients) The European Organisation for Research and Treatment of Cancer (EORTC) Core Quality of Life Questionnaire (QLQ-C30) [47] is included along with the supplemental Lung Cancer questionnaire module (QLQ-LC13) [48]. The QLQ-C30 is designed to use in clinical trials on physical treatments for cancer patients. It incorporates five functional scales (physical role cognitive emotional social) three symptom scales (fatigue pain nausea and vomiting) a global health and quality of life scale and an array of single-item symptom measures. After revisions in the role functioning global health and physical functioning scale internal consistency of the subscales varied between .65 and .94 except for the cognitive functioning scale with ? varying from .56 to .63 [474950]. Test-retest reliability varied from .63 to .86 [51]. The lung cancer questionnaire module is designed to supplement the core questionnaire and comprises specific symptoms associated with lung cancer (coughing haemoptysis dyspnoea pain) and side-effects from conventional chemo- and radiotherapy (hair loss neuropathy sore mouth dysphagia). While the multi-item dyspnoea scale showed high internal consistency the pain subscale did not. When combined with the dyspnoea and pain items of the core questionnaire both the dyspnoea (? = .86) and pain (? = .71) subscale showed high internal consistency. Since the QLQ-C30 and QLQ-LC13 are mainly focused on physical symptoms we added the items Social Interaction and Alertness Behavior of the Sickness Impact Profile (SIP) [52]. Internal consistency was .94 and test-retest reliability was .92. The SIP correlated with self-assessed sickness and dysfunction [52]. Caregiver appraisal (only for partners) We use the 9-item Self-Perceived Pressure from Informal Care (SPPIC) [53] to assess the extent to which caregiving is experienced as burdensome. To also measure positive aspects of caregiving the 9-item subscale Care-Derived Self-Esteem of the Caregiver Reaction Assessment (CRA-SE) [54] is included. Internal consistency of the SPPIC was .79 and of the CRA-SE was .73. The SPPIC and CRA-SE were unrelated to each other [55]. Relationship quality To measure relationship satisfaction we included the 10-item Satisfaction subscale of the Investment Model Scale (IMS-S) [56]. The IMS-S starts with 5 items that measure concrete examplars of satisfaction to enhance the comprehensibility of the global items which are utilized to form the construct. Internal consistency varied from .79 to .95 and the IMS-S was related to the Dyadic Adjustment Scale. Also the Mutual Interpersonal Sensitivity scale (MIS) [57] is included to measure communication between partners about the cancer. It contains 18 items and is divided into two scales: open communication and avoiding negative thoughts about the cancer. Spirituality is measured with the Spiritual Attitude and Involvement List (SAIL) [58] and consists of 26 items divided into the subscales meaningfulness trust acceptance caring for others connectedness with nature transcendent experiences and spiritual activities. The internal consistency varied from .74 to .88 and test-retest reliability varied from .77 to .92. All subscales except for connectedness with nature were related with the Functional Assessment of Chronic Illness Therapy Spiritual Well-Being Scale. Costs (only for patients) The cost-effectiveness evaluation is carried out from a societal perspective considering direct as well as indirect health costs. Data on costs are collected prospectively using a diary in which participants register a) health care utilization: the type of care and its duration and b) cancer-related absence from work. Unit cost estimates are derived from the national manual for cost prices in the health care sector [59]. Costs of reduced ability to work are estimated using the friction costs method which results in a more realistic estimate than the human capital approach [60]. Treatment costs of MBSR are calculated using activity-based-costing methods thus measuring actual resources (time of therapist time of patients facilities) used. All unit cost prices are adjusted to 2013 prices. Unit cost estimates are combined with resource utilization data to obtain a net cost per patient over the entire follow-up period. Process measures Mindfulness skills are examined with the 39-item Five Facet Mindfulness Questionnaire (FFMQ) [6162]. The FFMQ is based on an exploratory factor analysis of five mindfulness measures which allowed items from different instruments to form factors providing an empirical integration of these independent attempts to operationalize mindfulness." | Lung_Cancer |
"which contains an SH2 domain and two SH3 domains and can directly bind the EGFR [36]. The results of -A demonstrate using immunoprecipitation of EGFR and immunoblotting with anti-Grb-2 antibody that EGF induces EGFR/Grb-2 complex formation which is attenuated by pretreatment of H358 cells with MNTX. Recruitment of Grb-2 to the EGFR is important for plasma membrane recruitment and consequent tyrosine phosphorylation of the scaffolding protein Grb2-associated-binding protein 1 (Gab-1) [37]. -B indicates that EGF stimulation of H358 cells induces tyrosine phosphorylation of Gab-1 (Tyr307 and Tyr627) which peaks at ?5 minutes and is attenuated by MOR inhibition with MNTX. .0091577.g003 The peripheral mu opioid receptor antagonist methylnaltrexone (MNTX) inhibits EGF-induced recruitment/activation of the linker protein Grb-2 and the scaffolding protein Gab-1 in human lung cancer cells. Panel A: Human H358 non-small cell lung cancer (NSCLC) cells were either untreated (control) or treated with 100 nM MNTX (1 hour pre-incubation) 10 ng/ml EGF for 15 minutes or 100 nM MNTX and 10 ng/ml EGF. Cell lysates were obtained and immunoprecipitated with anti-EGFR antibody. Immunoblots were performed on total cell lysates and immunoprecipitated material using anti-Grb-2 (ac) and anti-EGFR (bd) antibody. MNTX inhibits EGF-induced recruitment of Grb-2 to the EGFR. Panel B: Human H358 non-small cell lung cancer (NSCLC) cells were either untreated (control) or treated with 100 nM MNTX alone 10 ng/ml EGF for 5 15 or 30 minutes or 100 nM MNTX and 10 ng/ml EGF for 515 or 30 minutes. Cell lysates were obtained and immunoblotted using anti-pY627 Gab-1 (a) anti-pY307 Gab-1 (b) and anti-actin (c) antibodies. MNTX attenuates EGF-induced Gab-1 tyrosine phosphorylation. Since tyrosine phosphorylation of Gab-1 by various tyrosine kinases including Src promotes binding to signaling molecules including Phosphatidylinositol 3-kinases (PI3Ks) which generate PIP3 and activate downstream effectors including Akt and STAT3 [37] [38] [39] [40] [41] [42] we next examined whether MOR inhibition can also influence Gab-1 binding/effector molecules. -A shows that like Gab-1 EGF challenge of H358 cells induces tyrosine phosphorylation of Src (Tyr416) the regulatory PI3K alpha subunits p85 and p55 (Tyr458/Tyr199) and the transcription factor STAT3 (Tyr705) which peak at ?5 minutes and are attenuated by MOR inhibition with MNTX in a statistically significant manner (-B)." | Lung_Cancer |
" This delay was largely influenced by the interests of Metropolitan Life Insurance Company (MetLife) and other asbestos mining and product manufacturing companies. Objectives: To understand the ongoing corporate influence on the science and politics of asbestos and silica exposure including litigation defense strategies related to historical manipulation of science. Methods: We examined previously secret corporate documents depositions and trial testimony produced in litigation; as well as published literature. Results: Our analysis indicates that companies that used and produced asbestos have continued and intensified their efforts to alter the asbestoscancer literature and utilize dust-exposure standards to avoid liability and regulation. anizations of asbestos product manufacturers delayed the reduction of permissible asbestos exposures by covering up the link between asbestos and cancer. Once the decline of the asbestos industry in the US became inevitable the companies and their lawyers designed the state of the art (SOA) defense to protect themselves in litigation and to maintain sales to developing countries. Conclusions: Asbestos product companies would like the public to believe that there was a legitimate debate surrounding the dangers of asbestos during the twentieth century particularly regarding the link to cancer which delayed adequate regulation. The asbestoscancer link was not a legitimate contestation of science; rather the companies directly manipulated the scientific literature. There is evidence that industry manipulation of scientific literature remains a continuing problem today resulting in inadequate regulation and compensation and perpetuating otherwise preventable worker and consumer injuries and deaths. asbestos mesothelioma state-of-the-art corporate corruption MetLife industry knowledge 9421547 4136 Hum Pathol Hum. Pathol. Human pathology 0046-8177 1532-8392 24746212 4271837 10.1016/j.humpath.2014.01.003 NIHMS648391 Y-chromosome status identification suggests a recipient origin of posttransplant nonsmall cell lung carcinomas: chromogenic in situ hybridization analysis??? Chen Wei MD PhD a Brodsky Sergey V. MD PhD a Zhao Weiqiang MD PhD a Otterson Gregory A. MD b Villalona-Calero Miguel MD b Satoskar Anjali A. MD a Hasan Ayesha MD b Pelletier Ronald MD c Ivanov Iouri MD PhD a Ross Patrick MD PhD c Nadasdy Tibor MD a Shilo Konstantin MD a * aDepartment of Pathology The Ohio State University Wexner Medical Center Columbus OH 43210 bDepartment of Medicine The Ohio State University Wexner Medical Center Columbus OH 43210 cDepartment of Surgery The Ohio State University Wexner Medical Center Columbus OH 43210 *Corresponding author. Department of Pathology The Ohio State University Wexner Medical Center E412 Doan Hall 450 West 10th Ave Columbus OH 43210. Konstantin.ShiloOSUMC.edu (K. Shilo) 13 12 2014 23 1 2014 5 2014 19 12 2014 45 5 1065 1070 2014 Elsevier Inc. All rights reserved. 2014 Summary Owing to the need of lifelong immunosuppression solid-an transplant recipients are known to have an increased risk of posttransplant malignancies including lung cancer. Posttransplant neoplastic transformation of donor-derived cells giving rise to hematopoietic malignancies Kaposi sarcoma and basal cell carcinoma in nongraft tissues has been reported. The goal of this study was to assess the cell origin (donor versus recipient derived) of posttransplant nonsmall cell lung carcinomas (NSCLCs) in kidney and heart transplant recipients. An institutional database search identified 2557 kidney and heart transplant recipients in 8 consecutive years. Among this cohort 20 (0.8%) renal and 18 (0.7%) heart transplant recipients developed NSCLC. The study cohort comprised 6 of 38 NSCLCs arising in donor-recipient sex-mismatched transplant patients. The tumor cell origin was evaluated by chromogenic in situ hybridization with Y-chromosome probe on formalin-fixed paraffin-embedded tissues. Y-chromosome was identified in 97% ± 1% (range from 92% to 99%) of all types of nucleated cells in male control tissues. In all 5 NSCLCs from male recipients of female donor an Y-chromosome was identified in 97% ± 2% (range from 92% to 100%) of tumor cells statistically equivalent to normal control (P < .001). No Y-chromosome was identified in NSCLC cells from a female recipient of male kidney. These findings suggest a recipient derivation of NSCLC arising in kidney and heart transplant recipients. A combination of histologic evaluation and chromogenic in situ hybridization with Y-chromosome analysis allows reliable determination of tissue origin in sex-mismatched solid-an transplant recipients and may aid in management of posttransplant malignancy in such cases. Postsolid-an transplantation lung cancer Chromogenic in situ hybridization for Y-chromosome 15030100R 648 Ann Thorac Surg Ann. Thorac. Surg. The Annals of thoracic surgery 0003-4975 1552-6259 24576597 4008142 10.1016/j.athoracsur.2013.12.043 NIHMS571118 Accuracy of FDG-PET within the clinical practice of the ACOSOG Z4031 trial to diagnose clinical stage I NSCLC Grogan Eric L. MD MPH a b c Deppen Stephen A. MA MS PhD b c * Ballman Karla V. f Andrade Gabriela M. b Verdial Francys C. b Aldrich Melinda C. b d Chen Chiu L. e Decker Paul A. f Harpole David H. MD g Cerfolio Rrobert J. MD h Keenan Robert J. MD i Jones David R. MD j DAmico Thomas A. MD g Shrager Joseph B. MD k Meyers Bryan F. MD l Putnam Joe B. Jr. MD a b aVeterans Affairs Medical Center Nashville TN bDepartment of Thoracic Surgery; Department of Medicine Vanderbilt University Medical Center Nashville TN cInstitute for Medicine and Public Health Vanderbilt University Medical Center Nashville TN dDivision of Epidemiology Vanderbilt University Medical Center Nashville TN eCenter for Quantitative Sciences Vanderbilt University Medical Center Nashville TN fDivision of Biomedical Statistics and Informatics Mayo Clinic Rochester MN gDepartment of Surgery Duke University Durham NC hDepartment of Surgery University of Alabama Birmingham AL iDepartment of Surgery Allegheny General Hospital Pittsburgh PA jDepartment of Surgery University of Virginia Charlottesville VA kDepartment of Surgery Stanford University Stanford CA lDepartment of Surgery Washington University St. Louis MO Corresponding Author/Request for Reprints: Eric Grogan M.D. M.P.H. Department of Thoracic Surgery 609 Oxford House 1313 21st Ave. South Nashville TN 37232 Phone: 615-322-0064 Fax: 615-343-9194 eric.groganvanderbilt.edu * Equal shared co-first author 23 4 2014 25 2 2014 4 2014 01 4 2015 97 4 1142 1148 2014 The Society of Thoracic Surgeons. Published by Elsevier Inc. All rights reserved. 2014 Background Fluoro-deoxyglucose positron emission tomography (FDG-PET) is recommended for diagnosis and staging of NSCLC. Meta-analyses of FDG-PET diagnostic accuracy demonstrated sensitivity and specificity of 96% and 78% respectively but were performed in select centers introducing potential bias. This study evaluates the accuracy of FDG-PET to diagnose NSCLC and examines differences across enrolling sites in the national ACOSOG Z4031 trial. Methods 959 eligible patients with clinical stage I (cT1-2N0M0) known or suspected NSCLC were enrolled between 2004 and 2006 in the Z4031 trial and 682 had a baseline FDG-PET. Final diagnosis was determined by pathological examination. FDG-PET avidity was categorized into four levels based on radiologist description or reported maximum standard uptake value (SUV). FDG-PET diagnostic accuracy was calculated for the entire cohort. Accuracy differences based on preoperative size and by enrolling site were examined. Results Preoperative FDG-PET results were available for 682 participants enrolled at 51 sites in 39 cities. Lung cancer prevalence was 83%. FDG-PET sensitivity was 82% (95% CI: 7985) and specificity was 31% (95% CI: 23%40%). Positive and negative predictive values were 85% and 26% respectively. Accuracy improved with lesion size. Of 80 false positive scans 69% were granulomas. False negative scans occurred in 101 patients with adenocarcinoma being the most frequent (64%) and eleven were ?10mm. The sensitivity varied from 68% to 91% (p=0.03) and the specificity ranged from 15% to 44% (p=0.72) across cities with > 25 participants. Conclusions In a national surgical population with clinical stage I NSCLC FDG-PET to diagnose lung cancer performed poorly compared to published studies. Tumour Biol Tumour Biol Tumour Biology 1010-4283 1423-0380 Springer Netherlands Dordrecht 24510347 4053595 1674 10.1007/s13277-014-1674-x Research The diagnostic and prognostic value of serum human kallikrein-related peptidases 11 in non-small cell lung cancer Xu Chun-Hua Zhang Yu Yu Li-Ke +86-25-8372-8558 +86-25-83728558 yulike_doctor163.com Department of Respiratory Medicine Nanjing Chest Hospital 215 Guangzhou Road Nanjing 210029 China Nanjing Clinical Center of Respiratory Diseases Nanjing China 9 2 2014 9 2 2014 6 2014 35 6 5199 5203 6 12 2013 22 1 2014 The Author(s) 2014 Open Access This is distributed under the terms of the Creative Commons Attribution License which permits any use distribution and reproduction in any medium provided the original author(s) and the source are credited. The aim of this study was to explore the diagnostic and prognostic value of serum human kallikrein-related peptidases 11 (KLK11) level in non-small cell lung cancer (NSCLC). Serum specimens from 138 patients with NSCLC and 40 healthy controls were collected. The concentration of KLK11 was measured by enzyme-linked immunosorbent assay (ELISA). The concentration of KLK11 in NSCLC was significantly higher compared to that in the controls (P?<?0.01). The serum KLK11 levels decreased with stage presence of lymph node and distant metastases regardless of histology age and sex. With a cutoff point of 1.05 ng/ml KLK11 showed a good diagnostic performance for NSCLC. Univariate analysis revealed that NSCLC patients with serum high KLK11 had a longer overall survival (OS) and progression-free survival (PFS) than those with low KLK11 (HR of 0.36 P?=?0.002; HR of 0.46 P?=?0.009). Cox multivariate analysis indicated that KLK11 was an independent prognostic indicator of PFS and OS (HR of 0.53 P?=?0.042; HR of 0.48 P?=?0.037). KaplanMeier survival curves further confirmed that patients with high KLK11 have longer PFS and OS (P?=?0.003 and P?=?0.018 respectively). In conclusion the measurement of KLK11 might be a useful diagnostic and prognostic test for NSCLC patients. Keywords Kallikrein-related peptidases 11 Non-small cell lung cancer Diagnosis Prognosis issue-copyright-statement International Society of Oncology and BioMarkers (ISOBM) 2014 Introduction Lung cancer is the leading cause of cancer-related death worldwide with more than 1.2 million deaths each year [1]. Non-small cell lung cancer (NSCLC) accounts for 8085 % of total lung malignancies [2]. Although advances in noninvasive methods have improved our ability to detect lung cancer more than 75 % of lung cancer patients present an advanced stage of disease [3] and they have little prospect of effective and curative treatment with 5-year survival rates of less than 15 % [4]. Tumor markers play a key role in patient management for many malignancies. The potential uses of serum tumor markers include aiding early diagnosis determining prognosis prospectively predicting response or resistance to specific therapies and monitoring therapy in patients with advanced disease. Kallikrein-related peptidases 11 (KLK11) is a member of the human kallikrein gene family which localized on chromosome 19q13.4 [5]. Recent studies have reported that KLK11 has been expressed in many cancers including prostate cancer [6] ovarian cancer [7] gastric cancer [8] as well as rectal carcinoma [9]. An immunofluorometric assay study demonstrated that KLK11 expression in ovarian cancer tissues is a marker of favorable prognosis since patients with KLK-positive tumors exhibit a longer progression-free survival (PFS) and overall survival (OS) [10]. Additionally Sasaki et al. [11] reported that lower KLK11 mRNA expression in lung cancer is an indicator of poor prognosis in patients with lung cancer. However there seems to be a paucity of research concerned with serum KLK11 expression in NSCLC. For this reason the goal of the present study was to investigate the baseline serum levels of KLK11 in patients with NSCLC to determine its potential diagnostic and prognostic roles. Materials and methods Patients A total of 138 patients with NSCLC were examined at the Nanjing Chest Hospital between January 2006 and May 2008. The cohort of patients included 80 (58.0 %) male and 58 (42.0 %) female subjects with a median age of 56 years (range 4568 years). The clinical features of the patients are summarized in Table 1. Follow-up lasted through December 2012 with a median follow-up period of 22 months for living patients (range 380 months). PFS was defined as the time interval between the date of diagnosis and the date of disease relapse. OS was defined as the time interval between the date of diagnosis and the date of death.Table 1Clinical characteristics of NSCLC patients and controlsVariablesNSCLCControl P valueSubject no.13840Age year57.8?±?10.254.6?±?7.80.614Male/Female80/5826/140.325Histology?AC78?SCC60 AC adenocarcinoma SCC squamous cell carcinoma The diagnosis of lung cancer was made using various methods: sputum cytology fine-needle aspiration or bronchoscopy as dictated by the patients presentation. Pathologists interpreted the cytology or histology of tissue biopsy. Lung cancer was staged using a widely used classification system and the staging procedure included a clinical examination; CT of the chest abdomen and brain; abdominal ultrasonography; bone scanning; and positron emission tomography. The study protocol was approved by the ethics committee of Nanjing Chest Hospital. All patients provided written informed consent before enrollment. Measurement of serum KLK11 levels Serum samples from each individual were obtained at the time of diagnosis before any therapeutic measures were started (surgery chemotherapy or radiation). Samples were centrifuged at 1500Ãg for 10 min at ?4 °C. The supernatant was stored at ?80 °C for assessment of the levels of KLK11. The KLK11 concentration was determined by ELISA with the commercial KLK11 ELISA Ready-SET-Go kit (eBioscience San Diego CA). All samples were blinded to the technologists running the assays and the code was broken to the statisticians after the database was constructed. Statistical analysis Statistical software (SPSS for Windows version 18) was used for the analysis. Differences between independent groups were examined by the MannWhitney U test. To determine the diagnostic accuracy of KLK11 receiver operating characteristic (ROC) curves were retrieved from logistic regression analysis and the area under the curve (AUC) was calculated. Univariate survival analysis was performed using the KaplanMeier method and the log-rank test. Multivariate analysis was conducted to determine an independent impact on survival using the Cox proportional hazard method. P?<?0.05 was considered statistically significant. Results Comparison of serum KLK11 levels between NSCLC patients and controls As shown in Fig. 1 the concentration of KLK11 was significantly higher in patients with NSCLC (2.04?±?0.86 ng/ml) than in those with the controls (0.93?±?0.52 ng/ml) (P?<?0.01).Fig. 1Levels of KLK11 in NSCLC. Among 138 NSCLC patients the serum levels of KLK11 were 2.04?±?0.86 ng/ml which were significantly higher than 0.93?±?0.52 ng/ml in healthy controls (P?<?0.01) Diagnostic value of KLK11 in NSCLC A ROC curve analysis was carried out to assess the value of KLK11 in NSCLC. The area under the ROC curve was 0.892 (confidence interval (95 % CI) 0.8410.942). With a cutoff point of 1.05 ng/ml which was defined as the normal value based on the mean value plus two standard deviation obtained from healthy controls serum KLK11 has a sensitivity of 65.9 % (91/138) a specificity of 82.5 % (33/40) an accuracy of 69.7 % (124/178) a positive predictive value of 92.9 % (91/98) and a negative predictive value of 41.3 % (33/80) (Fig. 2).Fig. 2ROC of KLK11 for the diagnosis of NSCLC. Serum levels of KLK11 among 138 NSCLC patients and 40 healthy controls were determined. The diagnostic potentials of KLK11 were " | Lung_Cancer |
"Radon is the exposure of interest and is modeled with different combinations of bases for f(x) and w(?) in the cross-basis sx(xt). Given the limited information on smoking histories in this analysis the cross-basis sz(zt) is a priori defined with a natural cubic B-spline with one knot at the median of 2.5 yearly packs 100 for the exposureresponse and a step function with a single cut-off at lag 20 for the lag structure with lag period 240 years. However different cross-basis functions can be applied. The model spends 5 df controlling for confounders and a different amount for modeling the effect of radon depending on the chosen cross-basis sx(xt). Modeling exposurelagresponse associations in time-to-event data assumes the definition of an extended version of continuous time-varying predictors namely the varying exposure history for each subject at the ages he contributes to different risk sets 28. The lag scale is chosen as years with lag 0 identifying the exposure during the last year. The lag period is fixed at 240 assuming no effect of exposure after 40 years and in the last 2 years consistently with previous analyses. Multiple exposure histories are computed for each subject at the ages he contributed to each risk set given his exposure profile reconstructed from the 5-year periods. This step produced matrices of exposure histories Qx and Qz for radon and smoking respectively as defined in (2). These matrices are used to specify the lag-bases or cross-bases matrices Wx and Wz from (3)(7) included in the design matrix of the Cox model. Additional information is provided in the Section B of the supporting information. The functions f(x) and w(?) composing sx(xt) for the model candidates are selected a priori among linear constant piecewise constant functions and quadratic B-splines with 36 models in total. Specifically the three cut-offs of a piecewise constant function and combinations of 01 or 2 knots for B-splines are placed at quartiles for the dimension of x corresponding to 26.760.2 and 122.2 WLM/year and at 13.320 or 26.6 lags for the dimension of ?. Also in alternative parameterizations of w(?) the intercept is excluded in the B-spline bases left-constraining the smooth lagresponse curve to start from a null risk at lag 2. This a priori assumption reasonably follows the hypothesis that the risk associated with past exposures smoothly increases from zero starting from lag 2. Model selection is based on AIC and BIC adapted to survival analysis given by the following: (12) where is the log-likelihood of the fitted model k is the number of total df and d is the number of uncensored events. The best-fitting model (11) is chosen by minimizing AIC or BIC in (12). Both criteria apply a multiplicative constant to the number of parameters for penalizing more complex models. In particular the penalty of BIC (equal to log(d)) is usually higher and tends to select simpler models. 3.3. Results for distributed lag models Results for simple DLMs assuming a linear radonmortality relationship on the log scale are illustrated first. Table II presents models with different functions w(?) as defined in (3). Specifically model 1 is specified by a constant (intercept only) function producing a lag-basis identical to the traditional index of unweighted cumulative exposure; model 2 is an example of a DLM with a piecewise constant function; the best-fitting B-spline models with and without intercept specified by a single knot at 13.3 lags are reported as models 3 and 4 respectively. The fit of the various options is expressed by AIC and BIC with the best performance achieved by model 1 for both criteria. This model assigns the same importance to the exposures experienced ? lags earlier in defining the risk for a given time. The specification of more flexible functions with more df does not seem to improve the fit. Table II Functions f(x) and w(?) total degrees of freedom (df) associated with the cross-basis and values for the AIC and BIC for alternative models for the exposurelagresponse association between radon and mortality. Data from the Colorado Plateau uranium miners cohort DLMs f(x) w(?) df AIC BIC Model 1 Linear Constant 1 2236.0 2257.3 Model 2 Linear Piecewise constant 4 2238.6 2270.6 Model 3 Linear Quadratic B-Spline? 4 2238.8 2270.8 Model 4 Linear Quadratic B-Spline§ 3 2238.9 2267.3 DLNMs f(x) w(?) df AIC BIC Model 5 Quadratic B-Spline* Constant 3 2181.4 2209.8 Model 6 Piecewise constant¡ Piecewise constant 12 2171.6 2232.0 Model 7 Quadratic B-Spline* Quadratic B-Spline? 12 2155.3 2215.7 Model 8 Quadratic B-Spline* Quadratic B-Spline§ 9 2153.2 2202.9 ¡ Cut-offs at 26.760.2 and 122.2 WLM/years. Cut-offs at 1020 and 30 lag. * Knot at 60.2 WLM/years. ? Knot at 13.3 lag. § Knot at 13.3 lag no intercept. DLM distributed lag models; DLNMs distributed lag non-linear models. shows the lagresponse curves estimated from models 12 and 4. The curves are composed of a series of estimated contributions to the risk of mortality for lung cancer at each lag ? associated with an increase of 100 WLM/year in radon exposure with defined in (8). The results can be interpreted following the scheme described in Section 2.3. By using a forward perspective represents the HR contribution from a unit increase in exposure experienced at t to the subsequent risk at t + ? with ? = 2 ¦ 40 years. Alternatively adopting a backward perspective the same summary is interpreted as the HR contribution from a unit increase in exposure experienced at t ? ? to the overall risk at t. Model 4 predicts a maximum increase in risk at lag 11 with a HR of 1.042 (95%CI: 1.0311.052) compared with the constant HR of 1.031 (95%CI: 1.0251.036) estimated from model 1. Hazard ratio (HR) of lung cancer mortality associated with radon exposure to 100 WLM/year in the lag period of 040 years. The figure shows the lagresponse curves estimated from models 4 (with 95%CI)2 and 1 as specified in Table II. Data from the Colorado Plateau uranium miners cohort. The better performance of model 1 seems to indicate that the hypothesis of constant risk H0 : w(?) = c is supported by the data. Also the lagresponse curve from model 4 in does not suggest a decrease in risk at longer lags although the confidence intervals are relatively wide in this part of the lag period. 3.4. Results for distributed lag non-linear models The results illustrated in Section 3.3 are dependent on the strong assumption of a log-linear relationship between radon exposure and lung cancer mortality. The analysis can be repeated with more flexible DLNMs which can describe simultaneously nonlinear exposureresponse relationships and lag structures through the specification of a cross-basis in (5)(7). The definition of DLNMs involves a higher number of potential models obtained by different combinations of bases for the functions f(x) and w(?). The second part of Table II only reports models with the same choices for w(?) used in DLM and with f(x) specified as another piecewise constant function and the B-spline providing the best fit with one knot at 60.2 WLM/year. Overall the best-fitting option for both AIC and BIC is model 8 with a B-spline for both f(x) and w(?). This model uses 9 df in total for expressing the bidimensional association. The hypothesis H0 : f(x) = x of a linear radon-mortality dependency is not supported by the data as all the DLNMs show a substantial decrease in both AIC and BIC when compared with simpler DLMs. In particular the comparison of the best-fitting model 8 representing f · w(x?) with model 4 representing x · w(x?) indicates that the 6 additional df substantially improve the fit. Similarly the hypothesis H0 : w(?) = c of a constant risk along lags previously suggested when evaluating DLMs is not supported either. The comparison of model 8 with model 5 representing f(x) · c indicates a better fit of the former. Interestingly this result is the opposite of what was suggested in Section 3.3 revealing how imposing a wrong assumption about the relationship in one dimension induces spurious results in the other space compromising the analysis of the association. The interpretation of results from DLNMs relies on a bidimensional representation of the exposurelagresponse association. This is achieved by computing the risk contributions over a grid defined in the range of the exposure x and the lag ? applying (9). This bidimensional dependency is depicted in the two top panels of Figure 2 showing the predicted HR surfaces from models 8 and 6 in the range 0250 WLM and 040 lags. The graphs show an initial increase in risk along lags peaking at approximately 10 years after the exposure and then decreasing and apparently disappearing after about 30 years independent of the exposure levels. The inspection of the panels along the dimension of x reveals the nonlinear radon-mortality dependency with the risk increasing steadily up to 50 WLM/year and then flattening out. The shape of the HR surfaces unveils the different assumptions underlying the choices of bases for functions f(x) and w(?) namely B-splines and piecewise constant functions. Figure 2 Hazard ratio (HR) of lung cancer mortality associated with radon exposure in the range 0250 WLM/year and lag period 040 years. The figure shows 3-D graphs of the exposurelagresponse association on a grid of exposure lag values (from model 8 top left and model 6 top right) lagresponse curves for radon exposure of 100 WLM/year (from models 8 with 95%CI and model 6 bottom left) and exposureresponse curves at lag 15 (from models 8 with 95%CI and models 6 and 4 bottom right). The models are described in Table II. Data from the Colorado Plateau uranium miners cohort. Although the 3-D representation offered by the top panels in Figure 2 provides an overview of the bidimensional association it is still limited for inferential purposes as the uncertainty in the estimate is not reported. In order to extend the interpretation the analysis can focus on the risk along ? predicted for specific exposure intensities or alternatively the risk along x for specific lags namely the vectors and from Section 2.3. These dependencies are represented by slices cut on the bidimensional risk surface along the appropriate dimension. The bottom panels of Figure 2 report the lagresponse curve corresponding to an exposure level of 100 WLM/year and the exposureresponse curve for lag 15 from both Models 8 and 6 together with 95% confidence intervals for the former. These curves correspond to the two bold lines in the 3-D plots. The bottom-left panel is interpreted similarly to the DLM in as the specific risk contributions composing the lagresponse curve but this time associated with a specific exposure xp = 100 WLM/year. The curve estimated from model 8 peaks at lag 11 with an HR of 1.21 (95%CI: 1.161.26) and both models 8 and 6 suggest that the risk disappears after 3035 years. The B-spline for w(?) in model 8 is left-constrained by the lack of an intercept forcing the smoothed lagresponse curve to start from a null risk at lag 2. The best fit of Model 8 if compared with model 7 which includes the intercept seems to support this hypothesis. The bottom-right panel shows instead the risk contributions at ?p = 15 for different exposure intensities and is interpreted as the exposureresponse at t from exposures experienced at t ? 15 (backward perspective) or the exposureresponse contributions at t + 15 from exposures experienced at year t (forward perspective). Although models 8 and 6 adopt different bases for functions f(x) and w(?) the estimates of the predicted risk along x and ? are consistent showing a radon-mortality relationship that is markedly nonlinear and nonconstant in time. These measures of risk are extended in Figure 3 reporting estimates from model 8 for different exposure and lag values. A right-constrained version of Model 8 is discussed in Section D.1 and illustrated in Figure S2 of the supporting information. Figure 3 Hazard ratio (HR) of lung cancer mortality associated with radon exposure in the range 0250 WLM/year and lag period 040 years. The figure shows lagresponse curves for radon exposure of 2050100 and 200 WLM/year (left) and exposureresponse curves at lag 51015 and 20 (right) estimated from model 8 as specified in Table II. " | Lung_Cancer |
"This combination has two possible explanations. Firstly they might represent tumors which are not expressing ALK protein at detectable levels because of a false-positive FISH result or an absence of addiction to rearranged ALK protein despite presence of recombined ALK DNA. These tumors are unlikely to respond to crizotinib. Secondly they might represent a failure of the IHC assay because of poor preservation of antigen insufficient material or another technical error. In this case crizotinib therapy would still be likely to be effective. The study includes seven cases with positive FISH results with data on response to crizotinib. Six showed at least a partial response to crizotinib therapy as assessed by Response Evaluation Criteria in Solid Tumors criteria. A single case showed no response and this was one of the two false negatives. Thus in this one case the IHC test would have correctly predicted response. This was a scanty cytological specimen in which FISH interpretation was difficult and only 20% of 515 cells showed rearranged ALK signals (fusion plus split red/green probes and fusion plus isolated red signal). Therefore it seems possible that this represents a technical failure of the FISH assay. The other case an excision specimen showed 39% of 626 cells with rearranged signals. It was also shown to harbor a driving mutation in a second gene; PCR testing demonstrated the loss of exon 19 of endothelial growth factor receptor. This has been described in another study that characterized two such false-negative cases.15 Thus these tumors may well escape oncogene addiction to the ALK kinase activity which would be consistent with indetectable ALK protein expression. Again IHC would be expected to be the best predictor of response to tyrosine kinase inhibitor therapy in such cases. It is essential to identify and molecularly characterize other false-negative cases that have received crizotinib therapy. In addition it seems likely that IHC should guide treatments in false-positive cases that express high levels of ALK from genetic lesions that are invisible to the current FISH assay. Although we identified no false positives i.e. FISH-negative IHC-positive cases our sensitivity may be an overestimate (as judged by FISH) because of the small number of FISH-negative cases under study. Several studies have identified rare cases with rearrangements that are indetectable by FISH but detectable by IHC and confirmed by reverse-transcriptase PCR.5910 Such cases would be expected to respond to crizotinib and a recent study shows that at least one novel FISH-indetectable rearrangement does indeed drive the malignant phenotype.5 One limitation of this study is the small number of cases under study although 15 FISH-positive cases is comparable to most other studies. The relatively small number of FISH-negative cases may have affected our ability to identify FISH-negative IHC-positive cases. However the study design does permit an assessment of the sensitivity of the IHC assay which is the most important consideration for a possible screening test. Our comparison of the immunohistochemical assays was not directly equivalent as the D5F3 assay included a proprietary tyramide signal amplification step whereas the ALK1 and 5A4 assays were conducted using our routine diagnostic detection system. However our study design also has several strengths. In particular the use of archival diagnostic paraffin blocks and FISH testing conducted in the course of routine diagnosis make the results of the study directly relevant to clinical practice. In summary we find IHC to be a highly sensitive (86%) and specific (100%) test for ALK rearrangement in lung adenocarcinoma. We find a slight advantage of a proprietary amplified assay (D5F3 Ventana) over two other antibodies with conventional DAB staining (ALK1 Dako and 5A4 Abcam) but only in scanty samples. Intensity of staining was the most discriminating measure and the proportion of cells staining did not contribute. We identified two cases that were positive for the ALK rearrangement by FISH but negative by all immunohistochemical assays and suggest that in discordant cases the IHC test result may be more predictive of treatment response than FISH. Further discordant cases need to be examined to help guide the treatment of these cases. Immunohistochemical testing is clearly at least a useful adjunct to FISH and we feel that it is reasonable in routine practice to use a sensitive IHC assay as a screening test. The danger of missing treatable cases using this method (i.e. FISH-positive IHC-negative crizotinib-sensitive tumors) appears very small especially when specimens contain adequate material. In difficult cases further investigations such as re-biopsy and repeated IHC/FISH may be helpful. Disclosure: This project was supported by the National Institute of Health Research Respiratory Disease Biomedical Research Unit at the Royal Brompton and Harefield NHS Foundation Trust and Imperial College London and the NIHR RM/ICR Biomedical Research Center. All other authors declare no conflict of interest. REFERENCES 1. Inamura K Takeuchi K Togashi Y EML4-ALK lung cancers are characterized by rare other mutations a TTF-1 cell lineage an acinar histology and young onset. Mod Pathol 2009 22 508 515 19234440 2. Koivunen JP Mermel C Zejnullahu K EML4-ALK fusion gene and efficacy of an ALK kinase inhibitor in lung cancer. Clin Cancer Res 2008 14 4275 4283 18594010 3. Shinmura K Kageyama S Tao H EML4-ALK fusion transcripts but no NPM- TPM3- CLTC- ATIC- or TFG-ALK fusion transcripts in non-small cell lung carcinomas. Lung Cancer 2008 61 163 169 18242762 4. Soda M Choi YL Enomoto M Identification of the transforming EML4-ALK fusion gene in non-small-cell lung cancer. Nature 2007 448 561 566 17625570 5. To KF Tong JH Yeung KS Detection of ALK rearrangement by immunohistochemistry in lung adenocarcinoma and the identification of a novel EML4-ALK variant. J Thorac Oncol 2013 8 883 891 23625156 6. McDermott U Iafrate AJ Gray NS Genomic alterations of anaplastic lymphoma kinase may sensitize tumors to anaplastic lymphoma kinase inhibitors. Cancer Res 2008 68 3389 3395 18451166 7. Kwak EL Bang YJ Camidge DR Anaplastic lymphoma kinase inhibition in non-small-cell lung cancer. N Engl J Med 2010 363 1693 1703 20979469 8. Lindeman NI Cagle PT Beasley MB Molecular testing guideline for selection of lung cancer patients for EGFR and ALK tyrosine kinase inhibitors: guideline from the College of American Pathologists International Association for the Study of Lung Cancer and Association for Molecular Pathology. J Thorac Oncol 2013 8 823 859 23552377 9. Murakami Y Mitsudomi T Yatabe Y A Screening Method for the ALK Fusion Gene in NSCLC. Front Oncol 2012 2 24 22655265 10. Rodig SJ Mino-Kenudson M Dacic S Unique clinicopathologic features characterize ALK-rearranged lung adenocarcinoma in the western population. Clin Cancer Res 2009 15 5216 5223 19671850 11. Peled N Palmer G Hirsch FR Next-generation sequencing identifies and immunohistochemistry confirms a novel crizotinib-sensitive ALK rearrangement in a patient with metastatic non-small-cell lung cancer. J Thorac Oncol 2012 7 e14 e16 22895149 12. Eisenhauer EA Therasse P Bogaerts J New response evaluation criteria in solid tumours: revised RECIST guideline (version 1.1). Eur J Cancer 2009 45 228 247 19097774 13. Selinger CI Rogers TM Russell PA Testing for ALK rearrangement in lung adenocarcinoma: a multicenter comparison of immunohistochemistry and fluorescent in situ hybridization. Mod Pathol 2013 26 1545 1553 23743928 14. Conklin CM Craddock KJ Have C Laskin J Couture C Ionescu DN Immunohistochemistry is a reliable screening tool for identification of ALK rearrangement in non-small-cell lung carcinoma and is antibody dependent. J Thorac Oncol 2013 8 45 51 23196275 15. Sholl LM Weremowicz S Gray SW Combined use of ALK immunohistochemistry and FISH for optimal detection of ALK-rearranged lung adenocarcinomas. J Thorac Oncol 2013 8 322 328 23407557 16. Savic S Bode B Diebold J Detection of ALK-positive non-small-cell lung cancers on cytological specimens: high accuracy of immunocytochemistry with the 5A4 clone. J Thorac Oncol 2013 8 1004 1011 23689429 Br J Cancer Br. J. Cancer British Journal of Cancer 0007-0920 1532-1827 Nature Publishing Group 24292447 3915116 bjc2013735 10.1038/bjc.2013.735 Clinical Study A phase II multicentre study of ziv-aflibercept in combination with cisplatin and pemetrexed in patients with previously untreated advanced/metastatic non-squamous non-small cell lung cancer Ziv-aflibercept/cisplatin/pemetrexed in NSCLC Chen H 1 * Modiano M R 2 Neal J W 3 Brahmer J R 4 Rigas J R 5 Jotte R M 6 Leighl N B 7 Riess J W 3 Kuo C J 3 Liu L 8 Gao B 8 DiCioccio A T 8 Adjei A A 1 Wakelee H A 3 1Department of Medicine Roswell Park Cancer Institute Elm & Carlton Streets Buffalo NY 14263 USA 2Arizona Oncology/Arizona Clinical Research Center 1620W. St Mary's Rd Tucson AZ 85745 USA 3Department of Medicine Stanford University School of Medicine and Cancer Institute 875 Blake Wilbur Dr Stanford CA 94305 USA 4Department of Oncology The Sidney Kimmel Comprehensive Cancer Center at Johns Hopkins Bunting/Blaustein CRB 1650 Orleans St. G94 Baltimore MD 21231 USA 5Department of Medicine Norris Cotton Cancer Center Geisel School of Medicine at Dartmouth 1 Medical Center Drive Lebanon NH 03756 USA 6Rocky Mountain Cancer Centers 1800 Williams Street Suite 200 Denver CO 80218 USA 7Department of Medicine Princess Margaret Hospital and University of Toronto 610 University Avenue Toronto ON M5G 2M9 Canada 8Regeneron Pharmaceuticals Inc. 777 Old Saw Mill River Road Tarrytown NY 10591 USA *E-mail: hongbin.chen@roswellpark.org 04 02 2014 28 11 2013 110 3 602 608 29 08 2013 27 10 2013 30 10 2013 Copyright © 2014 Cancer Research UK 2014 Cancer Research UK From twelve months after its original publication this work is licensed under the Creative Commons Attribution-NonCommercial-Share Alike 3.0 Unported License. To view a copy of this license visit http://creativecommons.org/licenses/by-nc-sa/3.0/ Background: This study evaluated the efficacy and safety of ziv-aflibercept in combination with cisplatin and pemetrexed in non-small cell lung cancer (NSCLC). Methods: This single arm multicentre phase II trial enrolled patients with previously untreated locally advanced or metastatic non-squamous NSCLC. Patients received intravenous ziv-aflibercept 6?mg?kg?1 pemetrexed 500?mg?m?2 and cisplatin 75?mg?m?2 every 21 days for up to six cycles. Maintenance administration of ziv-aflibercept was to continue until disease progression intolerable toxicity or other cause for withdrawal. The co-primary end points were objective response rate (ORR) and progression-free survival (PFS). Planned sample size was 72 patients. Results: The study was closed prematurely because of three confirmed and two suspected cases of reversible posterior leukoencephalopathy syndrome (RPLS). A total of 42 patients were enrolled. Median age was 61.5 years; 55% were male 86% Caucasian and 50% had Eastern Cooperative Oncology Group performance status (ECOG PS)=0. A median of four cycles of ziv-aflibercept was administered. The most common treatment-emergent adverse events (TEAEs) of any grade were nausea (69%) and fatigue (67%) with hypertension (36%) as the most common grade 3/4 TEAE. Of the 38 evaluable patients ORR was 26% and median PFS was 5 months. Conclusion: Cases of RPLS had been observed in other studies in the ziv-aflibercept clinical development programme but the rate observed in this study was higher than previously observed. This might be related to declining renal function and/or hypertension. Although ORR and PFS were in accordance with most historical first-line NSCLC studies this combination of ziv-aflibercept/cisplatin/pemetrexed will not be further explored in NSCLC. ziv-aflibercept non-small cell lung cancer reversible posterior leukoencephalopathy syndrome anti-angiogenesis Cancer growth is dependent upon angiogenesis to maintain a source of nutrition and oxygen (Folkman 1995) and vascular endothelial growth factor (VEGF) has a key role in tumour angiogenesis (Ferrara and Davis-Smyth 1997). Non-small cell lung cancer (NSCLC) produces VEGF and high serum levels of VEGF are correlated with poor prognosis (Korpanty et al 2010). Anti-angiogenic therapy thus aims to disrupt blood supply to tumours and has proven clinical benefit in non-squamous NSCLC (Jain 2001). Combination chemotherapy is used for the first-line treatment of advanced/metastatic NSCLC (Schiller et al 2002). The addition of the anti-VEGF antibody bevacizumab to carboplatin/paclitaxel in this setting improved response rate progression-free survival (PFS) and overall survival (OS; Sandler et al 2006). Similarly bevacizumab improved PFS when added to cisplatin/gemcitabine although OS was not significantly prolonged as a secondary end point in this case (Reck et al 2009). For non-squamous histology cisplatin/pemetrexed is a very active combination chemotherapy (Scagliotti et al 2008) and thus combinations of platinum/pemetrexed with bevacizumab or other anti-angiogenics are of strong interest for the first-line treatment of advanced/metastatic non-squamous NSCLC (Patel et al 2009b). Ziv-aflibercept (ZALTRAP Sanofi Bridgewater NJ USA and Regeneron Pharmaceuticals Tarrytown NY USA) is a recombinant fusion protein consisting of portions of human VEGF receptor extracellular domains fused to the Fc portion of human immunoglobulin (Gaya and Tse 2012). Ziv-aflibercept binds VEGF-A by acting as a high-affinity ligand trap to prevent binding to its endogenous receptor VEGFR-2 thereby inhibiting VEGF-induced angiogenesis in preclinical models (Lassoued et al 2010). Endothelial cells expressing high levels of VEGFR-2 were highly susceptible to blockade by ziv-aflibercept (Sitohy et al 2011). In addition ziv-aflibercept binds PIGF (placental growth factor) and VEGF-B which could potentially inhibit cancer invasion (Dowlati 2010). Studies have investigated ziv-aflibercept as a single agent or in combination with other chemotherapeutic agents in treatment of various types of cancers (Lockhart et al 2010; Tew et al 2010; de Groot et al 2011; Isambert et al 2012). In August 2012 ziv-aflibercept was approved by the US FDA for use in metastatic colorectal cancer based on the results of VELOUR trial (Van Cutsem et al 2012). A phase II study using ziv-aflibercept as monotherapy demonstrated objective responses in heavily pretreated patients with advanced adenocarcinoma of the lung (Leighl et al 2010) and improvement in response and PFS (but not OS) was observed in combination with docetaxel as second-line treatment of NSCLC (Ramlau et al 2012). We report the results of a phase II trial of ziv-aflibercept in combination with cisplatin and pemetrexed in patients with advanced or metastatic non-squamous NSCLC. This study was conducted after a phase I trial using the same regimen of ziv-aflibercept/cisplatin/pemetrexed (Diaz-Padilla et al 2012). That phase I trial determined the recommended dose of ziv-aflibercept (6?mg?kg?1 every 21 days) to be used in the current phase II trial which aimed to evaluate the efficacy and safety of ziv-aflibercept in combination with cisplatin and pemetrexed in the first-line treatment of advanced/metastatic NSCLC. Materials and methods Eligibility Patients eligible for this study had histologically/cytologically confirmed untreated locally advanced/metastatic NSCLC and they had to have measurable disease as per the Response Evaluation Criteria in Solid Tumors (RECIST) criteria (Therasse et al 2000). Patients with squamous histology and/or cavitating lesions were excluded. Patients were 18 years of age or older and had an Eastern Cooperative Oncology Group performance status (ECOG PS) of 0 or 1 with adequate bone marrow renal and hepatic functions and calculated creatinine clearance (CrCL) ?60?ml?min?1. Patients were excluded from the study if they had brain or central nervous system metastases; systolic blood pressure (BP) >150?mm?Hg and/or diastolic blood pressure >100?mm?Hg; bleeding diathesis or evidence of active bleeding; or recent significant cardiovascular cerebrovascular or thromboembolic conditions. The protocol was approved by the Institutional Review Boards at each participating institution. Informed consent was obtained from each patient. Study design This is a single arm open label multicentre phase II study (ClinicalTrials.gov identifier: NCT00794417). Patients received the three-drug combination intravenously on day 1 of every 21 days with ziv-aflibercept (6?mg?kg?1) first followed by pemetrexed (500?mg?m?2) and cisplatin (75?mg?m?2). Premedications consisted of folic acid vitamin B12 and dexamethasone as a prophylactic measure to reduce pemetrexed-related toxicities and standard anti-emetics. Patients could receive up to six cycles of combination therapy. For patients who completed the combined chemotherapy maintenance ziv-aflibercept every 21 days was to continue until disease progression intolerable toxicity or withdrawal from the study. End points and assessments The two co-primary end points were objective response rate (ORR) and PFS. The ORR was defined as the proportion of patients with complete response plus partial response (CR+PR). The PFS was defined as the time interval from the first dose of combination chemotherapy to tumour progression or death whichever occurred first. Secondary variables were the determination of the adverse events (AEs) pharmacokinetics (PK) and pharmacodynamic profiles (including anti-ziv-aflibercept antibody and hematopoiesis). Pharmacokinetic end points included the area under the concentration curve maximum concentration (Cmax) clearance and terminal half-life (t1/2). Tumour imaging (CT or MRI) was performed at screening on day 21 (±7 days) of every even numbered cycle (every 6 weeks) and when disease progression was suspected. Responses were assessed using RECIST version 1.0 (Therasse et al 2000). Safety and tolerability were assessed at baseline and at least every 21 days as evaluated by AEs and changes in laboratory parameters graded according to the Common Terminology Criteria for Adverse Events (CTCAE) version 3.0 (National Cancer Institute 2006). Ziv-aflibercept (free or bound to VEGF) in plasma samples was quantified using a validated direct enzyme-linked immunosorbent assay. A validated non-quantitative titre-based bridging assay was used to detect anti-ziv-aflibercept antibodies in serum samples. Correlative studies The exploratory objective of the correlative studies was to evaluate changes in erythropoiesis in response to VEGF inhibition. It was hypothesised that VEGF inhibition would result in an increase in haemoglobin via increased hepatic erythropoietin production. Statistical analysis Statistical testing was done to determine whether the ORR was larger than 20% or whether the PFS was greater than 4.5 months. Exact test (one-sided) was used to test the null hypothesis that ORR was ?20% versus the alternative hypothesis that ORR was ?35%. Assuming type I error was not >2.5% a sample of 72 patients would provide >80% power to test the hypothesis using exact binomial test. The calculated sample size of 72 patients would also provide >90% power to test the null hypothesis that median PFS was ?4.5 months versus the alternative hypothesis that PFS was ?6.5 months at one-sided alpha of 2.5% using one sample log-rank test. Safety data were to be summarised. Concentrations of free ziv-aflibercept and adjusted bound ziv-aflibercept: VEGF complex were to be summarised every 21 days over the duration of the study by nominal time point. Noncompartmental parameters were calculated using WinNonlin (version 5.3 Pharsight Corporation Mountain View CA USA) and model 202 (constant infusion) using nominal time points after a single dose of ziv-aflibercept. The noncompartmental analysis was performed over the dosing interval 21 days following the first dose. All analyses used statistical software SAS (version 9.1.3 Cary NC USA). Results Patients This study was closed prematurely because of three confirmed and two suspected but unconfirmed cases of reversible posterior leukoencephalopathy syndrome (RPLS). A total of 42 patients were enrolled from 17 participating sites across the United States and Canada between January 2009 and December 2010. Table 1 summarises the patient demographics. Median age was 61.5 years; 55% were male 86% were Caucasian and 50% had ECOG PS of 0. Safety evaluation Treatment exposure and dose modifications All 42 patients received at least one dose of each of the three study drugs with a median of 92 days of treatment (range 21288 days). Twenty-seven (64%) patients completed four or more cycles of the combination treatment. A median of 4.5 (range 16) cycles of pemetrexed and 4 (range 16) cycles of cisplatin were administered. The median dose intensity was 163.9 (range 110.1175.5)?mg?m?2 per week for pemetrexed and 24.6 (range 15.326.3)?mg?m?2 per week for cisplatin. The delivered dose intensities were 98.3% for pemetrexed and 98.5% for cisplatin. Seventeen (40%) completed six or more cycles of ziv-aflibercept. The median dose intensity of ziv-aflibercept was 1.97?mg?kg?1 per week close to the planned intensity of 2?mg?kg?1 per week. Reasons for treatment discontinuation were disease progression (33%) AEs (33%) and others (34% including withdrawal of consent and investigator request). Seventeen patients had at least one cycle delayed. Eleven patients (26%) had at least 1 dose modification of ziv-aflibercept 6 (14%) of pemetrexed and 11 of cisplatin. Adverse events Thirty-five patients (83%) experienced a treatment-emergent adverse event (TEAE) of grade 3 or 4 (3/4) and 16 patients (38%) experienced a serious TEAE. The most common TEAEs were nausea (69%) fatigue (67%) and hypertension (57%). Hypertension neutropaenia and hypokalaemia were the most common grade 3/4 TEAEs in 36%0.14 and 10% of patients respectively. Table 2 summarised the most common TEAEs. Thirty-nine patients (93%) experienced at least one haematologic abnormality with grade 3/4 in eight patients (19%) mostly neutropaenia. Every patient experienced at least one abnormal chemistry value with grade 3/4 in 15 (36%) most commonly hyponatraemia. Seven patients (17%) died before clinical cutoff of the study. Five died due to disease progression and two due to TEAEs: 1 pneumonia and 1 sepsis. Neurological toxicities Between 26 September 2010 and 30 December2010 five patients experienced neurological symptoms including altered mental status in four slurred speech in one seizure in two and headache in four patients. Three patients had a brain MRI that was consistent with RPLS (Figure 1B). Brain MRI was negative for RPLS in two other patients. The three patients diagnosed with RPLS were all Caucasian women aged 3851 and 72 years respectively. One of the three patients with RPLS entered the study with a history of hypertension. All three patients experienced elevated BP and two patients had reduced CrCL during the therapy: one patient's CrCL decreased by 45% from baseline (141 to 78?ml?min?1) after one cycle and the other's decreased by 20% (64 to 51?ml?min?1) after four cycles. They were diagnosed with RPLS after one two and five cycles of ziv-aflibercept respectively. Two patients recovered from RPLS and one died due to disease progression before RPLS resolution. Pharmacokinetic information was available for two of the three RPLS patients and for one suspected case: systemic concentrations of free ziv-aflibercept were within the range of other patients in the treatment cohort. In the phase I study using the same regimen (N=18) five patients experienced a mild neurocognitive disturbance but no RPLS was diagnosed (Diaz-Padilla et al 2012). Rare cases of RPLS have been observed in the ziv-aflibercept clinical development programme but the rate observed in this study (3 out of 42=7%) was much higher than previously reported (i.e. 0.5% of 3795 patients treated with ziv-aflibercept as monotherapy or in combination with chemotherapy ZALTRAP product insert). As a result this study was permanently closed to enrolment. Patients who remained on study were re-consented with updated safety information regarding RPLS in addition to continued close monitoring. Hypertension and renal insufficiency are two risk factors for RPLS. Twenty-four patients (57%) experienced hypertension (15 grade 3 but no grade 4) during the study 15 of whom had a history of hypertension and 12 had taken antihypertensive medications before entering the study. Eight patients with hypertension also experienced proteinuria. Fourteen patients (33%) experienced proteinuria (all grades 1 or 2 except a single grade 3) none of whom had a history of renal disease. Fourteen patients experienced CrCL decreases during treatment with six patients having CrCL decreases below 60?ml?min?1 after treatment cycle 4. Efficacy evaluation As the study was closed prematurely there was no statistical power to test the primary hypothesis. Of the 42 patients enrolled 4 patients discontinued early from the study due to AEs (2) consent withdrawal (1) and investigator decision (1). As they did not have a post-baseline tumour assessment they were excluded from the efficacy assessment per predefined statistical analysis plan. Of the 38 patients evaluable for efficacy the median PFS was 5 months (95% CI 4.37.1; Figure 1A) and ORR was 26% (95% CI 1240%) all of which (10/38) were PR. The disease control rate (PR+stable disease) was 89% (26%+63%). " | Lung_Cancer |
"This population therefore could be sufficiently different to give unexpected results. However the results of this trial will inform as to the acceptability of this approach as well as its effectiveness. Abbreviations CONSORT: Consolidated statement of reporting trials; COPD: Chronic obstructive pulmonary disease; DNA: Deoxyribonucleic acid; NHS: National health service UK; SNP: Single nucleotide polymorphism; SAE: Stamped addresses envelope. Competing interests JN and PG are in receipt of research grants from Lab 21 Cambridge who are marketing the Respiragene test in the UK and Synergenz Bioscience Ltd. who financed the development of the test from its origins in New Zealand. We initially purchased SmokeScreen kits (for salivary cotinine estimation) from GFC Diagnostics Ltd. But they subsequently supplied 30 kits free of charge. Authors contributions JN and PG developed the idea of a control trial of the Respiragene test after discussions with Aino Telaranta-Keerie of Lab 21 Cambridge. WK was involved in helping to write the protocol and her experience in running smoking cessation clinics was very helpful. PW was our statistical adviser and SdeL helped us to write the protocol in accordance with CONSORT principles and in development of trial methodology. All authors read and approved the final manuscript. Authors information PG is a Visiting Professor of Primary Care at The University of Surrey. SdeL is Professor of Health Care and Clinical Informatics at The University of Surrey. JN is a primary care physician and visiting research fellow at The University of Surrey. WK is a visiting research fellow at The University of Surrey and an experienced smoking cessation nurse. PW is a Statistics Consultant in the Department of Mathematics at The University of Surrey. Pre-publication history The pre-publication history for this paper can be accessed here: http://www.biomedcentral.com/1471-2466/14/77/prepub Supplementary Material Additional file 1 Detailed statistical analysis. Click here for file Acknowledgements We are grateful for the help of Aino Telaranta-Keerie and the staff of Lab 21 for their support and for carrying out the Respiragene tests. We are also indebted to Kevin Murphy of Synergenz for his encouragement and support. Professor Robert Young and his team of Auckland New Zealand developed the Respiragene test and the risk score formula. His advice and guidance has been invaluable. Wetterstrand KA DNA Sequencing Costs Data from the NHGRI Large-Scale Genome Sequencing Program http://en.wikipedia./wiki/Personal_genomics#cite_note-18 Smerecnik C Grispen JEJ Quaak M Effectiveness of testing for genetic susceptibility to smoking-related diseases on smoking cessation outcomes: a systematic review and meta-analysis Tob Control 2012 21 3 347 354 10.1136/tc.2011.042739 21948804 Smith SM Campbell MC Macleod U Factors contributing to the time taken to consult with symptoms of lung cancer: a cross sectional study Thorax 2009 64 1953 531 Sanderson SC ONeill SC White DB Bepler G Bastian L Lipkus IM McBride CM Responses to online GSTM1 genetic test results among smokers related to patients with lung cancer: a pilot study Cancer Epidemiol Biomarkers Prev 2009 18 7 1953 1961 10.1158/1055-9965.EPI-08-0620 19567511 Young RP Hopkins R Black PN Eddy C Wu L Gamble GD Mills GD Garrett JE Eaton TE Rees MI Functional variants of antioxidant genes in smokers with COPD and in those with normal lung function Thorax 2006 61 5 394 399 10.1136/thx.2005.048512 16467073 Young RP Hopkins RJ Christmas T Black PN Metcalf P Gamble GD COPD prevalence is increased in lung cancer independent of age sex and smoking history Eur Respir J 2009 34 2 380 386 10.1183/09031936.00144208 19196816 Young RP Hopkins RJ Hay BA Epton MJ Mills GD Black PN Gardner HD Sullivan R Gamble GD Lung cancer susceptibility model based on age family history and genetic variants [Electronic Resource] 2009 4 4 e5302 .0005302 Young RP Hopkins RJ Hay BA Gamble GD GWAS And Candidate SNPs For COPD And Lung Cancer Combine To Identify Lung Cancer Susceptibility: Validation In A Prospective Study Am J Respir Crit Care Med 2010 181 A3738 Young RP Hopkins RJ Hay BA Epton MJ Mills GD Black PN Gardner HD Sullivan R Gamble GD A gene-based risk score for lung cancer susceptibility in smokers and ex-smokers Postgrad Med J 2009 85 515 524 10.1136/pgmj.2008.077107 19789190 Young RP Hopkins RJ Hay BA Epton MJ Black PN Gamble GD Lung cancer gene associated with COPD: triple whammy or possible confounding effect? Eur Respir J 2008 32 5 1158 1164 10.1183/09031936.00093908 18978134 McBride CM Bepler G Lipkus IM Lyna P Samsa G Albright J Datta S Rimer BK Incorporating genetic susceptibility feedback into a smoking cessation program for African-American smokers with low income Cancer Epidemiol Biomarkers Prev 2002 11 6 521 528 12050092 Sanderson SC Humphries SE Hubbart C Hughes E Jarvis MJ Wardle J Psychological and Behavioural Impact of Genetic Testing Smokers for Lung Cancer Risk: A Phase II Exploratory Trial J Health Psychol 2008 13 481 494 10.1177/1359105308088519 18420756 Wells S de Lusignan S Does screening for loss of lung function help smokers give up? Br J Nurs 2003 12 12 744 750 12829957 Parkes G Greenhalgh T Griffin M Dent R Effect on smoking quit rate of telling patients their lung age: The Step2quit randomised control trial BMJ 2008 336 598 600 10.1136/bmj.39503.582396.25 18326503 Hopkins RJ Young RP Hay B Gamble GD Lung cancer risk testing enhances NRT uptake and quit rates in randomly recruited smokers offered a gene based risk test Am J Respir Crit Care Med 2012 185 A2590 Hopkins RJ Young RP Hay B Gamble GD Gene-based lung cancer risk score triggers smoking cessation in randomly recruited smokers Am J Respir Crit Care Med 2011 183 A5441 West R Shiffman S McLean D Fast Facts: Smoking Cessation (Fast Facts series) Paperback 2007 London: Health Press Young RP Hopkins RJ Smith M Hogarth DK Smoking cessation: the potential role of risk assessment tools as motivational triggers [Review] Postgrad Med J 2010 86 1011 26 33 10.1136/pgmj.2009.084947 20065338 Cabebe E Recruitment details: REACT Clinical Trial Lung Cancer Detection Study http://www.elcaminohospital./Cancer_Center/Clinical_Trials/Lung_Cancer_Detection_Study McClure JB Ludman EJ Grothaus L Pabiniak C Richards J Impact of spirometry feedback and brief motivational counseling on long-term smoking outcomes: a comparison of smokers with and without lung impairment Patient Education & Counseling 2010 80 2 280 283 10.1016/j.pec.2009.11.002 20434863 Sanderson SK Humphries SE Hubbart C Psychological and behavioural impact of genetic testing smokers for lung cancer risk J Health Psychol 2010 13 4 481 494 18420756 Croghan E NHS Local stop smoking services services delivery and monitoring guidance 2011/12 ://www.gov.uk/government/uploads/system/uploads/attachment_data/file/213755/dh_125939.pdf Barnfather KD Cope GF Chapple IL Effect of incorporating a 10 minute point of care test for salivary nicotine metabolites into a general practice based smoking cessation programme: randomised controlled trial BMJ 2005 331 999 10.1136/bmj.38621.463900.7C 16210250 West R Smoking toolkit study: protocol and methods 2006 http://www.smokinginengland.info/sts-documents/ (ST5001) Moher D Hopewell S Schulz KF Montori V Gotzsche PC Devereaux PJ Elbourne D Egger M Altman DG CONSORT 2010 explanation and elaboration: updated guidelines for reporting parallel group randomised trials BMJ 2010 340 c869 10.1136/bmj.c869 20332511 DH/IPU/Patient Confidentiality Department of Health: Confidentiality NHS Code of practice 2003 http://webarchive.nationalarchives.gov.uk/20130107105354/http://www.dh.gov.uk/prod_consum_dh/groups/dh_digitalassets/dh/en/documents/digitalasset/dh_4069254.pdf Lee JH Jones PG Bybee K OKeefe JH A longer course of varenicline therapy improves smoking cessation rates [Review] Prev Cardiol 2008 11 4 210 214 10.1111/j.1751-7141.2008.00003.x 19476573 West R Sohal T Catastrophic pathways to smoking cessation: findings from national survey BMJ 2006 332 458 460 10.1136/bmj.38723.573866.AE 16443610 Kahenda JW Loomis BR Anhikara B Marshall L A review of economic evaluations of tobacco control programs Int J Environ Res Public Health 2009 6 1 51 68 19440269 Sanders D Fowler G Mant D Fuller A Jones L Marzillier J Randomized controlled trial of anti-smoking advice by nurses in general practice J R Coll Gen Pract 1989 39 324 273 276 2556540 Wennike P Danielsson T Björn B Westin A Tøneson P Smoking reduction promotes smoking cessation: results from a double blind randomized placebo-controlled trial of nicotine gum with 2-year follow-up Addiction 2003 98 10 1395 1402 10.1046/j.1360-0443.2003.00489.x 14519176 MacPherson L Stipelman BA Duplinsky M Lejuez CW Distress tolerance and pre-smoking treatment attrition: examination of moderating relationships Addict Behaviour 2008 33 11 1385 1393 10.1016/j.addbeh.2008.07.001 Soulier-Parmeggiani L Griscom S Bongard O Avvanzino R Bounameaux H One-year results of a smoking-cessation programme Journal Suisse de Médecine 1999 129 10 395 398 10212973 PLoS One plos plosone 1932-6203 Public Library of Science San Francisco USA 24642707 3958375 PONE-D-14-01187 .0091811 Research Article Biology and Life Sciences Biochemistry Biomarkers Medicine and Health Sciences Diagnostic Medicine Gastroenterology and Hepatology Gastrointestinal Cancers Oncology Basic Cancer Research Metastasis Cancers and Neoplasms Carcinomas Adenocarcinomas Colon Adenocarcinoma Gastrointestinal Tumors Pathology and Laboratory Medicine Anatomical Pathology Surgical Pathology Molecular Pathology The Clinical Implication of Cancer-Associated Microvasculature and Fibroblast in Advanced Colorectal Cancer Patients with Synchronous or Metachronous Metastases Cancer-Associated Microenvironment in Advanced Colorectal Cancer Kwak Yoonjin 1 2 Lee Hee Eun 1 Kim Woo Ho 1 2 Kim Duck-Woo 3 Kang Sung-Bum 3 Lee Hye Seung 4 * 1 Department of Pathology Seoul National University Hospital Seoul South Korea 2 Department of Pathology Seoul National University College of Medicine Seoul South Korea 3 Department of Surgery Seoul National University Bundang Hospital Seongnam-si Gyeonggi-do South Korea 4 Department of Pathology Seoul National University Bundang Hospital Seongnam-si Gyeonggi-do South Korea Lo Anthony W. I. Editor The Chinese University of Hong Kong Hong Kong * E-mail: hye2snu.ac.kr. Competing Interests: The authors have declared that no competing interests exist. Conceived and designed the experiments: HEL WHK HSL. Performed the experiments: HEL WHK HSL. Analyzed the data: YK HEL HSL. Contributed reagents/materials/analysis tools: HEL WHK DWK SBK HSL. Wrote the paper: YK HEL WHK DWK SBK HSL. 2014 18 3 2014 9 3 e91811 11 1 2014 14 2 2014 2014 Kwak et al This is an open-access article distributed under the terms of the Creative Commons Attribution License which permits unrestricted use distribution and reproduction in any medium provided the original author and source are credited. Background We aimed to evaluate the clinical significance of microvessel density (MVD) lymphatic vessel density (LVD) and cancer-associated fibroblasts (CAFs) in relation to tumor location in advanced colorectal cancer (CRC). Methods Using immunohistochemistry we examined 181 advanced CRC patients for CD31 and D2-40 to measure MVD and LVD respectively ?-smooth muscle actin (SMA) and desmin to identify CAFs and PTEN to examine genetic changes of CAFs. To evaluate the regional heterogeneity of these properties we examined tissue from four sites (the center and periphery of the primary cancer a distant metastasis and a lymph node metastasis) in each patient. Results MVD LVD and CAFs showed significant heterogeneity with respect to the tumor location. LVD was the greatest in the center of the primary cancers and the amount of CAFs was the lowest in distant metastases. In distant metastases those from the lung had higher LVD and MVD but fewer CAFs than those from the liver peritoneum or ovary. Patients with low MVD and LVD in the center of the primary cancer had worse outcomes and patients with few CAFs in distant metastases and in the primary tumor had a lower survival rate. PTEN expression in CAFs in distant metastases was lost in 11 of 181 CRC patients (6.1%) which was associated with a worse prognosis. Conclusions The microenvironment including cancer-associated microvasculature and fibroblasts is heterogeneous with respect to the tumor location in CRC patients. Therefore heterogeneity of microenvironments should be taken into account when managing CRC patients. This study was supported by grant number 03-2011-012 from the Seoul National University Bundang Hospital Research Fund. The funder had no role in study design data collection and analysis decision to publish or preparation of the manuscript. Introduction Although the mortality rates of colorectal cancer (CRC) patients have decreased in most western countries and in several developing countries in Asia advanced CRC patients who initially present with stage IV disease or those who develop distant metastases several months after diagnosis still have a lower five-year survival rate [1] [2]._ENREF_4 Recently the range of systemic chemotherapy has expanded and targeted therapy including epidermal growth factor receptor (EGFR) and vascular endothelial growth factor (VEGF) inhibitor therapies have been used in advanced CRC patients increasing patient survival [3]. However some CRC patients respond poorly to targeted therapy despite presenting positive results in targeted therapy-specific mutation studies [4]. One possible explanation for this therapeutic failure is tumor heterogeneity; several studies have reported that CRCs possess a heterogenic genotype or phenotype including KRAS p53 and BRAF [5][7]. Therefore the differing characteristics of the primary tumor site and the corresponding metastatic an need to be clarified to improve the management of CRC patients with metastatic diseases. Furthermore understanding the clinicopathological characteristics of advanced CRC is important for the development and improvement of systemic therapies. Since Paget et al. first described the cancer microenvironment by the seed and soil theory [8] there has been growing evidence that cancer-associated stroma might affect the cancer cells themselves and contribute to cancer progression [9]. The main components of the cancer microenvironment are microvasculature (microvessels and lymphatic vessels) inflammatory cells and cancer-associated fibroblasts (CAFs) [10][12]. The current method of verifying angiogenetic and lymphangiogenetic activity in cancer tissue is to assess microvessel density (MVD) and lymphatic vessel density (LVD) respectively. MVD has been proposed as a surrogate marker of cancer-associated angiogenesis to identify patients with a high risk of recurrence or those with poor prognoses for various cancers including CRC [13] [14]; however the prognostic correlation of angiogenesis in CRC is still controversial [15] [16]. Similar to angiogenesis LVD has received interest as a means of lymphatic metastasis and survival [17] [18] but its role in tumor progression is still unclear [19]. The other prominent component of stroma CAFs are consistently activated and affect many aspects of tumor initiation invasion and progression [9]. While some studies have suggested that CAFs may inhibit tumor progression [20] [21] other studies have proposed that CAFs may promote progression in prostate breast and skin cancers [22][24]. In the context of CRC Tsujino et al. have suggested that ?-smooth muscle actin (SMA)-expressing CAFs might be a useful indicator of poor prognosis. However these results were restricted to stage II and III CRCs [25]. In addition to cancer cells genetic alterations in CAFs have demonstrated including the loss of heterozygosity microsatellite instability and genetic mutations [26] [27]. Recently genetic inactivation of PTEN in CAFs was reported in breast cancer patients [28]. Trimboli et al. identified that PTEN loss in stromal fibroblasts resulted in extensive extracellular matrix remodeling and angiogenesis which characteristic of tumor progression [28]. However expression loss of PTEN and its clinical significance have not been investigated in colorectal cancer patients. The aim of this study was to investigate the characteristics of microenvironments including microvasculatures and CAFs in advanced CRC patients. Additionally we assessed the intratumoral heterogeneity in the primary tumor and the discordance between primary tumor and distant metastasis microenvironments. Materials and Methods Patient selection A total of 181 advanced CRC patients with synchronous or metachronous metastases who were treated at Seoul National University Bundang Hospital (Seongnam-si South Korea) between 2003 and 2009 were enrolled in this study. Synchronous metastases were defined as distant metastases occurring within six months of the primary diagnosis of CRC and metachronous metastases were those occurring after that time point [29]. " | Lung_Cancer |
"Methods: Twenty-six rabbits with lung VX2 tumor were randomly divided into experimental and control group. In the experimental group microwave ablation guided by ultrasound or CT was performed based on location of the tumor. Enhanced CT scan was carried out immediately before and after the ablation for all animals. Two animals from each group were sacrificed immediately or 1 week after the ablation respectively and the others were followed for the rest of their lives. Results: CT scan revealed that the tumor was greatly reduced or ablated after ablation. Pathological examination immediately after ablation also confirmed the tumor reduction or ablation. The survival time of the animals in the experimental group was significantly longer than that in the control group. Conclusions: Microwave ablation is a safe and effective method for treating lung cancer in rabbits showing potential clinical applicability. Microwave ablation VX2 tumor lung cancer 9421547 4136 Hum Pathol Hum. Pathol. Human pathology 0046-8177 1532-8392 24444464 3965626 10.1016/j.humpath.2013.10.016 NIHMS537247 A PIK3CA mutation detected in plasma from a patient with synchronous primary breast and lung cancers Jelovac Danijela MD 1 * Beaver Julia A. MD 1 * Balukrishna Sasidharan MD 2 Wong Hong Yuen BS 1 Toro Patricia Valda BS 1 Cimino-Mathews Ashley MD 1 Argani Pedram MD 1 Stearns Vered MD 1 Jacobs Lisa MD 1 VanDenBerg Dustin BS 1 Kessler Jill BS 1 Jeter Stacie BS 1 Park Ben H. MD PhD 1 Wolff Antonio C. MD 1 1The Sidney Kimmel Comprehensive Cancer Center at Johns Hopkins 1650 Orleans Street Baltimore MD 21287 2Christian Medical College Vellore Tamil Nadu India 632004 * These authors contributed equally to this work 18 12 2013 31 10 2013 4 2014 01 4 2015 45 4 880 883 2013 Elsevier Inc. All rights reserved. 2013 Digital PCR is a new technology that enables detection and quantification of cancer DNA molecules from peripheral blood. Using this technique we identified mutant PIK3CA DNA in circulating plasma tumor DNA (ptDNA) from a patient with concurrent early stage breast cancer and non-small cell lung cancer. The patient underwent successful resection of both her breast and lung cancers and using standard Sanger sequencing the breast cancer was shown to harbor the identical PIK3CA mutation identified in peripheral blood. This case report highlights potential applications and concerns that can arise with the use of ptDNA in clinical oncology practice. plasma tumor DNA breast cancer lung cancer PIK3CA digital PCR Br J Cancer Br. J. Cancer British Journal of Cancer 0007-0920 1532-1827 Nature Publishing Group 24983368 4102953 bjc2014353 10.1038/bjc.2014.353 Genetics and Genomics Assessing standardization of molecular testing for non-small-cell lung cancer: results of a worldwide external quality assessment (EQA) scheme for EGFR mutation testing Worldwide external quality assessment for EGFR gene mutation testing Patton S 1 * Normanno N 2 Blackhall F 3 Murray S 4 Kerr K M 5 Dietel M 6 Filipits M 7 Benlloch S 8 Popat S 9 Stahel R 10 Thunnissen E 11 1EMQN Manchester Centre for Genomic Medicine St Mary's Hospital Manchester M13 9WL UK 2Cell Biology and Biotherapy Unit Istituto Nazionale per lo Studio e la Cura dei Tumori Fondazione Giovanni Pascale'IRCCS 80131 Naples Italy 3Christie Hospital Manchester M20 4BX UK 4Biomarker Solutions Ltd London EC1V 2NX UK 5Department of Pathology Aberdeen Royal Infirmary Aberdeen AB25 2ZN UK 6Charit Humboldt-Universitt zu Berlin Berlin 10117 Germany 7Medical University of Vienna 1010 Vienna Austria 8Pangaea Biotech USP Dexeus University Institute Barcelona 08028 Spain 9Royal Marsden Hospital London SW3 6JJ UK 10University Hospital Z¼rich CH-8091 Z¼rich Switzerland 11Department of Pathology VU University Medical Center Amsterdam 1081 HZ The Netherlands *E-mail: simon.pattoncmft.nhs.uk 15 07 2014 01 07 2014 15 7 2014 111 2 413 420 22 01 2014 19 05 2014 20 05 2014 Copyright 2014 Cancer Research UK 2014 Cancer Research UK This work is licensed under the Creative Commons Attribution-NonCommercial-Share Alike 3.0 Unported License. To view a copy of this license visit http://creativecommons./licenses/by-nc-sa/3.0/ Background: The external quality assurance (EQA) process aims at establishing laboratory performance levels. Leading European groups in the fields of EQA Pathology and Medical and Thoracic Oncology collaborated in a pilot EQA scheme for somatic epidermal growth factor receptor (EGFR) gene mutational analysis in non-small-cell lung cancer (NSCLC). Methods: EQA samples generated from cell lines mimicking clinical samples were provided to participating laboratories each with a mock clinical case. Participating laboratories performed the analysis using their usual method(s). Anonymous results were assessed and made available to all participants. Two subsequent EQA rounds followed the pilot scheme. Results: One hundred and seventeen labs from 30 countries registered and 91 returned results. Sanger sequencing and a commercial kit were the main methodologies used. The standard of genotyping was suboptimal with a significant number of genotyping errors made. Only 72 out of 91 (72%) participants passed the EQA. False-negative and -positive results were the main sources of error. The quality of reports submitted was acceptable; most were clear concise and easy to read. However some participants reported the genotyping result in the absence of any interpretation and many obscured the interpretation required for clinical care. Conclusions: Even in clinical laboratories the technical performance of genotyping in EGFR mutation testing for NSCLC can be improved evident from a high level of diagnostic errors. Robust EQA can contribute to global optimisation of EGFR testing for NSCLC patients. non-small-cell lung carcinoma EGFR gene mutations quality assessment Assessment of epidermal growth factor receptor (EGFR) mutations has become mandatory to choose the most active first-line treatment for patients with advanced non-small-cell lung cancer (NSCLC). Indeed randomized phase III clinical trials have demonstrated that first-line administration of an EGFR TKI results in a prolonged progression-free survival as compared with chemotherapy in patients carrying EGFR mutations (Mok et al 2009; Maemondo et al 2010; Mitsudomi et al 2010; Fukuoka et al 2011; Zhou et al 2011; Rosell et al 2012). These studies have also confirmed that EGFR mutations are a reliable marker that predicts sensitivity to EGFR TKIs (Mok et al 2009). Activating mutations occur in exons 18 through 21 of the TK domain of the EGFR gene and either point mutations or in-frame small deletions or insertions (Sharma et al 2007; De Luca and Normanno 2010). Although more than 250 mutations of the EGFR gene have been described to date two mutations a single point mutation in exon 21 the L858R and a series of small in-frame deletions in exon 19 account for ?90% of all EGFR mutations (Sharma et al 2007; Linardou et al 2008). EGFR mutations are strongly associated with defined clinical and pathological features: they are far more frequent in female patients as compared with male; in adenocarcinoma as compared with other histological types; in non-smokers as compared with current smokers or former smokers; and in East-Asian NSCLC patients as compared with Non-East-Asian patients (Normanno et al 2006). External quality assessment (EQA) is a system of objectively checking laboratory results by an independent external agency (van Krieken et al 2013). The main objective of an EQA programme is to establish inter-laboratory comparability. In this respect the EQA process can identify latent systematic errors in methodology that may not be revealed by a laboratory's own internal QA processes. Representatives from ETOP ESMO ESP EMQN and other leading European groups met in July 2010 to discuss a pan-European approach to EQA for EGFR mutation testing in NSCLC. In this paper we present the results of this pilot EQA scheme for EGFR testing that was completed in 2013. Materials and Methods anisation of the scheme A meeting was anised in July 2010 by ETOP and EMQN to bring together a group of professionals representing EMQN ESP ETOP ESMO and other leading European groups involved in NSCLC testing (see Supplementary Information). From this group a steering group of five individuals was formed who planned designed and assessed the results of the pilot EQA scheme. The scheme was coordinated and administered by the EMQN and three rounds were anised within a period of 18 months. The workflow of the scheme process is shown in Figure 1. Validation of samples The primary aim of this scheme was to develop a flexible scalable EQA scheme designed to assess issues related to techniques and minimum detection limits used in standard laboratory practice focusing exclusively on the analytical (that is sample processing genotyping) and reporting phases (interpretation of the results in relation to the clinical context). To enable this and to avoid the significant challenges of sample heterogeneity in real tissue samples 20 artificial materials were used composed of formalin-fixed paraffin-embedded (FFPE) cell line samples. These EQA materials were designed to mimic real tissue samples as closely as possible and contained homogenous mixtures of mutant vs wild-type cell lines at a range of different allelic ratios. The paraffin blocks were cut and 10??m sections placed in eppendorf tube at the Pathology department of the VU University Medical Centre in Amsterdam The Netherlands by Dr Erik Thunnissen. H&E (4??m) sections were used to estimate the number of tumour cells. In each EQA sample section at least 200 nuclei were present (usually >300) roughly mimicking the amount of cells from a small NSCLC biopsy. For each EQA sample one 10-?m-thick section was sent by EMQN to each of the three validating laboratories for mutational analysis in a blinded fashion. Different sections from the block were analysed for EGFR mutation status to ensure that the mutation was homogeneously represented within each block. The validating laboratories independently analysed the samples by using three different approaches: direct sequencing of the PCR product for exons 1821 mutations; fragment analysis for exon 19 deletions and an allelic discrimination-based real-time PCR assay for the L858R mutation in exon 21; and the Therascreen EGFR RGQ kit (Qiagen Hilden Germany) reporting the results directly to the EMQN. The allelic ratios of mutations in each sample used in rounds 2 and 3 were accurately quantified by a commercial sponsor (Horizon Diagnostics Cambridge UK) using droplet digital PCR (ddPCR) on a BioRad QX100 (Hercules CA USA) platform. Genomic DNA (gDNA) was extracted from FFPE sections on the Promega (Madison WI USA) Maxwell System using the Maxwell 16 FFPE Plus LEV DNA purification kit according to the manufacturer's protocol. Quantification was performed using a Promega QuantiFluor dsDNA assay kit according to the manufacturer's protocol. ddPCR was performed using Taqman custom SNP 40 primer/probe assays (Life Technologies Carlsbad CA USA) to assess the frequency of each mutation with the exception of the p.(E746_A750) assay which was designed in-house. DNA (40?ng) was added to each ddPCR reaction. Reactions were performed in quadruplicate and droplets were generated using a Droplet Generator according to the manufacturer's instructions. PCR was performed on a standard thermocycler using previously optimised assay-specific cycling conditions. Droplets were analysed using a QX100 Droplet Reader as described in the manufacturer's instructions. Data from at least 45?000 useable droplets were collected for each sample. Formalin-fixed paraffin-embedded reference standards (Horizon Diagnostics) were included as assay controls. Registration of participant laboratories and shipment of samples Laboratories that performed EGFR mutational analysis were invited to participate in the EQA via an open call from the EMQN in conjunction with the ESP ETOP and ESMO. Participating laboratories registered via the EMQN website (European Molecular Genetics Quality Network (EMQN) 2014) and were requested to perform DNA extraction and analysis using their routine method. In each round 10 samples (one 10-?m-thick section for each) with accompanying mock clinical referral information were sent to participating laboratory. Each laboratory was identified only by a unique EMQN ID code to avoid exchange of information between participants and minimise bias in the results' interpretation process. The laboratories were given 8 weeks to complete their analyses and to submit the results of genotyping to the EMQN website. The centres were requested to provide information on the technique used for mutational analysis and metrics relating to their experience of performing EGFR mutational analyses. Evaluation of results The scheme included three rounds: the first was restricted to a maximum of 30 labs to establish proof of principle and validate the materials. A subsequent second round of the scheme was anised with no restriction on participation. Laboratories that failed the second round were provided with another set of samples in a restricted third round. The steering group evaluated the results according to a pre-defined scoring system. The scoring system assigned two points to correct genotype and zero points to false-positive or -negative results (Table 1). Errors in mutation nomenclature that might lead to misinterpretation of the results (for example stating deletion' without specifying the exon in which the deletion occurs) were assigned 1.50 points. This deduction was applied only once for each center generally to the first sample for which the error was found. One point was awarded for cases in which the genotype was mispositioned or miscalled: this error sometimes occurs with exon 19 deletions for which it might be difficult to define the precise base or amino acid in which the deletion starts or ends. If a test failed giving no result on the sample (analytical failure) then the lab received 1.00 point for that sample. The threshold to pass the EQA was set at a total score for the 10 samples of ?18 out of 20 (Thunnissen et al 2011) laboratories with a genotyping score <18 were classified as poor performers (applied to rounds 2 and 3 only). Performance in the assessment of clinical interpretation and reporting did not contribute to poor performance. Results Selection of the samples for the EQA The first step of the EQA scheme was the selection and the validation of the samples. Twenty materials were manufactured by Dr Thunnissen by mixing four lung cancer cell lines (A549 EGFR wild type) H1650 (EGFR p.(E746_A750del) H1975 (EGFR p.(T790M) p.(L858R)) and SW48 (p.G719S). Cell lines with mutations were serially diluted into A549 or SIHA cells at different ratios relevant to establishing the analytical sensitivity of the tests used by labs. Each material was validated in three different reference laboratories using different techniques to confirm the genotype and the results showed that the mutations were detectable at all the designated ratios dependent on the technology used (Table 2). A good yield of gDNA was obtained from all the samples. In addition there was complete concordance on the EGFR mutational status of the selected specimens and therefore all were selected for use in the quality assessment scheme with samples A1A10 used for the pilot and B110 and C1C10 in subsequent rounds 2 and 3. To accurately establish quantitative measurements of the allelic frequencies of the EGFR mutations all 10 EQA samples (Table 2; samples B/C1B/C10) used in rounds 2 and 3 were analysed on a ddPCR platform (BioRad QX100). Three of the samples had allelic frequencies higher than expected (C3 C8 and C9) two were lower (C2 and C10) and in one (C5) it was not possible to establish the true value due to insufficient availability of sample material (Table 3). First round proof of principle pilot scheme Twenty-nine laboratories registered from 13 countries and 25 participated in the pilot EQA scheme (4 labs withdrew due to customs sample importation problems) which was run in fourth quarter of 2011. A set of 10 samples were sent to the laboratories (Table 2; samples A1A10). All the participating laboratories submitted results within the 8-week time frame. The main methodology used by the participants was PCR/sequencing (n=10 laboratories; 34%) and real-time PCR (n=10; 34%) (Figure 2). Two analytical errors (false-negative results) were observed. A further five laboratories made process errors (sample swaps) that resulted in an additional 24 genotype errors. In all cases the genotypes were correct but reported for the wrong sample. Therefore 92% of the false-negative results were concentrated in five laboratories. No false-positive results were reported. The materials performed well and there were no analytical test failures. As this was designed to ascertain proof of principle we did not apply a measure of successful laboratory performance. The pilot established that the scheme design and methods used were acceptable for use in a larger scheme. Second round One hundred and seventeen laboratories from 30 countries registered and 101 participated in the second round (due to customs issues we were not able to get samples to 16 labs) run in the second quarter of 2012. Ninety-one laboratories submitted results within the 8-week time frame the remaining 10 labs gave no reason why they did not submit results. A different set of samples from those used in the pilot first round were sent to the laboratories with the emphasis being on the inclusion of mutations at allelic frequencies that would challenge the analytical sensitivity of all the commonly used technologies (Table 2; samples B1B10). A code number different from the one assigned in the first round was given to the samples. In addition to the genotype results all participating laboratories were also required to submit for assessment copies of their clinical reports for three samples (B1 B4 and B9). The main methodology used by the participants was PCR/sequencing (n=35 laboratories; 39%) and real-time PCR (n=17; 18.6% Figure 2). It was common for labs to use a combination of different methodologies in their testing process (Table 4). A variety of different errors were detected by the second scheme round including 74 (8.1%) genotype errors (false-positive (n=13; 1.5%) false-negative (n=61; 82.4%) and a combination of false-negative and -positive results (n=1; 1.4%)) as well as analytical test failures (n=31; 3.4%) mispositioning of the genotype (n=7; 0.8%) and significant errors in the mutation nomenclature (n=36; 3.9%). Two samples (B2 and B8) gave a disproportionately high error rate compared with the other samples used in this round (Table 5) with 94.1% of errors for B2 made by labs using PCR/sequencing vs 40.7% of errors for sample B8 made by labs using a version of the Therascreen EGFR kit (Qiagen). Laboratories did not lose marks if the declared limitations of their assay meant that they would not detect a particular mutation at the given frequency used in the EQA materials. Eighteen laboratories (19.8%) from 13 countries with a total score below 18 did not pass the second round and were thus classified as poor performers 72.2% of these labs used PCR/Sequencing as their main diagnostic test for EGFR mutation status. " | Lung_Cancer |
"These results indicate that FTSJ2 is involved in the inhibition of cancer cell migration and invasion. .0090818.g006 Inhibition of cell migration and invasion upon the over-expression of hFTSJ2 in TE671 cancer cells. (A) The wound healing assay showing that the TE671-hFTSJ2 cells had a reduced migration compared with the untransfected TE671 cells at 12 hours after wounding. (B) Cell migration area at 12 hours after wounding ([healing area/wounding area]100%). (C) Invasion assay showing that the TE671-hFTSJ2 cells had a reduced invasion compared with the untransfected TE671 cells. The cells that penetrated the Trans-well membrane are shown in purple. (D) Quantity of the cells that invaded the Trans-well membrane ([Giemsa positive area/total area]100%). The values are equal to?=?the means±SE; n?=?3; *P<0.05 vs. untransfected TE671 cells. Discussion In this study we characterized the mammalian FTSJ2 protein which we presumed to be an ortholog of E. coli RrmJ. RrmJ is known as a 2?-O-ribose MTase which methylates U2552 in the A-loop of the peptidyl transferase center in the 23S rRNA [5]. Um2552 is one of the four 2?-O-methylated nucleotides in rRNA [6]. In a previous study a lack of U2552 methylation has been found to influence the tertiary interactions of U2552 U2555 and C2556; to reduce the conformational dynamics of the A-loop [8]; and to subsequently decrease the ribosome stability and translation efficiency [7] [9] [37]. These results indicate the importance of RrmJ and the methylation of U2552. In our phylogenetic analysis in this study the RrmJ homologs clustered into the following three groups in Eukaryota: FTSJ1/Trm7p FTSJ2/Mrm2p and FTSJ3/Spb1p (). In a comparison of the divergent distance between RrmJ and the ancestral roots of each group FTSJ2/Mrm2p showed the closest relation to RrmJ. In the FTSJ2/Mrm2p protein group S. cerevisiae Mrm2p has been studied extensively. In the mitochondrial rRNA of S. cerevisiae only three nucleotides are modified including the U2791 of the 21S rRNA which is 2?-O-ribose-methylated by Mrm2p. It has been proposed that Mrm2p is the mitochondrial RrmJ ortholog in S. cerevisiae according to the equivalent catalytic positions of Um2791 in the S. cerevisiae mitochondrial 21S rRNA and Um2552 in the E. coli 23S rRNA [6] [12]. However mammalian FTSJ2 remains uncharacterized. Thus we performed a sequence alignment of human FTSJ2 with RrmJ Mrm2p and FtsJ2 in M. jannaschii and three typological invertebrate species () and we compared the 3D structures of RrmJ human FTSJ2 and porcine FTSJ2 (Figure S1). A previous study showed the highly conserved catalytic tetrad K-D-K-E in site-specific 2?-O-ribose MTases [10] and this catalytic tetrad was also present in our sequence alignment. Furthermore a sequence alignment revealed the highly conserved amino acids involved in SAM binding. However interestingly the 3D structure of human FTSJ2 showed a different orientation for the first residue of the catalytic tetrad (lysine) compared with RrmJ. This difference may indicate a different A-loop structure of the rRNA substrate or a different catalytic mechanism of the FTSJ2/Mrm2p protein in mammals. Because S. cerevisiae Mrm2p is localized in the mitochondria [12] we hypothesized that hFTSJ2 is a mitochondrial protein. We used immunofluorescence and Western blot analysis to verify that hFTSJ2 was predominantly located in the mitochondria but not in the nucleus or cytoplasm (Figures 3C and 3D). In addition E. coli RrmJ is well known as a heat shock protein. The rrmJ mRNA expression increases over 20-fold after heat shock [3] and the rrmJ deletion strain fails to adapt to heat shock temperatures [7]. In S. cerevisiae the growth of the mrm2 deletion strain at 37°C is slightly reduced on glucose-containing medium and severely reduced on glycerol-containing medium [12]. Thus to evaluate the heat shock response of the RrmJ ortholog in mammals we tested the heat shock response of piglets at 30°C or 35°C. The large intestine lung and bladder showed an up-regulated expression of Ftsj2 mRNA at temperatures of 30°C and 35°C but only the lung tissue demonstrated a simultaneous heat shock response with the up-regulation of Hsp70.2 mRNA (). This finding in the lung may have been caused by the direct exposure of this tissue to the increased temperature through the inhalation of hot air. However under these heat shock treatments for the piglets only 5 (small intestine muscle lung kidney and liver) of the 11 tissues showed an up-regulation tendency of Hsp70.2 expression possibly because of the systemic effect of the response of the warm-blooded piglets to the heat shock stress. Furthermore to eliminate this systemic effect and to confirm the FTSJ2 mRNA up-regulation in the lung a human lung adenocarcinoma cell line (A549) was subjected to heat shock for 1 hour and allowed to recover at 37°C. The results of this experiment showed a 1.5-fold increase in the hFTSJ2 expression at both 42°C and 45°C and then a gradual return to its normal level after the recovery period (). Although the exact role of FTSJ2 in the heat shock response in mammals is unknown these results indicate that FTSJ2 inherited the HSP characteristics of its orthologs in E. coli and S. cerevisiae. In the previous studies of HSPs such as HSP70 and HSP90 it has been demonstrated that the heat shock responses are highly conserved during evolution. From Prokaryota to Eukaryota and Protozoa to Metazoa the HSPs represented the universal protein structures and similar physiological functions and following evolution the HSPs diverged and translocated into different anelles [1] [2] [38][40]. These characteristics are in alignment with the results of the RrmJ phylogenic analysis and the conservation of the heat shock response properties in mammals. In addition to certain small HSPs (i.e. HSP32 HSP25 and HSP22) most of the HSPs are expressed in all types of tissues [2] [41] and our results showed that Ftsj2 was expressed in all of the 13 normal piglet tissues (Figure S2). These results indicated that FTSJ2 was not only involved in the heat shock response but also might be necessary for mitochondrial functions under normal condition according to the mitochondrial localization of FTSJ2. In addition previous functional studies have shown that the HSPs (i.e. HSP70 and HSP90) are involved in tumorigenesis and the inhibition of apoptosis in cancer cells [40] [42][44]. Similarly the amplification of the genetic locus of FTSJ2 has been discovered in several NSCLC clinical samples and was considered as a novel oncogenic locus [20]. In our study the expression of FTSJ2 was also shown in different cancer cells (hepatocarcinoma lung adenocarcinoma and rhabdomyosarcoma cells). However in the human lung adenocarcinoma cell sublines CL1-0 and CL1-5 [45] we found that hFTSJ2 mRNA was decreased in the more invasive CL1-5 cells compared with the less invasive CL1-0 cells. Moreover the TE671-hFTSJ2 cells which over-expressed the hFTSJ2 protein showed a decrease in cell migration and invasion (). These results indicate that the mitochondrial hFTSJ2 protein exhibits an additional function to suppress cancer cell metastasis. Previous reports have suggested that hFTSJ2 functions in the mitochondria. Thus it is reasonable that FTSJ2 is required for extensive ATP production through respiration in the mitochondria of proliferating cancer cells [46][48]. In contrast according to recent studies a mitochondrial complex I and NAD+/NADH imbalance enhances the metastasis of breast cancer cell lines [49] and the dynamics of mitochondrial fusion or fission also regulates cell migration and invasion [50] [51]. These results indicate that the invasiveness of cells is affected by the condition and state of their mitochondria. In we characterized FTSJ2 as an ortholog of the E. coli 23S rRNA 2?-O-ribose MTase and showed that it functions in the mitochondria. We also provided evidence that FTSJ2 is a novel heat shock protein that is over-expressed after heat shock treatment in both piglet lung and lung adenocarcinoma cells. Surprisingly FTSJ2 may also be involved in the inhibition of cancer cell migration and invasion by influencing the mitochondrial functions. Accession Numbers The GenBank accession numbers of the protein sequences which were used in the phylogenetic tree construction and the protein sequences alignment are labeled in and . The protein coding regions of the porcine Ftsj1 and Ftsj2 mRNA were first sequenced in this study and the GenBank accession numbers of the corresponding porcine Ftsj1 and Ftsj2 mRNA are EU694401 and EU694400 respectively and the porcine FTSJ1 and FTSJ2 proteins are ACH57153 and ACH57152 respectively. Supporting Information Figure S1 Three-dimensional protein structures of E. coli RrmJ human FTSJ2 and porcine FTSJ2. (A) The protein structure of E. coli RrmJ which was resolved by B¼gl et al. (2000) (PDB ID: 1EIZ) [7]. (B) The protein structure of human FTSJ2 which was resolved by Wu et al. (2009) (PDB ID: 2NYU) [36]. (C) The protein structure of porcine FTSJ2 which was predicted using the SWISS-MODEL website with human FTSJ2 as a template. The ?-helices and ?-strands are shown in green and yellow respectively. The SAM residues and the K-D-K-E catalytic center are shown in the ball and stick representations respectively. (TIF) Click here for additional data file. Figure S2 Porcine Ftsj2 mRNA expression in porcine tissues. (A) Expression of porcine Ftsj2 mRNA as measured by semi-quantitative RT-PCR. Porcine ?-actin mRNA was used as a loading control. (B) Quantification of the porcine Ftsj2 mRNA expression which normalized to the ?-actin mRNA expression. The values are equal to?=?the means of duplicate experiments. (TIF) Click here for additional data file. The authors would like to thank Dr. Jeremy J.W. Chen for providing the CL1-0 and CL1-5 cell lines. We also like to thank our colleagues (Drs. Tung-Chou Tsai Yu-Tang Tung and Zi-Lun Lai) in the Molecular Embryology and DNA Methylation Laboratory for their help with discussions and technical issues. References 1 AngM LiberekK SkowyraD ZyliczM GeopoulosC (1991) Biological role and regulation of the universally conserved heat shock proteins. J Biol Chem266: 24233242361761528 2 BenjaminIJ McMillanDR (1998) Stress (heat shock) proteins: molecular chaperones in cardiovascular biology and disease. Circ Res83: 1171329686751 3 RichmondCS GlasnerJD MauR JinH BlattnerFR (1999) Genome-wide expression profiling in Escherichia coli K-12. Nucleic Acids Res27: 3821383510481021 4 OguraT TomoyasuT YukiT MorimuraS BeggKJ et al (1991) Structure and function of the ftsH gene in Escherichia coli. Res Microbiol142: 2792821925026 5 CaldasT BinetE BoulocP CostaA DesgresJ et al (2000) The FtsJ/RrmJ heat shock protein of Escherichia coli is a 23 S ribosomal RNA methyltransferase. J Biol Chem275: 164141641910748051 6 LapeyreB (2004) Conserved ribosomal RNA modification and their putative roles in ribosome biogenesis and translation. Curr Genet12: 263284 7 B¼glH FaumanEB StakerBL ZhengF KushnerSR et al (2000) RNA methylation under heat shock control. Mol Cell6: 34936010983982 8 BlanchardSC PuglisiJD (2001) Solution structure of the A loop of 23S ribosomal RNA. Proc Natl Acad Sci USA98: 3720372511259644 9 CaldasT BinetE BoulocP RicharmeG (2000) Translational defects of Escherichia coli mutants deficient in the Um(2552) 23S ribosomal RNA methyltransferase RrmJ/FTSJ. Biochem Biophys Res Commun271: 71471810814528 10 FederM PasJ WyrwiczLS BujnickiJM (2003) Molecular phylogenetics of the RrmJ/fibrillarin superfamily of ribose 2?-O-methyltransferases. Gene302: 12913812527203 11 PintardL LecointeF BujnickiJM BonnerotC GrosjeanH et al (2002) Trm7p catalyses the formation of two 2?-O-methylriboses in yeast tRNA anticodon loop. EMBO J21: 1811182011927565 12 PintardL BujnickiJM LapeyreB BonnerotC (2002) MRM2 encodes a novel yeast mitochondrial 21S rRNA methyltransferase. EMBO J21: 1139114711867542 13 BonnerotC PintardL LutfallaG (2003) Functional redundancy of Spb1p and a snR52-dependent mechanism for the 2?-O-ribose methylation of a conserved rRNA position in yeast. Mol Cell12: 1309131514636587 14 KresslerD RojoM LinderP CruzJ (1999) Spb1p is a putative methyltransferase required for 60S ribosomal subunit biogenesis in Saccharomyces cerevisiae. Nucleic Acids Res27: 4598460810556316 15 LapeyreB PurushothamanSK (2004) Spb1p-directed formation of Gm2922 in the ribosome catalytic center occurs at a late processing stage. Mol Cell16: 66366915546625 16 PintardL KresslerD LapeyreB (2000) Spb1p is a yeast nucleolar protein associated with Nop1p and Nop58p that is able to bind S-adenosyl-L-methionine in vitro. Mol Cell Biol20: 1370138110648622 17 HagerJ StakerBL B¼glH JakobU (2002) Active site in RrmJ a heat shock-induced methyltransferase. J Biol Chem277: 419784198612181314 18 YangD OyaizuY OyaizuH OlsenGJ WoeseCR (1985) Mitochondrial origins. Proc Natl Acad Sci USA82: 444344473892535 19 FreudeK HoffmannK JensenLR DelatyckiMB des PortesV et al (2004) Mutations in the FTSJ1 gene coding for a novel S-adenosylmethionine-binding protein cause nonsyndromic X-linked mental retardation. Am J Hum Genet75: 30530915162322 20 CampbellJM LockwoodWW BuysTP ChariR CoeBP (2008) Integrative genomic and gene expression analysis of chromosome 7 identified novel oncogene loci in non-small cell lung cancer. Genome51: 1032103919088816 21 MorelloLG ColtriPP QuaresmaAJ SimabucoFM SilvaTC (2011) The human nucleolar protein FTSJ3 associates with NIP7 and functions in pre-rRNA processing. PLoS One6: e2917422195017 22 SimabucoFM MorelloLG Arag£oAZ Paes LemeAF ZanchinNI (2012) Proteomic characterization of the human FTSJ3 preribosomal complexes. J Proteome Res11: 3112312622540864 23 WangH BoisvertD KimKK KimR KimSH (2000) Crystal structure of a fibrillarin homologue from Methanococcus jannaschii a hyperthermophile at 1.6 A resolution. EMBO J19: 31732310654930 24 HodelAE GershonPD QuiochoFA (1998) Structural basis for sequence-nonspecific recognition of 5?-capped mRNA by a cap-modifying enzyme. Mol Cell1: 4434479660928 25 VidgrenJ SvenssonLA LiljasA (1994) Crystal structure of catechol O- methyltransferase. Nature368: 3543588127373 26 TamuraK PetersonD PetersonN StecherG NeiM et al (2011) MEGA5: molecular evolutionary genetics analysis using maximum likelihood evolutionary distance and maximum parsimony methods. Mol Biol Evol28: 2731273921546353 27 PollastriG McLysaghtA (2005) Porter: a new accurate server for protein secondary structure prediction. Bioinformatics21: 1719172015585524 28 LiuFC ChenHL ChongKY HsuAL ChenCM (2008) Production of recombinant porcine colipase secreted by Pichia pastoris and its application to improve dietary fat digestion and growth of postweaning piglets. Biotechnol Prog24: 1333134119194948 29 LiuFC ChenHL LinW TungYT LaiCW et al (2010) Application of porcine lipase secreted by Pichia pastoris to improve fat digestion and growth performance of postweaning piglets. J Agric Food Chem58: 3322332920166658 30 ChangTP YuSL LinSY HsiaoYJ ChangGC et al (2010) Tumor suppressor HLJ1 binds and functionally alters nucleophosmin via activating enhancer binding protein 2alpha complex formation. Cancer Res70: 1656166720145123 31 HuangJT TsengCP LiaoMH LuSC YehWZ et al (2013) Hepatitis C virus replication is modulated by the interaction of nonstructural protein NS5B and fatty acid synthase. J Virol87: 4994500423427160 32 TungYT ChenHL LeeCY ChouYC LeePY et al (2013) Active component of danshen (Salvia miltiorrhiza Bunge) Tanshinone I attenuates lung tumorigenesis via inhibitions of VEGF Cyclin A and Cyclin B expressions. Evid Based Complement Alternat Med2013: e319247 33 ChenHL LaiYW ChenCS ChuTW LinW et al (2008) Probiotic Lactobacillus casei expressing human lactoferrin elevates antibacterial activity in the gastrointestinal tract. Biometals23: 54355420148305 34 TungYT ChenHL YenCC LeePY TsaiHC et al (2013) Bovine lactoferrin inhibits lung cancer growth through suppression of both inflammation and expression of vascular endothelial growth factor. J Dairy Sci96: 2095210623462173 35 TsaiSW TungYT ChenHL ShenCJ ChuangCH et al (2013) Treadmill running upregulates the expression of acetylcholine receptor in rat gastrocnemius following botulinum toxin A injection. J Orthop Res31: 12513122733692 36 Wu H Dong A Zeng H Loppnau P Weigelt J et al. (2009) PDB ID: 2NYU. 37 WiderakM KernR MalkiA RicharmeG (2005) U2552 methylation at the ribosomal A-site is a negative modulator of translational accuracy. Gene347: 10911415715963 38 LindquistS (1986) The heat-shock response. Annu Rev Biochem55: 115111912427013 39 Radosevic-StasicB JakovacH GrebicD TrobonjacaZ Mrakovcic-SuticI et al (2012) Heat shock protein Gp96 as potential regulator of morphostasis after partial hepatectomy in mice. Curr Aging Sci5: 25426223387888 40 SiegelinMD (2013) Inhibition of the mitochondrial Hsp90 chaperone network: a novel efficient treatment strategy for cancer?Cancer Lett333: 13314623376257 41 VerschuureP TatardC BoelensWC GrongnetJF DavidJC (2003) Expression of small heat shock proteins HspB2 HspB8 Hsp20 and cvHsp in different tissues of the perinatal developing pig. Eur J Cell Biol82: 52353014629120 42 MosserDD MorimotoRI (2004) Molecular chaperones and the stress of oncogenesis. Oncogene23: 2907291815077153 43 LeeHW LeeEH KimSH RohMS JungSB et al (2013) Heat shock protein 70 (HSP70) expression is associated with poor prognosis in intestinal type gastric cancer. Virchows Arch463: 48949523913168 44 YangX WangJ ZhouY WangY WangS et al (2012) Hsp70 promotes chemoresistance by blocking Bax mitochondrial translocation in ovarian cancer cells. Cancer Lett321: 13714322281241 45 ChuYW YangPC YangSC ShyuYC HendrixMJ et al (1997) Selection of invasive and metastatic subpopulations from a human lung adenocarcinoma cell line. Am J Respir Cell Mol Biol17: 3533609308922 46 ChengZ RistowM (2013) Mitochondria and metabolic homeostasis. Antioxid Redox Signal19: 24024223432475 47 ChoiI KimJ JeongHK KimB JouI et al (2013) PINK1 deficiency attenuates astrocyte proliferation through mitochondrial dysfunction reduced AKT and increased p38 MAPK activation and downregulation of EGFR. Glia61: 80081223440919 48 KangR TangD SchapiroNE LouxT LiveseyKM et al (2013) The HMGB1/RA GE inflammatory pathway promotes pancreatic tumor growth by regulating mitochondrial bioenergetics. Oncogene33: 56757723318458 49 SantidrianAF Matsuno-YagiA RitlandM SeoBB LeBoeufSE et al (2013) Mitochondrial complex I activity and NAD+/NADH balance regulate breast cancer progression. J Clin Invest123: 1068108123426180 50 LinCS LeeHT LeeSY ShenYA WangLS et al (2012) High mitochondrial DNA copy number and bioenergetic function are associated with tumor invasion of esophageal squamous cell carcinoma cell lines. Int J Mol Sci13: 112281124623109849 51 ZhaoJ ZhangJ YuM XieY HuangY et al (2013) Mitochondrial dynamics regulates migration and invasion of breast cancer cells. Oncogene32: 4814482423128392 J Thorac Oncol J Thorac Oncol JTO Journal of Thoracic Oncology 1556-0864 1556-1380 Lippincott Williams & Wilkins 24419415 4132025 00009 10.1097/JTO.0000000000000048 Original Articles Non-Small Cell Lung Cancer Effectiveness of Gefitinib against NonSmall-Cell Lung Cancer with the Uncommon EGFR Mutations G719X and L861Q Watanabe Satoshi MD PhD * Minegishi Yuji MD PhD Yoshizawa Hirohisa MD PhD * Maemondo Makoto MD PhD ¡ Inoue Akira MD PhD § Sugawara Shunichi MD PhD ? Isobe Hiroshi MD PhD ¶ Harada Masao MD PhD # Ishii Yoshiki MD PhD ** Gemma Akihiko MD PhD Hagiwara Koichi MD PhD Kobayashi Kunihiko MD PhD ¡¡ *Bioscience Medical Research Center Niigata University Medical and Dental Hospital Niigata Japan; Department of Internal Medicine Division of Pulmonary Medicine Infections Disease and Oncology Nippon Medical School Tokyo Japan; ¡Department of Respiratory Medicine Miyagi Cancer Center Miyagi Japan; §Department of Respiratory Medicine Tohoku University Sendai Japan; ?Department of Pulmonary Medicine Sendai Kousei Hospital Sendai Japan; ¶Department of Medical Oncology KKR Sapporo Medical Center Sapporo Japan; #Department of Respiratory Medicine National Hospital anization Hokkaido Cancer Center Sapporo Japan; **Department of Pulmonary Medicine and Clinical Immunology Dokkyo Medical University School of Medicine Mibu Japan; Department of Respiratory Medicine Saitama Medical University Saitama Japan; and ¡¡Department of Respiratory Medicine Saitama International Medical Center Saitama Japan. Address for correspondence: Hirohisa Yoshizawa MD PhD Bioscience Medical Research Center Niigata University Medical and Dental Hospital 1754 Asahimachi-dori Niigata 9518510 Japan. E-mail: nnys@med.niigata-u.ac.jp 2 2014 23 1 2014 9 2 189 194 Copyright © 2013 by the International Association for the Study of Lung Cancer 2013 This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial-NoDerivitives 3.0 License where it is permissible to download and share the work provided it is properly cited. The work cannot be changed in any way or used commercially. Introduction: In nonsmall-cell lung cancer an exon 19 deletion and an L858R point mutation in the epidermal growth factor receptor (EGFR) are predictors of a response to EGFR-tyrosine kinase inhibitors. However it is uncertain whether other uncommon EGFR mutations are associated with sensitivity to EGFR-tyrosine kinase inhibitors. Methods: A post-hoc analysis to assess prognostic factors was performed with the use of patients with EGFR mutations (exon 19 deletion L858R G719X and L861Q) who were treated with gefitinib in the NEJ002 study which compared gefitinib with carboplatin-paclitaxel as the first-line therapy. Results: In the NEJ002 study 225 patients with EGFR mutations received gefitinib at any treatment line. The Cox proportional hazards model indicated that performance status response to chemotherapy response to gefitinib and mutation types were significant prognostic factors. Overall survival (OS) was significantly shorter among patients with uncommon EGFR mutations (G719X or L861Q) compared with OS of those with common EGFR mutations (12 versus 28.4 months; p = 0.002). In the gefitinib group (n = 114) patients with uncommon EGFR mutations had a significantly shorter OS (11.9 versus 29.3 months; p < 0.001). By contrast OS was similar between patients with uncommon mutations and those with common mutations in the carboplatin-paclitaxel group (n = 111; 22.8 versus 28 months; p = 0.358). Conclusions: The post-hoc analyses clearly demonstrated shorter survival for gefitinib-treated patients with uncommon EGFR mutations compared with the survival of those with common mutations and suggest that the first-line chemotherapy may be relatively effective for nonsmall-cell lung cancer with uncommon EGFR mutations. Gefitinib G719X L861Q NEJ002 Uncommon epidermal growth factor receptor mutations OPEN-ACCESS TRUE The clinical efficacy of epidermal growth factor receptor-tyrosine kinase inhibitors (EGFR-TKIs) such as gefitinib and erlotinib has been demonstrated in nonsmall-cell lung cancer (NSCLC) patients in whom standard chemotherapy has failed.12 Further studies have revealed that the presence of activating mutations in the EGFR kinase domain is strongly associated with the therapeutic efficacy of EGFR-TKIs.34 Randomized phase 3 trials have demonstrated that EGFR-TKIs significantly improve median progression-free survival (PFS) compared with platinum-doublet therapy in EGFR-mutated patients.58 However not all mutations in the EGFR kinase domain are responsive to EGFR-TKI treatment. These phase 3 trials have shown that EGFR-TKIs are effective for patients with common EGFR mutations such as an exon 19 deletion or the L858R point mutation which account for more than 90% of EGFR mutations. Retrospective studies and case reports suggest that some uncommon mutations are associated with sensitivity to EGFR-TKIs.920 These mutations include G719X in exon 18 which accounts for approximately 3% of EGFR mutations and L861Q in exon 21 which represents approximately 2% of EGFR mutations. However these uncommon EGFR mutations have not been clearly shown to be predictive markers for the efficacy of EGFR-TKIs because of their low frequency. To investigate the efficacy of gefitinib in patients with uncommon mutations we conducted a post-hoc analysis of the NEJ002 which compared gefitinib and carboplatin-paclitaxel as first-line therapies for advanced NSCLC with activating EGFR mutations. PATIENTS AND METHODS Patient Population We retrospectively analyzed the data of 225 patients who received gefitinib treatment at any point in the NEJ002 study.6 The eligibility criteria of the NEJ002 study included the presence of advanced NSCLC harboring an EGFR mutation (exon 19 deletion or L858R G719X or L861Q point mutation) without the resistant EGFR mutation T790M (identified using the peptide nucleic acidlocked nucleic acid polymerase chain reaction clamp method) no history of chemotherapy an age of 75 years or younger a performance status of 0 to 1 and appropriate an function.2122 Patients provided a written informed consent. The study was conducted in accordance with the Helsinki Declaration of the World Medical Association. The protocol was approved by the institutional review board of each participating institution. Treatment Eligible patients were randomly assigned to receive either gefitinib (250 mg/day)" | Lung_Cancer |
"The time-varying exposure profiles for ns subjects are represented as series of occurrences xt at time t = 1 ¦100 generated by random exposure events with an intensity in the range 010. The exposurelagresponse associations are defined by the function fs(x) · ws(?) in (4) which is simpler to simulate if compared with the truly bivariate alternative in (5) for each value of exposure x and lag ?. Different scenarios explore alternative choices for the exposureresponse function fs(x) and the lagresponse function ws(?). These are obtained by simple mathematical functions involving logarithms or exponentials. Specifically fs(x) is specified as linear plateau and exponential while ws(?) as constant decay and peak (see Figure S7 in the supporting information). Three scenarios out of the nine possible combinations are shown in the top panels of the others in Figure S8 (supporting information). Results of the simulation study for three scenarios of exposurelagresponse associations (linear-constant plateau-decay and exponential-peak in each column). The graphs illustrate the true simulated 3-D exposurelagresponse association (first row) and the lagresponse (secondthird rows) and exposureresponse curves (fourthfifth rows) from AIC and BIC-selected models corresponding to the bold lines in the 3-D plots. These last panels compare the true simulated associations with the average of the estimated associations together with a sample of estimated curves corresponding to the first 25 simulations (in grey). Results from m = 500 simulated data sets with ns = 400 subjects. Time-to-event data are simulated conditional on the cumulative contribution of the simulated exposure using a permutational algorithm previously proposed for time-varying exposures 29. The cumulative effect is calculated in the form of a function defined in (4) given the exposure history of each subject at time t over a lag period 0L with L = 40. Censoring events are included and represent approximately 25% of the total. For each of the nine scenarios m = 500 data sets are simulated with a number of subjects ns equal to 200400 or 800. 4.2. Evaluation of performance For each data set i = 1 ¦500 the exposurelagresponse association is estimated by Cox regression models with a cross-basis as defined in (5)(7). The Efron method is used for tie handling. Similarly to the example in the exposureresponse function fe(x) is specified as a simple linear term or quadratic B-splines with 01 or 2 knots placed at 3.35 or 6.7. The lagresponse function we(?) is specified as a simple constant term with 1 df or quadratic B-splines with intercept and 01 or 2 knots placed at 13.320 or 26.7 lags. The total number of df for the cross-basis function se(xt) ranges from 1 1 = 1 to 4 5 = 20 in the 36 models. For each simulated data set the best-fitting models are selected as those minimizing AIC and BIC in (12) respectively. Performance is formally evaluated using a synthetic risk summary ?c from (10) corresponding to an overall cumulative effect and then visually assessed on the whole exposurelagresponse association. The formal evaluation consists in the computation of different ?ci at each ith iteration given an exposure history qhi evaluated at a random time t between 41 and 100 for a random individual among the ns subjects. Indices of relative bias coverage and relative RMSE are derived from the following: (13) where I is an indicator function and ?? 1(1 ? ?) is the quantile function of the cumulative normal distribution related to probability 1 ? ? with ? = 0.05. The effect summary ?ci corresponds to the true effect from while is estimated from the best fitting model selected by AIC and BIC by using given the specific exposure history qhi of the random subject at the random time. This approach assures that the performance indicators in (13) are evaluated on the whole range of simulated exposure histories and do not depend on a specific choice. A visual inspection of performance is also provided by computing from the best-fitting models the grid of risk contributions defined in (9) composing the exposurelagresponse surface. Bias is then assessed across the surface by comparing the average fit of the the m = 500 models with the true exposurelagresponse relationship. A bidimensional display of coverage is also provided for each scenario. The performance of the AIC and BIC are also evaluated through their empirical rejection rate for the hypotheses of linearity or constant effect namely the proportion of times the selection procedure favors a model with a non-linear term for fe(x) and a non-constant term for we(?). When H0 is true namely fs(x) = x or ws(?) = c the rejection rate is an estimate of the probability of error of the selection criteria which wrongly select unnecessarily complex models. When H0 is false namely fs(x) ? x or ws(?) ? c the rejection rate is an estimate of the power of the selection criteria for identifying non-linearity and constant lag structures. In a formal hypothesis testing setting these measures would be interpreted as the type I error and the power of the test. 4.3. Results of the simulation study The results of simulations under the nine scenarios with ns = 400 producing approximately 300 uncensored events are summarized in tables in graphs. Table IV reports the formal evaluation of performance on the synthetic risk summary ?c in terms of relative bias coverage and relative RMSE. A visual assessment for three scenarios is provided in each column of the multi-panel . The true simulated exposurelag response associations are displayed in the top panels while the other panels offer a comparison of the true lagresponse and exposureresponse curves at specific values with the average of the estimates from AIC and BIC-selected models together with a sample of 25 individual curves. Table IV Synthetic indices of relative bias coverage and relative root mean square error (RSME) for the nine scenarios of exposurelagresponse associations. Results from m = 500 simulated data sets with ns = 400 subjects Bias Coverage RMSE f(x) ? w(?) AIC BIC AIC BIC AIC BIC Linear-constant 0.01 0.01 0.91 0.94 0.07 0.04 Linear-decay 0.00 0.00 0.93 0.94 0.07 0.05 Linear-peak 0.01 0.01 0.92 0.90 0.08 0.07 Plateau-constant 0.06 0.13 0.84 0.72 0.08 0.09 Plateau-decay 0.04 0.14 0.90 0.74 0.09 0.13 Plateau-peak 0.07 0.21 0.87 0.62 0.11 0.18 Exponential-constant 0.01 0.03 0.90 0.80 0.09 0.09 Exponential-decay 0.05 0.04 0.93 0.87 0.12 0.13 Exponential-peak 0.00 0.17 0.91 0.75 0.12 0.17 Generally AIC-selected models offer a better performance with a lower relative bias and a coverage of confidence intervals closer to the 95% nominal value. The values of relative RMSE suggest that the higher variability of AIC-based estimators is often balanced by the higher bias affecting BIC. At least part of the bias can be attributed to lack of fit due to the insufficient flexibility of quadratic spline functions when used to fit logarithmic or exponential shapes. This phenomenon appears quite relevant for the plateau-type exposure response characterized by the highest relative bias in the order of 47% for AIC but up to 21% for BIC (see Table IV and second column). This pattern is confirmed by the results in Table V showing the average df in each dimension and the empirical rejection rates for the hypotheses of linearity and constant risk. The AIC selection is affected by moderate overfitting sometimes suggesting flexible models in scenarios of linear and/or constant risk. In contrast BIC shows severe underfitting often selecting simple models for complex exposurelagresponse associations in particular regarding linearity. Table V Average df in each dimension for the best fitting models selected through AIC and BIC (left part) and empirical rejection rate for the AIC and BIC-based selection for the hypotheses of linearity and constant risk (right part) for the nine scenarios of exposurelagresponse associations. Results from m = 500 simulated data sets with ns = 400 subjects Average df Empirical rejection rate f(x) w(?) H0 : f(x) = x H0 : w(?) = c f(x) ? w(?) AIC BIC AIC BIC AIC BIC AIC BIC Linear-constant 1.50 1.03 1.57 1.02 0.29* 0.03* 0.23* 0.01* Linear-decay 1.26 1.00 3.60 3.17 0.18* 0.00* 1.00 1.00 Linear-peak 1.22 1.00 4.02 3.72 0.15* 0.00* 1.00 0.98 Plateau-constant 2.26 1.54 1.47 1.00 0.82 0.47 0.19* 0.00* Plateau-decay 2.53 1.55 3.49 3.10 0.97 0.54 1.00 1.00 Plateau-peak 2.18 1.21 4.01 3.56 0.85 0.19 1.00 0.93 Exponential-onstant 2.20 1.56 1.43 1.00 0.83 0.52 0.16* 0.00* Exponential-decay 2.36 1.81 3.58 3.12 0.99 0.80 1.00 1.00 Exponential-peak 2.15 1.29 4.05 3.69 0.90 0.27 1.00 0.93 * H0 is true The undercoverage of confidence intervals as shown in Table IV can be attributed to both lack of fit and a posteriori model selection. The latter as discussed in Section 2.5 may generate undercoverage through the underestimation of the true sampling (co)variance. A comparison of the importance of the two sources can be provided by the assessment of undercoverage in the first scenario where linear and constant functions are actually among the options of the selection procedure and the underlying simulated association can be potentially recovered with no lack of fit. In this scenario AIC-selected models affected by overfitting show a coverage of 91% very close to the nominal value as illustrated in Table IV. The under-coverage seems to be proportional to the bias as confirmed by Figure 6 with a lower coverage corresponding to sections of the bidimensional space characterized by worse fit. Figure 6 Empirical coverage across the risk surfaces for three scenarios of exposurelagresponse associations (linear-constant plateau-decay and exponential-peak in each column). Results from m = 500 simulated data sets with ns = 400 subjects. The simulated examples with ns = 200 and ns = 800 generate approximately 150 and 600 uncensored events respectively. The versions of Tables IVV and for these examples are reported in Tables S2S5 and Figures S9S10 of the supporting information. The comparison suggests that varying the sample size does not dramatically affect the performance of the AIC-based test apart from the expected different power in identifying nonlinear and noncostant exposuretimeresponse associations. Consistently AIC-based selection seems to perform well across the range of number of subjects included in the analysis with a small bias and reasonable coverage. The results of this simulation study are consistent with previous findings on one-dimensional models for exposurelagresponse associations assuming a linear exposureresponse relationship 18. 5. Discussion In this contribution I illustrate a statistical framework for modeling temporal dependencies with time-varying exposures defined here as exposurelagresponse associations. The approach is based on the extension of distributed lag non-linear models a modeling class previously proposed in time series analysis 2324. The extended DLNM methodology brings together and extends previous methodological developments on the topic as summarized in. Briefly it provides a unified framework for different study designs and regression methods and is applicable to time series cross-sectional case-control survival and longitudinal data. A major advantage is the possibility to describe the lag structure of either linear or nonlinear exposureresponse relationships through the choice of two functions that define the association along the dimensions of the predictor and lags including most of the previous approaches as special cases. The example in illustrates how such flexibility is important for obtaining correct estimates of the association. Model specification easily accounts for previous knowledge on the association and incorporates assumptions on the phenomenon to be investigated through the choice of specific functions lag period and constraints. Interpretation of complex exposurelagresponse associations is aided by the definition of simple summary measures of effect and prediction and by graphical representation. The modeling framework is defined through a neat and compact algebraic representation including the derivation of measures of uncertainty such as standard errors and confidence intervals. Estimation is carried out with standard regression models which do not require specialized optimization procedures and may include terms for multiple exposurelagresponse dependencies as shown for radon and smoking here. The parameterization prediction and graphical representation are carried out with few general functions implemented in a freely available and documented software as discussed in. A key issue of the DLNM methodology is about selecting the appropriate model among different options for modeling the bidimensional exposurelagresponse relationship. The simulation study in indicates that AIC-based selection performs reasonably well over a range of 150600 uncensored events while the strong penalty of BIC induces the selection of models too simple to recover the underlying dependency." | Lung_Cancer |
"CC Bruns GA Weis JJ Klickstein LB Wong WW Fearon DT A complement receptor locus: genes encoding C3b/C4b receptor and C3d/Epstein-Barr virus receptor map to 1q32 J Immunol 1987 138 312 315 3782802 Wilson JG Wong WW Murphy EE 3rd Schur PH Fearon DT Deficiency of the C3b/C4b receptor (CR1) of erythrocytes in systemic lupus erythematosus: analysis of the stability of the defect and of a restriction fragment length polymorphism of the CR1 gene J Immunol 1987 138 2708 2710 2881967 Xiang L Rundles JR Hamilton DR Wilson JG Quantitative alleles of CR1: coding sequence analysis and comparison of haplotypes in two ethnic groups J Immunol 1999 163 4939 4945 10528197 Birmingham DJ Chen W Liang G Schmitt HC Gavit K Nagaraja HN A CR1 polymorphism associated with constitutive erythrocyte CR1 levels affects binding to C4b but not C3b Immunology 2003 108 531 538 10.1046/j.1365-2567.2003.01579.x 12667215 Holers VM Chaplin DD Leykam JF Gruner BA Kumar V Atkinson JP Human complement C3b/C4b receptor (CR1) mRNA polymorphism that correlates with the CR1 allelic molecular weight polymorphism Proc Natl Acad Sci U S A 1987 84 2459 2463 10.1073/pnas.84.8.2459 3031685 Zhang Q Yu JT Zhu QX Zhang W Wu ZC Miao D Tan L Complement receptor 1 polymorphisms and risk of late-onset Alzheimers disease Brain Res 2010 1348 216 221 20558149 He JR Xi J Ren ZF Qin H Zhang Y Zeng YX Mo HY Jia WH Complement receptor 1 expression in peripheral blood mononuclear cells and the association with clinicopathological features and prognosis of nasopharyngeal carcinoma Asian Pac J Cancer Prev 2012 13 6527 6531 10.7314/APJCP.2012.13.12.6527 23464487 Srivastava A Mittal B Complement receptor 1 (A3650G RsaI and intron 27 HindIII) polymorphisms and risk of gallbladder cancer in north Indian population Scand J Immunol 2009 70 614 620 10.1111/j.1365-3083.2009.02329.x 19906204 Ferreira CG Lung cancer in developing countries Am Soc Clin Oncol Educ Book 2013 327 331 PMID:23714537 23714537 Amos CI Wu X Broderick P Gorlov IP Gu J Eisen T Dong Q Zhang Q Gu X Vijayakrishnan J Sullivan K Matakidou A Wang Y Mills G Doheny K Tsai YY Chen WV Shete S Spitz MR Houlston RS Genome-wide association scan of tag SNPs identifies a susceptibility locus for lung cancer at 15q25.1 Nat Genet 2008 40 616 622 10.1038/ng.109 18385676 Hung RJ McKay JD Gaborieau V Boffetta P Hashibe M Zaridze D Mukeria A Szeszenia-Dabrowska N Lissowska J Rudnai P Fabianova E Mates D Bencko V Foretova L Janout V Chen C Goodman G Field JK Liloglou T Xinarianos G Cassidy A McLaughlin J Liu G Narod S Krokan HE Skorpen F Elvestad MB Hveem K Vatten L Linseisen J A susceptibility locus for lung cancer maps to nicotinic acetylcholine receptor subunit genes on 15q25 Nature 2008 452 633 637 10.1038/nature06885 18385738 Wang Y Broderick P Webb E Wu X Vijayakrishnan J Matakidou A Qureshi M Dong Q Gu X Chen WV Spitz MR Eisen T Amos CI Houlston RS Common 5p15.33 and 6p21.33 variants influence lung cancer risk Nat Genet 2008 40 1407 1409 10.1038/ng.273 18978787 McKay JD Hung RJ Gaborieau V Boffetta P Chabrier A Byrnes G Zaridze D Mukeria A Szeszenia-Dabrowska N Lissowska J Rudnai P Fabianova E Mates D Bencko V Foretova L Janout V McLaughlin J Shepherd F Montpetit A Narod S Krokan HE Skorpen F Elvestad MB Vatten L Nj¸lstad I Axelsson T Chen C Goodman G Barnett M Loomis MM Lung cancer susceptibility locus at 5p15.33 Nat Genet 2008 40 1404 1406 10.1038/ng.254 18978790 Markiewski MM Lambris JD The role of complement in inflammatory diseases from behind the scenes into the spotlight Am J Pathol 2007 171 715 727 10.2353/ajpath.2007.070166 17640961 Ricklin D Lambris JD Complement-targeted therapeutics Nat Biotechnol 2007 25 1265 1275 10.1038/nbt1342 17989689 Hugli TE Biochemistry and biology of anaphylatoxins Complement 1986 3 111 127 3542363 Ostrand-Rosenberg S Cancer and complement Nat Biotechnol 2008 26 1348 1349 10.1038/nbt1208-1348 19060872 Markiewski MM DeAngelis RA Benencia F Ricklin-Lichtsteiner SK Koutoulaki A Gerard C Coukos G Lambris JD Modulation of the antitumor immune response by complement Nat Immunol 2008 9 1225 1235 10.1038/ni.1655 18820683 Markiewski MM Lambris JD Is complement good or bad for cancer patients? A new perspective on an old dilemma Trends Immunol 2009 30 286 292 10.1016/j.it.2009.04.002 19428302 Fan Q He JF Wang QR Cai HB Sun XG Zhou XX Qin HD Shugart YY Jia WH Functional polymorphism in the 5?-UTR of CR2 is associated with susceptibility to nasopharyngeal carcinoma Oncol Rep 2013 30 11 16 23612877 Cerhan JR Novak AJ Fredericksen ZS Wang AH Liebow M Call TG Dogan A Witzig TE Ansell SM Habermann TM Kay NE Slager SL Risk of non-Hodgkin lymphoma in association with germline variation in complement genes Br J Haematol 2009 145 614 623 10.1111/j.1365-2141.2009.07675.x 19344414 Zhang Z Yu D Yuan J Guo Y Wang H Zhang X Cigarette smoking strongly modifies the association of complement factor H variant and the risk of lung cancer Cancer Epidemiol 2012 36 e111 e115 10.1016/j.canep.2011.11.004 22197220 Shen M Vermeulen R Rajaraman P Menashe I He X Chapman RS Yeager M Thomas G Burdett L Hutchinson A Yuenger J Chanock S Lan Q Polymorphisms in innate immunity genes and lung cancer risk in Xuanwei China Environ Mol Mutagen 2009 50 285 290 10.1002/em.20452 19170196 Fearon DT Identification of the membrane glycoprotein that is the C3b receptor of the human erythrocyte polymorphonuclear leukocyte B lymphocyte and monocyte J Exp Med 1980 152 20 30 10.1084/jem.152.1.20 6967510 Besaratinia A Pfeifer GP Second-hand smoke and human lung cancer Lancet Oncol 2008 9 657 666 10.1016/S1470-2045(08)70172-4 18598930 Coyle YM Minahjuddin AT Hynan LS Minna JD An ecological study of the association of metal air pollutants with lung cancer incidence in Texas J Thorac Oncol 2006 1 654 661 10.1097/01243894-200609000-00009 17409932 Garshick E Laden F Hart JE Rosner B Smith TJ Dockery DW Speizer FE Lung cancer in railroad workers exposed to diesel exhaust Environ Health Perspect 2004 112 1539 1543 10.1289/ehp.7195 15531439 Brennan P Buffler PA Reynolds P Wu AH Wichmann HE Agudo A Pershagen G Jockel KH Benhamou S Greenberg RS Merletti F Winck C Fontham ET Kreuzer M Darby SC Forastiere F Simonato L Boffetta P Secondhand smoke exposure in adulthood and risk of lung cancer among never smokers: a pooled analysis of two large studies Int J Cancer 2004 109 125 131 10.1002/ijc.11682 14735478 Lee G Walser TC Dubinett SM Chronic inflammation chronic obstructive pulmonary disease and lung cancer Curr Opin Pulm Med 2009 15 303 307 10.1097/MCP.0b013e32832c975a 19417670 Engels EA Inflammation in the development of lung cancer: epidemiological evidence Expert Rev Anticancer Ther 2008 8 605 615 10.1586/14737140.8.4.605 18402527 Kullo IJ Ding K Shameer K McCarty CA Jarvik GP Denny JC Ritchie MD Ye Z Crosslin DR Chisholm RL Manolio TA Chute CG Complement receptor 1 gene variants" | Lung_Cancer |
"non-small cell lung cancer International Journal of Molecular Medicine 2010 25 4 517 523 2-s2.0-77749289244 20198299 38 Roy S Yu Y Padhye SB Sarkar FH Majumdar AP Difluorinated-curcumin (CDF) restores PTEN expression in colon cancer cells by down-regulating miR-21 PLoS One 2013 8 e68543 miR-21 expression was knocked down by transfecting NSCLC A549 cells with anti-miR-21. miR-21 expression in A549 cells at 48?h after transfection with anti-miR-NC or anti-miR-21 was detected by TaqMan real-time quantitative RT-PCR. The mean and standard deviation of expression levels relative to U6 expression levels are shown and are normalized to the expression in A549 cells transfected with anti-miR-NC. All experiments were performed at least in triplicate. *P < 0.05 versus cells transfected with anti-miR-NC. Clonogenic survival of NSCLC A549 cells after varying doses of ionizing radiation. A549 cells were transfected with either anti-miR-21 or anti-miR-NC and 48?h later were irradiated followed by a further incubation for 24?h at 37°C before trypsinization and plating for clonogenic survival. After 14-day incubation colonies were stained and the surviving fractions were determined. *P < 0.05 versus cells transfected with anti-miR-NC. Each value represents the means ± SD for three independent experiments. Proliferation of NSCLC A549 cells after ionizing radiation (IR). A549 cells were transfected with either anti-miR-21 or anti-miR-NC and 48?h later were exposed to 8?Gy of IR and the growth characteristics of A549 cells were determined by MTT assay 72 hours after IR. The anti-miR-NC-transfected sample was normalized to 100% cell viability. The data represent the means ± SD of three separate experiments. Student's t-test was used to analyze the statistics (*P < 0.05). Apoptosis of NSCLC A549 cells after ionizing radiation (IR). Apoptosis in anti-miR-21- (or anti-miR-NC-) transfected A549 cells combined with (or without) IR (8.0?Gy) was detected through annexin V-FITC/PI staining by flow cytometric analysis. The data represent the means ± SD of three separate experiments. Student's t-test was used to analyze the statistics (*P < 0.05). Suppression of ionizing radiation-induced phosphorylated-Akt (p-Akt) upregulation by anti-miR-21 in NSCLC A549 cells. The expression level of the phosphorylated or total Akt in A549 cells transfected with anti-miR-21 or anti-miR-NC for 48?h followed by ionizing radiation (8?Gy) with or without 10?ng/mL PI3K constituent activator IGF-1 was measured by Western blot. Representative of three independent experiments was shown. Knockdown of miR-21 promoted NSCLC A549 cells apoptosis via inactivation of PI3K-Akt pathway. Apoptosis induced by 8?Gy ionizing radiation in anti-miR-21- (or anti-miR-NC-) transfected A549 cells combined with (or without) PI3K activator IGF-1 treatment (10?ng/mL) was detected through annexin V-FITC/PI staining by flow cytometric analysis. The data represent the means ± SD of three separate experiments. Student's t-test was used to analyze the statistics (*P < 0.05). 1306016 3069 Clin Radiol Clin Radiol Clinical radiology 0009-9260 1365-229X 24857677 4105980 10.1016/j.crad.2014.03.020 NIHMS587373 Revisiting the relationship between tumour volume and diameter in advanced NSCLC patients: An exercise to maximize the utility of each measure to assess response to therapy Nishino M. a * Jackman D.M. b DiPiro P.J. a Hatabu H. a Jnne P.A. b Johnson B.E. b aDepartment of Radiology Dana-Farber Cancer Institute and Brigham and Womens Hospital 450 Brookline Ave. 75 Francis St. Boston MA 02215 USA bDepartment of Medical Oncology and Department of Medicine Dana-Farber Cancer Institute and Brigham and Womens Hospital 450 Brookline Ave. Boston MA 02215 USA *Guarantor and correspondent: M. Nishino Department of Radiology Dana-Farber Cancer Institute and Brigham and Womens Hospital 450 Brookline Ave. Boston MA 02215 USA. Tel.: +1 617 582 7163; fax: +1 617 582 8574. Mizuki_Nishinodfci.harvard.edu (M. Nishino) 30 5 2014 22 5 2014 8 2014 01 8 2015 69 8 841 848 2014 The Royal College of Radiologists. Published by Elsevier Ltd. All rights reserved. 2014 AIM To revisit the presumed relationship between tumour diameter and volume in advanced non-small-cell lung cancer (NSCLC) patients and determine whether the measured volume using volume-analysis software and its proportional changes during therapy matches with the calculated volume obtained from the presumed relationship and results in concordant response assessment. MATERIALS AND METHODS Twenty-three patients with stage IIIB/IV NSCLC with a total of 53 measurable lung lesions treated in a phase II trial of erlotinib were studied with institutional review board approval. Tumour volume and diameter were measured at baseline and at the first follow-up computed tomography (CT) examination using volume-analysis software. Using the measured diameter (2r) and the equation calculated volume was obtained as (4/3) ?r3 at baseline and at the follow-up. Percent volume change was obtained by comparing to baseline for measured and calculated volumes and response assessment was assigned. RESULTS The measured volume was significantly smaller than the calculated volume at baseline (median 11488.9 mm3 versus 17148.6 mm3; p < 0.0001) with a concordance correlation coefficient (CCC) of 0.7022. At follow-up the measured volume was once again significantly smaller than the calculated volume (median 6573.5 mm3 versus 9198.1 mm3; p = 0.0022) with a CCC of 0.7408. Response assessment by calculated versus measured volume changes had only moderate agreement (weighted ? = 0.545) with discordant assessment results in 20% (8/40) of lesions. Calculated volume based on the presumed relationship significantly differed from the measured volume in advanced NSCLC patients with only moderate concordance in response assessment indicating the limitations of presumed relationship. CMAJ CMAJ 9711805 CMAJ : Canadian Medical Association Journal 0820-3946 1488-2329 Canadian Medical Association 24638027 4016095 10.1503/cmaj.131385 186e296 Practice Five Things to Know About... Screening for lung cancer Kennedy Sean Baerlocher Mark Otto MD School of Medicine (Kennedy) McMaster University Hamilton Ont.; Department of Radiology (Baerlocher) Royal Victoria Hospital Barrie Ont. Correspondence to: Sean Kennedy sean.kennedymedportal.ca 13 5 2014 13 5 2015 186 8 E296 E296 1995-2014 Canadian Medical Association 2014 0042124 4284 Int J Cancer Int. J. Cancer International journal of cancer. Journal international du cancer 0020-7136 1097-0215 24806617 4200482 10.1002/ijc.28958 NIHMS594253 p38 MAPK inhibits breast cancer metastasis through regulation of stromal expansion Hong Bangxing 1 Li Haiyan 1 Zhang Mingjun 1 Xu Jingda 2 Lu Yong 1 Zheng Yuhuan 1 Qian Jianfei 1 Chang Jeffrey T 3 Yang Jing 2 Yi Qing 1 1Department of Cancer Biology Lerner Research Institute Cleveland Clinic Cleveland OH USA 2Department of Lymphoma and Myeloma University of Texas MD Anderson Cancer Center Houston TX USA 3Department of Integrative Biology & Pharmacology University of Texas at Houston Houston TX USA Corresponding author: Qing Yi MD PhD Department of Cancer Biology Cleveland Clinic Lerner Research Institute 9500 Euclid Avenue/NB40 Cleveland OH 44195 USA. Tel: 216-636-7532; Fax: 216-444-3164; yiqccf. 31 5 2014 16 5 2014 1 1 2015 01 1 2016 136 1 34 43 p38 MAPK signaling controls cell growth proliferation and the cell cycle under stress conditions. However the function of p38 activation in tumor metastasis is still not well understood. We report that p38 activation in breast cancer cells inhibits tumor metastasis but does not substantially modulate primary tumor growth. Stable p38 knockdown in breast cancer cells suppressed NF-?B p65 activation inhibiting miR-365 expression and resulting in increased IL-6 secretion. The inhibitory effect of p38 signaling on metastasis was mediated by suppression of mesenchymal stem cell (MSC) migration to the primary tumor and sites of metastasis where MSCs can differentiate into cancer-associated fibroblasts to promote tumor metastasis. The migration of MSCs to these sites relies on CXCR4-SDF1 signaling in the tumor microenvironment. Analysis of human primary and metastatic breast cancer tumors showed that p38 activation was inversely associated with IL-6 and vimentin expression. This study suggests that combination analysis of p38 MAPK and IL-6 signaling in patients with breast cancer may improve prognosis and treatment of metastatic breast cancer. p38 MAPK Breast cancer Metastasis microRNA IL-6 J Mol Diagn J Mol Diagn The Journal of Molecular Diagnostics : JMD 1525-1578 1943-7811 American Society for Investigative Pathology 24813172 4078366 S1525-1578(14)00074-9 10.1016/j.jmoldx.2014.03.006 Regular Detection of Gene Rearrangements in Targeted Clinical Next-Generation Sequencing Abel Haley J. ? Al-Kateb Hussam Cottrell Catherine E. Bredemeyer Andrew J. Pritchard Colin C. ¡ Grossmann Allie H. § Wallander Michelle L. ¶ Pfeifer John D. Lockwood Christina M. Duncavage Eric J. eduncavagepath.wustl.edu ? ?Department of Genetics Washington University St. Louis Missouri Department of Pathology and Immunology Washington University St. Louis Missouri ¡Department of Laboratory Medicine University of Washington Seattle Washington §Department of Pathology University of Utah and ARUP Laboratories Salt Lake City Utah ¶ARUP Institute for Clinical and Experimental Pathology Salt Lake City Utah ?Address correspondence to Eric J. Duncavage M.D. Department of Pathology and Immunology" | Lung_Cancer |
"lung and liver cells. Genomic analyses identified two major DNase I hypersensitive regions (HS-1 and HS-2) within the ~15 kb intervening sequence separating E1b from the downstream E1 promoter. In BEAS-2B cells the Nrf2 effectors SFN and tBHQ selectively activated the more distal HS-2 through an antioxidant-response element (ARE). An activator protein 1/12-O-tetradecanoylphorbol-13-acetate interaction was further identified within the HS-2 enhancer that functioned to additionally contribute to ARE-mediated induction responsiveness of the E1b promoter. The results demonstrate that ARE modulation integrated with additional transcriptional complexes regulates the tissue-specific expression of mEH and that these processes likely coordinate both the protective and bioactivation functions contributed by mEH activities in human tissues. microsomal epoxide hydrolase human gene regulation alternative gene promoters Nrf2 0410462 6011 Nature Nature Nature 0028-0836 1476-4687 25337876 4270925 10.1038/nature13902 HHMIMS632589 In vivo engineering of oncogenic chromosomal rearrangements with the CRISPR/Cas9 system Maddalo Danilo 1 Manchado Eusebio 1 Concepcion Carla P. 1 2 Bonetti Ciro 1 Vidigal Joana A. 1 Han Yoon-Chi 1 Ogrodowski Paul 1 Crippa Alessandra 3 Rekhtman Natasha 4 de Stanchina Elisa 5 Lowe Scott W. 1 6 Ventura Andrea 1 7 1 Memorial Sloan Kettering Cancer Center Cancer Biology and Genetics Program 1275 York Avenue New York NY 10065 2 Weill Cornell Graduate School of Medical Sciences of Cornell University 3 Department of Medical Oncology San Gerardo Hospital Monza Italy 4 Memorial Sloan Kettering Cancer Center Thoracic Pathology and Cytopathology 5 Memorial Sloan Kettering Cancer Center Molecular Pharmacology Program 6 Howard Hughes Medical Institute 7 Corresponding Author. venturaamskcc. Phone: 646-888-3068 3 10 2014 22 10 2014 18 12 2014 18 6 2015 516 7531 423 427 Chromosomal rearrangements play a central role in the pathogenesis of human cancers and often result in the expression of therapeutically actionable gene fusions1. A recently discovered example is a fusion between the Echinoderm Microtubule-associated Protein-like 4 (EML4) and the Anaplastic Lymphoma Kinase (ALK) genes generated by an inversion on the short arm of chromosome 2: inv(2)(p21p23). The EML4-ALK oncogene is detected in a subset of human non-small cell lung cancers (NSCLC)2 and is clinically relevant because it confers sensitivity to ALK inhibitors3. Despite their importance modeling such genetic events in mice has proven challenging and requires complex manipulation of the germline. Here we describe an efficient method to induce specific chromosomal rearrangements in vivo using viral-mediated delivery of the CRISPR/Cas9 system to somatic cells of adult animals. We apply it to generate a mouse model of Eml4-Alk-driven lung cancer. The resulting tumors invariably harbor the Eml4-Alkinversion express the Eml4-Alk fusion gene display histo-pathologic and molecular features typical of ALK+ human NSCLCs and respond to treatment with ALK-inhibitors. The general strategy described here substantially expands our ability to model human cancers in mice and potentially in other anisms. Oncogene Oncogene Oncogene 0950-9232 1476-5594 Nature Publishing Group 23770855 4031636 onc2013239 10.1038/onc.2013.239 Short Communication Gene amplification of the histone methyltransferase SETDB1 contributes to human lung tumorigenesis A role for SETDB1 in lung cancer Rodriguez-Paredes M 1 Martinez de Paz A 1 Sim-Riudalbas L 1 Sayols S 1 Moutinho C 1 Moran S 1 Villanueva A 2 V¡zquez-Cedeira M 3 4 Lazo P A 3 4 Carneiro F 5 Moura C S 5 Vieira J 6 Teixeira M R 6 Esteller M 1 7 8 * 1Cancer Epigenetics and Biology Progrm (PEBC) Bellvitge Biomedical Research Institute (IDIBELL) Barcelona Spain 2Translational Research Laboratory IDIBELL-Institut Catala d?Oncologia Barcelona Spain 3Experimental Therapeutics and Translational Oncology Program Instituto de Biologa Molecular y Celular del C¡ncer CSIC-Universidad de Salamanca Salamanca Spain 4Instituto de Investigacin Biomdica de Salamanca (IBSAL) Salamanca Spain 5Department of Pathology Centro Hospitalar S£o Jo£o/Medical Faculty and Institute of Molecular Pathology and Immunology of the University of Porto (IPATIMUP) Porto Portugal 6Department of Genetics Portuguese Oncology Institute and Biomedical Sciences Institute (ICBAS) University of Porto Porto Portugal 7Department of Physiological Sciences II School of Medicine University of Barcelona Barcelona Spain 8Institucio Catalana de Recerca i Estudis Avan§ats (ICREA) Barcelona Spain *Cancer Epigenetics and Biology Program (PEBC) 3rd Floor Hospital Duran i Reynals Avenue Gran Via 199-203 08907 L?Hospitalet Barcelona Spain. Email: mestelleridibell.cat 22 05 2014 17 06 2013 33 21 2807 2813 07 11 2012 11 04 2013 12 04 2013 Copyright 2014 Macmillan Publishers Limited 2014 Macmillan Publishers Limited This work is licensed under a Creative Commons Attribution-NonCommercial-NoDerivs 3.0 Unported License. To view a copy of this license visit http://creativecommons./licenses/by-nc-nd/3.0/ Disruption of the histone modification patterns is one of the most common features of human tumors. However few genetic alterations in the histone modifier genes have been described in tumorigenesis. Herein we show that the histone methyltransferase SETDB1 undergoes gene amplification in non-small and small lung cancer cell lines and primary tumors. The existence of additional copies of the SETDB1 gene in these transformed cells is associated with higher levels of the corresponding mRNA and protein. From a functional standpoint the depletion of SETDB1 expression in amplified cells reduces cancer growth in cell culture and nude mice models whereas its overexpression increases the tumor invasiveness. The increased gene dosage of SETDB1 is also associated with enhanced sensitivity to the growth inhibitory effect mediated by the SETDB1-interfering drug mithramycin. Overall the findings identify SETDB1 as a bona fide oncogene undergoing gene amplification-associated activation in lung cancer and suggest its potential for new therapeutic strategies. SETDB1 gene amplification overexpression lung cancer histone methyltransferase chemotherapy Introduction Disruption of the epigenetic landscape is a common event in cancer cells leading to significant changes in chromatin structure and gene expression.1 2 Although information about DNA methylation profiles is widespread we know much less about the patterns of histone modification disruption in human tumors.3 In this latter setting it is recognized that there are particular combinations of histone marks for a given promoter associated with the transcriptional silencing of tumor suppressor genes such as deacetylation of histones H3 and H4 loss of H3K4 trimethylation and gain of H3-K9 methylation and Lys27 of histone H3 (H3K27) trimethylation.1 2 At the global level cancer cells show reduced monoacetylated and trimethylated lysines 16 and 20 of histone H44 respectively and histone acetylation and dimethylation changes in histones H3 and H4 respectively might have prognostic value.5 Recent efforts to study human cancer genomics have highlighted that point mutations translocations deletions and gene amplification events occur in histone modifier enzymes such as histone acetyltransferases deacetylases methyltransferases and demethyltransferases.678 9 One of the best examples of a histone methyltransferase involved in human cancer is the enhancer of zeste homolog 2 a component of the Polycomb repressive complex 2 which represses gene transcription via trimethylation of H3K27 that targets tumor suppressor genes.101112 13 The enhancer of zeste homolog 2 has the hallmarks of an oncogene particularly in prostate and breast cancer where elevated levels are found in the more advanced forms of the disease.1415 16 Recently the enhancer of zeste homolog 2 gain-of-function mutations have also been found in lymphomas.17 However the list of histone methyltransferases with a role in tumorigenesis is rapidly growing and includes such examples as the mixed lineage leukemia 1 (ALL-1/HRX)18 hDOT1L19 which is targeted by chromosomal translocations and NSD1 that undergoes DNA methylation-associated silencing in solid tumors.20 Among the different histone methyltransferases SETDB1 has been of increasing interest owing to its involvement in the development of melanoma where it resides in a recurrently amplified chromosome 1q21 interval and accelerates melanoma onset in a zebrafish model21 and also because the described 1q21.3 region includes a plausible human melanoma susceptibility gene. SETDB1 is a likely candidate for this.22 Also known as ESET or KMT1E SETDB1 is a histone H3 lysine 9-specific methyltransferase involved in the transcriptional silencing of euchromatic genes and retroelements.232425 26 Recent reports also show that SETDB1 is essential for proviral silencing and for controlling developmental regulators and chimeric transcripts that maintain the fate of embryonic stem cells.2627 28 In addition to the discoveries in melanoma21 22 the role of SETDB1 in cancer was also suggested by its association with the DNA methylation machinery25 the promyelocytic nuclear leukemia-nuclear bodies29 and by its increased expression in transformed broncoepithelial cells." | Lung_Cancer |
"We found a similar result in H1299 PAX6 KD cells (A). Another relevant cyclin regulating G1/S progression is cyclin E [17]. We also determined whether cyclin E was regulated by PAX6 expression. As a result cyclin E expression was not affected by the stable shRNA-mediated knockdown of PAX6 in lung cancer cells (data not shown). This demonstrates that PAX6 might promote cell growth by inducing cyclin D1 expression. .0085738.g004 Cyclin D1 expression and pRB phosphorylation was inhibited while PAX6 expression was suppressed. A B The expression of cyclin D1 pRB and the phosphorylated pRB in A549 PAX6 KD A549 NC A549 cells as well as H1299 PAX6KD H1299NC H1299 cells was determined by Western blotting. ?-actin and GAPDH expression level was measured as internal loading controls respectively. Cyclin D1 and pRB levels were measured by the gray level and were normalized by internal loading controls. Data are expressed as mean ±SEM. Times of the experiments are listed above the histograms. *P <0.05 **P <0.01. The major substrate of cyclin D1-CDK4/6 complexes is retinoblastoma protein (pRB) [18]. Thus pRB S780 protein phosphorylation was also detected by Western blotting (B). The S780 phosphorylation of pRB was decreased when PAX6 expression was inhibited in A549 cells. A similar result was obtained when H1299 PAX6 KD cells were used (B). MAPK signal pathway was suppressed by the inhibition of PAX6 The MAPK (mitogen activated protein kinase) pathway has been implicated in the regulation of G1/S transitions and cell mitosis [19]. In our study some central regulatory molecules of MAPK pathways were examined using western blot analysis. As shown in the phosphorylation levels of ERK1/2 and p38 were decreased both in A549 PAX6 KD and H1299 PAX6 KD cells. It indicated that the MAPK signal was weakened resulted from the RNAi interference of PAX6. .0085738.g005 The phosphorylation levels of ERK1/2 and p38 were suppressed by the inhibiton of PAX6 expression. Western-blot analysis of A549 A549 NC A549 PAX6 KD H1299 H1299NC H1299 PAX6 KD with antibodies to ERK1/2 (A) p38(B) and their phosphorylated forms were shown in the figure. GAPDH and ?-actin was used as internal loading controls respectively. ERK1/2 and p38 levels were normalized by GAPDH and ?-actin respectively. Data are expressed as mean ±SEM. All the experiments were repeated three times. *P <0.05 **P <0.01. PAX6 was highly expressed in lung cancer tissue Pax6 mRNA in lung cancer tissue as well as matched adjacent tissue was detected to confirm the role of PAX6 in lung cancer. The clinical characteristics of the 52 patients are listed in . As shown in A PAX6 mRNA was abundantly expressed in tumor tissue as compared to adjacent normal tissues. The expression of PAX6 represented by a cancer-to-adjacent nontumorous tissue ratio for each individual was indicated in B. PAX6 expression in lung cancer tissue was higher than that in each matched adjacent normal tissue in all but three cases (B). The statistic results were listed in table 2 and the ratio (tumor/adjacent tissue) of 65% patients (34 samples) exceeded 100. That is to say in most cases PAX6 was mainly expressed in lung cancer tissues. .0085738.g006 PAX6 mRNA was highly expressed in primary lung cancer tissues and lung cancer cell lines. A Real-time PCR analysis of the PAX6 expression level in lung cancer tissues as well as the matched adjacent tissues from 52 patients. The PAX6 mRNA level was normalized by ?-actin expression level. B Each column represents the relative ratio of PAX6 mRNA in primary NSCLC versus adjacent lung tissue and the line across the graph represents the value 1 and 10 respectively. All the experiments were repeated three times. **P <0.01. .0085738.t002 The relative ratio of PAX6 mRNA in primary NSCLC versus adjacent nontumorous lung tissue. PAX6 mRNA level (Tumor/adjacent tissue) 01 1100 10010000 10000100000 Number of patients 3 15 19 15 Discussion In our study the function of PAX6 in lung cancer cells was investigated. The growth ability of A549 and H1299 cells was declined when PAX6 expression was inhibited by specific PAX6 shRNA. We suggest that PAX6 promotes G1-S progression by activating the MAPK signal pathway. And PAX6 was highly expressed in lung cancer tissues and lung cancer cell lines. The transcription factor PAX6 plays different roles in different tumors. It is frequently expressed in pancreatic cancer and retinoblastoma cells implicating an oncogenic function while PAX6 is recognized as a tumor suppressor in gliomas and prostate cancer [6] [10] [11] [20] [21].PAX6 expression is significantly reduced in glioblastomas and the expression level is correlated with longer patient survival [22]. PAX6 suppresses glioblastoma cell growth anchorage-independent growth and glioma angiogenesis as well as invasiveness of glioblastoma cell via inhibition of matrix metalloproteinase-2 (MMP2) expression and vascular endothelial growth factor A (VEGFA) expression [20] [23] [24]. " | Lung_Cancer |