Datasets:

ManuelAlv

/

Cancer

like 0

"Thus novel approaches to effectively managing this disease at the molecular level could identify patients who have a higher or lower risk of relapse following surgery and provide biomarkers for the prediction of patient survival. In this regard the use of serum miRNAs as potential biomarkers for diagnosing and predicting prognosis of lung cancers has been reported [7] [10]. Indeed several studies have identified miRNA signatures that differ between normal and cancerous tissues for the classification of cancer types and for tumor diagnosis and prognosis. It may also be possible to use miRNA expression as a biomarker to monitor treatment efficacy or predict cancer progression [11]“[12]. However to date most studies have focused on tumor tissue and changes in circulating serum miRNAs levels and the relationship between these changes and the tissue at disease onset remain controversial [7]. Moreover the usefulness of many circulating miRNAs has been demonstrated in the diagnosis of NSCLC but few circulating miRNAs showed diagnostic value for early stage NSCLC [13] [14]. However further verification in different populations is needed. Thus in this study we analyzed levels of three miRNAs (miR-29c miR-93 and miR-429) in non-small cell lung cancer (NSCLC) tissues and compared them to those in serum samples of NSCLC patients and healthy controls particularly their expression levels in early stage NSCLC patients. Meanwhile we analyzed the data by comparison with carcinoma embryonic antigen (CEA) which is a widely used marker in the diagnosis of NSCLC [15]. We then investigated associations between their expression and clinicopathological and survival data from NSCLC patients. Materials and Methods Ethics Statement This study was approved by the Ethical Review Committee of Zhoushan Municipal Government of China and all biological samples were obtained with patients' written informed consent. Patient samples In this study we recruited 70 patients with surgically resected NSCLC and matched distant noncancerous tissues from Zhoushan Hospital Zhejiang China between January 2008 and May 2009. There were 56 male and 14 female patients with NSCLC including 34 patients younger than 60 years and 36 older than 60 years. Meanwhile sera from all NSCLC patients and 48 healthy volunteers matched according to sex and age were also collected. None of the patients enrolled in this study had received any chemotherapy or radiotherapy before surgery. For tissue sample collection upon removal of the surgical specimens the tissues were immediately transported to the Pathology Laboratory and the samples were placed in a cryovial snap-frozen in liquid nitrogen for 30 min and stored at ?80°C until use. All tissue samples were reviewed by two pathologists and the diagnosis was made according to the National Comprehensive Cancer Network (NCCN) criteria. There were 34 lung adenocarcinomas and 36 lung squamous cell carcinomas and 46 tumors were moderately to highly differentiated whereas 24 were poorly differentiated. Moreover 18 NSCLC patients had a tumor less than 3 cm in size whereas 52 patients with a tumor larger than 3 cm. Lymph node metastasis was found in 32 patients and 36 patients had stage I NSCLC and 34 patients had stage II III or IV NSCLC (). In addition serum levels of CEA were measured using chemiluminescence as part of routine clinical tests and reference value was acquired from the clinical database at Zhoushan Hospital. .0087780.t001 Clinicopathological features of 70 NSCLC patients. Clinical features n Mean age (years) 59 <60 34 ?60 36 Gender Male 56 Female 14 Tumor size 0“3 cm 18 >3 cm 52 Histological classification Adenocarcinoma 34 SCC 36 Differentiation Moderate“well 46 Poor 24 Lymph node Negative 38 Positive 32 Stage classification Stage I 36 Stage II III and IV 34 RNA isolation and quantitative RT-PCR Total cellular RNA was isolated from 100 mg lung tissue or 600 µl serum samples using a miRNAs isolation kit or mirVana PARIS RNA isolation kit (Applied Biosystems Foster City CA USA) according to the manufacturer's protocol. RNA concentration was determined using a NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies Wilmington DE USA) and RNA quality was measured using a denaturing 15% polyacrylamide gel. The reverse transcription reaction was carried out using the TaqMan MicroRNA Reverse Transcription Kit (Applied Biosystems) according to the manufacturer's instructions in a total reaction volume of 7.5 µl. qPCR was performed in triplicate using TaqMan 2— Universal PCR Master Mix without AmpErase UNG (Applied Biosystems) in an ABI 7500 Real-Time PCR system (Applied Biosystems) with the following conditions: 95°C for 10 min followed by 40 cycles of 95°C for 15 s and 60°C for 1 min. The cycle threshold (Ct) values were calculated using SDS 2.0.1 software (Applied Biosystems). Template-free controls for both RT and PCR were included in each experiment to ensure target-specific amplification. The average levels of miRNA expression in tissues and sera were normalized relative to the average amounts of U6 snRNA and U48 snRNA using the 2???Ct method [16]“[17]. "

Lung_Cancer

"In the liver lymphatic vessels run parallel to the interlobular vessels and bile duct. Lymphatic vessels can be classified as deep or superficial lymphatic collecting ducts. Superficial lymphatic collecting ducts are often found in the connective tissues of the liver capsule and the lymph is transferred into the parasternal paracardial and abdominal lymph nodes. The deep lymphatic collecting ducts connect to one another to form upstream and downstream trunks which transport lymph into the phrenic lymph nodes around the terminal segment of the inferior vena cava and hepatic and left gastric lymph nodes. Thus lymphatic metastasis of liver carcinoma may be found in the hepatic hilar upper abdominal and retroperitoneal lymph nodes because of the parallel distribution between lymphatic vessels and major abdominal blood vessels. In addition skip metastasis may be found in several groups of lymph nodes. Overall PLC is rare in liver carcinoma. To date to the best of our knowledge PLC has not been identified in patients who have undergone liver transplantation due to liver carcinoma. PLC patients usually develop progressive dyspnea cough weight loss fatigue and other symptoms accompanied by hypoxemia restrictive ventilatory dysfunction and diffusion dysfunction [5]. The history of cancer or surgery and characteristic features identified on lung CT scans can be used to diagnose PLC after exclusion of interstitial pneumonia pulmonary fibrosis sarcoidosis pulmonary embolism heart failure and hematogenous disseminated pulmonary tuberculosis. Biopsy and subsequent pathologic examination are not required for the diagnosis of PLC [69]. In the early stages lung CT shows interstitial lesions linear and reticular shadows and interlobar fissure thickening. Approximately one-third of PLC patients present with pleural effusion (unilateral or bilateral). Once patients develop dyspnea other findings may be present including irregular thickening of the tracheal vascular bundles and interlobular septa as well as multiple beaded small nodules of varying sizes (usually smaller than 3 mm in diameter) distributed along the interlobular septa and pleura. In our present case report the patient was suspected to have interstitial pneumonia due to Pneumocystis carinii after transplantation. Thus management was geared toward removing the edema and treating the pulmonary infection (SMZ and caspofungin); however the response to treatment was poor. On the basis of examination of cancer cells in the pleural effusion and the PET-CT scan PLC was subsequently diagnosed. The positive rate of cancer cells in pleural effusion is 40% to 50%. This diagnostic accuracy rate may increase if the sediment from the pleural effusion is used for examination after being kept for 24 hours. Although biopsy via bronchoscopy pleurocentesis lung puncture or thoracoscopy and subsequent pathologic examination may confirm the diagnosis of PLC biopsy increases the risk of pneumothorax. Sputum collection is relatively easy but examination of exfoliated cells in the sputum is associated with a low positive rate [3]. Lung CT and PET-CT findings and cytology from the pleural effusion can confirm the diagnosis of PLC. Although a false-negative diagnosis of primary liver carcinoma is possible with the use of PET-CT (40% to 50%) PET-CT has favorable sensitivity in the detection of extrahepatic metastasis of liver carcinoma. Acikgoz et al. [10] reported that the detection rate of extrahepatic metastatic foci ?1 cm in diameter was as high as 92.9% in liver carcinoma patients after liver transplantation. There is evidence that the specificity of PET-CT for PLC is 100% and that the sensitivity is 86%. The mean SUV in the region of PLC (1.37?±?0.64) was significantly greater than that in the normal lung (0.5?±?0.29) (P?<?0.0001) [11]. Thus combined examinations have an elevated detection rate compared to a single examination. Examinations selected according to the disease condition may significantly increase the detection rate. To date no effective strategies have been developed for the treatment of PLC. Currently antitumor therapy and antispasmodic therapy of the airway with theophylline or ?2-adrenergic receptor agonists are used. However these treatments usually have poor efficacy and PLC is associated with a poor prognosis. Patients usually develop progressive dyspnea and die as a result of respiratory failure and/or heart failure. Approximately 50% to 85% of PLC patients have a survival time between 3 and 6 months [1213]. In our patient PLC progressed rapidly because of immunosuppression after liver transplantation. Although immunosuppressive therapy was discontinued promptly the severity of the patient™s symptoms increased rapidly and he died as a result of respiratory failure within 1 month. In 1975 Kane et al. [14] reported the autopsy findings from 7524 patients with solid cancers that originated from the prostate breast stomach pancreas and liver. Involvement of the pulmonary lymphatic system by cancer cells was noted in 1085 patients (only 1% of these patients died as a result of respiratory failure). Although PLC is rarely reported in liver carcinoma the incidence of liver carcinoma“induced PLC might be far higher than previously reported. In addition liver carcinoma is highly malignant and progresses rapidly."

Lung_Cancer

"Lung and Intrathoracic Tumors Pathology and Laboratory Medicine Anatomical Pathology Surgical Pathology Radiology and Imaging Research and Analysis Methods Imaging Techniques Tumor Size and Computed Tomography Attenuation of Pulmonary Pure Ground-Glass Nodules Are Useful for Predicting Pathological Invasiveness Prediction of Pathological Invasiveness of Pure Ground-Glass Nodules Eguchi Takashi 1 * Yoshizawa Akihiko 2 Kawakami Satoshi 3 Kumeda Hirotaka 1 Umesaki Tetsuya 1 Agatsuma Hiroyuki 1 Sakaizawa Takao 1 Tominaga Yoshiaki 1 Toishi Masayuki 1 Hashizume Masahiro 1 Shiina Takayuki 1 Yoshida Kazuo 1 Asaka Shiho 2 Matsushita Mina 3 Koizumi Tomonobu 4 1 Division of Thoracic Surgery Department of Surgery Shinshu University Matsumoto Japan 2 Department of Pathology Shinshu University Matsumoto Japan 3 Department of Radiology Shinshu University Matsumoto Japan 4 Comprehensive Cancer Center Shinshu University Matsumoto Japan Adusumilli Prasad S. Editor Memorial Sloan-Kettering Cancer Center United States of America * E-mail: tks1976shinshu-u.ac.jp Competing Interests: The authors have declared that no competing interests exist. Conceived and designed the experiments: TE AY SK. Performed the experiments: TE AY SK HK TU HA T. Sakaizawa SA MM. Analyzed the data: TE YT MT MH T. Shiina KY TK. Contributed reagents/materials/analysis tools: TE TK. Wrote the paper: TE AY SK. 2014 20 5 2014 9 5 e97867 6 3 2014 25 4 2014 2014 Eguchi et al This is an open-access distributed under the terms of the Creative Commons Attribution License which permits unrestricted use distribution and reproduction in any medium provided the original author and source are credited. Objectives Pulmonary ground-glass nodules (GGNs) are occasionally diagnosed as invasive adenocarcinomas. This study aimed to evaluate the clinicopathological features of patients with pulmonary GGNs to identify factors predictive of pathological invasion. Methods We retrospectively evaluated 101 pulmonary GGNs resected between July 2006 and November 2013 and pathologically classified them as adenocarcinoma in situ (AIS; n?=?47) minimally invasive adenocarcinoma (MIA; n?=?30) or invasive adenocarcinoma (I-ADC; n?=?24). The age sex smoking history tumor size and computed tomography (CT) attenuation of the 3 groups were compared. Receiver operating characteristic (ROC) curve analyses were performed to identify factors that could predict the presence of pathologically invasive adenocarcinomas. Results Tumor size was significantly larger in the MIA and I-ADC groups than in the AIS group. CT attenuation was significantly greater in the I-ADC group than in the AIS and MIA groups. In ROC curve analyses the sensitivity and specificity of tumor size (cutoff 11 mm) were 95.8% and 46.8% respectively and those for CT attenuation (cutoff ?680 HU) were 95.8% and 35.1% respectively; the areas under the curve (AUC) were 0.75 and 0.77 respectively. A combination of tumor size and CT attenuation (cutoffs of 11 mm and ?680 HU for tumor size and CT attenuation respectively) yielded in a sensitivity and specificity of 91.7% and 71.4% respectively with an AUC of 0.82. Conclusions Tumor size and CT attenuation were predictive factors of pathological invasiveness for pulmonary GGNs. Use of a combination of tumor size and CT attenuation facilitated more accurate prediction of invasive adenocarcinoma than the use of these factors independently. The authors have no support or funding to report. Introduction We have previously evaluated the usefulness of computed tomography (CT) as a screening tool for lung cancer [1] [2]. With the increased use of CT screening cases of lung cancer appearing as pure ground-glass nodules (GGNs) which are radiologically nonsolid nodules are being detected with increasing frequency [3]. Neoplastic cells in pure GGNs are usually distributed along pre-existing alveolar structures in a lepidic growth pattern without interstitial invasion [4] and because of this limited resection is sometimes indicated in patients with pulmonary pure GGNs. However a subset of pulmonary pure GGNs are associated with pathological invasion and in general it is difficult to distinguish between pure GGNs with invasion and those without invasion by CT examination. The relationship between pathological invasiveness and radiological findings of pulmonary pure GGNs has not yet been fully elucidated and hence the objective of this study was to evaluate the demographic and clinicopathological features of patients with pulmonary pure GGNs in order to identify factors predictive of pathological invasion. Patients and Methods This retrospective study was approved by the institutional review board of Shinshu University Hospital Matsumoto Japan and was conducted in accordance with the principles outlined in the Declaration of Helsinki. Between July 2006 and November 2013 775 patients underwent lung resection for primary lung cancer at Shinshu University Hospital. Among these patients 101 tumors in 98 patients appeared as pure GGNs on the last CT examination performed before surgery and we retrospectively investigated the clinicopathological characteristics of these 101 tumors. During this period we used 2 types of CT scanners for the diagnosis of GGNs: Light Speed Ultra (GE Healthcare Freiburg Germany) CT scanner from July 2006 to December 2007; and the Light Speed VCT Vision (GE Healthcare) CT scanner from December 2007 onwards. Written informed consent was not given by participants for their clinical records to be used in this study. Patient records/information was anonymized and de-identified prior to analysis. Radiological Definition All CT examinations were performed at our institute and full resolution scans of 1.25-mm-thick sections were obtained without the use of contrast media. All tumors were viewed in both the lung window setting (window level ?550 Hounsfield units [HU]; window width 1500 HU) and mediastinal window setting (window level 30 HU; window width 400 HU). Two experienced radiologists (SK and MM) who were blinded to the patients™ clinical information independently interpreted all of the scans. Pure GGNs were defined as focal nodular areas of increased lung attenuation through which normal parenchymal structures including airways and vessels could be visualized [5]. Nodules that included both ground-glass and solid components were defined to be ˜part-solid GGNs™ [6] and were excluded from the study. Solid components were evaluated using the mediastinal window setting [6]. The radiological tumor size was defined as the maximum lesion diameter in the lung window setting. The mean CT attenuation was measured using the region-of-interest cursors which traced the edge of the tumor on the slices containing the region of the lesion with the maximum diameter [7]. Histological Examination All tumors were histologically evaluated by two experienced pathologists (AY and SA) who were blinded to the patients™ clinical information. All histological evaluations were performed by examining hematoxylin and eosin stained slides which were prepared using formalin-fixed paraffin-embedded tissues. Adenocarcinoma lesions were classified according to the new lung adenocarcinoma classification proposed by the International Association for the Study of Lung Cancer American Thoracic Society and European Respiratory Society (IASLC/ATS/ERS) [8]. Surgical Criteria In our institute surgical resection for pure GGNs was indicated in cases of tumors ?10 mm in size tumors enlarged during the follow-up period and other tumors with surgical indications present in the ipsilateral lung. The surgical procedure for pure GGNs was determined according to the tumor size as follows: <10 mm partial resection; 10 mm to <20 mm segmentectomy or lobectomy; and ?20 mm lobectomy. However radiological follow-up or limited surgery were occasionally selected by the attending physicians on considering factors such as patient age lung function performance status and pre-existing diseases. Statistical Analysis The tumors were divided into 3 groups according to pathological classifications: (1) adenocarcinoma in situ (AIS) (2) minimally invasive adenocarcinoma (MIA) and (3) invasive adenocarcinoma (I-ADC). Patient characteristics (age sex smoking history and preoperative plasma carcinoembryonic antigen [CEA] levels) tumor size and mean CT attenuation values were compared between the 3 groups. Continuous variables were compared using the analysis of variance with Scheffe™s post-hoc test and categorical data were compared using Chi-square tests. Pearson™s correlation analyses were used to verify whether the tumor size and mean CT attenuation values could be useful for predicting the pathological invasion diameter and receiver operating characteristic (ROC) curve analyses were used to confirm the predictive value of factors identified as predictive of pathologically invasive adenocarcinomas. All statistical analyses were performed using PASW Statistics 18.0 (IBM corp. Armonk NY). All data are reported as mean ± standard deviation and statistical significance was set at P<0.05. Results Patient Characteristics and Radiological Tumor Properties The age sex smoking history serum CEA levels tumor size and mean CT attenuation for all patients and for each group are summarized in Table 1. 10.1371/journal.pone.0097867.t001 Table 1 Patient characteristics and tumor properties. Total (n?=?103) AIS (n?=?47) MIA (n?=?30) I- ADC (n?=?24) p value Age (years) 64.3±9.7 63±10.8 64.3±9.2 66.3±8 0.3953 Sex (male/female) 39/62 19/28 14/16 6/18 0.5983 Smoking history (with/without) 31/70 15/32 13/17 3/21 0.1976 CEA level (ng/ml) 2.1±1.7 1.8±0.9 2.6±2.6 2.1±1.1 0.1408 Tumor size (mm) 13.1±5.5 11±3.6 14.7±7.6# 15.5±3.6# 0.0005 CT attenuation (HU) ?621±86.3 ?649.8±88.4 ?625.8±88.4 ?560.2±69.3* <0.0001 Abbreviations: AIS adenocarcinoma in situ; MIA minimally invasive adenocarcinoma; I-ADC invasive adenocarcinoma; CEA carcinoembryonic antigen; CT computed tomography; HU Hounsfield unit. # significantly higher than tumor size in the AIS group. *significantly higher than CT attenuation in the AIS and MIA groups. Surgical Procedures The surgical procedures performed for the 101 tumors in 98 patients were as follows: lobectomy 34 tumors in 32 patients; segmentectomy 28 tumors in 28 patients; and partial resection 39 tumors in 39 patients. In 2 patients who underwent lobectomy 2 tumors were present in the same lobe. In 1 patient with two tumors in different lobes in the ipsilateral lung lobectomy and partial resection were performed. Pathological Findings and Outcomes Pathologically all lesions were diagnosed as pulmonary adenocarcinoma. The IASLC/ATS/ERS classification of these adenocarcinomas was as follows: AIS 47 lesions; MIA 30 lesions; and I-ADC 24 lesions (lepidic predominant 10 lesions; papillary predominant 8 lesions; and acinar predominant 6 lesions). The mean pathological maximum diameter was 11.0±5.4 mm. The mean invasion diameter was 2.9±3.7 mm. All patients in our study were classified as having pathological stage T1aN0M0 lung cancer. No vascular invasion lymph node metastasis or intrapulmonary metastasis was detected. The median follow-up duration (from the date of surgery to the last follow-up) was 21.2 months (range 1“51.2 months). Recurrence was not observed in any patient and 1 patient in the MIA group died 12 months after surgery due to an unrelated cause. Figure 1 shows representative radiological and histological images from patients in each of the groups. 10.1371/journal.pone.0097867.g001 Figure 1 Representative radiological and histological images. (a) A 64-year-old female patient with adenocarcinoma in situ. (i) Computed tomography (CT) scan (lung window setting) showed a pure ground-glass nodule (GGN) 11.9 mm in size. The mean CT attenuation of the tumor was ?716 Hounsfield units (HU). (ii) Mediastinal window setting CT showed no tumor components except for vessels. (iii) Low magnification image (hematoxylin and eosin (HE) staining) showed a circumscribed tumor growing purely with a lepidic pattern without foci of invasion. A slight thickening of the alveolar walls in the tumor area was observed. (iv) Middle magnification image of the tumor (HE staining) revealed that tumor cells appeared to replace normal pneumocytes on alveolar walls. (b) A 63-year-old female patient with minimally invasive adenocarcinoma. (i) Lung window CT image showed a pure GGN 14.2 mm in size. The mean CT attenuation was ?691 HU. (ii) Mediastinal window CT showed no tumor components. "

Lung_Cancer

" distribution and reproduction in any medium provided the original author and source are credited. The epithelial mesenchymal transition (EMT) is an important process in tumor development. Despite previous investigations it remains unclear how p120-catenin (p120ctn) isoforms 1A and 3A affect the EMT of tumor cells. Here we investigated expression of p120ctn E-cadherin and vimentin in 78 human non-small cell lung cancer (NSCLC) samples by immunohistochemistry and found that p120ctn membrane expression positively correlated with E-cadherin expression (P<0.001) and negatively correlated with vimentin expression and lymph node metastasis (P<0.05). Meanwhile p120ctn cytoplasmic expression negatively correlated with E-cadherin expression (P<0.001) and positively correlated with vimentin expression and lymph node metastasis (P<0.05). Cells expressing high (H460 and SPC) and low (H1299 and LK2) levels of p120ctn were screen to investigate its impact on EMT. E-cadherin was restricted to the cell membrane in H460 and H1299 cells whereas it was expressed in the cytoplasm of SPC and LK2 cells. Ablation of endogenous p120ctn isoform 1A in cells expressing high levels of the protein resulted in decreased E-cadherin expression increased N-cadherin vimentin and snail expression and enhanced invasiveness in H460 cells. Meanwhile completely opposite results were observed in SPC cells. Furthermore transfection of in H1299 cells expressing low p120ctn levels with the p120ctn isoform 1A plasmid resulted in increased E-cadherin expression decreased N-cadherin vimentin and snail expression and weakened invasiveness while LK2 cells showed completely opposite results. Both cell lines expressing low p120ctn levels and transfected with the p120ctn isoform 3A plasmid appeared to have increased E-cadherin expression decreased N-cadherin vimentin and snail expression and weakened invasiveness. In in cells with membrane E-cadherin both p120ctn isoforms 1A and 3A inhibited EMT and decreased cell invasiveness. In cells with cytoplasmic E-cadherin p120ctn isoform 1A promoted EMT and increased cell invasiveness while p120ctn isoform 3A inhibited the EMT and decreased cell invasiveness. This work was supported by grants from the National Natural Science Foundation of China (grants 81071905 and 81272606 to E.-H. W. grants 81101780 to Y.Z.). The funders had no role in study design data collection and analysis decision to publish or preparation of the manuscript. Introduction The epithelial mesenchymal transition (EMT) is a rapid and often reversible change of cell phenotype and plays a particularly important role in tumor development. In the process of EMT epithelial cells undergo a phenotypic switch to form mesenchymal cells that are similar in appearance to fibroblasts [1] [2]. Such phenotypic changes cause epithelial cells to lose their characteristic cell-cell adhesion structures alter their polarity modulate the anization of their cytoskeletal systems switch expression from keratin- to vimentin-type intermediate filaments as well as become isolated motile and resistant to anoikis [3] [4]. Typically cells undergoing EMT show decreased E-cadherin expression [5] [6] and decreased expression of mesenchymal biomarkers such as N-cadherin vimentin snail slug and twist [7] [8]. Previous studies on the relationship between p120-catenin (p120ctn) and EMT have been confined to the switch from short to long p120ctn isoforms during the EMT induced by expression of SIP1/ZEB2 [9] twist [10] or Zeppo1 [11]. However the mechanism by which p120-catenin isoforms 1A and 3A affect EMT of tumor cells remains unknown. The p120ctn protein has four isoforms (1 to 4) resulting from four transcriptional start sites and each isoform has a full central Armadillo repeat domain that can interact with the juxtamembrane domain of E-cadherin in order to participate in the formation of an adhesion complex on the cell membrane [12]. These observations suggest that the subcellular localization and function of p120ctn can be affected by the localization of E-cadherin. Previous studies have shown that p120ctn may play opposing roles depending on whether it is located on the membrane or in the cytoplasm of cells [13] [14]. Others have also found that p120ctn isoforms 1A and 3A have different regulatory functions on tumor cell proliferation invasion and metastasis [15] [16] . These studies indicate that if p120ctn has an impact on the EMT it is likely to be different between p120ctn isoforms 1A and 3A. Some studies have shown that p120ctn may promote or inhibit tumor growth and invasiveness depending on whether E-cadherin expressed or not [18] [19]. Yu and colleagues also found different effects of p120ctn isoforms 1A and 3A on proliferation and invasion in tumor cells exhibiting different localizations of E-cadherin [20]. Thus whether p120ctn isoforms 1A and 3A also play different roles in regulating EMT in tumor cells with E-cadherin at different locations remains unknown. The aim of this study was to determine the potential effects and regulatory mechanisms of p120ctn isoforms 1A and 3A on EMT in lung cancer cells. We first revealed that the membrane or cytoplasmic expression of p120ctn correlated with expression of E-cadherin and vimentin or lymph node metastasis by immunohistochemistry. We further detected the expression levels of p120ctn E-cadherin and vimentin in lung cancer cells by Western blot and screened cell lines expressing both low and high levels of p120ctn and with E-cadherin in the membrane or cytoplasm. Changes in expression of EMT-related molecules and cell invasion were also investigated by knockdown of endogenous p120ctn-1A or overexpression by transfection of p120ctn-1A and 3A plasmids into cells. Materials and Methods Materials This study was conducted with the approval of the institutional review board at China Medical University. Written consent was given by the participants for their information to be stored in the hospital database and for their specimens to be used in this study. All clinical investigations were conducted according to the principles expressed in the Declaration of Helsinki. Samples were collected from 78 cases of squamous cell lung cancer and lung adenocarcinoma diagnosed at the First Affiliated Hospital of China Medical University (Sheny-ang China). The samples were from 46 male and 32 female patients with an average age of 57 years. The samples were classified according to lung tumor histological criteria (2004) of the World Health anization (WHO) [21] as squamous cell lung carcinoma (32 cases) or lung adeno-carcinoma (46 cases). Thirty cases were highly differentiated and forty-eight were moderately or poorly differentiated. Lymph node metastases were present in 43 cases but not in the other 35. We selected cases with lymph node metastases to compare the metastatic nodules with the primary tumor. Tumor staging was performed according to the tumor-node-metastasis (TNM) staging system of the International Union against Cancer (UICC) [22]. There were 39 cases at stage I“II and 39 cases at stage IIIa“IIIb. None of the patients had received radiotherapy or chemotherapy before the operation and were given the standard treatment following the surgery. All samples were fixed in formalin embedded in paraffin and stained with hematoxylin and eosin for pathological analysis and diagnosis. Cell culture Normal human bronchial epithelial (HBE) cells and A549 H1299 H460 and H157 cell lines were obtained from the American Type Culture Collection (Manassas VA USA). The SPC-A-1 LTEP-A-2 and LK2 cell lines were purchased from the Shanghai Cell Bank of Chinese Academy of Science. The human lung ADC Anip973 and AGZY83a cell lines were purchased from Shanghai Bioleaf Biotech Co. Ltd (http://www.bioleaf.com) and stored in the Department of Pathology Harbin Medical University. Cells were cultured in RPMI 1640 (Invitrogen Carlsbad CA USA) containing 10% fetal calf serum (Invitrogen) 100 IU/ml penicillin (Sigma St. Louis MO USA) and 100 mg/ml streptomycin (Sigma). Plasmid construction and transfection Expression plasmids for p120ctn isoforms 1A and 3A (donated by Dr. Albert B. Reynolds Department of Cancer Biology Vanderbilt University School of Medicine TN USA) have been described previously [16]. Sequences of p120ctn-1A-siRNA (Guangzhou Ruibo Co. Ltd Guangzhou China) used in the experiments were as follows: si-h-CTNND1: 5?-CACAAGAUGCCAACCCACU dTdT-3? 3?-dTdT GUGUUCUACGGUUGGGUGA-5?. The cells were transiently transfected with p120ctn-1A-siRNA and plasmids expressing p120ctn isoforms 1A and 3A using Lipofectamine 2000 (Invitrogen Carlsbad CA) or Attractene Transfection Reagent (QIAGEN GmbH Hilden Germany) according to the manufacturer's instructions. Immunohistochemistry The paraffin embedded samples were cut serially into 4-?m thick sections. Normal bronchial epithelium present in the tumor slides was used as an internal positive control. Immunostaining was performed by the streptavidin-peroxidase (S-P) method. The tissue sections were incubated with a p120ctn mouse monoclonal antibody (1?100 cat. 610134 BD Transduction Laboratories Lexington KY USA) E-cadherin rabbit monoclonal antibody (1?100 cat. SC-7870; Santa Cruz Biotechnology Santa Cruz CA USA) or vimentin rabbit monoclonal antibody (ready-to-use cat. RMA-0547 MaiXin Bio Fuzhou China) at 4°C overnight. PBS was used as a negative control. Biotinylated goat anti-mouse serum IgG or biotinylated goat anti-rabbit serum IgG (ready-to-use cat. KIT-9922 MaiXin Bio) was used as the secondary antibody. After washing the sections were incubated with streptavidin“biotin conjugated with horseradish peroxidase (Ultrasensitive MaiXin Bio) and then the peroxidase reaction was developed with 33-diaminobenzidine tetrahydrochloride (MaiXin Bio). Light counterstaining was performed with hematoxylin and then the sections were dehydrated in alcohol before being mounted. Two investigators independently examined all the tumor slides. Five random fields were examined per slide and 100 cells were observed per high magnification field (400×). The percentage of positive cells was scored as follows: 0?=?no staining; 1+?=?0“25%; 2+?=?26“50%; 3+?=?51“75%; and 4+?=?76“100%. The staining intensity was scored as follows: 0?=?no staining; 1?=?light yellow granules; 2?=?dark yellow or brown granules. The labeling score defined by multiplying the percentage of positive cells by the staining intensity was the final score for the section. When the total score was ?3 the case was defined as positive. When the total score was <3 the case was defined as negative. For scores greater than 3 points when more than 30% of the tumor cells stained strongly and continuously for p120ctn signal on the cell membrane the sample was defined as membrane positive. When fewer than 30% of the tumor cells displayed membrane expression but stained strongly and continuously for p120ctn in the cytoplasm the sample was defined as cytoplasm positive. Western blot analysis Fifty micrograms of proteins were separated by SDS-PAGE (10%). After transfer to a polyvinylidene fluoride (PVDF) membrane (Millipore Billerica MA USA) the proteins were incubated overnight at 4°C with antibodies to the following: p120ctn (1?500 cat. 610134) E-cadherin (1?300 cat. 610181) N-cadherin (1?1000 cat. 610920) (BD Transduction Laboratories Lexington KY USA) vimentin (1?1000 cat. 5741) snail (1?500 cat. 3879) (Cell Signaling Technology Boston MA USA) and twist (1?200 cat. sc-15193 Santa Cruz Biotechnology). After incubation with anti-mouse (1?2000 E030110-01) or anti-rabbit (1?2000 E030120-01) IgG (EarthOx LLC San Francisco CA USA) at 37°C for 2 h the protein bands were visualized using enhanced chemiluminescence (ECL Thermo Fisher Scientific Waltham MA USA) and quantified using BioImaging Systems (UVP Upland CA USA). Relative protein levels were calculated in reference to GAPDH as the loading control. Immunofluorescent staining Cells grown on glass coverslips were fixed with ice-cold 4% paraformaldehyde for 15 min followed by permeabilization with 0.2% Triton X-100 and incubation with normal goat serum for 30 min at 37°C. Cells were then incubated overnight with p120ctn mouse monoclonal antibody (1?200 cat. 610134; BD Transduction Laboratories Lexington KY USA) and E-cadherin rabbit polyclonal antibody (1?100 SC-7870; Santa Cruz Biotechnology). Primary antibodies were applied overnight at 4°C followed by incubation with a rhodamine/fluorescein-5-isothiocyanate (FITC)-labeled secondary antibody goat anti-mouse or TRITC-labeled goat anti-rabbit IgG (1?100 cat. E031210-01 and E031320-01 EarthOx San Francisco CA USA). The nuclei were counterstained with propidium iodide/4 6 diamidino-2-phenylin-dole. Epifluorescent microscopy was performed using an inverted Nikon TE300 microscope (Melville NY USA) and confocal microscopy was performed using a Radiance 2000 laser scanning confocal microscope (Carl Zeiss Thornwood NY USA). Matrigel cell invasion assay Matrigel cell invasion assays were performed according to the manufacturer's instructions (Corning Acton MA USA). A 100-?l cell suspension (5×105 cells) was added to the upper chamber while the lower chamber was filled with RPMI 1640 medium containing 10% fetal calf serum. Each upper and lower chamber was separated by a 8-?m porous polycarbonate membrane. The cells were incubated for 24 h at 37°C in a humid atmosphere with 5% CO2. After the medium was discarded the cells were fixed with methanol for 30 min and stained with hematoxylin (Sigma). For each filter the numbers of cells that invaded to the lower surface of the porous membrane in five different fields of 400× magnification were counted randomly using a Nikon E200 microscope. The mean was calculated from data obtained from each experiment repeated three times. Statistical analysis All statistical analyses were performed using SPSS 17.0 (SPSS Inc. Chicago IL USA) for Windows software. The chi-square test was used to analyze immunohistochemistry data. The independent samples T test was used to examine transwell experimental data. P values<0.05 were considered statistically significant. Results Membrane expression of p120ctn positively correlates with E-cadherin expression and negatively correlates with vimentin expression and lymph node metastasis Normal bronchial epithelial tissues showed p120ctn in the membrane (Figure 1A) while the proportion of lung cancer tissues expressing p120ctn in the membrane was significantly lower (35% 27/78) than that with p120ctn cytoplasmic expression (65% 51/78). E-cadherin was expressed in the membrane in normal bronchial epithelium tissues (Figure 1A) while the rate of positive expression was decreased (28% 22/78) and that of negative expression was significantly increased (72% 56/78) for E-cadherin in lung cancer tissues. Vimentin was negatively expressed in normal bronchial epithelial tissues (Figure 1A) while the rate of positive expression was increased to 32% (25/78) in the lung cancer tissue. It appears lung cancer tissues with cytoplasmic/nuclear localization of p120ctn tended to express vimentin in comparison with those with the membranous localization (41.2% [21/51] versus 14.8 [4/27]).. Cytoplasmic/nuclear localization of p120ctn showed increased lymph node metastasis (29/51) in comparison with the membranous localization (8/27). Statistical analysis showed that the localization of p120ctn was closely related with E-cadherin expression vimentin expression and lymph node metastasis (P<0.05) (Table 1). In other words p120ctn membrane expression was positively correlated with E-cadherin expression and negatively correlated with vimentin expression and lymph node metastasis (Figure 1B); meanwhile p120ctn cytoplasmic expression was negatively correlated with E-cadherin expression and positively correlated with vimentin expression and lymph node metastasis (Figure 1C). 10.1371/journal.pone.0088064.g001 Figure 1 Immunohistochemical analysis of p120ctn E-cadherin and vimentin localization in NSCLC. (A) E-cadherin and p120ctn were membrane positive and vimentin was negative in normal bronchial epithelial cells. (B) E-cadherin was membrane positive and vimentin was negative in p120ctn membrane-positive lung cancer cells. (C) E-cadherin was negative and vimentin was positive in p120ctn cytoplasmic-positive lung cancer cells. 10.1371/journal.pone.0088064.t001 Table 1 Correlation between E-cadherin vimentin and lymph node metastasis and p120ctn. p120ctn N membrane cytolymph/nucleolus X2 p E-cadherin negative 56 9 47 30.166 <0.01 positive 22 18 4 Vimentin negative 53 23 30 5.633 0.022 positive 25 4 21 Lymph node metastasis No 41 19 22 5.251 0.032 Yes 37 8 29 Localization of p120ctn is consistent with E-cadherin in lung cancer cells We examined the protein expression levels of p120ctn and E-cadherin in normal HBE cells and nine lung cancer cell lines by Western blot and found that they all expressed mainly isoforms 1A (120 kDa) and 3A (100 kDa) of p120ctn (Figure 2A). Although the protein expression levels of p120ctn were not related to E-cadherin the localization (membrane or cytoplasm) of p120ctn was always consistent with that of E-cadherin. We then screened cells expressing high levels of p120ctn and E-cadherin in the membrane (H460 cells) or cytoplasm (SPC cells) as well as those expressing low levels of p120ctn and E-cadherin in the membrane (H4299 cells) or cytoplasm (LK2 cells) for further study (Figure 2B). 10.1371/journal.pone.0088064.g002 Figure 2 Expression and localization of p120ctn and E-cadherin in H460 SPC H1299 and LK2 cells. (A) Western blot analyses showed expression of p120ctn and E-cadherin in nine lung cancer cell lines and HBE. (B) By immunofluorescence analysis the expression of E-cadherin and p120ctn were observed restricted to the cell membrane at cell-cell adherens junctions in H460 and H1299 cells whereas they both were confined to the cytoplasm in SPC and LK2 cells. Different functions of p120ctn isoform 1A in EMT are dependent on E-cadherin subcellular localization Knockdown of endogenous p120ctn isoform 1A by siRNA-p120ctn-1A resulted in decreased E-cadherin expression and increased N-cadherin snail and vimentin expression in H460 cells (Figure 3A). However knockdown of endogenous p120ctn-1A by siRNA-p120ctn-1A showed opposite results in SPC cells where we found increased E-cadherin expression and decreased N-cadherin snail and vimentin expression (Figure 3B). In comparison with the control the ablation of p120ctn isoform 1A also enhanced the H460 cells invasiveness (17.33±1.25 vs. 36.33±1.70 P<0.01) (Figure 3C) whereas reduced the SPC cells invasiveness (23.0±0.82 vs. 13.0±0.82 P<0.01) (Figure 3D). These results revealed that the p120ctn isoform 1A plays a different role in EMT and cell invasiveness in different E-cadherin subcellular locations. 10.1371/journal.pone.0088064.g003 Figure 3 p120ctn isoform 1A plays a different role in regulating EMT in H460 and SPC cells. (A) Ablation of p120ctn isoform 1A decreased E-cadherin expression and increased N-cadherin snail and vimentin expression in H460 cells. (B) SPC cells were treated as in (A) and the opposite results were obtained. (C) Ablation of p120ctn isoform 1A enhanced the invasiveness of H460 cells (**P<0.01). (D) Ablation of p120ctn isoform 1A decreased the invasiveness of SPC cells (**P<0.01). Inhibitory function of p120ctn isoform 3A on EMT is not affected by differences in E-cadherin subcellular localization To verify whether p120ctn isoforms 1A and 3A play different roles in regulating EMT their expression plasmids were transiently transfected into lung cancer cells with low expression of p120ctn (H1299 with membrane E-cadherin expression and LK2 with cytoplasmic E-cadherin expression). The western-blot analysis demonstrated that overexpression of the p120ctn isoform 1A led to increased E-cadherin expression and decreased N-cadherin vimentin and snail expression (Figure 4A); on the contrary the decreased E-cadherin expression and increased N-cadherin vimentin and snail expression were observed in LK2 cells (Figure 4B). Overexpression of the p120ctn isoform 1A also reduced the H1299 cell invasiveness (52.0±2.65 vs. 33.33±2.64 P<0.01) (Figure 4C) while enhanced the LK2 cell invasiveness (18.0±0.82 vs. 39.66±2.05 P<0.01) (Figure 4D).. Overexpression of p120ctn isoform 3A led to increased E-cadherin expression decreased N-cadherin vimentin and snail expression (Figure 4A 4B) and reduced cell invasiveness (52.0±2.65 vs. 29.66±1.53 P<0.01; 18.0±0.82 vs. 8.33±expression 0.47 P<0.01) (Figure 4C 4D) in both of these cell lines. These results further confirmed that the p120ctn isoform 1A had a different effect on EMT depending on the subcellular localization of E-cadherin. They also revealed that the p120ctn isoform 3A maintained an inhibitory role in the EMT of lung cancer cells whether E-cadherin was localized to the membrane or the cytoplasm. 10.1371/journal.pone.0088064.g004 Figure 4 p120ctn isoform 3A maintains the role of inhibitiing EMT independently of E-cadherin localization. (A B) Both H1299 (E-cadherin membrane localization) and LK2 cells (E-cadherin cytoplasmic localization) transiently transfected with the p120ctn isoform 3A plasmid showed increased E-cadherin expression and decreased N-cadherin vimentin and snail expression. (C D) Transient transfection of p120ctn isoform 3A plasmids into H1299 and LK2 cells resulted in decreased cell invasiveness (**P<0.01). (E) E-cadherin remained localized on the membrane in H1299 cells and in the cytoplasm of LK2 cells after transfection of the p120ctn isoform 3A plasmid. Discussion The phenomenon of EMT in tumor cells often leads to decreased cell adhesion and increased mobility and this transition is accompanied by decreased E-cadherin expression and increased expression of N-cadherin vimentin and other mesenchymal biomarkers [3] [4] [5] [6] [7]. As an important factor for stabilizing E-cadherin p120ctn plays a role in inhibiting or promoting tumor cell proliferation and invasion that is dependent on whether E-cadherin is expressed or not [16] [17]. Furthermore p120ctn isoforms 1A and 3A have shown different effects on E-cadherin expression and tumor cell invasiveness which are based on differences in the localization of E-cadherin [18]. These results strongly suggest that p120ctn most likely regulates the EMT of tumor cells by affecting E-cadherin expression and that p120ctn isoforms 1A and 3A play different roles in EMT expressing E-cadherin in different subcellular locations. We first found that the p120ctn membrane expression was positively correlated with E-cadherin expression and negatively correlated with vimentin expression and lymph node metastasis while the cytoplasmic expression of p120ctn was negatively correlated with E-cadherin expression and positively correlated with vimentin expression and lymph node metastasis by immunohistochemistry. Although these results were consistent with previous studies [13] [14] they further suggested that p120ctn likely affects the EMT by influencing the expression of E-cadherin and vimentin and thereby the cell invasion and metastasis in non-small cell lung cancer (NSCLC). To confirm the different impacts of p120ctn isoforms 1A and 3A on EMT in cells expressing E-cadherin in different locations we selected H460 and H1299 cells with E-cadherin membrane expression and SPC and LK2 cells with E-cadherin cytoplasmic expression for further analysis. Plasmids expressing the p120ctn isoforms 1A and 3A were constructed and the full-length p120ctn siRNA was synthesized for these experiments. Since the sequence beyond amino acids 1“101 of p120ctn isoform 1A is similar to that of p120ctn isoform 3A [24] [25] we could not design an interference sequence specifically for p120ctn isoform 3A. Therefore we had to further study the impact of the two isoforms on EMT and cell invasiveness in lung cancer cells with different E-cadherin locations specifically by knocking down p120ctn isoform 1A in H460 and SPC cells with high p120ctn expression and transfecting cDNA plasmids for exogenous p120ctn isoforms 1A and 3A into H1299 and LK2 cells with low expression of p120ctn. Knockdown of p120ctn isoform 1A in H460 cells destroyed the epithelial cell adhesion complexes. E-cadherin expression was also downregulated due to the loss of its important stabilizing factor p120ctn isoform 1A which was consistent with previous studies [20] [26]. Decreased E-cadherin expression and disrupted cell-cell adhesion may induce EMT [27] [28] [43] [44] which results in increased N-cadherin vimentin and snail expression and enhanced cell invasiveness. On the other hand overexpressed p120ctn isoforms 1A and 3A was shown to bind E-cadherin located on the membrane proactively in tumor cells [29] and then inhibit the degradation of E-cadherin and stabilize its expression contributing to the formation of effective epithelial cell adhesion complexes [30] [31] [32]. As these series of processes maintained the normal cell-cell adhesion connection and inhibited EMT there was increased E-cadherin expression and decreased N-cadherin vimentin and snail expression as well as inhibited cell invasiveness in H1299 cells. Previous studies have shown that although p120ctn isoform 1A could bind E-cadherin in the cytoplasm they could not form effective adhesion complexes on the membrane between epithelial cells [33]. Furthermore the cytoplasmic E-cadherin is likely not to be the full-length E-cadherin but instead cleaved E-cadherin fragments such as E-cad/sE-cad (80 kDa) and E-cad/CTF2 (33 kDa) [34]. The E-cad/CTF2 fragment can bind to p120 in the cytoplasm and then translocate into the nucleus and bind the transcriptional repressor of Kaiso to activate the Wnt/b-catenin pathway [35] [36] finally promoting the EMT of tumor cells and enhancing cell invasion and metastasis [37]. Moreover others have shown that p120ctn-1A is related to abnormal expression of E-cadherin and poor prognosis [38]. These studies illustrated that the cytoplasmic p120ctn isoform 1A can play a role in promoting tumor cell EMT invasion and metastasis. Based on the above we observed on the one hand that the effect of p120ctn isoform 1A to promote tumor cell EMT invasion and metastasis would be lifted by its ablation resulting in increased E-cadherin expression decreased N-cadherin vimentin and snail expression and inhibited invasiveness in SPC cells. On the other hand transfection of the p120ctn isoform 1A plasmid into LK2 cells expressing cytoplasmic E-cadherin resulted in decreased E-cadherin expression increased N-cadherin vimentin and snail expression and enhanced cell invasiveness. Although the precise role of p120ctn during EMT induction is still unclarified previous studies suggested that knockdown of all isoforms of p120ctn could induce EMT indirectly [27] [28] [43] [44]. All inductions were based on decreased E-cadherin expression and intercellular adhesion in previous studies which were also confirmed by our study in H460 cells with E-cadherin membrane localization. Unlike the H460 cells knockdown of the p120ctn isoform 1A in SPC cells with E-cadherin cytoplasmic expression could not decrease E-cadherin expression and intercellular adhesion. Instead we found increased E-cadherin expression and decreased cell invasiveness indicating that the EMT could not be induced by this pathway in SPC cells. It was worth noting that the same result was observed in LK2 and H1299 cells transfected with the p120ctn isoform 3A plasmid both showing increased E-cadherin expression decreased N-cadherin vimentin and snail expression and inhibited cell invasiveness. These results suggested that p120ctn isoform 3A has the function of inhibiting EMT of lung cancer cells and this function is independent of the cellular E-cadherin localization. Past research had also confirmed a shift from p120ctn isoform 3A to p120ctn isoform 1A expression after the induction of EMT [9] [10] [11] which indirectly indicates that p120ctn isoform 3A"

Lung_Cancer

"non-small cell lung cancer International Journal of Molecular Medicine 2010 25 4 517 523 2-s2.0-77749289244 20198299 38 Roy S Yu Y Padhye SB Sarkar FH Majumdar AP Difluorinated-curcumin (CDF) restores PTEN expression in colon cancer cells by down-regulating miR-21 PLoS One 2013 8 e68543 miR-21 expression was knocked down by transfecting NSCLC A549 cells with anti-miR-21. miR-21 expression in A549 cells at 48?h after transfection with anti-miR-NC or anti-miR-21 was detected by TaqMan real-time quantitative RT-PCR. The mean and standard deviation of expression levels relative to U6 expression levels are shown and are normalized to the expression in A549 cells transfected with anti-miR-NC. All experiments were performed at least in triplicate. *P < 0.05 versus cells transfected with anti-miR-NC. Clonogenic survival of NSCLC A549 cells after varying doses of ionizing radiation. A549 cells were transfected with either anti-miR-21 or anti-miR-NC and 48?h later were irradiated followed by a further incubation for 24?h at 37°C before trypsinization and plating for clonogenic survival. After 14-day incubation colonies were stained and the surviving fractions were determined. *P < 0.05 versus cells transfected with anti-miR-NC. Each value represents the means ± SD for three independent experiments. Proliferation of NSCLC A549 cells after ionizing radiation (IR). A549 cells were transfected with either anti-miR-21 or anti-miR-NC and 48?h later were exposed to 8?Gy of IR and the growth characteristics of A549 cells were determined by MTT assay 72 hours after IR. The anti-miR-NC-transfected sample was normalized to 100% cell viability. The data represent the means ± SD of three separate experiments. Student's t-test was used to analyze the statistics (*P < 0.05). Apoptosis of NSCLC A549 cells after ionizing radiation (IR). Apoptosis in anti-miR-21- (or anti-miR-NC-) transfected A549 cells combined with (or without) IR (8.0?Gy) was detected through annexin V-FITC/PI staining by flow cytometric analysis. The data represent the means ± SD of three separate experiments. Student's t-test was used to analyze the statistics (*P < 0.05). Suppression of ionizing radiation-induced phosphorylated-Akt (p-Akt) upregulation by anti-miR-21 in NSCLC A549 cells. The expression level of the phosphorylated or total Akt in A549 cells transfected with anti-miR-21 or anti-miR-NC for 48?h followed by ionizing radiation (8?Gy) with or without 10?ng/mL PI3K constituent activator IGF-1 was measured by Western blot. Representative of three independent experiments was shown. Knockdown of miR-21 promoted NSCLC A549 cells apoptosis via inactivation of PI3K-Akt pathway. Apoptosis induced by 8?Gy ionizing radiation in anti-miR-21- (or anti-miR-NC-) transfected A549 cells combined with (or without) PI3K activator IGF-1 treatment (10?ng/mL) was detected through annexin V-FITC/PI staining by flow cytometric analysis. The data represent the means ± SD of three separate experiments. Student's t-test was used to analyze the statistics (*P < 0.05). 1306016 3069 Clin Radiol Clin Radiol Clinical radiology 0009-9260 1365-229X 24857677 4105980 10.1016/j.crad.2014.03.020 NIHMS587373 Revisiting the relationship between tumour volume and diameter in advanced NSCLC patients: An exercise to maximize the utility of each measure to assess response to therapy Nishino M. a * Jackman D.M. b DiPiro P.J. a Hatabu H. a Jnne P.A. b Johnson B.E. b aDepartment of Radiology Dana-Farber Cancer Institute and Brigham and Women™s Hospital 450 Brookline Ave. 75 Francis St. Boston MA 02215 USA bDepartment of Medical Oncology and Department of Medicine Dana-Farber Cancer Institute and Brigham and Women™s Hospital 450 Brookline Ave. Boston MA 02215 USA *Guarantor and correspondent: M. Nishino Department of Radiology Dana-Farber Cancer Institute and Brigham and Women™s Hospital 450 Brookline Ave. Boston MA 02215 USA. Tel.: +1 617 582 7163; fax: +1 617 582 8574. Mizuki_Nishinodfci.harvard.edu (M. Nishino) 30 5 2014 22 5 2014 8 2014 01 8 2015 69 8 841 848 2014 The Royal College of Radiologists. Published by Elsevier Ltd. All rights reserved. 2014 AIM To revisit the presumed relationship between tumour diameter and volume in advanced non-small-cell lung cancer (NSCLC) patients and determine whether the measured volume using volume-analysis software and its proportional changes during therapy matches with the calculated volume obtained from the presumed relationship and results in concordant response assessment. MATERIALS AND METHODS Twenty-three patients with stage IIIB/IV NSCLC with a total of 53 measurable lung lesions treated in a phase II trial of erlotinib were studied with institutional review board approval. Tumour volume and diameter were measured at baseline and at the first follow-up computed tomography (CT) examination using volume-analysis software. Using the measured diameter (2r) and the equation calculated volume was obtained as (4/3) ?r3 at baseline and at the follow-up. Percent volume change was obtained by comparing to baseline for measured and calculated volumes and response assessment was assigned. RESULTS The measured volume was significantly smaller than the calculated volume at baseline (median 11488.9 mm3 versus 17148.6 mm3; p < 0.0001) with a concordance correlation coefficient (CCC) of 0.7022. At follow-up the measured volume was once again significantly smaller than the calculated volume (median 6573.5 mm3 versus 9198.1 mm3; p = 0.0022) with a CCC of 0.7408. Response assessment by calculated versus measured volume changes had only moderate agreement (weighted ? = 0.545) with discordant assessment results in 20% (8/40) of lesions. Calculated volume based on the presumed relationship significantly differed from the measured volume in advanced NSCLC patients with only moderate concordance in response assessment indicating the limitations of presumed relationship. CMAJ CMAJ 9711805 CMAJ : Canadian Medical Association Journal 0820-3946 1488-2329 Canadian Medical Association 24638027 4016095 10.1503/cmaj.131385 186e296 Practice Five Things to Know About... Screening for lung cancer Kennedy Sean Baerlocher Mark Otto MD School of Medicine (Kennedy) McMaster University Hamilton Ont.; Department of Radiology (Baerlocher) Royal Victoria Hospital Barrie Ont. Correspondence to: Sean Kennedy sean.kennedymedportal.ca 13 5 2014 13 5 2015 186 8 E296 E296 1995-2014 Canadian Medical Association 2014 0042124 4284 Int J Cancer Int. J. Cancer International journal of cancer. Journal international du cancer 0020-7136 1097-0215 24806617 4200482 10.1002/ijc.28958 NIHMS594253 p38 MAPK inhibits breast cancer metastasis through regulation of stromal expansion Hong Bangxing 1 Li Haiyan 1 Zhang Mingjun 1 Xu Jingda 2 Lu Yong 1 Zheng Yuhuan 1 Qian Jianfei 1 Chang Jeffrey T 3 Yang Jing 2 Yi Qing 1 1Department of Cancer Biology Lerner Research Institute Cleveland Clinic Cleveland OH USA 2Department of Lymphoma and Myeloma University of Texas MD Anderson Cancer Center Houston TX USA 3Department of Integrative Biology & Pharmacology University of Texas at Houston Houston TX USA Corresponding author: Qing Yi MD PhD Department of Cancer Biology Cleveland Clinic Lerner Research Institute 9500 Euclid Avenue/NB40 Cleveland OH 44195 USA. Tel: 216-636-7532; Fax: 216-444-3164; yiqccf. 31 5 2014 16 5 2014 1 1 2015 01 1 2016 136 1 34 43 p38 MAPK signaling controls cell growth proliferation and the cell cycle under stress conditions. However the function of p38 activation in tumor metastasis is still not well understood. We report that p38 activation in breast cancer cells inhibits tumor metastasis but does not substantially modulate primary tumor growth. Stable p38 knockdown in breast cancer cells suppressed NF-?B p65 activation inhibiting miR-365 expression and resulting in increased IL-6 secretion. The inhibitory effect of p38 signaling on metastasis was mediated by suppression of mesenchymal stem cell (MSC) migration to the primary tumor and sites of metastasis where MSCs can differentiate into cancer-associated fibroblasts to promote tumor metastasis. The migration of MSCs to these sites relies on CXCR4-SDF1 signaling in the tumor microenvironment. Analysis of human primary and metastatic breast cancer tumors showed that p38 activation was inversely associated with IL-6 and vimentin expression. This study suggests that combination analysis of p38 MAPK and IL-6 signaling in patients with breast cancer may improve prognosis and treatment of metastatic breast cancer. p38 MAPK Breast cancer Metastasis microRNA IL-6 J Mol Diagn J Mol Diagn The Journal of Molecular Diagnostics : JMD 1525-1578 1943-7811 American Society for Investigative Pathology 24813172 4078366 S1525-1578(14)00074-9 10.1016/j.jmoldx.2014.03.006 Regular Detection of Gene Rearrangements in Targeted Clinical Next-Generation Sequencing Abel Haley J. ? Al-Kateb Hussam   Cottrell Catherine E.   Bredemeyer Andrew J.   Pritchard Colin C. ¡ Grossmann Allie H. § Wallander Michelle L. ¶ Pfeifer John D.   Lockwood Christina M.   Duncavage Eric J. eduncavagepath.wustl.edu   ? ?Department of Genetics Washington University St. Louis Missouri  Department of Pathology and Immunology Washington University St. Louis Missouri ¡Department of Laboratory Medicine University of Washington Seattle Washington §Department of Pathology University of Utah and ARUP Laboratories Salt Lake City Utah ¶ARUP Institute for Clinical and Experimental Pathology Salt Lake City Utah ?Address correspondence to Eric J. Duncavage M.D. Department of Pathology and Immunology"

Lung_Cancer

"Purpose Although the EGF receptor tyrosine kinase inhibitors (EGFR-TKI) gefitinib have shown dramatic effects against EGFR mutant lung cancer patients become resistant by various mechanisms including gatekeeper EGFR-T790M mutation MET amplification and KRAS mutation thereafter relapsing. AZD6244 is a potent selective and orally available MEK1/2 inhibitor. In this study we evaluated the therapeutic efficacy of AZD6244 alone or with BEZ235 an orally available potent inhibitor of phosphatidylinositol 3“kinase (PI3K) and mammalian target of rapamycin (mTOR) in gefitinib-resistant non-small cell lung carcinoma (NSCLC) models. Experimental design NCI-H1975 with EGFR-T790M mutation NCI-H1993 with MET amplification and NCI-H460 with KRAS/PIK3CA mutation human NSCLC cells were subcutaneous injected into the athymic nude mice respectively. Mice were randomly assigned to treatment with AZD6244 BEZ235 AZD6244 plus BEZ235 or control for 3 weeks then all mice were sacrificed and tumor tissues were subjected to western blot analyses and immunohistochemical staining. Results AZD6244 could inhibit the tumor growth of NCI-H1993 but slightly inhibit the tumor growth of NCI-1975 and NCI-H460. Combining AZD6244 with BEZ235 markedly enhanced their antitumor effects and without any marked adverse events. Western blot analysis and immunohistochemical staining revealed that AZD6244 alone reduced ERK1/2 phosphorylation angiogenesis and tumor cell proliferation. Moreover MEK1/2 inhibition resulted in decreased AKT phosphorylation in NCI-H1993 tumor model. BEZ235 also inhibited AKT phosphorylation as well as their downstream molecules in all three tumor models. The antiangiogenic effects were substantially enhanced when the agents were combined which may due to the reduced expression of matrix metallopeptidase-9 in tumor tissues (MMP-9). Conclusions In this study we evaluated therapy directed against MEK and PI3K/mTOR in distinct gefitinib-resistant NSCLC xenograft models. Combining AZD6244 with BEZ235 enhanced their antitumor and antiangiogenic effects. We concluded that the combination of a selective MEK inhibitor and a PI3K/mTOR inhibitor was effective in suppressing the growth of gefitinib-resistant tumors caused by EGFR T790M mutation MET amplification and KRAS/PIK3CA mutation. This new therapeutic strategy may be a practical approach in the treatment of these patients. AZD6244 BEZ235 Tyrosine kinase inhibitor Non-small cell lung cancer Introduction Lung cancer is the leading cause of cancer-related death in many countries including the China [1]. Non-small cell lung cancer (NSCLC) accounts for up to 80% of all lung cancer cases; patients typically present with advanced disease at the time of diagnosis. The prognosis of patients with advanced lung cancer remains poor and recent studies show that conventional therapies may have reached a therapeutic plateau as evidenced by the 5-year survival rate for NSCLCs which remains at 15% [23]. The EGF receptor tyrosine kinase inhibitors (EGFR-TKIs) gefitinib and erlotinib have shown marked therapeutic effects against NSCLCs with EGFR activating mutations such as exon 19 deletions and L858R point mutations [4]. Almost all tumors however acquire resistance to EGFR-TKIs after varying periods of time. Common mechanisms for acquired resistance include emergence of an EGFR gatekeeper mutation (T790M) and MET gene amplification [56]. In addition PIK3CA mutations as well as KRAS mutations have been found to contribute to EGFR-TKIs resistance in a subpopulation of tumors [78]. The limited therapeutic options currently available for patients with advanced lung cancer create a pressing need to identify new therapeutic strategy. Selumetinib (AZD6244) is an oral non-ATP competitive inhibitor and highly specific for extracellular signal-regulated kinase (ERK) kinase (MEK)1/2 a key enzyme in the RAS-RAF-MEK-ERK pathway. AZD6244 had minimal effects on the p38 c-Jun-NH2-kinase PI3K and MEK5/ERK5 pathways and is currently in phase II clinical trial in KRAS-mutant NSCLC [910]. In vivo AZD6244 could inhibit the tumor growth in HT-29 xenograft model which is a colorectal tumor model carrying a BRAF mutation at a dose of 100 mg/kg and the tumor growth inhibition of AZD6244 is better than gemcitabine [11]. However the inhibition of MEK signaling alone may not be sufficient in patients with gefitinib-resistant NSCLC and negative feedback mechanisms in PI3K pathway may be problematic when it is used alone [12]. By contrast combined blockade of both pathways was able to overcome the reciprocal pathway activation induced by inhibitor-mediated release of negative feedback loops and resulted in a significant tumor growth inhibition. Thus coinhibition of both pathways has shown use in reducing tumor growth in a variety of xenograft models [1314] and clinical trials of such combinations are under way in adults. BEZ235 is an orally available dual inhibitor of PI3K and mTOR that is being evaluated in phase I/II trials [15]. With the aim of developing effective therapeutic strategy for treatment gefitinib-resistant NSCLCs we have initially evaluated the antitumor activity of AZD6244 alone or combination with BEZ235 in a panel of three human NSCLC cell lines which were selected according to their different mutation status for EGFR-T790M MET and KRAS/PIK3CA genes. We hypothesized that targeting the MEK pathway in combination with selective inhibitors of PI3K/mTOR signaling could overcome gefitinib-resistant NSCLC and enhance the antitumor efficacy. Methods Reagents AZD6244 and BEZ235 were purchased from Sellech Chemicals (Houston TX USA) all drugs were dissolved in sterile dimethylsulfoxide (DMSO) and a 10 mM working solution was prepared and stored in aliquots at -22°C. Working concentrations were diluted in culture medium just before each experiment. RPMI1640 media and fetal bovine serum (FBS) were purchased from Invitrogen (Carlsbad CA USA). Fibronectin and 3-(4 5-dimethylthiazol-2-yl)-2 5-diphenyltetrazolium bromide (MTT) were obtained from Sigma (St. Louis MO USA). Phospho-AKT (Ser473 p-AKT) phospho-S6 (Ser240/244 p-S6) phospho-4E-BP1 (Ser 65 p-4E-BP1) phospho-ERK1/2 (Thr202/Tyr204 p-ERK1/2) phospho-MEK1/2 (Ser217/221 p-MEK1/2) AKT S6 4E-BP1 MEK1/2 and ERK1/2 antibodies were purchased from Santa Cruz Biotechnology Inc (Santa Cruz CA USA). CD31 and Ki-67 antibodies for IHC were purchased from Cell Signaling Technology (Danvers MA USA). All other chemicals used in this study were of analytical reagent grade. Cell lines The NCI-H1975 EGFR T790M mutation [16] NCI-H460 KRAS/PIK3CA mutation and NCI-H1993 MET amplification [1718] human NSCLC cell lines were obtained from American Type Culture Collection (ATCC) (Manassas VA USA). The cells were cultured in RPMI1640 medium supplemented with 10% FBS 100 mg/L streptomycin 100 IU/mL penicillin and 0.03% L-glutamine (Hyclone Logan UT USA) and maintained at 37°C with 5% CO2 in a humidified atmosphere. Cell viability assay Cell viability was measured using the MTT [3-(45-dimethylthiazol-2-yl)-25-diphenyl tetrazolium] dye reduction method. Tumor cells (1?—?104 cells/100 mL/well) in RPMI1640 medium with 10% FBS were plated into 96-well plates and cultured with indicated compounds for 72 h followed by the addition of 50 mL of MTT solution (2 mg/mL; Sigma St. Louis MO) to each well and further incubation for 2 h. The medium was removed and the dark blue crystals in each well were dissolved in 100 mL dimethyl sulfoxide. The absorbance of the wells was measured with a microplate reader at test and reference wavelengths of 490 nm respectively. Percent growth was reported relative to untreated controls. Each experiment contained at least triplicate samples and was performed at least three times. Efficacy study in vivo BALB/C nude mice (female 6-7 weeks old) were obtained from Vital River (Beijing China). Mice were maintained under super pathogen-free conditions and housed in barrier facilities on a 12-h light/dark cycle with food and water ad libitum. All animal experiments were performed in accordance with protocols approved by the Shandong University Experimental Animal Care and Use Committee. Mice were injected subcutaneous (s.c.) with 5?—?106 NCI-H1993 NCI-H1975 and NCI-H460 cells that had been resuspended in 200 ?L of matrigel (BD Biosciences Milan IT). AZD6244 solubilized in a methocel/polysorbate buffer was injected by oral gavage twice daily at the dose of 25 mg/kg for 3 weeks [19]. BEZ235 was reconstituted in NMP (1-methyl-2 pyrrolidone) and PEG300 and injected by oral gavage once daily at the dose of 20 mg/kg for 3 weeks [20]. When the mean volumes of tumors were between 150 and 200 mm3 mice were randomly divided in four groups (ten mice per group). The tumor volume and body weight in each group were balanced. The animals were ear-punched for identification during the study. Two orthogonal diameters of the tumor are measured with digital vernier calipers and individual animal weights were weighed and recorded twice a week. Tumor volume (TV) are measured and recorded during treatment period by the formula: TV?=?Length?—?Width2/2. Growth inhibition from the start of treatment was assessed by comparison of the differences in tumor volume between control and treated groups. Tumor growth inhibition T/C ratio is calculated by the following equations: T/C ratio?=?(Vt?-?V0)Compound treated/(Vt?-?V0)Control?—?100?%. Western blot analysis The expressions of p-ERK1/2 p-AKT p-S6 p-MEK1/2 and p-4E-BP1 in tumor tissues were examined by Western Blotting. Fresh tumors in each group were resected after last treatment with AZD6244 and/or BEZ235 for 2 h on Day 21 of the efficacy study. Tumor tissues were lysed by lysis buffer (50 mM HEPES [pH 7.4] 150 mM NaCl 10% glycerol 1% Triton X-100 1.5 mM MgCl2 1 mM EDTA [pH 8.0] 100 mM NaF 1 mM phenylmethylsulfonyl fluoride 1 mM sodium orthovanadate 10 ?g/mL aprotinin 50 ?g/mL leupeptin and 1 ?g/mL pepstatin A). The resected tumor samples were homogenized with lysis buffer containing 25 mM b-glycerophosphate and 0.5% (v / v) phosphatase inhibitor cocktail 2 (Sigma-Aldrich St. Louis MO USA) at 4°C. Cellular debris was removed by centrifugation at 17 860?g for 20 min at 4°C. Aliquots of the supernatants containing 5“20 ?g of protein were subjected to SDS-PAGE under reducing conditions. The protein concentration of the supernatant was determined by Bio-Rad protein assay reagent (Bio-Rad CA USA). Equal amounts of protein were separated by sodium dodecyl sulfate/polyacrylamidegel electrophoresis (SDS/PAGE) on 10% gels blotted on polyvinylidene difluoride (PVDF) and probed with p-ERK1/2 p-AKT p-S6 p-MEK1/2 p-4E-BP1 MMP2 MMP9 ERK1/2 AKT S6 MEK1/2 and 4E-BP1 rabbit monoclonal antibody and subsequently with goatanti-rabbit (HRP) and detected by chemiluminescence. To measure protein loading antibodies directed against ?-actin were used. Immunohistochemical analysis Fresh tumors in each group were resected after last treatment with AZD6244 and/or BEZ235 for 2 h on Day 21 of the efficacy study fixing in formalin and embedding the tumor tissue. Cutting and mounting the section. Immunocytochemical analysis was performed according to the method described on the commercial kits to examine the expressions of CD31 and Ki-67 (Cell Signaling Technology Danvers MA USA). Caspase activity assay The apoptotic markers activity of caspase-3-8 and -9 were measured by using caspase colorimetric protease kits (Abnova Walnut CA USA). Fresh tumors in each group were resected after last treatment with AZD6244 and/or BEZ235 for 2 h on Day 21 of the efficacy study and then tumor lysis containing 200 ?g of protein was incubated with 5 ?L of 4 mM pNA-conjugated substrate (DEVD-pNA IETD-pNA and LEHD-pNA) at 37°C for 2 h. The amount of pNA released was measured at 405 nm using a microplate reader. Statistical analysis of the data All results and data were confirmed in at least three separate experiments. Data are expressed as means?±?SD and were analyzed by ANOVA using Statistics Package for Social Science (SPSS) software (version 13.0; SPSS Chicago IL USA). Test article can be demonstrated as an effective compound until T/C ratio???42% and a value of P?<?0.05 was indicated to be statistically significance on tumor volume calculation. Results Effect of AZD6244 and BEZ235 on viability of gefitinib-resistant NSCLC in vitro Before evaluating the effect of AZD6244 BEZ235 and AZD6244 plus BEZ235 treatment on gefitinib-resistant NSCLC xenograft models in nude mice the sensitivity of cell lines to compounds was evaluated in vitro. Cell proliferation was analyzed by MTT assay in cells treated with 00.010.11 10 and 100 ?M of AZD6244 or BEZ235 for 72 h. The results showed that AZD6244 significantly suppressed the growth of NCI-H1993 with a low micromolar IC50 value of 5.6 ?M (Figure 1A). Moreover AZD6244 alone mildly inhibited cell growth with IC50 values of 37.5 ?M and 26.8 ?M in NCI-H1975 and NCI-H460 cells respectively (Figure 1A). BEZ235 alone also suppressed the growth of three cell lines with slightly high IC50 values of 23.5 67.8 and 16.8 ?M in NCI-H1993 NCI-H1975 and NCI-H460 cells respectively (Figure 1B). Figure 1 Anti-proliferative effects of AZD6244 and BEZ235 in NCI-H1993 NCI-H1975 and NCI-H460 gefitinib-resistant cell lines. Cells were treated with varying concentrations of AZD6244 (A) or BEZ235 (B) alone for 72 h. Doses ranged from 0.01 ?M to 100 ?M. Mean?±?SD n?=?5. Concurrent inhibition of MEK and PI3K/mTOR has a synergistic effect on gefitinib-resistant NSCLC cell lines growth in vitro The anti-proliferative effect of combining a MEK and PI3K/mTOR inhibitor was measured in NCI-H1993 NCI-H1975 and NCI-H460 cells by calculating the combination index (CI) according to the Chou-Talalay method [21] using a fixed dose ratio. Both AZD6244 and BEZ235 were introduced to cell cultures at 0.25— 0.5— 1— 2— and 4— their respective IC50s in NCI-H1993 NCI-H1975 and NCI-H460 cell lines for 72 h. Cell growth in all cell lines was markedly decreased following combination treatment at multiple paired concentrations when compared with either single agent alone. The cells viability data were processed to get the CI under the corresponding effective dose (ED) in NCI-H1993 NCI-H1975 and NCI-H460 cell lines (Figure 2) by CalcuSyn software. For the NCI-H1993 cell line the following CI value was obtained: 0.4101 (ED50). For NCI-H1975 and NCI-H460 cell line the CI values were 0.02052 (ED50) and 0.0440 (ED50) respectively. The CI results suggested that AZD6244 and BEZ235 worked synergistically to produce an anti-proliferative effect in NCI-H1993 NCI-H1975 and NCI-H460 cell lines (Figures 2A-C). Figure 2 Synergistic effects of AZD6244-BEZ235 combination therapy on cell viability. NCI-H1993 (A) NCI-H1975 (B) and NCI-H460 (C) cells were treated with AZD6244 alone BEZ235 alone or AZD6244-BEZ235 in combination for 72 h. Results were analyzed according to the Chou-Talalay method [19]. The combination index (CI) values were calculated by using CalcuSyn software. Mean?±?SD n?=?5. Tumor growth inhibition effect of MEK and PI3K/mTOR inhibitors in gefitinib-resistant NSCLC tumor models In order to investigate tumor growth inhibition effect of AZD6244 and/or BEZ235 in vivo we used AZD6244 BEZ235 and AZD6244 plus BEZ235 to treat NCI-H1993 NCI-H1975 and NCI-H460 subcutaneous tumor models respectively for 3 weeks. As shown in Figure 3A-C treatment with AZD6244 for 3 weeks was able to inhibit tumor growth of NCI-H1993 (T/C value 40%) but slightly inhibit tumor growth in both NCI-H1975 and NCI-H460 subcutaneous tumor models (T/C values 60% and 65%) whereas BEZ235 treatment caused an approximately 50% reduction in tumor growth in all three subcutaneous tumor models. In contrast the combined treatments with the two drugs almost completely inhibited NCI-H1993 NCI-H1975 and NCI-H460 tumor growth at the end of the 3 weeks of therapy (Figure 3A-D). "

Lung_Cancer

"The main complexity of modeling and interpreting such phenomena lies in the additional temporal dimension needed to express the association as the risk depends on both intensity and timing of past exposures. This type of dependency is defined here as exposure“lag“response association. In this contribution I illustrate a general statistical framework for such associations established through the extension of distributed lag non-linear models originally developed in time series analysis. This modeling class is based on the definition of a cross-basis obtained by the combination of two functions to flexibly model linear or nonlinear exposure-responses and the lag structure of the relationship respectively. The methodology is illustrated with an example application to cohort data and validated through a simulation study. This modeling framework generalizes to various study designs and regression models and can be applied to study the health effects of protracted exposures to environmental factors drugs or carcinogenic agents among others. 2013 The Authors. Statistics in Medicine published by John Wiley & Sons Ltd. latency distributed lag models exposure“lag“response delayed effects splines 1. Introduction In biomedical research it is commonly appreciated that an exposure event produces effects lasting well beyond the exposure period with an increase in risk occurring from few hours to many years later depending on the physiological processes linking the exposure and the health outcome. The problem is made even more complicated in the presence of protracted time-varying exposures when the health effect measured at a given time can be described as the result of multiple exposure events of different intensities sustained in the past. This phenomenon common to various research fields has been associated for example with peak 1 or chronic exposures 2 to environmental stressors drug intake 34 or occupational exposures to carcinogenic substances 5. The main complexity of modeling and interpreting such dependencies lies in the additional temporal dimension needed to express the association beyond the usual exposure“response relationship as the risk depends on both intensity and timing of past exposures. Nonetheless the appropriate representation of the temporal pattern of risks may provide further insights on the association of interest in particular regarding the underlying pathophysiological mechanisms and prevent biases in estimates and predictions. Revising previous terminology 6 I define these dependencies as exposure“lag“response associations. In particular this issue has been debated in cancer epidemiology 7“9. Analytical approaches extend simple indices such as cumulative exposure in order to accommodate the temporal variation in risk because of protracted exposures. In particular the pioneering work by Thomas 106 helped develop sophisticated statistical methods on the basis of weighting past exposures through specific functions whose parameters are estimated by the data. Vacek 11 Langholz and colleagues 12 and Richardson 13 provided interesting applications in case-control studies with weights represented through simple parametric functions. The methodology was improved by Hauptmann and colleagues in a series of papers 14“16 by using flexible and smooth spline functions. Sylvestre and Abrahamowicz 17 and Abrahamowicz and colleagues 18 extended the spline methods to the analysis of time-to-event data with a cohort design and presented their applications in pharmaco-epidemiology. The main limitation of the statistical techniques described in these papers is the assumption of a linear exposure“response relationship. Models for nonlinear dependencies introduce further nontrivial complexities from both statistical and interpretational perspectives as the problem becomes inherently bidimensional. Abrahamowicz and Mackenzie 19 proposed a model for analyzing the nonlinear time-dependent effects of fixed exposures while Vacek 11 and Berhane and colleagues 20 extended this scheme to the case of protracted time-varying exposures. However the modeling techniques illustrated in these other papers still face some limitations as they are based on complex estimation routines with convergence issues and problems in producing uncertainty measures such as standard errors and confidence intervals. Interestingly equivalent approaches were previously established in time series analysis on the basis of distributed lag models (DLMs) a methodology originally formulated in econometrics 21 then applied in epidemiological research 22. These models involve the definition of a distributed lag function analogous to the weighting function described before. In particular Armstrong 23 generalized the method to distributed lag non-linear models (DLNMs) a class of models with different options for the functions applied to model nonlinearity and distributed lag effects. The theory of DLMs and DLNMs have been recently re-evaluated 24 offering a well-grounded statistical tool and a comprehensive scheme for interpretation. In this paper I aim to establish a general conceptual and statistical framework for modeling exposure“lag“response associations built upon the paradigm of DLMs and DLNMs. This modeling class extended beyond time series analysis provides a unified methodology applicable in different study designs data structures and regression models including most of the previous methods as specific cases. Also the statistical framework is defined by completely parametric functions and fitted through standard regression methods with measures of uncertainty and fit statistics easily available. The R package dlnm originally developed for time series data 25 is extended in parallel offering a easy-to-use implementation of the modeling approach. The manuscript is structured as follows. The development and algebraic definition of the modeling framework is described in Section 2. As an illustrative example in I apply the method for investigating the relationship between occupational exposure to radon and lung cancer mortality by using the data from the Colorado Plateau miners cohort. The modeling framework is then validated in a simulation study n. A final discussion is provided in. Information on data and software implementation is included in. The R code and data are included in the supporting information together with additional details making the results of the illustrative example and of the simulation study entirely reproducible. 2. Modeling framework The modeling skeleton is derived by extending the class of DLNMs beyond the time series context. This extension provides a neat algebraic representation and a comprehensive statistical definition. The focus is on a function here defined s(xt) which describes the dependency in terms of the exposure history to x evaluated at time t. The function s(xt) is commonly included in regression models in order to estimate the association while controlling for potential confounders. Although the regression model varies depending on the study design and the type of data the definition of s(xt) provided later and the related modeling framework generally apply. 2.1. Models for linear exposure“response relationships Previous studies on the topic have defined the function s(xt) by using slightly different algebraic formulae 1026111417. Assuming a linear exposure“response relationship a general notation can be given by (1a) (1b) (1c) In (1a) the increase in risk at time t is defined as the integral of the instantaneous exposure intensity xu over the period ?t = [t0t1] with t0 and t1 representing the times of the first and last relevant exposures. Here w(t ? u) is the weighting function previously described in which assigns weights to past exposures experienced at time t ? u on the basis of their contribution to the risk at time t. The model can be reparameterized as in (1b) where the risk is now expressed along the lag with ? ? [?0L]. Here L ? ?0 = t1 ? t0 is interpreted as the lag period over which an exposure to x is assumed to affect the risk at time t usually with ?0 = 0. This parameterization offers the advantage that the function w is now directly defined in the new dimension of lag ? and it is independent of the time axis chosen for t which may represent different time scales depending on the study design. The function w(?) termed from here on as the lag“response function models the lag“response curve associated with exposure x. Finally for computational purposes the integral is approximated in (1c) by a sum of terms derived by partitioning the lag interval in equally spaced discrete units and assuming the protracted exposure as a sequence of exposure events xt ? ? at lags ? = ?0 ¦ L. A statistical model for (1) can be defined by expressing the lag“response function w(?) as a linear combination of terms obtained through basis transformation with related parameters. By using matrix notation let the vector qxt of exposure history be defined by (2) Such exposure history changes along time depending on the time t at which the vector qxt is computed. Given (2) the cumulative function s(xt) in (1) can be written using a compact and general matrix notation as (3) The (L ? ?0 + 1) × v? matrix C is obtained from the transformation of the lag vector ? = [?0 ¦ ? ¦ L]T by choosing a specific basis with dimension v? for w(?) which defines the related basis functions. In this parameterization the function s(xt) representing the integral of x · w(?) over the interval [?0L] is defined as a lag“basis function with parameters ?. Interestingly the equation in (3) is almost identical to that defining DLMs 24 Eq. (4). The different indexing in the original version reflects the specific application in time series where the data are perfectly ordered in time and the matrix Q has a structure such that qt? ? qt + 1? + 1. However this is a specific case of the general representation in (2)“(3). The theory and software already developed for DLMs can be therefore extended in parallel. Alternative lag“basis functions for representing s(xt) are derived through different lag“response functions w(?) in (1). In particular the traditional index of unweighted cumulative exposure is a specific case of (3) where reduces to with w(?) equal to a constant c. This is obtained by specifying C as an (L ? ?0 + 1)-dimensional vector of 1's with v? = 1. More sophisticated models with splines or other functions such as those illustrated in publications cited in only require the application of different bases for deriving C but are nevertheless represented by 3). 2.2. Extension to nonlinear exposure“response relationships The extension to the nonlinear case presents further complexities as anticipated earlier. The model in (1) can be extended by defining an additional exposure“response function f(x) to express the potentially nonlinear exposure“response curve along the dimension of the predictor. An intuitive generalization of (1) is: (4) with f(x) as the standard exposure“response function. However the function f(x) · w(?) in 4) previously proposed 1119 is not easily represented as a linear combination of basis variables and generates models that are not linear in their parameters and thus require ad hoc optimization routines. More importantly this representation is based on the strong assumption of independency between f(x) and w(?) namely that the exposure“response shape is the same at each lag ? and vice versa that the lag structure is the same at each value of x. This assumption can be relaxed by expressing s(xt) as a truly bivariate function with the more flexible representation: (5) Here the bidimensional function f · w(x?) is defined as the exposure“lag“response function and models simultaneously the exposure“response curve along x and lag“response curve along ? namely an exposure“lag“response surface. Differently from 4) the exposure“lag“response function in 5) can be expressed as a linear combination of basis variables and related parameters through a special tensor product. As anticipated earlier Armstrong 23 proposed the same approach for time series data within the DLNM framework generalizing this tensor product parameterization through the concept of cross-basis. Specifically two sets of basis functions are independently chosen to represent f(x) and w(?) respectively. The cross-basis is the bidimensional space of functions obtained by the combination of the two sets integrated over the lag dimension and represents the core of DLNMs. The algebraic representation has been previously presented 24 and a revised version is proposed here. Briefly the simpler lag-basis for DLMs in 3) can be extended by choosing an additional basis with dimension vx for representing f(x). The application of the related basis functions to the vector of exposure history qxt obtained by 2) generates a (L ? ?0 + 1) × vx matrix Rxt. Let Axt be: (6) with 1v as a v-dimensional vector of 1's and C defined in 3). The cross-basis function s(xt;?) can be defined as (7) In this case the dimension of the cross-basis is determined by the product of the dimensions of the bases for the two spaces and the association is expressed through vx · v? values W and related parameters ?. The cross-basis function s(xt) represents the integral of f · w(x?) over the interval [?0L] cumulating the contributions of events representing the exposure history. In spite of the relatively complex algebraic form the definition of cross-basis and the specification of DLNMs only amount to the choice of the bases for the functions f(x) and w(?). These can be independently selected between several options such as splines linear threshold or piecewise constant (step) functions. The DLNM modeling class comprises the simpler DLMs from Section 2.1. For example the bidimensional exposure“lag“response function f · w(x?) in 5) reduces to a non-linear function for un-weighted cumulative exposure f(x) · c when w(?) is a constant function c and to the lag“response function x · w(?) in (1) when f(x) is simply an linear function of the untransformed x. The model proposed by Berhane and colleagues 20 can be written in the form of 6)“7) when both f(x) and w(?) are cubic B-splines. 2.3. Estimation and prediction Although the lag-basis and cross-basis functions in (1)“(3) and (5)“(7) involve a nonstandard parameterization in terms of exposure histories DLMs and DLNMs do not require specialized estimation procedures. The association is entirely expressed by the vx × v? parameters ? of the cross-basis values W. The computation of the exposure history in (2) can be extended to all N observations with x measured at time t producing an N × (L ? ?0 + 1) matrix of exposure histories Q. The matrix of transformed variables W in (3) and (7) is consequently derived. This matrix can be included in the design matrix of standard regression models to estimate the parameters ?. In the completely parametric development proposed here the number of coefficients vx × v? represents the degrees of freedom (df) used to model the association. Inference on the parameters ? and interpretation of the estimated association is aided by the prediction of specific risk measures. For simpler DLMs that assume a linear exposure“response relationship this step reduces to the computation of a series of estimated risk contributions at lag ?p with ?0 ? ?p ? L and the associated (co)variance matrix . The series of risk contributions is provided by (8) with Cp obtained from the vector of lag ?p used for prediction by applying the same basis functions for w(?) used for estimation. These estimated risk contributions compose the lag“response curve and can be interpreted using either a forward or backward perspective. Namely represents the risk contribution at time t + ?p in the future from a unit increase in exposure x at time t or the contribution from a unit increase in exposure x occurring at time t ? ?p in the past to a given risk measured at time t. The estimated risk contributions associated with different exposure increases are easily derived. The equations in (8) only apply to DLMs with lag-bases as defined in (3). For DLNMs the association is allowed to vary nonlinearly in the space of x. Moreover the specification in (5)“(7) allows the lag-response curve to change depending on the level of the exposure. The prediction of risk contributions corresponding to a specific exposure intensity xp at lag ?p involves a more complex procedure. First let be the (L ? ?0 + 1)-dimensional vector of exposure history with constant exposure xp. The related matrices and are derived from (6) substituting qxt and C with and Cp by applying the same two sets of basis functions for f · w(x?) chosen for estimation. The exposure-specific risk contributions and associated (co)variance matrix are provided by (9) The estimated risk contributions may be interpreted as a lag-response curve similar to in (8) but this time associated with a specific exposure level xp instead of a unit increase. These measures may be used to define a grid of predicted risk contributions defined within the ranges of the exposure x and the lag ? thus obtaining a bi-dimensional representation of the association. From this grid besides above it is also possible to derive the vector of lag-specific risk contributions expressing the exposure-response curve for lag ?p. As noted in Section 2.2 the truly bivariate definition of (7) allows both the lag-response curve and exposure-response curve defined by and respectively to change depending on the specific exposure and lag values xp and ?p. The grid is interpreted as a risk surface along x and ? representing the exposure“lag“response. In addition predictions in (8)“(9) may be extended to a generic exposure history qh. Substituting it into in (9) provides the vector of lag-specific risk contributions for each exposure that occurred within the lag period. The overall cumulative effect of such exposure history with associated (co)variance matrix may be computed with: (10) The Equation (10) can be used to estimate the predicted cumulative risk for a given pattern of exposure qh. This method can also be applied to investigate how the risk progressively evolves along an exposure profile computing the cumulative risk at each time associated with the time-varying exposure history qh. 2.4. Identifiability and constraints The tensor product structure of the cross-basis defined in (5)“(7) poses some identifiability issues. In particular each of the vx basis variables in R is multiplied by each of the v? basis variables in C. If an intercept is included in f(x) the related matrix of cross-basis variables W is not of full rank and the parameters of the regression model are not identifiable even when a common intercept is not included. Therefore the cross-basis in (7) should always be defined without an intercept in the basis functions for x. Also these basis functions can be centered on a specific exposure value x0 which will represent the reference for the risk summaries computed by (8)“(10). The bidimensional shape of the exposure“lag“response can be constrained to follow a prespecified pattern. In particular a priori assumptions on the lag structure can be imposed through functional constraints on the basis for the space of ?. Left and right constraints on the extremes of the supporting interval ?0“L are particularly meaningful for smooth functions. A left constraint can be imposed by excluding the intercept from the basis. This step will force the lag“response curve to predict a null risk at the beginning of the lag period. A right constraint on a B-splines basis can be produced by excluding specific basis variables as previously described for linear exposure“response relationships 17. The constraint produces a smooth dependency which approaches a null risk at the end of the lag period. Such constraints are particularly useful in the presence of sparse data in order to limit the flexibility of the model under specific assumptions about the lag“response curve. However biases can be introduced if these assumptions are not met. Additional information is provided in Section D1 of the supporting information. The functional constraints discussed in this section can be specified without introducing customized optimization methods for estimating the parameters ? in (3)“(7). More sophisticated methods are required for example to constrain the lag“response curve to be non-negative in the whole lag period L. These approaches have been previously proposed for linear dependencies 141718 and introduce further complexities in the bidimensional context of DLNMs. This development is not pursued here. 2.5. Model selection and inferential procedures The framework described in Sections 2.1“2.2 includes a fairly large number of models defined by different functions for each of the two dimensions and by different choices regarding each function such as number and location of knots in splines. This raises the issue of selecting the optimal model for describing the exposure“lag“response association. Previous studies on temporal dependencies have proposed selection procedures on the basis of profile likelihood 15 AIC 141620 or BIC 17. Simulation studies seems to indicate a better performance of AIC when compared with BIC in this context 18 a result consistent with unpublished simulations performed on time series data for DLNMs. Inference on the models illustrated in the previous sections primarily focuses on the specification of confidence intervals for the risk measures in Section 2.3 and on the definition of tests for a set of null hypotheses. Confidence intervals for lag“response curves exposure“response curves and cumulative risks obtained through and can be easily derived from the diagonal of the related (co)variance matrices in (8)“(10) assuming a multivariate normal distribution of the estimators. Regarding hypothesis testing two null hypotheses are particularly relevant in this framework. The first one postulates a linear exposure“response relationship namely H0 : f(x) = x. The second one assumes a constant risk namely H0 : w(?) = c. Tests on constrained models can be also defined. The assumption of independency is not easily tested as the form in (4) cannot be expressed as a model linear in its parameters. However defining general inferential procedures in this setting is not straightforward. First the null hypotheses H0 : f(x) = x and H0 : w(?) = c are not independent and an incorrect assumption about the association in one dimension may bias the test estimator for the hypothesis related to the other space as previously reported 19. In addition estimates are usually conditional on a posteriori selection of a best-fitting model based on the selection methods discussed before. Under these conditions the estimators for the (co)variance matrices in (8)“(10) are likely to underestimate the true sampling (co)variance and the distribution of the test statistics may be different from that assumed unconditional on the selection procedure. This may generate undercoverage of confidence intervals and inflated type I error for tests 1727. Given these complexities a general framework for hypothesis testing embedded in the model selection procedure is not provided here. An assessment through simulations of the performance of estimators generated by AIC and BIC-selected models will be presented in. Specifically simulations will provide an empirical evaluation of the ability of the information criteria to identify the correct model between those defining the null or alternative hypotheses about linearity and constant effects and measures of performance such as bias coverage and root mean square error. 3. An application The conceptual and statistical framework of DLNMs described in extended beyond time series data is general and applicable in different study designs. As an illustrative example I propose here an application in survival analysis of time-to-event data. This represents one of the most complex settings as the temporal pattern of risk is produced by exposure histories that vary during the follow-up of each subject. Specifically the methodology is used to investigate the association between occupational exposure to radon and mortality for lung cancer. The analysis is based on data from the Colorado Plateau uranium miners cohort already used in previous methodological contributions 121520. Section A of the supporting information provides a list of the main steps to replicate the analysis in other real-life examples. 3.1. Data The cohort data used in this example were collected by the National Institute for Occupational Safety and Health. Detailed information on the cohort is given elsewhere 12. Briefly subjects were eligible to enter the cohort if they worked in mines within the Colorado Plateau area between 1950 and 1960 and provided demographic personal and occupational information during their working period. Vital status and cause of death were ascertained by linkage with different sources. The data used in this example refer to the follow-up of the cohort on December 311982 including 3347 subjects and 258 lung cancer deaths. Exposure data available in the data set include cumulative measures of radon and smoking in 5-year age intervals. The radon exposure history for each subject expressed in working-level months (WLM) was reconstructed by linking employment information with measured or predicted levels in each mine in each year. The smoking history expressed in the number of cigarettes packs × 100 was reported by each subject during his working period and assumed constant after the last reporting age. A summary of the data is provided in Table I. Table I Descriptive statistics of the Colorado Plateau uranium miners cohort. The data included here refer to the follow-up on December 31 1982. Exposure to radon is measured in working level months (WLM) while smoking is reported as packs of cigarettes/100 Full cohort Lung cancer cases N % N % Subjects 3347 100.0 258 7.7 Deaths (%) 1258 37.6 258 100.0 Ever smokers (%) 2656 79.4 238 92.2 Median Min 25th 75th Max Median Min 25th 75th Max Age at entry 34.0 15.8 25.8 44.0 80.0 41.6 18.6 34.3 48.0 63.9 Follow-up time (years) 23.9 0.1 19.6 25.5 32.5 18.3 0.3 12.9 22.0 30.8 Exposure to radon Exposure period (years) 6.7 0.1 2.7 11.8 53.0 12.8 0.1 7.8 17.6 39.5 Total cumulative exposure (WLM/year) 429.0 0.0 153.5 1016.8 10000.0 1231.9 8.0 553.7 2528.6 10000.0 Yearly exposure (WLM/year) All 60.2 0.1 26.7 122.2 3245.3 81.6 1.0 42.3 165.4 1295.7 Lag 0“9 52.4 0.1 23.8 102.5 2994.0 61.4 3.9 31.3 144.7 1110.8 Lag 10“19 53.8 0.1 24.3 112.5 3245.3 78.3 1.0 42.9 164.0 1295.7 Lag 20“29 74.0 0.1 33.0 141.7 3245.3 104.7 4.1 52.2 180.0 1295.7 Lag 30“40 95.7 0.2 48.0 151.6 2994.0 104.7 5.5 60.0 175.3 860.2 Smoking Exposure period (years) 38.0 5.0 31.0 46.0 75.0 40.0 14.0 33.0 48.0 72.0 Total cumulative exposure (packs × 100) 131.6 0.4 94.5 174.5 676.3 147.4 21.8 109.5 188.1 567.2 Yearly exposure (packs × 100) 3.6 0.0 2.5 3.6 24.4 3.6 0.0 3.5 4.2 13.4 3.2. Modeling strategy For this illustrative example the analysis is performed through a Cox proportional-hazard model with time-varying covariates by using age as the time axis. Effect measures are reported as a hazard ratio (HR). The model is represented by the following: (11) where the log-hazard log [h(t)] is expressed as a sum of baseline log-hazard log [h0(t)] and contributions of additional covariates. These comprise cross-basis functions sx(xt) and sz(zt) for radon and smoking respectively as defined in (1)“(7) and a linear term for calendar time u in order to control for secular trends in lung cancer risk not accounted for by the delayed effects of the two exposures. Radon is the exposure of interest and is modeled with different combinations of bases for f(x) and w(?) in the cross-basis sx(xt). Given the limited information on smoking histories in this analysis the cross-basis sz(zt) is a priori defined with a natural cubic B-spline with one knot at the median of 2.5 yearly packs × 100 for the exposure“response and a step function with a single cut-off at lag 20 for the lag structure with lag period 2“40 years. However different cross-basis functions can be applied. The model spends 5 df controlling for confounders and a different amount for modeling the effect of radon depending on the chosen cross-basis sx(xt). Modeling exposure“lag“response associations in time-to-event data assumes the definition of an extended version of continuous time-varying predictors namely the varying exposure history for each subject at the ages he contributes to different risk sets 28. The lag scale is chosen as years with lag 0 identifying the exposure during the last year. The lag period is fixed at 2“40 assuming no effect of exposure after 40 years and in the last 2 years consistently with previous analyses. Multiple exposure histories are computed for each subject at the ages he contributed to each risk set given his exposure profile reconstructed from the 5-year periods. This step produced matrices of exposure histories Qx and Qz for radon and smoking respectively as defined in (2). These matrices are used to specify the lag-bases or cross-bases matrices Wx and Wz from (3)“(7) included in the design matrix of the Cox model."

Lung_Cancer

"FISH analysis was performed on the 297 cases to evaluate ALK gene rearrangement status. Two hundred and eighty-six out of 297 cases were informative for FISH analysis and 33 cases were identified with ALK+?(E). Thirty of the 33 ALK+?cases showed strong ALK expression and the other 3 showed weak ALK expression. Therefore there were 11 cases that showed ALK expression but were ALK-. We re-reviewed the FISH slides of the 11 discordant cases (2 cases with strong and 9 cases with weak ALK expression) and 3 cases (1 with strong and 2 with weak ALK expression) were identified as ALK+?while 8 (1 case with strong and 7 with weak ALK expression) were still ALK- ( F). Regarding the 3 ALK+?cases which were not identified by the original FISH analysis a case-by-case analysis revealed the following: Case 1 The dominant FISH signal pattern in this case was more than one copy of a single green signal without a corresponding orange signal in addition to fused signals (D). According to the ALK signal enumeration guide this indicated a deletion of the orange portion of the ALK probe which targeted the drug targeting area. Therefore we initially considered this case as negative. After re-reviewing the FISH analysis we found there were some areas containing scattered ALK+?cells with one or more copies of single green signals in addition to fused signals and a single red signal. The first 50 cells counted revealed 8 ALK+?cells. The second and third cell count in another 100 cells by different readers revealed 6 and 7 ALK+?cells respectively. If the first and third 50-cell count was considered the average percentage of positive cells reached 15%. Therefore this sample should be considered positive. Case 1 and 3 For these two cases originally constructed on TMA and IHC analysis showed strongly positive staining in one core and weakly positive staining in the other. After re-reviewing the FISH slides we found that there was indeed a small area of each core with a few cells containing subtle break-apart signals. As cell counts were difficult to perform in small areas containing not many cancer cells we cut the tissue sections. The IHC analysis still demonstrated strongly and weakly positive ALK expression respectively. The FISH analysis in the tissue sections showed ALK+. According to the final result of FISH analysis 36 out of the 286 lung adenocarcinoma cases were identified with ALK+. None of IHC negative cases were ALK+ demonstrating 100% sensitivity. Eight IHC-positive cases (1 strongly and 7 weakly positive cases) did not show ALK gene rearrangement resulting in 81.8% specificity. The concordance rate of IHC and FISH is 97.2% (). qRT-PCR and VENTANA ALK IHC analysis of discordant cases To further identify whether eight discordant cases of IHC and FISH carried ALK fusion at the RNA level a qRT-PCR analysis was applied. Positive qRT-PCR results were observed in 5 cases (1 strongly and 4 weakly positive cases) (). Among the 5 cases 3 (1 strongly and 2 weakly positive cases) were shown to have ALK expression using VENTANA ALK IHC analysis (G). The ALK fusion in these 3 cases was detected at around 14 of 30 qRT-PCR cycles (J). Regarding the other two cases although weak staining in cancer cells could be observed (H) they were considered negative according to the manufacturer™s scoring algorithm (details in Materials and Method section). The ALK fusion in these 2 cases was detected at around 28 of 30 qRT-PCR cycles (K). The remaining 3 of the 8 discordant cases showed neither VENTANA ALK staining nor ALK fusion (Figures 1I and 1L). VENTANA IHC and qRT-PCR analysis of all weakly positive and discordant cases detected by CST ALK (D5F3) Sample ID FISH IHC (CST) IHC (VENTANA) qRT-PCR Variant type 9 Positive 1+ Positive EML4-ALK variant 1/2/3a/3b 37 Positive 1+ Positive EML4-ALK variant 1/2/3a/3b 67 Positive 1+ Positive EML4-ALK variant 1/2/3a/3b 94 Positive 1+ Positive EML4-ALK variant 1/2/3a/3b 98 Positive 1+ Positive EML4-ALK variant 1/2/3a/3b 28 Negative 2+ Positive EML4-ALK variant 1/2/3a/3b 171 Negative 1+ Positive EML4-ALK variant 1/2/3a/3b 203 Negative 1+ Positive EML4-ALK variant 1/2/3a/3b 21 Negative 1+ Negative EML4-ALK variant 1/2/3a/3b 36 Negative 1+ Negative EML4-ALK variant 1/2/3a/3b 41 Negative 1+ Negative Negative 39 Negative 1+ Negative Negative 74 Negative 1+ Negative Negative VENTANA ALK IHC and qRT-PCR assays were also applied to the remaining 5 of the 12 ALK weakly expressed cases which were concordant with FISH analysis. These 5 cases were shown to have ALK expression detected by VENTANA ALK IHC and ALK fusion revealed by qRT-PCR analysis (). Clinicopathological characteristics of patients with ALK+ Using FISH analysis as a standard detection method the clinicopathological characteristics of the ALK+?and ALK- patients were compared and the results are shown in . As the median ages of the positive and negative groups were 48 and 58 years respectively the ALK+ patients were significantly younger (p <0.001). Patients with ALK+ were more likely to have lymph node metastasis compared to ALK- patients (p = 0.002). No correlation was observed between ALK+ and ALK- cases in terms of sex smoking habit tumor size pT M factors or pathologic TNM stage."

Lung_Cancer

"The Center for Functional Cancer Epigenetics Dana-Farber Cancer Institute Boston MA 02215 14USC Epigenome Center and USC/Norris Comprehensive Cancer Center Los Angeles CA 90089 USA Correspondence: landimmail.nih.gov 4 4 2014 27 2 2014 27 8 2014 5 3365 3365 The genetic regulation of the human epigenome is not fully appreciated. Here we describe the effects of genetic variants on the DNA methylome in human lung based on methylation-quantitative trait loci (meQTL) analyses. We report 34304 cis- and 585 trans-meQTLs a genetic-epigenetic interaction of surprising magnitude including a regulatory hotspot. These findings are replicated in both breast and kidney tissues and show distinct patterns: cis-meQTLs mostly localize to CpG sites outside of genes promoters and CpG islands (CGIs) while trans-meQTLs are over-represented in promoter CGIs. meQTL SNPs are enriched in CTCF binding sites DNaseI hypersensitivity regions and histone marks. Importantly 4 of the 5 established lung cancer risk loci in European ancestry are cis-meQTLs and in aggregate cis-meQTLs are enriched for lung cancer risk in a genome-wide analysis of 11587 subjects. Thus inherited genetic variation may affect lung carcinogenesis by regulating the human methylome. Introduction DNA methylation plays a central role in epigenetic regulation. Twin studies have suggested that DNA methylation at specific CpG sites can be heritable12; however the genetic effects on DNA methylation have been investigated only in brain tissues34 adipose tissues56 and lymphoblastoid cell lines (LCL)7. Most studies were based on the Illumina HumanMethylation27 array which has a low density and mainly focuses on CpG-sites mapping to gene promoter regions. While the functional role of DNA methylation in non-promoter or non-CpG Island (CGI) regions remains largely unknown evidence shows roles in regulating gene splicing8 and alternative promoters9 silencing of intragenic repetitive DNA sequences10 and predisposing to germline and somatic mutations that could contribute to cancer development1112. Notably a recent study13 suggests that most DNA methylation alterations in colon cancer occur outside of promoters or CGIs in so called CpG island shores and shelves and the Cancer Genome Project has reported high mutation rates in CpG regions outside CGI in multiple cancers14. Although expression QTLs (eQTLs) have been extensively studied in different cell lines and tissues15 the minimal overlap observed between cis-acting meQTLs and eQTLs (?5“10%)347 emphasizes the necessity of mapping meQTLs that may function independently of nearby gene expression. This might reveal novel mechanisms for genetic effects on cancer risk particularly since many of the established cancer susceptibility SNPs map to non-genic regions. Lung diseases constitute a significant public health burden. About 10 million Americans had chronic obstructive pulmonary disease in 201216 and lung cancer continues to be the leading cancer-related cause of mortality worldwide17. To provide functional annotation of SNPs particularly those relevant to lung diseases and traits we systematically mapped meQTLs in 210 histologically normal human lung tissues using Illumina Infinium HumanMethylation450 BeadChip arrays which provide a comprehensive platform to interrogate the DNA methylation status of 485512 cytosine targets with excellent coverage in both promoter and non-promoter regions (Fig. 1a) CGI and non-CGI regions (Fig. 1b) and gene and non-gene regions. Thus our study enables the characterization of genetic effects across the methylome in unprecedented detail. Moreover since DNA methylation exhibits tissue specific features18 we investigated whether similar meQTLs could be identified in other tissues. Results Identification of cis-acting meQTLs We profiled DNA methylation for 244 fresh-frozen histologically normal lung samples from non-small cell lung cancer (NSCLC) patients from the Environment and Genetics in Lung cancer Etiology (EAGLE) study19. A subset of 210 tissue samples that passed quality control and had germline genotype data from blood samples20 was used for meQTL analysis. The analysis was restricted to 338456 autosomal CpG probes after excluding those annotated in repetitive genomic regions or that harbored genetic variants. The distribution of methylation levels differed strongly across distinct types of genomic regions (Supplementary Fig. 1ab). Consistent with previous studies21 CpG sites in promoter or CGI regions were largely unmethylated while those in other regions were largely methylated (Supplementary Fig. 1ab). We performed cis-meQTL analysis for each methylation trait by searching for SNPs within 500kb of the target CpG-site in each direction (1Mb overall). The genetic association was tested under an additive model between each SNP and each normalized methylation probe adjusting for sex age plate population stratification and methylation-based principal component analysis (PCA) scores. Controlling FDR at 5% (P=4.0—10?5) we detected cis-meQTLs for 34304 (10.1% of 338456) CpG probes (Supplementary ) mapping to 9330 genes. A more stringent threshold (P=6.0—10?6) at FDR=1% detected cis-meQTLs for 27043 CpG probes mapping to 8479 genes. Moreover with a 200kb window (100kb from both sides) instead than 1Mb we detected 40650 cis-meQTLs (P=2.0—10?4) controlling for FDR=5%. The methylation distribution in CpG sites detected with meQTLs differed substantially from those without meQTLs (Supplementary Fig. 1ab). The peak SNPs were equally distributed on either side of the target CpG-sites with a median distance (?) of 11.8 kb. The proportion of explained phenotypic variance (h2) ranged from 7.7% to 79.8% (Supplementary Fig. 1c) and inversely depended on ? (Supplementary Fig. 1d). We detected strong cis-meQTLs for DNMT1 a gene known for establishment and regulation of tissue-specific patterns of methylated cytosine residues and for DNMT3A/B two genes involved in de novo methylation in mammals but not for MTHFR which affects global methylation (Supplementary Fig. 1e). The likelihood of detecting cis-meQTLs varied across CpG regions and strongly depended on the variability of the methylation levels (Fig. 1d e). CpG probes in non-CGI regions were twice as likely to harbor cis-meQTLs than CpG probes in CGI regions (11.5% v.s. 4.8% t-test P<10?100); similarly CpG probes located in CGI of non-gene regions were twice as likely to harbor cis meQTL than those in gene regions (14.6% v.s. 6.6% t-test P<10?100). To verify the cis-meQTLs we analyzed data from The Cancer Genome Atlas (TCGA)22 NSCLC patients (n=65) for whom both DNA methylation data from llumina HumanMethylation450 BeadChip of histologically normal lung tissue and germline genotypes from Affymetrix Genome-Wide Human SNP Array 6.0 were available. Genetic associations were tested using the imputed genotypic dosages. EAGLE findings were strongly replicated in TCGA lung data: for the 34304 associations detected in EAGLE32128 (93.8%) had the same direction and 22441 (65.4%) had FDR<0.05 based on single-sided P-values (). For 34304 CpG probes detected with cis-meQTLs we searched for secondary independently associated SNPs in cis regions by conditioning on the primary cis-meQTL SNPs. We detected secondary cis-meQTL SNPs for 3546 CpG probes (FDR=5% P=4—10?5) 61.5% of which were replicated in TCGA lung data. Identification of trans-acting meQTLs Identification of trans-meQTLs was performed by searching for SNPs that were on different chromosomes from the target CpG-sites or on the same chromosome but more than 500kb away. We detected 615 CpG-probes with trans-meQTLs (FDR=5% P=2.5—10?10) including 438 interchromosomal and 177 intrachromosomal trans-meQTLs. Among 177 intrachromosomal trans-associations 30 lost significance after conditioning on the corresponding cis-regulating SNPs suggesting that these trans-associations were caused by cis-acting regulations through long range linkage disequilibrium (LD). Thus we detected 585 traits with œtrue trans-meQTLs (Fig. 2a) mapping to 373 genes. The number of trans-meQTLs was reduced to 500 if controlling for FDR=1% (P=4.0—10?11). We replicated 79.8% of the 585 trans-associations in TCGA lung data. Interestingly trans-meQTLs were strongly enriched in CGI sites in contrast to the observation that cis-meQTLs were strongly enriched in non-CGI sites (Fig. 2b). CpG dinucleotides in 3™UTR regions where microRNA target sites are typically located showed an opposite trend in both cis- and trans-meQTLs (Fig. 2b). In 62.8% of the trans-associations the SNPs involved were also detected to have cis-acting effects. We investigated whether trans-associations were mediated by these cis-regulated proximal CpG sites (Fig. 2cd). We found that 30 and 166 trans-associations had full and partial mediation respectively while 389 had no significant mediation. The trans-associations involving SNPs in gene desert regions are less likely to be mediated by proximal CpG probes (15.7% v.s. 34.3%; P=0.0067 Fisher™s exact test). To obtain mechanistic insight into the trans-associations showing mediation effects (n=196) we used the DAVID tool23 to characterize the function of genes harboring the mediating cis-CpG probes. The analysis was performed for 115 genes after excluding the major histocompatibility complex (MHC) region because of long range complex LD patterns. The GO analysis revealed three top gene categories with nominal significance involved in DNA methylation regulation including GTPase-activity related genes (P=0.004 Fisher™s exact test) genes regulating transcription (P=0.02) and genetic imprinting (P=0.04 Fisher™s exact test Supplementary Table 2). Notably 106 trans SNPs with P<2.5—10?10 were associated with multiple distal CpG probes suggesting that they are multi-CpG regulators. In particular we detected one master regulatory SNP rs12933229 located at 16p11.2 in a very large intron of the NPIPL1 gene which was associated with the methylation of CpG sites annotated to five genes on different chromosomes (Fig. 2a Supplementary Fig. 2 and Supplementary Table 3). These associations were partially mediated by a proximal CpG probe cg06871736. All five trans-associations were replicated in TCGA. The trans-associations show a consistent direction with the ˜C™ allele associated with higher methylation levels. All five regulated target sites are in CGIs and three are in gene promoter regions. We evaluated the association with gene expression for these three CpG probes using 28 TCGA histologically normal lung tissue samples with RNA sequencing data. Based on this limited sample size two of the target genes PABPC4 and STARD3 showed decreased expression with increased methylation (FDR=10%). Enrichment of meQTLs in DNA regulatory regions SNPs associated with complex diseases in GWAS or with eQTLs have been reported to be enriched in ENCODE-annotated regulatory regions2425. These include DNaseI hypersensitivity sites CCTC-binding factor (CTCF) binding sites and regions enriched in- active and repressive histone modification marks. The large number of meQTLs detected in our study both cis and trans enabled us to systematically investigate their enrichment in regulatory regions. We performed enrichment analysis using Chip-Seq data in small airway epithelial cells (SAEC) from the ENCODE project for histone marks26 CTCF occupancy27 and DNaseI hypersensitivity sites28; and histone marks in primary human alveolar epithelial cells (hAEC) from our own laboratory29. Compared to the œcontrol SNP set not associated with the methylation of CpG sites (with minor allele frequency and CpG probe density matched with meQTL SNPs) the meQTL SNPs were strongly enriched for sites of CTCF DNaseI hypersensitivity and histone marks (H3K4me3 H3K9-14Ac and H3K36me3) associated with active promoters enhancers and active transcription and to a lesser extent for the repressive mark H3K27me3 (Table 2). Enrichment of all regulatory regions became stronger with increasing significance of association with the exception of the H3K27me3 repressive mark (Fig. 3). Using SAEC CTCF ChIP data we found that meQTL SNPs or associated SNPs in high LD located within CTCF consensus sequences can affect allele-specific binding of CTCF (see two examples in Supplementary Fig. 3 and 4). Lung cancer risk SNPs affect methylation in human lung tissue To determine whether the identified meQTLs might provide functional annotation to the established genetic associations with lung cancer risks we examined SNPs in five genomic regions reported to be associated with lung cancer risk in genome-wide association studies (GWAS) of populations of European ancestry: 15q25.130“32 (CHRNA5-CHRNA3-CHRNB4) 5p15.33203334 6p21.3333 (BAT3 most strongly associated with squamous cell carcinoma or SQ) 12p13.335 (RAD52 for SQ) and 9p21.336 (CDKN2A/CDKN2B particularly for SQ). The GWAS SNPs at 15q25.1 were reported to be associated with total expression levels and multiple isoforms of CHRNA5 in normal lung tissue samples3738. The GWAS SNPs at the other four loci have not been reported to be associated with the total expression of nearby genes. Consistently we did not observe an association in RNA-seq data from TCGA lung normal tissue samples (n=59) although a detailed investigation of alternative promoters splice sites and allele-specific gene expression in larger studies is warranted. Here we investigated whether these SNPs contributed to lung cancer risk with epigenetic regulation by examining their associations with DNA methylation levels. The top GWAS SNPs located at 15q25.1 5p15.33 6p21.33 and 12p13.3 were all strongly associated with the methylation of the nearby CpG probes and the associations were replicated in TCGA lung data (Fig. 4). Importantly five of the six GWAS SNPs at these loci excluding the RAD52 locus were also the SNPs with the strongest association with the corresponding CpG probes. For the cg22937753 probe located in the RAD52 locus another SNP rs724709 with weak correlation with the GWAS SNP (r2=0.1) had the strongest association with meQTL. All involved CpG sites are located within gene bodies (which may affect gene splicing39) or the 3™UTR regions. No meQTL was detected for 9p21.3 (Supplementary Fig. 5) possibly because of fewer CpG dinucleotide probes available in this gene region on the Illumina platform. The location of these lung cancer GWAS-associated CpG sites might identify which genes within the relevant regions are more likely associated with the risk SNPs something that is particularly important for regions with complex LD structure as the MHC region on 6p21. In MHC two GWAS SNPs in complete LD (r2=1) rs3117582 (BAT3) and rs3131379 (MSH5) were most strongly associated with the methylation of CpG sites located nearby of MSH5 (involved in DNA mismatch repair and meiotic recombination process) suggesting that MSH5 (P=5.4—10?13 t-test) is more likely to be involved in lung carcinogenesis than BAT3 (P=8.8—10?5 t-test) or that the SNP closer to MSH5 (rs3131379) is more likely to be the SNP most responsible of the GWAS association with lung cancer risk (Fig. 4b). Our meQTL data also show that rs3131379 trans-regulated the methylation level of CpG probe cg12093005 located in the body of FBRSL1 at 12q24 (PEAGLE=4.0—10?9 PTCGA=7.2—10?4 and Pcombined=5. 4—10?11 t-test). Thus this known GWAS locus might affect lung cancer risk through a gene located on a different chromosome. Of note on the 15q25.1 locus two independent lung cancer risk SNPs rs2036534 and rs1051730 were associated with CpG probes not linked with CHRNA5 expression. In Supplementary Fig. 6 we show that the two SNPs jointly regulated another methylation probe cg22563815 within the CHRNA5 promoter which is associated with CHRNA5 expression. This extends and further confirms the complex regulatory pattern with multiple SNPs previously observed for this locus35. Most subjects in the analyses were smokers (n=206). Adjustment for smoking status (former and current) or intensity (pack/years) did not change the results. cis-meQTLs are enriched in lung squamous cell carcinoma risk We investigated whether the identified cis-meQTL SNPs were enriched in the National Cancer Institute (NCI) lung cancer GWAS including 5739 cases and 5848 controls of European ancestry19. To focus on potentially new genetic risk associations we excluded the top lung cancer GWAS SNPs mentioned above and their surrounding regions. We tested the enrichment by examining whether the GWAS P-values for the LD-pruned cis-meQTL SNPs deviated from the uniform distribution i.e. no enrichment. When all cis-meQTL SNPs were analyzed together we detected a strong enrichment for overall lung cancer risk (P<10?4 based on 10000 permutations) which was primarily driven by the enrichment in SQ (P<10?4 based on 10000 permutations) (Fig. 5a). The genomic control ?-values based on genome-wide SNPs showed that the type-I error rates of our enrichment test were not inflated (?=1.01 and 1.00 for overall lung cancer and SQ respectively). Stratified analyses further refined the enrichment to the cis-meQTL SNPs regulating CpG-sites mapping to north shore (Fig. 5b) and gene body (Fig. 5c) regions (see Supplementary Fig. 7 for the quantile-quantile plot). These gene bodies and north shores were enriched for genes involved in cancer pathways (P=2.5—10?4 Fisher™s exact test) and particularly those in NSCLC pathway (e.g. AKT1 MAPK1 RASSF5 etc. Supplementary Table 4). In contrast cis-meQTLs related with CGI regions or promoters were not enriched with the risk of overall lung cancer or any lung cancer subtype further emphasizing the need to comprehensively study the methylome to identify functional mechanisms for GWAS findings and identify new genetic loci. "

Lung_Cancer

"The staining extent of MLM was significantly smaller than methylene blue (0.6 vs 1.0 cm P<0.001). MLM showed superior staining ability over methylene blue (2.8 vs 2.2 P=0.010). Excellent staining was achieved in 17 subjects (81%) with MLM and 8 (38%) with methylene blue (P=0.011). An acceptable or excellent radio-opacity of MLM was found in 13 subjects (62%). An appropriate localization rate of MLM was 100% with the use of the directly visible ability and radio-opacity of MLM. MLM provides a superior pulmonary localization ability over methylene blue. Lung Ethiodized Oil Methylene Blue Tomography X-Ray Computed Radiology Interventional Seoul National University College of Medicine 800-20120036 INTRODUCTION Preoperative localization is necessary for video-assisted thoracoscopic surgery (VATS) when pulmonary nodules are too small or distant from the visceral pleura to be detected (1-3). A failure to localize nodules disturbs the success of the thoracoscopic resection and leads to conversion to thoracotomy (4 5). There are two kinds of localizing procedures: marking with thoracoscopically directly visible materials and marking with radio-opaque materials. Examples of directly visible materials are hook wire methylene blue and indocyanine green. Ethiodized oil (lipiodol) barium and iodine contrast agents are used for radio-opaque markers. Each marking method has strong and weak points. Localization with a hook wire is easy to perform but carries a high risk of pneumothorax and a propensity to dislodge during transport and surgical preparation (6 7). Methylene blue and indigo carmine have a tendency to diffuse over a large area by the time the operation is done and render localization features inadequate (8 9). The use of a radio-opaque marker (such as barium or lipiodol) requires an intraoperative fluoroscopy to confirm an adequate excision as well as lead to increased radiation exposure (10-13). The use of mixture has been reported to make up for the weakness of marking materials. For example the problem of dye diffusion has led to attempts to use a mixture of dye with various materials such as cyanoacrylate adhesive or collagen or autologous blood (14-16). However they have not been widely used for localization due to difficulties in making and manipulation. Lipiodol and methylene blue are commonly used materials for localization (17-20). We hypothesized that lipiodol reduces the spread of methylene blue and provides additional localization opportunities by its radio-opacity. The use of a mixture of lipidol and methylene blue (MLM) for a percutaneous injection material requires a high success rate for appropriate localization and a low complication rate. To our knowledge there have been no reports that evaluate the availability of MLM as a percutaneous injection material in human lungs. This study compared MLM with methylene blue as a percutaneous injection material for pulmonary localization in rabbit lungs. MATERIALS AND METHODS Animal preparation This study was performed after approval by the Institutional Animal Care and Use Committee (IACUC) in Seoul National University Hospital biomedical research institute (IACUC approval No. 11-0356). Twenty-four adult New Zealand White rabbits were used. We recorded their weight before the procedures. The animals were randomly divided into two groups: Group A (n=12) and Group B (n=12) each sacrificed at about 6 hr and 24 hr after percutaneous injections respectively (Fig. 1). Six hours after percutaneous injections were same day operations of the preoperative localization; and 24 hr after percutaneous injections were next day operations of the preoperative localization. The injection of each material was done in all 24 subjects because we injected methylene blue and MLM at two different lung sites for each subject. Percutaneous injection materials: mixture of lipiodol and methylene blue versus methylene blue A pilot study was performed to decide the optimal amount of materials for percutaneous injections. Methylene blue (1% 100 mg/mL TERA Pharmaceuticals Buena Park CA USA) of 0.3 to 0.9 mL was used for human lung localization in previous studies by Wicky et al. (18) and Vandoni et al. (19). In the pilot study with rabbit lungs we injected 0.1 mL and 0.05 mL of methylene blue and MLM in four subjects. We found that staining was extensive (more than half height of one lobe) with 0.1 mL and localized (about 1 cm of staining diameter) with 0.05 mL for both methylene blue and MLM. Extensive dispersion made it difficult to find exact injecting sites; subsequently 0.05 mL of methylene blue was administered. We made variable mix ratios of lipiodol and methylene blue in vitro; 1:1 1:2 1:3 1:4 and 1:5 in order to find an appropriate mixing ratio of lipiodol (480 mg Iodine/mL Andre Guerbet Aulnay-sous-Bois France) and methylene blue. The separation of two materials occurred instantly after mechanical blending to the fat-soluble character of lipiodol and the water-soluble character of methylene blue. A higher concentration of lipiodol in MLM resulted in increased uneven blending and rapid separation. A mixture with a 1:6 (or lower) mixing ratio contained a minimal amount of lipiodol and it might make it difficult to be detected on the fluoroscopy; subsequently we decided that 1:5 was an appropriate mixing ratio for injection. A total of 0.06 mL of MLM (0.01 mL of lipiodol plus 0.05 mL of methylene blue) was administrated in each subject to avoid the effect of different volumes of methylene blue to the diffusion extent of the materials. CT guided percutaneous injections Percutaneous injection was performed with computed tomography (CT) guidance (Discovery CT750 HD; GE Healthcare Waukesha WI USA). We performed pre-procedural CT scans in order to determine an appropriate skin entry site for the successful placement of a needle in the desired location. The desired location was the basal portion of both caudal lobes around the mid-scapula line. We tried to situate the needle tip at 5 mm depth from the visceral pleura and avoid passing through the pulmonary vessels. We placed the needle of 20 gauze and 3.5 cm length in the lung parenchyma after marking the appropriate skin entry site. The parameters of CT used in our study were: tube voltage of 120 kV tube current of 25 mA slice thickness of 2 mm thickness and gantry rotation speed of 350 milliseconds. We connected 1 mL syringe to the needle hub and retracted the syringe piston to confirm that no blood was aspirated after the needle tip was accurately located within the desired location. We then injected the materials and immediately removed the needle. On the procedural CT scan we measured the distance from the skin-entry to the needle tip and the depth from visceral pleura to the needle tip. A post-procedural CT scan identified procedure-related complications that included the leakage of injecting materials and pneumothorax; in addition we recorded the extent shape and density of radio-opacity of MLM after injection. The extent of MLM was defined as a maximum diameter of the radio-opacities. The shape of radio-opacity was categorized into 3 groups (small faint nodular scattered nodular and discrete compact nodular). We recorded the injection time to measure the time interval between injection and sacrifice. Fluoroscopic examinations A successful localization of lipiodol was determined by fluoroscopic examination; subsequently we evaluated the radio-opacity of MLM using the fluoroscopy X-ray unit (BV Pulsera; Philips Medical Systems Best The Netherlands) at the immediate post-procedure session and the follow up session at 6 hr in Group A and 24 hr in Group B. The parameters of fluoroscopy were: tube voltage of 59 kV and tube current of 946 mA. We obtained anteroposterior fluoroscopic images of the thorax of the rabbit with a 17 cm of field of view. A radio-opaque ruler of 5 cm was located near the rabbit in order to estimate the exact size of lipiodol opacity. We recorded the time of the fluoroscopic examinations and the radiographic findings of MLM (size and shape of the radio-opacity). Evaluation of the staining and radio-opacity We assessed the directly visible staining on the freshly excised lung surface and radio-opacity of MLM on the fluoroscopic examinations using 4-point scoring in order to compare the localization ability of MLM and methylene blue as a percutaneous injection material. A blind reviewer who was unaware of the injection materials assessed the staining ability. In order to evaluate the staining ability the blind reader reviewed the photographic images of the freshly excised lung specimens obtained before formalin fixations and rated the staining by 4-point scores: 0=non-visualization of staining 1=inappropriate; extensive dispersion made it difficult to find accurate injecting locations 2=acceptable; available to estimate injecting locations in spite of the dispersion and 3=excellent definitely localized staining (Fig. 2). The maximum diameter of the staining extent on the lung surface was measured. We calculated and compared scores and extent of staining between two materials. For the fluoroscopic findings the radio-opacity of MLM was evaluated using 4-point scoring: 0=no detectable radio-opacity 1=inappropriate minimally increased opacity 2=acceptable low density of increased opacity 3=excellent compact nodular increased opacity (Fig. 3). We compared the average scores of initial and follow up fluoroscopic examinations. We considered a score of 0 or 1 as inappropriate and a score of 2 or 3 as appropriate for localization for both staining and radio-opacity. We compared the number of appropriate or excellent localization between MLM and methylene blue. Sacrifice and histopathologic examinations Both freshly excised entire lungs were used as final specimens. The lung tissues were fixed in 10% neutral formalin embedded in paraffin and cut into 5 µm thick slices after we took photographs to record staining on the lung surface. We made 4 axial slices that covered the center of the staining. The slices were subjected to hematoxylin-eosin (H-E) stain to the evaluate lung parenchymal change. We evaluated the presence or absence of neutrophil infiltration vasculitis necrosis hemorrhage and foam cell in alveolus. The extent of each histopathologic finding was estimated using visual grading scores as 0 (no) 1 (focal) or 2 (diffuse). Localized parenchymal change (<50% of total area) surrounded by normal lung was defined as focal. Extensive lung parenchymal change (?50% of total area) that replaced normal lung was defined as diffuse. An experienced pathologist with eight years of experience reviewed all slices. The overall severity of the lung parenchymal change was defined as a total score by adding visual grading scores for each histopathologic finding. We compared the overall severity score between MLM and methylene blue as well as between Group A and Group B. Statistical analysis All data are expressed as mean±standard deviation (SD) unless otherwise stated. Comparisons of the average scores were performed by two-tailed unpaired Student's t-test or Mann-Whitney test. We used a Fisher's exact test to compare the number of subjects in the subgroups. Linear by linear association evaluated the association of the extent of lung parenchymal change and materials or groups. Null hypotheses of no difference were rejected if the P values were less than 0.05. The statistical analysis was performed with commercially available statistical software IBM SPSS Statistics version 20.0 (IBM Corp. in Armonk NY USA). RESULTS Subject characteristics procedural records time interval of injection and examinations Among the 24 subjects included in our study successful CT-guided percutaneous injections into the desired location of the lung were achieved in 21 subjects (11 in Group A and 10 in Group B). Three subjects died during anesthesia. Mean weight was 3.2±0.2 kg for Group A and 3.3±0.2 kg for Group B. Injection depth from visceral pleura to needle tip was 0.4±0.1 cm (range: 0.3-0.6 cm) for MLM and 0.4±0.1 cm (range: 0.3-0.7 cm) for methylene blue (P=0.43). Distance from skin to needle tip was 2.8±0.6 cm (range: 2.1-5.0 cm) for MLM and 2.8±0.3 cm (range: 2.2-3.5 cm) for methylene blue (P=0.83). Of 42 CT-guided percutaneous injections total number of procedure related complications was 10 (24%) including 7 leakage (all in MLM) and 3 pneumothorax (2 in MLM 1 in methylene blue). The complication rate in MLM was significantly higher than methylene blue (43% vs 5%) (P=0.004). On post-procedural CT images the extent of the radio-opacity of MLM was 1.3±0.4 cm (range: 0.7-2.0 cm) for Group A and 0.6±0.3 cm (range: 0.3-1.1 cm) for Group B. Discrete compact nodular opacity was achieved in 15 subjects (72%) scattered nodular opacities in 3 (14%) and small faint opacity in 3 (14%) (Fig. 4). The average value of radio-opacity of MLM was 1415±856 HU (range: 307-2768 HU). The interval between injection and sacrifice was 7.9±0.1 hr (range: 7.8-8.0 hr) for Group A and 23.5±0.1 hr (range: 23.4-23.7 hr) for Group B. Time from injection to initial and follow up fluoroscopy was 3.4±0.5 hr (range: 2.5-4.2 hr) and 6.8±0.4 hr (range: 6.3-7.7 hr) for Group A and 1.5±0.4 hr (range: 0.9-2.1 hr) and 22.6±0.4 hr (range: 21.9-23.2 hr) for Group B respectively. Scores and extent of staining and radio-opacity Table 1 demonstrates the staining extent and localization ability of MLM and methylene blue. In total groups the staining extent of MLM was significant smaller than methylene blue (0.6 cm vs 1.0 cm P<0.001). MLM showed a significantly higher staining ability score than methylene blue (2.8 vs 2.2 P=0.010). Radio-opacity in the initial fluoroscopy was not significantly different from the follow up (2.0 vs 1.9 P=0.49). Table 2 showed the number of subjects in each score of localization ability of staining or radio-opacity. In Group A appropriate staining was 100% for both MLM and methylene blue. In Group B appropriate staining was 90% for MLM and 70% for methylene blue. Appropriate staining of MLM was not significantly different from that of methylene blue (95% vs 86% P=0.61); however excellent staining in MLM was significantly higher than methylene blue (81% vs 38% P=0.011) (Table 3). Table 4 shows the localization ability of MLM regarding both staining ability and radio-opacity. There was no subject with a score of 0 or 1 in both radio-opacity and staining. MLM achieved appropriate staining or radio-opacity in 21 subjects (100%) with a dual localization feature. Histopathologic findings Table 5 demonstrates the results of the histopathologic findings. In all lung specimens both methylene blue and MLM showed acute lung parenchymal change that included neutrophil infiltration hemorrhage and foam cell in alveolus (Fig. 4). Comparing the two materials the number of specimen having neutrophil infiltration vasculitis necrosis hemorrhage and foam cell in alveolus was similar in each extent. In terms of all features the number of specimen that showed diffuse extent was more in Group B than Group A for both MLM and methylene blue. The extent of the histopathologic findings was not significantly associated with the materials for all histopathologic features (Table 5). Among the histopathologic findings the extent of vasculitis was significantly associated with Group for both MLM and methylene blue (P=0.002 for both MLM and methylene blue). Focal or diffuse extent of vasculitis was more frequently found in Group A than Group B (P=0.001 for both MLM and methylene blue). The overall severity of lung parenchymal change was not different between MLM and methylene blue (5.6±1.6 vs 5.7±1.5 P=0.839); in addition Group B showed a significantly higher overall severity score of lung parenchymal change than Group A (6.6±1.6 vs 4.7±0.9 P=0.005). DISCUSSION The results of this study show that MLM is a useful percutaneous injection material for a successful localization in the lung. The average staining score of MLM was significantly higher than methylene blue (2.8±0.5 vs 2.2±0.7 P=0.010). In terms of staining the appropriate localization rate (acceptable or excellent staining) in our study was 95% using MLM. The result was in close agreement with previous studies that showed a high success performance rate of lipiodol localization (99%-100%) (21-23). An appropriate localization rate (acceptable or excellent staining) of methylene blue injection was 86% in our study. This is lower than the results found in previous studies where the success rate of methylene blue injection was 96%-100% (18 20). We found that an acceptable (or excellent staining rate) of MLM and methylene blue was not significantly different (95% vs 86% P=0.610). However MLM showed excellent staining for localization in 17 (81%) of 21 subjects and was significantly higher than methylene blue (38%) (P=0.011). The results indicate that lipiodol reduced the spread of methylene blue. This is the first study to indicate that MLM is an available percutaneous injection material for localization with superior staining ability compared to methylene blue. The complication rate was 43% in MLM and 5% in the methylene blue (P=0.004). Possible complications after percutaneous injection for pulmonary localization include pneumothorax leakage hemorrhage pain hemoptysis hemothorax and embolism. Previous studies reported that the complication rate was 17-29% for lipiodol and 33% for methylene blue (2023 24). The complication rate of MLM in the current study was higher than the results of previous studies mainly due to the leakage of MLM into the pleural cavity (n=9). This difference was probably because the distance from the pleura to the injecting needle tip (0.4±0.1 cm for MLM) was inadequate to avoid leakage into the pleural cavity. In the previous studies of lipiodol marking for localization the mean distance from the pleura to the target nodule was 1.0-1.9 cm (22-24) more than twice our study. The results indicate that the high complication rate of our study is associated with the inserting procedure of the needle rather than MLM itself. The dispersion of methylene blue throughout the lung parenchyma may lead to unnecessarily large wedge resections; in addition some have reported instances of the dispersion of methylene blue throughout the entire pleural surface or intraoperative identification failure due to severe anthracosis of the visceral pleura. The failure rate was reported to be 0%-13% with the use of methylene blue (1819 25). The results are similar to our study and indicate that inappropriate staining on the lung surface was 14% in methylene blue. In this study we found that the dispersion of methylene blue in MLM through the lung parenchyma was significantly smaller than methylene blue (0.6±0.3 cm vs 1.0±0.4 cm P<0.05). The result implies that lipiodol reduces the spread of methylene blue in lung parenchyma. Regarding the score of radio-opacity 38% of MLM showed non-visualization or minimally increased opacity on the fluoroscopic examinations. It means the proportion of lipiodol in MLM at the time of the percutaneous injection was too small to be detected. Post-procedural CT images also revealed that 3 subjects had small faint radio-opacity after the injection of MLM. It suggests that the uneven blending of lipiodol and methylene blue occurred during the preparation of MLM. Water-insolubility of lipiodol would result in the uneven mixing of water soluble methylene blue after mechanical blending of the two materials. Further research is required to reduce non-homogeneity of MLM at the time of injection. Previous studies reported the availability of a mixture of methylene blue with other materials such as collagen or autologous blood (15 16). They performed VATS resection on the same day as localization. In our study we evaluated the localization ability of MLM on the same day of localization (6 hr) as well as 24 hr after injection. Localization is usually performed on the day of surgery. This requires the simultaneous use of the CT and the operating room which is not always available. Surgeries on the next day of localization were reported in several published articles (26 27). MLM shows a prolonged localization ability of up to 24 hr in terms of staining ability and radio-opacity. Stable localization ability is the advantage of MLM in our study. Due to uneven blending of MLM one subject (10%) showed inappropriate staining and appropriate radio-opacity and required an intraoperative fluoroscopic examination to detect MLM. Possible radiation exposure is a drawback of MLM. We would like to justify the use of intraoperative fluoroscopy because the operator can avoid radiation exposure with a lead apron. In regards to the risk-benefit for patients lowering the risk of detection failure is thought to be more important than radiation exposure. Histopathologic examinations showed lung parenchymal changes in all specimens. Both methylene blue and MLM induced acute lung injury that included neutrophil infiltration vasculitis necrosis hemorrhage and foam cell in alveolus (Table 5). The results of our study are similar to those of a previous study by Kwon et al. (28) that showed that lipiodol led to acute lung injury. They described that lipiodol creates the histopathologic feature of acute lung injury such as peripheral endothelial cell damage neutrophil infiltration necrosis hemorrhage alveolar wall destruction vasculitis emboli (or thrombi in arteriole) and macrophages in the alveolar space (28). In our results the extent of lung parenchymal change was not associated with the materials for all histopathologic features. In addition the overall severity score of lung parenchymal change in MLM was not different from methylene blue (5.6 and 5.7 P=0.839). This suggests that MLM shows similar histopathologic effects in the lung parenchyma to methylene blue. The overall severity score of parenchymal change was higher in Group B (follow up interval of 24 hr) than Group A (follow up interval of 6 hr) (6.6 vs 4.7 P=0.005). The extent of lung parenchymal change depends on the time interval. Acute lung injury after the percutaneous injection of lipiodol or methylene blue was reported in animal studies (28 29); however there are no clinical results that show the adverse effect of acute lung injury in human lungs. Injection material (such as barium) can potentially complicate the pathologic diagnosis of the target lesion due to acute inflammation (29 30). To our knowledge no study has indicated that lipiodol or methylene blue hinders the histopathologic diagnosis of target lesions in human lungs. The small amount of material injection in human lungs might not create a significant parenchymal change or disrupt underlying lung disease. It is necessary to avoid directly injecting materials into the target lesion in human lungs in order to avoid the adverse effect of injection materials on underlying lung disease (especially ground glass opacity nodule or potential benign lesion). There were several limitations in our study. First we included only a small number of subjects. Second the overall localization success rate was low and the complication rate was high (compared to the results of previous studies) due to the difficulty in an accurate percutaneous injection at the desired location and depth in the small sized rabbit lung. Third we used a 1 mL syringe with manual administration to inject materials in the lung parenchyma and there were possible individual difference in the administering volume of materials. Fourth we could not evaluate complications such as intractable pain material related anaphylaxis or embolism. Fifth we could not evaluate if the histopathologic changes had any effect on underlying lung disease because the lung parenchyma of the experimental rabbits were normal. Finally we did not evaluate a successful localization for the true target lesion in lung parenchyma. The criteria for appropriate staining and radio-opacity were subjective. We expect that further clinical studies might provide an answer to if MLM can be a useful percutaneous injection material for localization in the human lung. In conclusion MLM is available for percutaneous injection for the pulmonary localization. The results of this study showed that MLM provides superior ability for appropriate localization than that of methylene blue. Further research on human lungs can clarify the availability of MLM as a CT guided percutaneous injection material. This study was supported by grant from the Seoul National University College of Medicine Research Fund 2012 (800-20120036). We have no potential conflicts of interest or commercial involvement to disclose. 1 Nakashima S Watanabe A Obama T Yamada G Takahashi H Higami T Need for preoperative computed tomography-guided localization in video-assisted thoracoscopic surgery pulmonary resections of metastatic pulmonary nodules Ann Thorac Surg 2010 89 212 218 20103238 2 Chen S Zhou J Zhang J Hu H Luo X Zhang Y Chen H Video-assisted thoracoscopic solitary pulmonary nodule resection after CT-guided hookwire localization: 43 cases report and literature review Surg Endosc 2011 25 1723 1729 21181200 3 Ciriaco P Negri G Puglisi A Nicoletti R Del Maschio A Zannini P Video-assisted thoracoscopic surgery for pulmonary nodules: rationale for preoperative computed tomography-guided hookwire localization Eur J Cardiothorac Surg 2004 25 429 433 15019673 4 Suzuki K Nagai K Yoshida J Ohmatsu H Takahashi K Nishimura M Nishiwaki Y Video-assisted thoracoscopic surgery for small indeterminate pulmonary nodules: indications for preoperative marking Chest 1999 115 563 568 10027460 5 Seo JM Lee HY Kim HK Choi YS Kim J Shim YM Lee KS Factors determining successful computed tomography-guided localization of lung nodules J Thorac Cardiovasc Surg 2012 143 809 814 22104686 6 Gossot D Miaux Y Guermazi A Celerier M Friga J The hook-wire technique for localization of pulmonary nodules during thoracoscopic resection Chest 1994 105 1467 1469 8181339 7 Pittet O Christodoulou M Pezzetta E Schmidt S Schnyder P Ris HB Video-assisted thoracoscopic resection of a small pulmonary nodule after computed tomography-guided localization with a hook-wire system: experience in 45 consecutive patients World J Surg 2007 31 575 578 17318707 8 Chen W Chen L Yang S Chen Z Qian G Zhang S Jing J A novel technique for localization of small pulmonary nodules Chest 2007 131 1526 1531 17494801 9 Bernard A Resection of pulmonary nodules using video-assisted thoracic surgery: the Thorax Group Ann Thorac Surg 1996 61 202 204 8561553 10 Martin AE Chen JY Muratore CS Mayo-Smith WW Luks FI Dual localization technique for thoracoscopic resection of lung lesions in children J Laparoendosc Adv Surg Tech A 2009 19 S161 S164 18999984 11 Kawanaka K Nomori H Mori T Ikeda K Ikeda O Tomiguchi S Yamashita Y Marking of small pulmonary nodules before thoracoscopic resection: injection of lipiodol under CT-fluoroscopic guidance Acad Radiol 2009 16 39 45 19064210 12 Yamagami T Miura H Yoshimatsu R Tanaka O Ono S Iehara T Hosoi H Nishimura T Experience of fluoroscopy-aided thoracoscopic resection of pulmonary nodule localised with Lipiodol in a child J Med Imaging Radiat Oncol 2011 55 401 403 21843175 13 Iwasaki Y Nagata K Yuba T Hosogi S Kohno K Ohsugi S Kuwahara H Takemura Y Yokomura I Fluoroscopy-guided barium marking for localizing small pulmonary lesions before video-assisted thoracic surgery Respir Med 2005 99 285 289 15733503 14 Yoshida J Nagai K Nishimura M Takahashi K Computed tomography-fluoroscopy guided injection of cyanoacrylate to mark a pulmonary nodule for thoracoscopic resection Jpn J Thorac Cardiovasc Surg 1999 47 210 213 10402768 15 Nomori H Horio H Colored collagen is a long-lasting point marker for small pulmonary nodules in thoracoscopic operations Ann Thorac Surg 1996 61 1070 1073 8607658 16 McConnell PI Feola GP Meyers RL Methylene blue-stained autologous blood for needle localization and thoracoscopic resection of deep pulmonary nodules J Pediatr Surg 2002 37 1729 1731 12483642 17 Hu J Zhang C Sun L Localization of small pulmonary nodules for videothoracoscopic surgery ANZ J Surg 2006 76 649 651 16813634 18 Wicky S Mayor B Cuttat JF Schnyder P CT-guided localizations of pulmonary nodules with methylene blue injections for thoracoscopic resections Chest 1994 106 1326 1328 7956378 19 Vandoni RE Cuttat JF Wicky S Suter M CT-guided methylene-blue labelling before thoracoscopic resection of pulmonary nodules Eur J Cardiothorac Surg 1998 14 265 270 9761435 20 Lenglinger FX Schwarz CD Artmann W Localization of pulmonary nodules before thoracoscopic surgery: value of percutaneous staining with methylene blue AJR Am J Roentgenol 1994 163 297 300 7518642 21 Ikeda K Nomori H Mori T Kobayashi H Iwatani K Yoshimoto K Kawanaka K Impalpable pulmonary nodules with ground-glass opacity: success for making pathologic sections with preoperative marking by lipiodol Chest 2007 131 502 506 17296654 22 Nomori H Horio H Naruke T Suemasu K Fluoroscopy-assisted thoracoscopic resection of lung nodules marked with lipiodol Ann Thorac Surg 2002 74 170 173 12118752 23 Watanabe K Nomori H Ohtsuka T Kaji M Naruke T Suemasu K Usefulness and complications of computed tomography-guided lipiodol marking for fluoroscopy-assisted thoracoscopic resection of small pulmonary nodules: experience with 174 nodules J Thorac Cardiovasc Surg 2006 132 320 324 16872957 24 Kim YD Jeong YJ I H Cho JS Lee JW Kim HJ Lee SH Kim DH Localization of pulmonary nodules with lipiodol prior to thoracoscopic surgery Acta Radiol 2011 52 64 69 21498328 25 Mayo JR Clifton JC Powell TI English JC Evans KG Yee J McWilliams AM Lam SC Finley RJ Lung nodules: CT-guided placement of microcoils to direct video-assisted thoracoscopic surgical resection Radiology 2009 250 576 585 19188326 26 Lee NK Park CM Kang CH Jeon YK Choo JY Lee HJ Goo JM CT-guided percutaneous transthoracic localization of pulmonary nodules prior to video-assisted thoracoscopic surgery using barium suspension Korean J Radiol 2012 13 694 701 23118567 27 Kamiyoshihara M Ishikawa S Morishita Y Pulmonary cryptococcosis diagnosed by video-assisted thoracoscopic surgery with CT-guided localization: report of a case Kyobu Geka 2000 53 795 797 10935411 28 Kwon WJ Kim HJ Jeong YJ Lee CH Kim KI Kim YD Lee JH Direct lipiodol injection used for a radio-opaque lung marker: stability and histopathologic effects Exp Lung Res 2011 37 310 317 21574876 29 Jang HS Effect of drugs for preoperative localization of thoracoscopy to histopathologic change in rabbit lung Seoul the Catholic University of Korea 2000 27 Dissertation 30 Okumura T Kondo H Suzuki K Asamura H Kobayashi T Kaneko M Tsuchiya R Fluoroscopy-assisted thoracoscopic surgery after computed tomography-guided bronchoscopic barium marking Ann Thorac Surg 2001 71 439 442 11235684 Fig. 1 Overview of the experimental design. Animals were randomly divided into two groups: Group A (n = 12) was sacrificed 6 hr after percutaneous injection and Group B (n = 12) was sacrificed 24 hr after a CT guided percutaneous injection of MLM and methylene blue. Fig. 2 Examples of evaluation of staining on the lung surface. Photographs show (A) the extensive staining (score 1) (B) localized dispersion of staining (score 2) and (C) minimal dispersion of staining (score 3). The white lines on the bottom of the figure are markings of the ruler. The distance between two lines is one centimeter. Fig. 3 Examples of assessment of radio-opacity on the fluoroscopic examinations. The fluoroscopic images show (A) a minimally increased opacity (arrow) (score 1) (B) a low density of increased opacity (arrow) (score 2) and (C) a compact nodular increased opacity (arrow) (score 3). Fig. 4 CT and corresponding photomicrograph of lung specimen. MLM in Group B (A-D); (A)"

Lung_Cancer

"The cancer tissue used in this study was received from patients that had surgical resection of both the primary tumor and related metastases. None of the patients had received chemo- or radiotherapy before the resection of the primary tumor. Medical charts and pathology reports were reviewed to record clinical and pathological data. Glass slides were reviewed to determine the histological type according to the WHO classification [30]. Follow-up information including the patient outcome and the time interval between the date of surgical resection and death was collected. The cases lost to follow-up and deaths from causes other than CRC were considered censored data for the survival analysis. The median follow-up period was 37.9 months (range 0.8“104.6 months). Ethical statement All human specimens were obtained from the files of surgically resected cases examined at the Department of Pathology Seoul National University Bundang Hospital for the pathologic diagnosis. The retrospective study was performed using the stored samples after the pathologic diagnosis and all of the samples were anonymized before the study. The participants did not provide written informed consent in this study. The study was approved by the Institutional Review Board of Seoul National University Bundang Hospital under the condition of anonymization (reference: B-1109/136-302). Tissue array methods To evaluate the regional stromal differences samples were taken from each patient from four areas: the center and periphery of the primary cancer distant metastases and lymph node metastases. The distant metastatic sites for the tissue arrays were as follows: liver in 83 cases (45.9%) lung in 38 cases (21.0%) seedings in 38 cases (21.0%) distant lymph nodes in 6 cases (3.3%) and ovary in 16 cases (8.3%). The representative core tissue specimens (2 mm in diameter) were taken from individual paraffin blocks and rearranged in new tissue array blocks using a trephine apparatus (Superbiochips Laboratories Seoul South Korea) [31]. Immunohistochemistry Array slides were labelled by immunohistochemistry using antibodies for CD31 (1?100 DAKO Glostrup Denmark) D2-40 (1?100 DAKO) SMA (1?1000 Neomarkers Fremont CA USA) desmin (1?300 DAKO) and PTEN (1?80 Epitomics Burlingame CA USA) after a microwave antigen retrieval procedure except SMA. Non-reactive sites were blocked using 1% horse serum in Tris-buffered saline (pH 6.0) for 3 min. Primary antibodies were applied and antibody binding was detected with diaminobenzidine (DAB). Sections were counterstained with hematoxylin. The reactivity of PTEN in each tissue section was scored as negative faint or strong and the percentage of PTEN-positive fibroblasts was quantified. For the statistical analysis the sample was deemed PTEN-positive if 5% or more CAFs were scored as strong positives. Calculation of LVD MVD and CAFs using digital pathology Slides were concurrently evaluated by two pathologists (H.E.L and H.S.L) using light microscopy to improve the accuracy of the results (Fig. 1). CRC cells were considered as internal negative controls. Medium- to large-sized vessels were considered as internal positive controls for CD31 and D2-40. Intestinal muscular layer or medium- to large-sized vessels were considered as internal positive controls for desmin and SMA. Samples showing inappropriate staining in internal negative or positive controls were considered non-informative and were excluded from the analysis. Slides were scanned using an Aperio ScanScope® CS instrument (Aperio Technologies Inc. Vista CA) at 20— magnification. Subsequently they were analyzed in ImageScope„¢ using the Microvessel Analysis v1 algorithm (Aperio Technologies) and MVD and LVD were calculated. Because desmin-positive muscularis mucosa and propria are positive for SMA immunostaining the area of CAFs (mm2) was calculated by subtracting the areas of desmin staining from that of SMA staining (SMA - desmin). .0091811.g001 Representative sections from four tumor locations stained with CD31 D2-40 SMA or desmin antibodies (—100). Statistical analysis A chi-squared test or Fisher's exact test (2-sided) for non-continuous variables and Mann-Whitney or Kruskal-Wallis analysis for continuous variables were used to compare each parameter with respect to the CRC site and according to its clinicopathologic features. The correlation between continuous variables was analyzed using the Pearson correlation coefficient. To determine the best cut-offs of continuous variables for predicting patient survival the maximal chi-squared method was performed using R program (http://cran.r-project./). The overall survival curves were plotted using the Kaplan-Meier product-limit method and the significance of the differences between these curves was determined using the log-rank test. A univariate and multivariate regression analysis was performed using the Cox's proportional hazards model to determine hazard ratios (HRs). P-values of less than 0.05 were considered statistically significant. All statistical analysis excluding the maximal chi-squared test was performed with the IBM SPSS statistics 20 (Armonk NY USA). Results 1. Heterogeneity of cancer-associated stroma according to examined tumor locations The clinicopathological characteristics of the advanced CRC patients are described in . The CRC patients with synchronous metastases had aggressive features including larger tumor size more advanced pT and pN stage and the presence of perineural and venous invasion than the patients with metachronous metastasis (p<0.05). .0091811.t001 Clinicopathologic characteristics of advanced colorectal cancers. Parameters Total Metachronous Synchronous P value (n?=?181) (n?=?57) (n?=?124) Age (median range) 60.00 (28“93) 62.00 (36“79) 60.00 (28“93) 0.241 Sex 0.007 Male 97 39 (68.4%) 58 (46.8%) Female 84 18 (31.6%) 66 (53.2%) Location 0.055 Right colon 37 6 (10.5%) 31 (25.0%) Left colon 75 29 (50.9%) 46 (37.1%) Rectum 69 22 (38.6%) 47 (37.9%) Size of primary tumor 5.30 (2.0“13.0) 4.20 (2“9) 5.50 (2.5“13) <0.001 Histologic grade 0.227 Low grade 157 52 (91.2%) 105 (84.7%) High grade 24 5 (8.8%) 19 (15.3%) T stage <0.001 T1 0 0 0 T2 5 3 (5.3%) 2 (1.6%) T3 107 45 (78.9%) 62 (50.0%) T4 69 9 (15.8%) 60 (48.4%) N stage <0.001 N0 35 23 (40.4%) 12 (9.7%) N1 58 23 (40.4%) 35 (28.2%) N2 88 11 (19.3%) 77 (62.1%) Perineural invasion 0.011 Absent 89 36 (63.2%) 53 (42.7%) Present 92 21 (36.8%) 71 (57.3%) Venous invasion 0.028 Absent 126 46 (80.7%) 80 (64.5%) Present 55 11 (19.3%) 44 (35.5%) The heterogeneous values for LVD MVD and CAF area are shown in Fig 2. LVD was the highest in center of the primary cancers (median interquartile range (IQR); 37.00 10.50“81.00) than any other site (5.00 1.00“23.75 at the periphery; 2.50 1.00“15.00 in lymph node metastases; 3.00 1.00“20.00 in distant metastases). MVD was lower in distant metastases (median IQR; 641.50 428.00“1006.75) than at the periphery of the primary cancer (731.00 508.25“1049.75) and lymph node metastases (893.50 520.25“1275.25). The area occupied by CAFs was the lowest in the distant metastases (median IQR; 0.91 0.68“1.18) than any other site (1.12 0.88“1.41 in the center; 1.22 0.96“1.54 in the periphery1.4 1.00“1.71 in lymph node metastases). In addition the stromal characteristics varied in relation to the metastatic an examined. MVD and LVD were the higher in lung metastases than those in the liver peritoneum or lymph nodes (p<0.001; Fig. 3). However the amounts of CAFs were consistent among the different metastatic ans (p?=?0.180). .0091811.g002 Heterogeneity of lymphatic vessel density (LVD) microvessel density (MVD) and amount of cancer-associated fibroblasts (CAFs) with respect to tumor location. The LVD (A) MVD (B) and CAF area (C) was significantly different according to each tumor location. .0091811.g003 LVD MVD and CAF area at different distant metastasis sites. The characteristics of cancer-associated stroma differed with respect to the metastatic site. LVD (A) and MVD (B) were greater in the metastatic tumor samples collected from the lung than in samples collected from other metastatic sites (p<0.001). However the amount of CAFs was not significant different between metastatic sites (C). Despite the heterogeneity of stromal characteristics CRC cases with higher LVD MVD and CAFs in center of the primary cancers had a tendency of higher LVD MVD and CAFs in periphery (p<0.05; Table S1). However LVD in center and periphery of primary cancer were not correlated with LVD in related distant metastasis (Table S1). In addition the amount of microvasculature was significantly correlated with the amount of CAFs (Table S2). 2. Clinical significance of cancer-associated stroma in advanced CRCs The MVD LVD and amount of CAFs present at each tumor location were compared according to their clinicopathologic features (Table 2). High grade CRCs were associated with lower CAFs in samples taken from the central cancer site (p?=?0.041). When compared with synchronous metastases the patients with metachronous metastases had higher LVD in center and periphery of the primary cancer and had higher MVD in lymph node metastases. Most patients with metachronous metastases were treated by adjuvant chemotherapy before metastasectomy. LVD and MVD in the distant metastases were significantly higher in the patients who had received chemotherapy before metastasectomy than those who did not (p?=?0.011 and 0.048 respectively). .0091811.t002 Table 2 Clinicopathologic factor and LVD MVD and CAFs. Center (median) Periphery (median) LN metastasis (median) Distant metastasis (median) LVD MVD CAFs LVD MVD CAFs LVD MVD CAFs LVD MVD CAFs Total 39 717 1.13 5 740 1.22 3 888 1.42 3 648 0.91 Histologic grade Low grade 40 717 1.15* 5 741 1.23 3 895 1.43 3 665 0.92 High grade 34 683.5 0.94* 6 643.5 1.18 2 656 1.32 6 498 0.82 pT stage pT2 34 758 1.15 16 870 1.48 6 772 0.73 pT3 47 737 1.19 5 803 1.22 2.5 884 1.43 3 724 0.92 pT4 33 639 1.09 4 630 1.22 3 895 1.41 3 520 0.93 LN metastasis Absent 49 602 1.15 8 712 1.42 4 772 0.94 Present 39 737.5 1.12 4 740 1.21 3 884 1.41 3 617 0.91 Perineural invasion Absent 41 738 1.12 6 772 1.32 5.5 931.5 1.42 4 687 0.94 Present 39 672 1.13 4 702 1.2 2 796 1.39 3 548.5 0.86 Metastasis Synchronous 34* 717.5 1.11 3.0* 741 1.21 3 797* 1.39 3 617 0.93 Metachronous 55* 716 1.21 8.0* 712 1.23 2 1117* 1.63 5 698 0.91 Chemotherapy  Not done 2.0* 597.5* 0.93 Done 10.0* 684* 0.91 * p<0.05; ** p<0.01;   chemotherapy prior to metastatectomy of distant metastasis. 3. Expression loss of PTEN in CAFs PTEN was expressed in cytoplasm and sometimes the nucleus of both cancer and non-neoplastic cells when examined using immunohistochemistry. Expression of PTEN was lost in 8 cases in the center 2 cases in the periphery 4 cases in lymph node metastases and 11 cases in distant metastases (Table S3). In all 11 distant metastases with PTEN loss PTEN expression was intact in both the center and periphery of primary cancer (data not shown). PTEN loss in distant metastasis was correlated with synchronous metastasis (p?=?0.018). 4. Cancer-associated stroma and patient prognosis By using the obtained cut-offs lower LVD MVD and CAFs in the center LVD and CAFs in the periphery and MVD and CAFs in distant metastases were all significantly correlated with lower survival (p<0.05; Fig. S1). Among other clinicopathologic features synchronous metastasis old age larger size high histologic grade advanced pT and pN stage and presence of perineural invasion were associated with a worse prognosis (Table 3). By multivariate Cox regression analysis the hazard ratio of synchronous versus metachronous was the highest (4.029) with the lowest p value (p<0.001). CAFs in distant metastasis LVD and MVD in the center LVD in the periphery age and perineural invasion also independently predicted patient survival. In addition loss of PTEN expression in CAFs in distant metastases was associated with a worse prognosis (p?=?0.042; Fig S2) but not in primary cancer or lymph node metastasis. .0091811.t003 Table 3 Univariate and multivariate survival analysis according to clinicopathologic features. Univariate survival analysis Multivariate survival analysis Factors HR (95% CI) P value HR (95% CI) P value Synchronous vs. Metachronous 4.617 (2.472“8.624) <0.001 3.762 (1.838“7.701) <0.001 Age 1.023 (1.004“1.044) 0.020 1.033 (1.011“1.056) 0.003 Sex (female vs. male) 1.428 (0.920“2.218) 0.113 ” ” Location (left vs. right) 0.503 (0.314“0.806) 0.004 0.700 (0.413“1.188) NS (0.186) Size 1.073 (1.005“1.146) 0.036 1.040 (0.903“1.198) NS (0.584) Histologic grade (high vs. low) 1.862 (1.061“3.269) 0.030 1.491 (0.763“2.912) NS (0.243) pT stage (pT4 vs. pT2/3) 2.341 (1.503“3.645) <0.001 1.137 (0.674“1.921) NS (0.630) pN stage (pN1/2 vs. pN0) 3.848 (1.760“8.411) 0.001 1.773 (0.758“4.146) NS (0.186) Perineural invasion 2.628 (1.640“4.211) <0.001 2.108 (1.265“3.513) 0.004 Venous invasion 1.217 (0.757“1.956) 0.418 ” Center LVD (high vs. low) 0.364 (0.158“0.836) 0.017 0.298 (0.118“0.753) 0.010 Center MVD (high vs. low) 0.391 (0.233“0.655) <0.001 0.437 (0.238“0.801) 0.007 Center CAFs (high vs. low) 0.579 (0.352“0.954) 0.032 1.038 (0.607“1.773) NS (0.892) Periphery LVD (high vs. low) 0.235 (0.086“0.644) 0.005 0.279 (0.096“0.809) 0.019 Periphery MVD (high vs. low) 1.456 (0.911“2.327) 0.117 ” Periphery CAFs (high vs. low) 0.524 (0.336“0.817) 0.004 0.813 (0.499“1.326) NS (0.406) LN LVD (high vs. low) 1.646 (0.874“3.100) 0.123 ” LN MVD (high vs. low) 0.597 (0.294“1.213) 0.154 ” LN CAFs (high vs. low) 0.717 (0.423“1.217) 0.218 ” Metastasis LVD (high vs. low) 0.569 (0.314“1.032) 0.063 ” Metastasis MVD (high vs. low) 0.579 (0.364“0.921) 0.021 1.262 (0.720“2.211) NS (0.417) Metastasis CAFs (high vs. low) 0.492 (0.271“0.894) 0.020 0.290 (0.144“0.582) 0.001 Metastasis PTEN (intact vs. loss) 0.454 (0.208“0.993) 0.048 0.575 (0.239“1.383) NS (0.217) Discussion Carcinoma cells in different tissue areas have distinct characteristics [32]. In central areas of the tumor carcinoma cells maintain an epithelial cell phenotype but carcinoma cells in the invasive front acquire a more malignant and mesenchymal phenotype and are thought to have an increased migratory capacity and contribute to metastatic diseases. These metastatic cells may restore the epithelial phenotype at metastatic sites [33]. In addition to carcinoma cells themselves microenvironment is suggested to be uneven within a given tumor because tumor formation and progression involve the co-evolution of cancer cells and microenvironments [34]. The present study demonstrated that the cancer-associated microenvironment also had distinct characteristics in different areas. Of the sites examined LVD was highest in the center of the primary cancer. MVD was slightly higher in center than at the periphery of the primary cancer but this difference was not statistically significant. Interestingly the amount of CAFs in distant metastases was significantly lower than in center and periphery of the primary cancer. We show that the stromal microenvironment has regional heterogeneity both within the primary tumor and between the primary site and its related metastases. Furthermore our data suggests that the stromal heterogeneity might be attributable to tumor heterogeneity. Therefore it would be beneficial to consider both stromal and tumor cell heterogeneity in order to manage CRC patients better. We evaluated the MVD LVD and amount of CAFs in metastatic tissues of various ans including the liver lung peritoneal seeding distant lymph nodes and ovary. Of the metastatic ans we examined both LVD and MVD were the highest in lung. In our previous study the KRAS discordance rate was also significantly higher in matched lung metastases than in other matched metastatic ans [35]. The underlying mechanism is not known. It could be that primary CRCs with high LVD and MVD have a tendency to produce lung metastases; however our results indicated that LVD and MVD in the center and at the periphery of the primary cancers were lower in the patients with lung metastases (data not shown). Alternatively it may be due to the physiological characteristics of metastatic ans interactions between cancer cells and microenvironment within the metastatic an or the characteristics of the cancer cell clones prone to lung metastasis. However technical or sampling errors also may be possible thus further large-scale studies are required. Although numerous studies have attempted to demonstrate an association between tumor microenvironment characteristics and survival the prognostic impacts of MVD and LVD are still controversial. Some studies have been presented that active angiogenesis and lymphangiogenesis represented by high MVD and LVD are associated with poor prognosis and aggressive clinicopathologic factors [36] [37]. Recent meta-analysis has demonstrated that LVD was significantly associated with disease-free survival but not overall survival [38]. Other studies have reported no statistical significance of MVD and LVD on survival [39]. Prall et al. has reported that high MVD and LVD are related with better survival in a consecutive series and liver metastases [40]. Our results were based on patients with advanced disease with distant metastasis and we showed that high MVD and LVD were related with improved survival. This might be because all the patients in this study had confirmed to have distant metastasis and microvasculatures could influence even delivery of the chemotherapeutic drug into the tumor. However our study had some limitations in terms of the survival analysis. We enrolled the CRC patients with available surgically resected cancer tissues from both primary tumors and corresponding metastatic tumors. Not all advanced CRC patients with metastatic diseases were included and far advanced cases were not enrolled because of their inoperability. Therefore unrecognized biases might have influenced our survival results. Some studies have demonstrated an anti-tumorigenic effect of fibroblasts [20] [21]. However it has become clear that CAFs contribute to the progression of cancer and their prognostic significance in various cancers also has been raised [41] and furthermore several studies have observed genetic alterations in CAFs [26] [27]. PTEN loss of CAFs has been observed in breast cancer and prognostic association of it has been suggested [27] [28]. "

Lung_Cancer

"Angelique Whitehurst PhD. UT-Southwestern Medical Center 6001 Forest Park Drive Dallas TX 75390-8807. Phone (214)-645-6066. 214-645-6347 angelique.whitehurstutsouthwestern.edu. 13 6 2014 23 5 2014 15 7 2014 15 7 2015 74 14 3857 3869 Non-small cell lung cancer (NSCLC) is notorious for its paltry responses to first-line therapeutic regimens. In contrast to acquired chemoresistance little is known about the molecular underpinnings of the intrinsic resistance of chemo-na¯ve NSCLC. Here we report that intrinsic resistance to paclitaxel in NSCLC occurs at a cell-autonomous level due to the uncoupling of mitotic defects from apoptosis. To identify components that permit escape from mitotic stress-induced death we employed a genome-wide RNAi-based strategy which combines a high-throughput toxicity screen with a live-cell imaging platform to measure mitotic fate. This strategy revealed that prolonging mitotic arrest with a small molecule inhibitor of the APC/Cyclosome could sensitize otherwise paclitaxel-resistant NSCLC. We also defined novel roles for CASC1 and TRIM69 in supporting resistance to spindle poisons. CASC1 which is frequently co-amplified with KRAS in lung tumors is essential for microtubule polymerization and satisfaction of the spindle assembly checkpoint. TRIM69 which associates with spindle poles and promotes centrosomal clustering is essential for formation of a bipolar spindle. Notably RNAi-mediated attenuation of CASC1 or TRIM69 was sufficient to inhibit tumor growth in vivo. On the basis of our results we hypothesize that tumor evolution selects for a permissive mitotic checkpoint which may promote survival despite chromosome segregation errors. Attacking this adaptation may restore the apoptotic consequences of mitotic damage to permit the therapeutic eradication of drug-resistant cancer cells. mitotic slippage pan-genomic RNAi screen paclitaxel CASC1 TRIM69 8811105 1399 Mol Carcinog Mol. Carcinog. Molecular carcinogenesis 0899-1987 1098-2744 23681825 4152901 10.1002/mc.22006 NIHMS619642 Heme-related gene expression signatures of meat intakes in lung cancer tissues Lam Tram Kim 1 2 * Rotunno Melissa 2 * Ryan Brid M. 3 Pesatori Angela C. 4 5 Bertazzi Pier Alberto 4 5 Spitz Margaret 6 Caporaso Neil E. 2 Landi Maria Teresa 2 § 1Cancer Prevention Fellowship Program Office of Preventive Oncology National Cancer Institute National Institutes of Health (NIH) DHHS Bethesda Maryland 2Division of Cancer Epidemiology and Genetics Genetic Epidemiology Branch National Cancer Institute National Institutes of Health (NIH) DHHS Bethesda Maryland 3Laboratory of Human Carcinogenesis Center for Cancer Research National Cancer Institute Bethesda Maryland 4EPOCA Epidemiology Research Center Universita™ degli Studi di Milano Milan 5Unit of Epidemiology Fondazione IRCCS Ospedale Maggiore Policlinico Mangiagalli e Regina Elena Milan Italy 6MD Anderson Cancer Center Houston Texas §To whom correspondence should be addressed. National Cancer Institute 6120 Executive Blvd. MSC 7114 Bethesda MD 20892-7248; landimmail.nih.gov; Fax: 301-402-4489 * The authors equally contributed to the presented work. 9 8 2014 16 5 2013 7 2014 03 9 2014 53 7 548 556 Lung cancer causes more deaths worldwide than any other cancer. In addition to cigarette smoking dietary factors may contribute to lung carcinogenesis. Epidemiologic studies including the Environment and Genetics in Lung cancer Etiology (EAGLE) have reported increased consumption of red/processed meats to be associated with higher risk of lung cancer. Heme-iron toxicity may link meat intake with cancer. We investigated this hypothesis in meat-related lung carcinogenesis using whole genome expression. We measured genome-wide expression (HG-U133A) in 49 tumor and 42 non-involved fresh frozen lung tissues of 64 adenocarcinoma EAGLE patients. We studied gene expression profiles by high-versus-low meat consumption with and without adjustment by sex age and smoking. Threshold for significance was a False Discovery Rate (FDR) ?0.15. We studied whether the identified genes played a role in heme-iron related processes by means of manually curated literature search and gene ontology-based pathway analysis. We found that gene expression of 232 annotated genes in tumor tissue significantly distinguished lung adenocarcinoma cases who consumed above/below the median intake of fresh red meats (FDR=0.12). Sixty-three (~28%) of the 232 identified genes (12 expected by chance p-value<0.001) were involved in heme binding absorption transport and Wnt signaling pathway (e.g. CYPs TPO HPX HFE SLCs WNTs). We also identified several genes involved in lipid metabolism (e.g. NCR1 TNF UCP3) and oxidative stress (e.g. TPO SGK2 MTHFR) that may be indirectly related to heme-toxicity. The study™s results provide preliminary evidence that heme-iron toxicity might be one underlying mechanism linking fresh red meat intake and lung cancer. Proc Natl Acad Sci U S A Proc. Natl. Acad. Sci. U.S.A pnas pnas PNAS Proceedings of the National Academy of Sciences of the United States of America 0027-8424 1091-6490 National Academy of Sciences 24550319 3932924 201320956 10.1073/pnas.1320956111 PNAS Plus Biological Sciences Medical Sciences PNAS Plus Mapping the molecular determinants of BRAF oncogene dependence in human lung cancer BRAF oncogene dependence in NSCLC Lin Luping a b Asthana Saurabh a b Chan Elton a b Bandyopadhyay Sourav b Martins Maria M. b Olivas Victor a b Yan Jenny Jiacheng a b Pham Luu b Wang Mingxue Michelle b Bollag Gideon c Solit David B. d Collisson Eric A. a b Rudin Charles M. e Taylor Barry S. a b f Bivona Trever G. a b 1 Departments of aMedicine and fEpidemiology and Biostatistics and bHelen Diller Family Comprehensive Cancer Center University of California San Francisco CA 94158; cPlexxikon Inc. Berkeley CA 94710; dHuman Oncology and Pathogenesis Program and eThoracic Oncology Service Memorial Sloan“Kettering Cancer Center New York NY 10065 1To whom correspondence should be addressed. E-mail: trever.bivonaucsf.edu. Edited by Arthur Weiss University of California San Francisco CA and approved January 15 2014 (received for review November 6 2013) Author contributions: L.L. G.B. D.B.S. E.A.C. C.M.R. B.S.T. and T.G.B. designed research; L.L. E.C. S.B. M.M.M. V.O. J.J.Y. L.P. and M.M.W. performed research; C.M.R. contributed new reagents/analytic tools; L.L. S.A. S.B. and B.S.T. analyzed data; and L.L. B.S.T. and T.G.B. wrote the paper. 18 2 2014 3 2 2014 111 7 E748 E757 Significance Oncogenic mutations in the BRAF kinase occur in 6“8% of nonsmall cell lung cancers (NSCLCs) but the biological and clinical relevance of these mutations is unclear. We uncovered mechanisms of resistance to BRAF inhibition in NSCLC using an integrated functional chemical genetics approach in human BRAF-mutant NSCLC cells and clinical specimens. Our results provide biological insights into the regulation of BRAF oncogene dependence and identify strategies to optimize outcomes in BRAF-mutant NSCLC patients. Oncogenic mutations in the BRAF kinase occur in 6“8% of nonsmall cell lung cancers (NSCLCs) accounting for more than 90000 deaths annually worldwide. The biological and clinical relevance of these BRAF mutations in NSCLC is incompletely understood. Here we demonstrate that human NSCLC cells with BRAFV600E but not other BRAF mutations initially are sensitive to BRAF-inhibitor treatment. However these BRAFV600E NSCLC cells rapidly acquire resistance to BRAF inhibition through at least one of two discrete molecular mechanisms: (i) loss of full-length BRAFV600E coupled with expression of an aberrant form of BRAFV600E that retains RAF pathway dependence or (ii) constitutive autocrine EGF receptor (EGFR) signaling driven by c-Jun“mediated EGFR ligand expression. BRAFV600E cells with EGFR-driven resistance are characterized by hyperphosphorylated protein kinase AKT"

Lung_Cancer

"Subsequently the principal investigator will report back to clinic A patients with estimated lung cancer risks (session 3). To ensure balance in the control clinic the principal investigator will also attend Clinic B sessions 2 and 3 (see flow charts). ¢At the eight week clinic and the 6-month follow-up clinic smoking cessation status and carbon monoxide breath test score will be recorded and a feedback questionnaire used to assess efficacy of various components will be administered. Mailing 4. Telephone calls followed by letters to patients with invitation to 6-month follow-up session with NHS Smoking Cessation Practitioners and the principal investigator when cessation rate will be assessed and verified by repeating the carbon monoxide breath and salivary cotinine tests. “ for further details see : flow charts Timeline of project. Flow chart for the duration of the trial. a. Flow chart of project from start to week 12. b. Flow chart of project to week 36. We anticipate good attendance at the eight week free smoking cessation clinic as would be expected if it were a regular NHS smoking cessation clinic but the attendance at the 6-month follow-up clinic may be more challenging. We consider this attendance essential and as attendance will take up an evening of their time study participants should be paid for their travel expenses (£20) and will receive up to three reminders. Group B subjects attending at the 6-month follow up who have been unable to quit will be offered the gene-based test at this stage. Technique for taking the respiragene test The test requires a Buccal swab and the subjects should not eat or drink within 15 minutes prior to supplying a sample (if has eaten or taken a drink within 15 minutes then rinse mouth with tap water). The nurse taking the sample should wear latex or plastic gloves and take care to avoid contact with the buccal swab collection tip to avoid DNA (deoxyribonucleic acid) contamination. Then: 1. Open buccal swab package at the handle end and carefully remove the swab. 2. Holding handle end of swab stick scrape the collection tip firmly against the inside of the cheek 5-6 times (about 10 seconds) being careful not to press the plunger that ejects the tip. 3. After taking the sample eject the swab tip into a labelled 2 ml microcentrifuge tube by firmly pressing the plunger at the end of the handle. 4. Complete and affix the sample tube label onto the microtube. The sample label requires the anonymised trial code for the subject. Storage of the respiragene test After sample collection tips can be kept at room temperature if they are posted immediately. If storage is necessary freeze the tubes containing the tips at -20°C. Packaging instructions for return of samples to Lab21 Ltd 1. Place absorbent material around the tube and then place tube in the plastic bag provided with the kit. Seal the plastic back as per the instructions on the bag 2. Place the plastic bag containing the sample tube into the shipping box. 3. Seal the box with the security seal supplied. 4. Using the Freepost service provided send the samples to: Lab 21 184 Cambridge Science Park Cambridge CB4 0GA. Patients will be asked to sign a disclaimer form that explains clearly that this test can only give an estimation of cancer risk and is a test that is still under development (one copy of form for investigators and one for patient). Interpretation of result of respiragene test Lung cancer susceptibility is calculated using the Respiragene test Auckland formula [7]: Lung cancer score?=?(number of susceptible genotypes) - (number of protective genotypes)?+?3 (for positive family history)?+?4 (for past history of COPD)?+?4 (for age?>?60 years old). The laboratory reports include the scores with an explanation of how the scores relate to a risk category (see ). When the subject is aged <60 years the report will also include the score and risk category that would apply if the subject is still a smoker at age 60 years or over. Follow-up questionnaires The questionnaires will be slightly different for groups A (questionnaire 2a) and B (questionnaire 2b) as only 2a will contain a direct reference to the gene-based test. Patients who fail to attend at eight weeks and six months will be contacted by telephone to remind them to complete their questionnaires and hand them in to the practice manager."

Lung_Cancer

"Although PLC may be present in liver carcinoma patients these patients might die as a result of other causes such as liver failure or hemorrhage due to cancer rupture before the typical symptoms of PLC manifest. On the basis of our experience and previous reports clinicians should exclude PLC when patients develop hypoxemia and interstitial pneumonia of unknown cause. PLC may cause significant deterioration of the patient™s condition. Thus only early identification diagnosis and treatment can prolong the survival of liver carcinoma patients with PLC. Conclusions Although PLC is rare in liver carcinoma patients cancer cells can migrate into the pulmonary lymphatic system. Early identification diagnosis and treatment are crucial to improving the survival of PLC patients. Combined use of CT PET-CT and pathologic examinations may significantly increase the PLC detection rate. In our patient immunosuppressive therapy after liver transplantation caused rapid progression of PLC. Although we discontinued immunosuppressive therapy employed strategies to improve the patient™s lung edema and administered antitumor therapy the efficacy of the treatment was still very poor. Consent Written informed consent was obtained from the patient for publication of this case report and any accompanying images. A copy of the written consent is available for review by the Editor-in-Chief of this journal. Abbreviations LT: Liver transplantation; PET-CT: Positron emission tomography/computed tomography; PLC: Pulmonary lymphangitic carcinomatosis. Competing interests The authors declare that they have no competing interests. Authors™ contributions Li Zhuang carried out clinical data collection participated in the sequence alignment and drafted the manuscript. XL and CH carried out pathological analysis. Lin Zhang and GJ carried out clinical data collection JW and SZ carried out pathological analysis. All authors read and approved the final manuscript. Acknowledgements This work is supported by grants from the Zhejiang Medicines and Health Technologies Program (201350072) and the National Natural Science Foundation of China (NSFC 81000962). Grossman EJ Millis JM Liver transplantation for non-hepatocellular carcinoma malignancy: indications limitations and analysis of the current literature Liver Transpl 2010 16 930 942 10.1002/lt.22106 20677284 Bruce DM Heys SD Eremin O Lymphangitis carcinomatosa: a literature review J R Coll Surg Edinb 1996 41 7 13 8930034 Zhang K Huang Y [Clinical features and diagnosis of pulmonary lymphangitic carcinomatosis [in Chinese] Ai Zheng 2006 25 1127 1130 16965655 Otsubo K Kubo N Nakashima N Izumi M Nakamori M Koto H A juvenile case of pulmonary lymphangitic carcinomatosis caused by sigmoid colon cancer with a component of micropapillary carcinoma Intern Med 2011 50 2361 2365 10.2169/internalmedicine.50.5170 22001466 Wallach JB McGarry T Torres J Lymphangitic metastasis of recurrent renal cell carcinoma to the contralateral lung causing lymphangitic carcinomatosis and respiratory symptoms Curr Oncol 2011 18 e35 e37 21331270 Babu S Satheeshan B Geetha M Salih S A rare presentation of pulmonary lymphangitic carcinomatosis in cancer of lip: case report World J Surg Oncol 2011 9 77 10.1186/1477-7819-9-77 21756338 Katyal S Oliver JH 3rd Peterson MS Ferris JV Carr BS Baron RL Extrahepatic metastases of hepatocellular carcinoma Radiology 2000 216 698 703 10.1148/radiology.216.3.r00se24698 10966697 Molina DK Valente PT Lymphangitic spread of hepatocellular carcinoma Arch Pathol Lab Med 2003 127 e11 e13 12562285 Shin NY Hong YJ Kim AH Shim HS Nam JE Lee HJ Kim MJ Diffuse interstitial infiltrative lung metastasis of malignant melanoma: a case report Korean J Radiol 2011 12 252 255 10.3348/kjr.2011.12.2.252 21430944 Acikgoz G Kim SM Houseni M Cermik TF Intenzo CM Alavi A Pulmonary lymphangitic carcinomatosis (PLC): spectrum of FDG-PET findings Clin Nucl Med 2006 31 673 678"

Lung_Cancer

"however excellent staining in MLM was significantly higher than methylene blue (81% vs 38% P=0.011) (). shows the localization ability of MLM regarding both staining ability and radio-opacity. There was no subject with a score of 0 or 1 in both radio-opacity and staining. MLM achieved appropriate staining or radio-opacity in 21 subjects (100%) with a dual localization feature. Histopathologic findings demonstrates the results of the histopathologic findings. In all lung specimens both methylene blue and MLM showed acute lung parenchymal change that included neutrophil infiltration hemorrhage and foam cell in alveolus (Fig. 4). Comparing the two materials the number of specimen having neutrophil infiltration vasculitis necrosis hemorrhage and foam cell in alveolus was similar in each extent. In terms of all features the number of specimen that showed diffuse extent was more in Group B than Group A for both MLM and methylene blue. The extent of the histopathologic findings was not significantly associated with the materials for all histopathologic features (). Among the histopathologic findings the extent of vasculitis was significantly associated with Group for both MLM and methylene blue (P=0.002 for both MLM and methylene blue). Focal or diffuse extent of vasculitis was more frequently found in Group A than Group B (P=0.001 for both MLM and methylene blue). The overall severity of lung parenchymal change was not different between MLM and methylene blue (5.6±1.6 vs 5.7±1.5 P=0.839); in addition Group B showed a significantly higher overall severity score of lung parenchymal change than Group A (6.6±1.6 vs 4.7±0.9 P=0.005). DISCUSSION The results of this study show that MLM is a useful percutaneous injection material for a successful localization in the lung. The average staining score of MLM was significantly higher than methylene blue (2.8±0.5 vs 2.2±0.7 P=0.010). In terms of staining the appropriate localization rate (acceptable or excellent staining) in our study was 95% using MLM. The result was in close agreement with previous studies that showed a high success performance rate of lipiodol localization (99%-100%) (21-23). An appropriate localization rate (acceptable or excellent staining) of methylene blue injection was 86% in our study. This is lower than the results found in previous studies where the success rate of methylene blue injection was 96%-100% (18 20). We found that an acceptable (or excellent staining rate) of MLM and methylene blue was not significantly different (95% vs 86% P=0.610). However MLM showed excellent staining for localization in 17 (81%) of 21 subjects and was significantly higher than methylene blue (38%) (P=0.011). The results indicate that lipiodol reduced the spread of methylene blue. This is the first study to indicate that MLM is an available percutaneous injection material for localization with superior staining ability compared to methylene blue. The complication rate was 43% in MLM and 5% in the methylene blue (P=0.004). Possible complications after percutaneous injection for pulmonary localization include pneumothorax leakage hemorrhage pain hemoptysis hemothorax and embolism. Previous studies reported that the complication rate was 17-29% for lipiodol and 33% for methylene blue (2023 24). The complication rate of MLM in the current study was higher than the results of previous studies mainly due to the leakage of MLM into the pleural cavity (n=9). This difference was probably because the distance from the pleura to the injecting needle tip (0.4±0.1 cm for MLM) was inadequate to avoid leakage into the pleural cavity. In the previous studies of lipiodol marking for localization the mean distance from the pleura to the target nodule was 1.0-1.9 cm (22-24) more than twice our study. The results indicate that the high complication rate of our study is associated with the inserting procedure of the needle rather than MLM itself. The dispersion of methylene blue throughout the lung parenchyma may lead to unnecessarily large wedge resections; in addition some have reported instances of the dispersion of methylene blue throughout the entire pleural surface or intraoperative identification failure due to severe anthracosis of the visceral pleura. The failure rate was reported to be 0%-13% with the use of methylene blue (1819 25). The results are similar to our study and indicate that inappropriate staining on the lung surface was 14% in methylene blue. In this study we found that the dispersion of methylene blue in MLM through the lung parenchyma was significantly smaller than methylene blue (0.6±0.3 cm vs 1.0±0.4 cm P<0.05). The result implies that lipiodol reduces the spread of methylene blue in lung parenchyma. Regarding the score of radio-opacity 38% of MLM showed non-visualization or minimally increased opacity on the fluoroscopic examinations. It means the proportion of lipiodol in MLM at the time of the percutaneous injection was too small to be detected. Post-procedural CT images also revealed that 3 subjects had small faint radio-opacity after the injection of MLM. It suggests that the uneven blending of lipiodol and methylene blue occurred during the preparation of MLM. Water-insolubility of lipiodol would result in the uneven mixing of water soluble methylene blue after mechanical blending of the two materials. Further research is required to reduce non-homogeneity of MLM at the time of injection. Previous studies reported the availability of a mixture of methylene blue with other materials such as collagen or autologous blood (15 16). They performed VATS resection on the same day as localization. In our study we evaluated the localization ability of MLM on the same day of localization (6 hr) as well as 24 hr after injection. Localization is usually performed on the day of surgery. This requires the simultaneous use of the CT and the operating room which is not always available. Surgeries on the next day of localization were reported in several published s (26 27). MLM shows a prolonged localization ability of up to 24 hr in terms of staining ability and radio-opacity. Stable localization ability is the advantage of MLM in our study. Due to uneven blending of MLM one subject (10%) showed inappropriate staining and appropriate radio-opacity and required an intraoperative fluoroscopic examination to detect MLM. Possible radiation exposure is a drawback of MLM. We would like to justify the use of intraoperative fluoroscopy because the operator can avoid radiation exposure with a lead apron. In regards to the risk-benefit for patients lowering the risk of detection failure is thought to be more important than radiation exposure. Histopathologic examinations showed lung parenchymal changes in all specimens. Both methylene blue and MLM induced acute lung injury that included neutrophil infiltration vasculitis necrosis hemorrhage and foam cell in alveolus (). The results of our study are similar to those of a previous study by Kwon et al. (28) that showed that lipiodol led to acute lung injury. They described that lipiodol creates the histopathologic feature of acute lung injury such as peripheral endothelial cell damage neutrophil infiltration necrosis hemorrhage alveolar wall destruction vasculitis emboli (or thrombi in arteriole) and macrophages in the alveolar space (28). In our results the extent of lung parenchymal change was not associated with the materials for all histopathologic features. In addition the overall severity score of lung parenchymal change in MLM was not different from methylene blue (5.6 and 5.7 P=0.839). This suggests that MLM shows similar histopathologic effects in the lung parenchyma to methylene blue. The overall severity score of parenchymal change was higher in Group B (follow up interval of 24 hr) than Group A (follow up interval of 6 hr) (6.6 vs 4.7 P=0.005). The extent of lung parenchymal change depends on the time interval. Acute lung injury after the percutaneous injection of lipiodol or methylene blue was reported in animal studies (28 29); however there are no clinical results that show the adverse effect of acute lung injury in human lungs. Injection material (such as barium) can potentially complicate the pathologic diagnosis of the target lesion due to acute inflammation (29 30). To our knowledge no study has indicated that lipiodol or methylene blue hinders the histopathologic diagnosis of target lesions in human lungs. The small amount of material injection in human lungs might not create a significant parenchymal change or disrupt underlying lung disease. It is necessary to avoid directly injecting materials into the target lesion in human lungs in order to avoid the adverse effect of injection materials on underlying lung disease (especially ground glass opacity nodule or potential benign lesion). There were several limitations in our study. First we included only a small number of subjects. Second the overall localization success rate was low and the complication rate was high (compared to the results of previous studies) due to the difficulty in an accurate percutaneous injection at the desired location and depth in the small sized rabbit lung. Third we used a 1 mL syringe with manual administration to inject materials in the lung parenchyma and there were possible individual difference in the administering volume of materials. Fourth we could not evaluate complications such as intractable pain material related anaphylaxis or embolism. Fifth we could not evaluate if the histopathologic changes had any effect on underlying lung disease because the lung parenchyma of the experimental rabbits were normal. Finally we did not evaluate a successful localization for the true target lesion in lung parenchyma. The criteria for appropriate staining and radio-opacity were subjective. We expect that further clinical studies might provide an answer to if MLM can be a useful percutaneous injection material for localization in the human lung. In conclusion MLM is available for percutaneous injection for the pulmonary localization. The results of this study showed that MLM provides superior ability for appropriate localization than that of methylene blue. Further research on human lungs can clarify the availability of MLM as a CT guided percutaneous injection material. This study was supported by grant from the Seoul National University College of Medicine Research Fund 2012 (800-20120036). We have no potential conflicts of interest or commercial involvement to disclose. 1 Nakashima S Watanabe A Obama T Yamada G Takahashi H Higami T Need for preoperative computed tomography-guided localization in video-assisted thoracoscopic surgery pulmonary resections of metastatic pulmonary nodules Ann Thorac Surg 2010 89 212 218 20103238 2 Chen S Zhou J Zhang J Hu H Luo X Zhang Y Chen H Video-assisted thoracoscopic solitary pulmonary nodule resection after CT-guided hookwire localization: 43 cases report and literature review Surg Endosc 2011 25 1723 1729 21181200 3 Ciriaco P Negri G Puglisi A Nicoletti R Del Maschio A Zannini P Video-assisted thoracoscopic surgery for pulmonary nodules: rationale for preoperative computed tomography-guided hookwire localization Eur J Cardiothorac Surg 2004 25 429 433 15019673 4 Suzuki K Nagai K Yoshida J Ohmatsu H Takahashi K Nishimura M Nishiwaki Y Video-assisted thoracoscopic surgery for small indeterminate pulmonary nodules: indications for preoperative marking Chest 1999 115 563 568 10027460 5 Seo JM Lee HY Kim HK Choi YS Kim J Shim YM Lee KS Factors determining successful computed tomography-guided localization of lung nodules J Thorac Cardiovasc Surg 2012 143 809 814 22104686 6 Gossot D Miaux Y Guermazi A Celerier M Friga J The hook-wire technique for localization of pulmonary nodules during thoracoscopic resection Chest 1994 105 1467 1469 8181339 7 Pittet O Christodoulou M Pezzetta E Schmidt S Schnyder P Ris HB Video-assisted thoracoscopic resection of a small pulmonary nodule after computed tomography-guided localization with a hook-wire system: experience in 45 consecutive patients World J Surg 2007 31 575 578 17318707 8 Chen W Chen L Yang S Chen Z Qian G Zhang S Jing J A novel technique for localization of small pulmonary nodules Chest 2007 131 1526 1531 17494801 9 Bernard A Resection of pulmonary nodules using video-assisted thoracic surgery: the Thorax Group Ann Thorac Surg 1996 61 202 204 8561553 10 Martin AE Chen JY Muratore CS Mayo-Smith WW Luks FI Dual localization technique for thoracoscopic resection of lung lesions in children J Laparoendosc Adv Surg Tech A 2009 19 S161 S164 18999984 11 Kawanaka K Nomori H Mori T Ikeda K Ikeda O Tomiguchi S Yamashita Y Marking of small pulmonary nodules before thoracoscopic resection: injection of lipiodol under CT-fluoroscopic guidance Acad Radiol 2009 16 39 45 19064210 12 Yamagami T Miura H Yoshimatsu R Tanaka O Ono S Iehara T Hosoi H Nishimura T Experience of fluoroscopy-aided thoracoscopic resection of pulmonary nodule localised with Lipiodol in a child J Med Imaging Radiat Oncol 2011 55 401 403 21843175 13 Iwasaki Y Nagata K Yuba T Hosogi S Kohno K Ohsugi S Kuwahara H Takemura Y Yokomura I Fluoroscopy-guided barium marking for localizing small pulmonary lesions before video-assisted thoracic surgery Respir Med 2005 99 285 289 15733503 14 Yoshida J Nagai K Nishimura M Takahashi K Computed tomography-fluoroscopy guided injection of cyanoacrylate to mark a pulmonary nodule for thoracoscopic resection Jpn J Thorac Cardiovasc Surg 1999 47 210 213 10402768 15 Nomori H Horio H Colored collagen is a long-lasting point marker for small pulmonary nodules in thoracoscopic operations Ann Thorac Surg 1996 61 1070 1073 8607658 16 McConnell PI Feola GP Meyers RL Methylene blue-stained autologous blood for needle localization and thoracoscopic resection of deep pulmonary nodules J Pediatr Surg 2002 37 1729 1731 12483642 17 Hu J Zhang C Sun L Localization of small pulmonary nodules for videothoracoscopic surgery ANZ J Surg 2006 76 649 651 16813634 18 Wicky S Mayor B Cuttat JF Schnyder P CT-guided localizations of pulmonary nodules with methylene blue injections for thoracoscopic resections Chest 1994 106 1326 1328 7956378 19 Vandoni RE Cuttat JF Wicky S Suter M CT-guided methylene-blue labelling before thoracoscopic resection of pulmonary nodules Eur J Cardiothorac Surg 1998 14 265 270 9761435 20 Lenglinger FX Schwarz CD Artmann W Localization of pulmonary nodules before thoracoscopic surgery: value of percutaneous staining with methylene blue AJR Am J Roentgenol 1994 163 297 300 7518642 21 Ikeda K Nomori H Mori T Kobayashi H Iwatani K Yoshimoto K Kawanaka K Impalpable pulmonary nodules with ground-glass opacity: success for making pathologic sections with preoperative marking by lipiodol Chest 2007 131 502 506 17296654 22 Nomori H Horio H Naruke T Suemasu K Fluoroscopy-assisted thoracoscopic resection of lung nodules marked with lipiodol Ann Thorac Surg 2002 74 170 173 12118752 23 Watanabe K Nomori H Ohtsuka T Kaji M Naruke T Suemasu K Usefulness and complications of computed tomography-guided lipiodol marking for fluoroscopy-assisted thoracoscopic resection of small pulmonary nodules: experience with 174 nodules J Thorac Cardiovasc Surg 2006 132 320 324 16872957 24 Kim YD Jeong YJ I H Cho JS Lee JW Kim HJ Lee SH Kim DH Localization of pulmonary nodules with lipiodol prior to thoracoscopic surgery Acta Radiol 2011 52 64 69 21498328 25 Mayo JR Clifton JC Powell TI English JC Evans KG Yee J McWilliams AM Lam SC Finley RJ Lung nodules: CT-guided placement of microcoils to direct video-assisted thoracoscopic surgical resection Radiology 2009 250 576 585 19188326 26 Lee NK Park CM Kang CH Jeon YK Choo JY Lee HJ Goo JM CT-guided percutaneous transthoracic localization of pulmonary nodules prior to video-assisted thoracoscopic surgery using barium suspension Korean J Radiol 2012 13 694 701 23118567 27 Kamiyoshihara M Ishikawa S Morishita Y Pulmonary cryptococcosis diagnosed by video-assisted thoracoscopic surgery with CT-guided localization: report of a case Kyobu Geka 2000 53 795 797 10935411 28 Kwon WJ Kim HJ Jeong YJ Lee CH Kim KI Kim YD Lee JH Direct lipiodol injection used for a radio-opaque lung marker: stability and histopathologic effects Exp Lung Res 2011 37 310 317 21574876 29 Jang HS Effect of drugs for preoperative localization of thoracoscopy to histopathologic change in rabbit lung Seoul the Catholic University of Korea 2000 27 Dissertation 30 Okumura T Kondo H Suzuki K Asamura H Kobayashi T Kaneko M Tsuchiya R Fluoroscopy-assisted thoracoscopic surgery after computed tomography-guided bronchoscopic barium marking Ann Thorac Surg 2001 71 439 442 11235684 Fig. 1 Overview of the experimental design. Animals were randomly divided into two groups: Group A (n = 12) was sacrificed 6 hr after percutaneous injection and Group B (n = 12) was sacrificed 24 hr after a CT guided percutaneous injection of MLM and methylene blue. Fig. 2 Examples of evaluation of staining on the lung surface. Photographs show (A) the extensive staining (score 1) (B) localized dispersion of staining (score 2) and (C) minimal dispersion of staining (score 3). The white lines on the bottom of the figure are markings of the ruler. The distance between two lines is one centimeter. Fig. 3 Examples of assessment of radio-opacity on the fluoroscopic examinations. The fluoroscopic images show (A) a minimally increased opacity (arrow) (score 1) (B) a low density of increased opacity (arrow) (score 2) and (C) a compact nodular increased opacity (arrow) (score 3). Fig. 4 CT and corresponding photomicrograph of lung specimen. MLM in Group B (A-D); (A) discrete and compact nodular opacity (arrowheads) (B) focal neutrophil infiltration necrosis and hemorrhage (arrowheads) (H&E ×12.5) (C) scattered small nodular opacities of lipiodol (long arrows) and faint nodular opacity (arrowheads) (D) focal hemorrhage and necrosis (arrowheads) with diffuse neutrophil infiltration (short arrows) (H&E ×12.5). MLM in Group A (E F); (E) faint nodular lipiodol opacity (arrows) (F) focal hemorrhage (arrows) with diffuse neutrophil infiltration (arrowheads) (H&E ×12.5). Methylene blue in Group A (G H); (G) faint nodular opacity (arrowheads) and (H) focal extent of neutrophil infiltration necrosis and hemorrhage (arrowheads) (H&E ×12.5). Table 1 Staining extent and localization ability of MLM versus methylene blue Data are mean±standard deviation. Numbers in parentheses are ranges. N/A indicates not available. *Non-parametric Mann-Whitney test was performed to compare the average score of MLM and methylene blue. MLM mixture of lipiodol and methylene blue. Table 2 Localization ability score of staining and radio-opacity for MLM as well as methylene blue Data are numbers of subjects. Numbers in parentheses are percentages. MLM mixture of lipiodol and methylene blue. Comparison of localization ability between MLM and methylene blue in total subjects (n = 42) We considered a score of 2 or 3 as appropriate and 3 as excellent for localization respectively. Numbers in parentheses are percentages. *Fisher's exact test compared the proportion of appropriate or excellent staining between the mixture and methylene blue. MLM mixture of lipiodol and methylene blue. Localization ability of MLM: Evaluation of radio-opacity and staining score Data are given as numbers of subjects. Numbers in parentheses are percentages. MLM mixture of lipiodol and methylene blue. Histopathologic findings of lung specimens after percutaneous injections Data are numbers of subjects. Numbers in parentheses are percentages. N/A indicates not available. *Linear by linear association was performed between material and the extent of the histopathologic findings. € Linear by linear association was performed between groups and the extent of the histopathologic findings. MLM mixture of lipiodol and methylene blue. PLoS One PLoS ONE plos plosone PLoS ONE 1932-6203 Public Library of Science San Francisco USA 24819391 4018408 PONE-D-13-46027 10.1371/journal.pone.0096911 Research Biology and Life Sciences Biochemistry Biomarkers Genetics Heredity Medicine and Health Sciences Diagnostic Medicine Epidemiology Biomarker Epidemiology Cancer Epidemiology Health Care Environmental Health Oncology Cancer Risk Factors Environmental Causes of Cancer Pathology and Laboratory Medicine Public and Occupational Health Pulmonology Environmental and Occupational Lung Diseases Single Nucleotide Polymorphism in ATM Gene Cooking Oil Fumes and Lung Adenocarcinoma Susceptibility in Chinese Female Non-Smokers: A Case-Control Study ATM Polymorphism and Risk of Lung Adenocarcinoma Shen Li 1 2 Yin Zhihua 1 2 Wu Wei 1 2 Ren Yangwu 1 2 Li Xuelian 1 2 Zhou Baosen 1 2 * 1 Department of Epidemiology School of Public Health China Medical University Heping District Shenyang Liaoning Province China 2 Key Laboratory of Cancer Etiology and Intervention University of Liaoning Province China Chang Jeffrey S. Editor National Health Research Institutes Taiwan * E-mail: bszhou@mail.cmu.edu.cn Competing Interests: The authors have declared that no competing interests exist. Conceived and designed the experiments: LS. Performed the experiments: LS YR XL. Analyzed the data: LS WW ZY. Contributed reagents/materials/analysis tools: LS ZY XL BZ. Wrote the paper: LS. Obtained informed consent from subjects: Baosen Zhou. 2014 12 5 2014 9 5 e96911 3 11 2013 12 4 2014 2014 Shen et al This is an open-access distributed under the terms of the Creative Commons Attribution License which permits unrestricted use distribution and reproduction in any medium provided the original author and source are credited. Background The ataxia-telangiectasia mutated (ATM) gene plays an important role in the DNA double-strand breaks repair pathway. Single nucleotide polymorphisms (SNPs) of DNA repair genes are suspected to influence the risk of lung cancer. This study aimed to investigate the association between the ATM -111G>A (rs189037) polymorphism environmental risk factors and the risk of lung adenocarcinoma in Chinese female non-smokers. Methods A hospital-based case-control study of 487 lung cancer patients and 516 matched cancer-free controls was conducted. Information concerning demographic and environmental risk factors was obtained for each case and control by a trained interviewer. After informed consent was obtained 10 ml venous blood was collected from each subject for biomarker testing. Single nucleotide polymorphism was determined by using TaqMan method. Results This study showed that the individuals with ATM rs189037 AA genotype were at an increased risk for lung adenocarcinoma compared with those carrying the GA or GG genotype (adjusted odds ratios (OR) 1.44 95% confidence interval (CI) 1.02€“2.02 P?=?0.039). The stratified analysis suggested that increased risk associated with ATM rs189037 AA genotype in individuals who never or seldom were exposed to cooking oil fumes (adjusted OR 1.89 95%CI 1.03€“3.49 P?=?0.040). Conclusions ATM rs189037 might be associated with the risk of lung adenocarcinoma in Chinese non-smoking females. Furthermore ATM rs189037 AA genotype might be a risk factor of lung adenocarcinoma among female non-smokers without cooking oil fume exposure. This study was supported by grant no. 81272293 from National Natural Science Foundation of China grant no. 81102194 from National Natural Science Foundation of China and grant no. 00726 from China Medical Board. The funders had no role in study design data collection and analysis decision to publish or preparation of the manuscript. Introduction Lung cancer is the leading cause of cancer-related deaths both worldwide and in China. Although cigarette smoke is the major risk factor for lung cancer only a fraction of smokers develop this disease [1] suggesting that host genetic susceptibility may play an important role in the development of lung cancer. Recent genetic susceptibility studies of lung cancer have focused on single nucleotide polymorphisms (SNPs) in candidate genes among which DNA repair genes are increasingly studied because of their critical role in maintain genome integrity. Genetic variations in DNA repair genes are thought to affect DNA repair capacity and deficits in DNA repair capacity may lead to genetic instability and carcinogenesis [2] [3]. "

Lung_Cancer

"cells treated with thiaminase are consistent with inhibition of BCKDH complex pyruvate dehydrogenase complex and transketolase inhibition. However inhibition of the same enzyme was shown to result in different metabolic consequences in the case of BCKDH where inhibition in RS4 cells caused a demonstrable increase in BCKDH substrates whereas in MCF-7 cells inhibition led to a decrease in the products of the enzymatic reaction. This difference may then lead to different consequences on cell growth as the substrates for BCKDH are known to be toxic metabolites and result in the an toxicity in the metabolic syndrome maple syrup urine disease. We have previously shown that RS4 cells as well as other lymphoid leukemia cell lines have a biphasic dose response to thiaminase where there is an initial growth inhibition related to extracellular thiamine depletion and a cytotoxic response at higher concentrations related to intracellular thiamine depletion [7]. Gabapentin appears to be protective against the growth inhibitory effects of thiaminase in RS4 cells at the concentrations that produce extracellular thiamine depletion indicating that growth inhibition is not due solely to thiamine depletion but also to the accumulation of branched-chain amino acid catabolites. These studies demonstrate that the cell lines and presumable tumors have different metabolic consequences resulting from inhibition of the same enzymes and that these consequences may form the basis of sensitivity to TDE inhibition as well as identify potential biomarkers of response. In addition thiaminase treatment was associated with increased lipolysis and decreased polyamine synthesis (data not shown) both of which were reversed by co-treatment with rapamycin. These changes are consistent with altered energy production and reduced cellular proliferation as a result of thiamine depletion but also may be related to our previous observation that mammary tumor formation is delayed in mice fed a low-thiamine normal-fat diet but not in mice fed a low-thiamine high-fat diet [4]. Although fatty acid metabolism may be affected by inhibition of 2-hydroxyl-CoA lyase (HACL1) a peroxisomal enzyme that also requires thiamine pyrophosphate as a cofactor and mediates the catabolism of branched chain fatty acids and 2-hydroxyl straight chain fatty acids [17] we did not see any evidence for accumulation of these metabolites in either cell line. Conclusions Overall these studies demonstrate that TDE disruption leads to specific metabolic consequences that are predictable from its role as a cofactor for enzymes that catalyze important steps in energy production biomass generation and amino acid catabolism. Comparison of the changes observed with thiaminase treatment in RS4 cells versus MCF-7 cells reveals different biochemical signatures as a result of thiamine depletion that may reflect differences in the relative contributions of different pathways to energy production and anaplerotic contributions to the TCA cycle. The near-global reversal of the specific metabolic effects of thiaminase by rapamycin indicate a closer regulation of thiamine-dependent metabolism by mTOR than has been previously appreciated and further studies are needed to determine how mTOR signaling pathways regulates thiamine-dependent metabolism. The disruption of thiamine metabolism results in cytotoxicity in breast cancer and leukemia tumor model systems and has the potential to provide novel targets for therapies directed toward these malignancies. Supporting Information Figure S1 Results of metabolomic analysis for branched-chain amino acid metabolites in A.) RS4 cell line and B.) MCF7 cell cline analyzed under six conditions: control for 24 hours (C-24); incubation in thiaminase for 24 hours (T-24); control for 48 hours (C-48); thiaminase for 48 hours (T-48); rapamycin for 48 hours (R-48); and both rapamycin and thiaminase for 48 hours (R+T-48). The median is indicated by the bar in the center of the rectangle the rectangle dimensions reflect the range of the two mid-quartile values and the outer bars represent the ranges of all of the values. The data represent four independent experiments. For C-48 vs T-48 and C-48 vs T+R-48 comparisons ** indicates p<0.05 and * indicates 0.05<p<0.1). (TIF) Click here for additional data file. Table S1 Metabolomic pathway heat map data for RS4 and MCF-7 cells treated with thiaminase (T) rapamycin (R) or both (R+T) for 24 and 48 hours. (XLSX) Click here for additional data file. The authors thank the Research Communication Office of the Markey Cancer Center at the University of Kentucky for editorial and graphics assistance. This work was supported by DanceBlue an effort of the University of Kentucky student community to support pediatric oncology care and research. References 1 ZastreJA SweetRL HanberryBS YeS (2013) Linking vitamin B1 with cancer cell metabolism. Cancer & Metabolism1: 1“1424280107 2 LiuS HuangH LuX GolinskiM ComesseS et al (2003) Down-regulation of thiamine transporter THTR2 gene expression in breast cancer and its association with resistance to apoptosis. Mol Cancer Res1: 665“67312861052 3 LiuS StrombergA TaiHH MoscowJA (2004) Thiamine transporter gene expression and exogenous thiamine modulate the expression of genes involved in drug and prostaglandin metabolism in breast cancer cells. Mol Cancer Res2: 477“48715328374 4 Daily A Liu S Bhatnagar S Karabakhtsian RG Moscow JA (2013) Low thiamine diet increases mammary tumor latency in FVB/N-Tg(MMTVneu) mice. Int J Vitamin Nutrition Res In press. 5 CostelloCA KelleherNL AbeM McLaffertyFW BegleyTP (1996) Mechanistic studies on thiaminase I. Overexpression and identification of the active site nucleophile. J Biol Chem271: 3445“34528631946 6 LiuS BaeY LeggasM DailyA BhatnagarS et al (2012) Pharmacologic properties of polyethylene glycol-modified Bacillus thiaminolyticus thiaminase I enzyme. J Pharmacol Exp Ther341: 775“78322431205 7 DailyA LiuS BaeY BhatnagarS MoscowJA (2011) Linear chain PEGylated recombinant Bacillus thiaminolyticus thiaminase I enzyme has growth inhibitory activity against lymphoid leukemia cell lines. Mol Cancer Ther10: 1563“157021697396 8 LiuS MonksNR HanesJW BegleyTP YuH et al (2010) Sensitivity of breast cancer cell lines to recombinant thiaminase I. Cancer Chemother Pharmacol. 66: 171“179 9 HassaneDC SenS MinhajuddinM RossiRM CorbettCA et al (2010) Chemical genomic screening reveals synergism between parthenolide and inhibitors of the PI-3 kinase and mTOR pathways. Blood116: 5983“599020889920 10 EvansAM DeHavenCD BarrettT MitchellM MilgramE (2009) Integrated nontargeted ultrahigh performance liquid chromatography/electrospray ionization tandem mass spectrometry platform for the identification and relative quantification of the small-molecule complement of biological systems. Anal Chem81: 6656“666719624122 11 OhtaT MasutomiN TsutsuiN SakairiT MitchellM et al (2009) Untargeted metabolomic profiling as an evaluative tool of fenofibrate-induced toxicology in Fischer 344 male rats. Toxicol Pathol37: 521“53519458390 12 DehavenCD EvansAM DaiH LawtonKA (2010) anization of GC/MS and LC/MS metabolomics data into chemical libraries. J Cheminform2: 920955607 13 Le HuerouY GunawardanaI ThomasAA BoydSA de MeeseJ et al (2008) Prodrug thiamine analogs as inhibitors of the enzyme transketolase. Bio Med Chem Lett18: 505“50818083562 14 ThomasAA Le HuerouY De MeeseJ GunawardanaI KaplanT et al (2008) Synthesis in vitro and in vivo activity of thiamine antagonist transketolase inhibitors. Bio Med Chem Lett18: 2206“221018267359 15 HutsonSM BerkichD DrownP XuB AschnerM et al (1998) Role of branched-chain aminotransferase isoenzymes and gabapentin in neurotransmitter metabolism. J Neurochem71: 863“8749681479 16 SantraS BaumannU (2008) Experience of nitisinone for the pharmacological treatment of hereditary tyrosinaemia type 1. Expert Opin Pharmacother9: 1229“123618422479 17 CasteelsM SniekersM FraccasciaP MannaertsGP Van VeldhovenPP (2007) The role of 2-hydroxyacyl-CoA lyase a thiamin pyrophosphate-dependent enzyme in the peroxisomal metabolism of 3-methyl-branched fatty acids and 2-hydroxy straight-chain fatty acids. Biochem Soc Trans35: 876“88017956236 9502500 8794 Clin Cancer Res Clin. Cancer Res. Clinical cancer research : an official journal of the American Association for Cancer Research 1078-0432 24536073 3962777 10.1158/1078-0432.CCR-13-0583 NIHMS557917 Article NEW STRATEGIES FOR TRIPLE NEGATIVE BREAST CANCER “ DECIPHERING THE HETEROGENEITY Mayer Ingrid A. 1 3 Abramson Vandana G. 1 3 Lehmann Brian D. 2 3 Pietenpol Jennifer A. 2 3 1Department of Medicine Vanderbilt University School of Medicine Nashville TN 2Department of Cancer Biology Vanderbilt University School of Medicine Nashville TN 3Breast Cancer Research Program Vanderbilt-Ingram Cancer Center Vanderbilt University School of Medicine Nashville TN Corresponding author: Ingrid A. Mayer Div. Hematology/Oncology VUMC 2220 Pierce Avenue 777 PRB Nashville TN 37232-6307 Tel: 615 936 3524 Fax: 615 343-7602 ingrid.mayer@vanderbilt.edu 11 3 2014 15 2 2014 15 2 2015 20 4 782 790 Triple-negative breast cancer (TNBC) is a heterogeneous disease; gene expression (GE) analyses recently identified six distinct TNBC subtypes each displaying a unique biology. Exploring novel approaches to treatment of these subtypes is critical since less than 30% of women with metastatic breast cancer survive five years and virtually all women with metastatic TNBC will ultimately die of their disease despite systemic therapy. To date not a single targeted therapy has been approved for the treatment of TNBC and cytotoxic chemotherapy remains the standard treatment. We will discuss the current and upcoming therapeutic strategies being explored in an attempt to œtarget TNBC. J Womens Health (Larchmt) J Womens Health (Larchmt) jwh Journal of Women's Health 1540-9996 1931-843X Mary Ann Liebert Inc. 140 Huguenot Street 3rd FloorNew Rochelle NY 10801USA 24372085 4011422 10.1089/jwh.2013.4516 10.1089/jwh.2013.4516 Original Articles Perceived Versus Objective Breast Cancer Breast Cancer Risk in Diverse Women Fehniger Julia MD 1 2 Livaudais-Toman Jennifer PhD 1 Karliner Leah MD 1 3 Kerlikowske Karla MD 34 5 Tice Jeffrey A. MD 1 3 Quinn Jessica MS 1 Ozanne Elissa PhD 6 Kaplan Celia P. DrPH MA 1 3 1Department of Medicine Division of General Internal Medicine University of California San Francisco California. 2Department of Obstetrics and Gynecology University of California San Francisco California. 3Helen Diller Family Comprehensive Cancer Center University of California San Francisco California. 4General Internal Medicine Section Department of Veterans Affairs University of California San Francisco California. 5Departments of Medicine and Epidemiology and Biostatistics University of California San Francisco California. 6Institute for Health Policy Studies and Department of Surgery University of California San Francisco California. Address correspondence to: Celia P. Kaplan DrPH MA Helen Diller Family Comprehensive Cancer Center University of California San Francisco 3333 California Street Box 0856 San Francisco CA 94143 E-mail: celia.kaplan@ucsf.edu 01 5 2014 23 5 420 427 Copyright 2014 Mary Ann Liebert Inc. 2014 Abstract Background: Prior research suggests that women do not accurately estimate their risk for breast cancer. Estimating and informing women of their risk is essential for tailoring appropriate screening and risk reduction strategies. Methods: Data were collected for BreastCARE a randomized controlled trial designed to evaluate a PC-tablet based intervention providing multiethnic women and their primary care physicians with tailored information about breast cancer risk. We included women ages 40“74 visiting general internal medicine primary care clinics at one academic practice and one safety net practice who spoke English Spanish or Cantonese and had no personal history of breast cancer. We collected baseline information regarding risk perception and concern. Women were categorized as high risk (vs. average risk) if their family history met criteria for referral to genetic counseling or if they were in the top 5% of risk for their age based on the Gail or Breast Cancer Surveillance Consortium Model (BCSC) breast cancer risk model. Results: Of 1261 participants 25% (N=314) were classified as high risk. More average risk than high risk women had correct risk perception (72% vs. 18%); 25% of both average and high risk women reported being very concerned about breast cancer. Average risk women with correct risk perception were less likely to be concerned about breast cancer (odds ratio [OR]=0.3; 95% confidence interval [CI]=0.2“0.4) while high risk women with correct risk perception were more likely to be concerned about breast cancer (OR=5.1; 95%CI=2.7“9.6). Conclusions: Many women did not accurately perceive their risk for breast cancer. Women with accurate risk perception had an appropriate level of concern about breast cancer. Improved methods of assessing and informing women of their breast cancer risk could motivate high risk women to apply appropriate prevention strategies and allay unnecessary concern among average risk women. Clin Exp Immunol Clin. Exp. Immunol cei Clinical and Experimental Immunology 0009-9104 1365-2249 Blackwell Science Inc Oxford UK 24654775 4226594 10.1111/cei.12332 Original Articles Spontaneous antibodies against Engrailed-2 (EN2) protein in patients with prostate cancer Annels N E * Simpson G R * Denyer M * McGrath S E * Falgari G * Killick E   Eeles R   Stebbing J ¡ Pchejetski D ¡ Cutress R § Murray N § Michael A * Pandha H * * Oncology Faculty of Health and Medical Sciences University of Surrey Guildford Surrey UK   Institute of Cancer Research Sutton Surrey UK ¡ Charing Cross Hospital London Hampshire UK § University Hospital Southampton Southampton Hampshire UK H. Pandha Oncology Faculty of Health and Medical Sciences Leggett Building University of Surrey Guildford Surrey GU2 7WG UK. E-mail: h.pandha@surrey.ac.uk 8 2014 09 7 2014 177 2 428 438 16 3 2014 © 2014 British Society for Immunology 2014 We reported the expression of the homeodomain-containing transcription factor Engrailed-2 (EN2) in prostate cancer and showed that the presence of EN2 protein in the urine was highly predictive of prostate cancer. This study aimed to determine whether patients with prostate cancer have EN2 autoantibodies what the prevalence of these antibodies is and whether they are associated with disease stage. The spontaneous immunoglobulin (Ig)G immune response against EN2 and for comparison the tumour antigen New York Esophageal Squamous Cell Carcinoma 1 (NY-ESO-1) were tested by enzyme-linked immunosorbent assay (ELISA) in three different cohorts of prostate cancer patients as well as a group of men genetically predisposed to prostate cancer. Thirty-two of 353 (9·1%) of the SUN cohort representing all stages of prostate cancer demonstrated EN2 IgG responses 12 of 107 patients (11·2%) in the advanced prostate cancer patients showed responses while only four of 121 patients (3·3%) with castrate-resistant prostate cancer showed EN2 autoantibodies. No significant responses were found in the predisposed group. Anti-EN2 IgG responses were significantly higher in patients with prostate cancer compared to healthy control males and similarly prevalent to anti-NY-ESO-1 responses. While EN2 autoantibodies are not a useful diagnostic or monitoring tool EN2 immunogenicity provides the rationale to pursue studies using EN2 as an immunotherapeutic target. autoantibodies Engrailed-2 prostate cancer BMC Cancer BMC Cancer BMC Cancer 1471-2407 BioMed Central 24383403 3880410 1471-2407-14-1 10.1186/1471-2407-14-1 Research Article Prolyl-4-hydroxylase ? subunit 2 promotes breast cancer progression and metastasis by regulating collagen deposition Xiong Gaofeng 1 gaofeng.xiong@uky.edu Deng Lei 1 dnaxy@hotmail.com Zhu Jieqing 1 jzh254@g.uky.edu Rychahou Piotr G 1 2 piotr.rychahou@uky.edu Xu Ren 1 3 ren.xu2010@uky.edu 1Markey Cancer Center University of Kentucky Lexington KY 40536 USA 2Department of Surgery University of Kentucky Lexington KY 40536 USA 3Department of Molecular and Biomedical Pharmacology University of Kentucky 741 S. Limestone BBSRB Lexington KY 40536 USA 2014 2 1 2014 14 1 1 27 9 2013 26 12 2013 Copyright © 2014 Xiong et al.; licensee BioMed Central Ltd. 2014 Xiong et al.; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons./licenses/by/2.0) which permits unrestricted use distribution and reproduction in any medium provided the original work is properly cited. The Creative Commons Public Domain Dedication waiver (http://creativecommons./publicdomain/zero/1.0/) applies to the data made available in this article unless otherwise stated. Background Increased collagen deposition provides physical and biochemical signals to support tumor growth and invasion during breast cancer development. Therefore inhibition of collagen synthesis and deposition has been considered a strategy to suppress breast cancer progression. Collagen prolyl-4-hydroxylase ? subunit 2 (P4HA2) an enzyme hydroxylating proline residues in -X-Pro-Gly- sequences is a potential therapeutic target for the disorders associated with increased collagen deposition. However expression and function of P4HA2 in breast cancer progression are not well investigated. Methods Gene co-expression analysis was performed in the published microarray datasets to identify potential regulators of collagen I III and IV in human breast cancer tissue. Expression of P4HA2 was silenced by shRNAs and its activity was inhibited by 1 4-DPCA a prolyl-4-hydroxylase inhibitor. Three-dimensional culture assay was used to analyze roles of P4HA2 in regulating malignant phenotypes of breast cancer cells. Reduced deposition of collagen I and IV was detected by Western blotting and immunofluorescence. Control and P4HA2-silenced breast cancer cells were injected into fat pad and tail vein of SCID mice to examine effect of P4HA2 on tumor growth and lung metastasis. Results Using gene co-expression analysis we showed that P4HA2 was associated with expression of Col1A1 Col3A1 and Col4A1 during breast cancer development and progression. P4HA2 mRNA levels were significantly upregulated in breast cancer compared to normal mammary tissue. Increased mRNA levels of P4HA2 correlated with poor clinical outcome in breast cancer patients which is independent of estrogen receptor status. Silencing P4HA2 expression or treatment with the P4HA inhibitor significantly inhibited cell proliferation and suppressed aggressive phenotypes of breast cancer cells in 3D culture accompanied by reduced deposition of collagen I and IV. We also found that knockdown of P4HA2 inhibited mammary tumor growth and metastasis to lungs in xenograft models. Conclusion These results suggest the critical role of P4HA2 in breast cancer progression and identify P4HA2 as a potential therapeutic target and biomarker for breast cancer progression. Tumor microenvironment Breast cancer Collagen deposition Cancer progression Cell proliferation Background Extracellular matrix (ECM) is an important component of tumor microenvironment and plays critical roles in cancer development [1-3]. Collagens are the major structural ECM proteins and form fibers or networks in tumor tissue [4-6]. Cell-collagen interaction controls a variety of cellular activities including proliferation migration and invasion through integrin and discoidin domain receptor [7-9]. Enhanced expression and deposition of collagens are associated with tumor development and progression [10-12]. Recent studies demonstrate that increased collagen deposition and crosslinking enhance the stiffness and density of mammary tissue [51013] which is an important risk factor for breast cancer development. Type I collagen has been identified as a prognosis marker and is associated with cancer recurrence in human breast cancer patients [14]. Collagen VI knockout mice have reduced primary tumor formation and growth [12] while enhancing collagen deposition and inhibiting collagen degradation significantly enhances tumor initiation and tumor growth [510]. In addition cancer cell invasion usually occurs at tumor-stromal interfaces with oriented collagen fibers and aligned collagen fibers can facilitate cell migration and metastasis [5101115]. These results indicate that increased collagen expression and deposition promotes breast cancer development and progression by enhancing tumor growth and invasion. Therefore inhibiting collagen synthesis or deposition is a promising strategy to suppress breast cancer progression. Collagen biosynthesis is a multistep process that involves several post-transcription modification enzymes and one of the most important members of these enzymes is collagen prolyl-4-hydroxylase [16]. It catalyzes the formation of 4-hydroxyproline by hydroxylating proline residues in -X-Pro-Gly- sequences [17-20]. Collagen prolyl-4-hydroxylase resides within the lumen of the endoplasmic reticulum (ER) [18] and its expression is used as a marker for collagen synthesis [2122]. Because 4-hydroxyproline residues formed in this reaction are essential for triple helix formation and stabilization of collagen [22-24] inhibiting the prolyl-4-hydroxylases activity efficiently blocks collagen synthesis and deposition. All known vertebrate collagen prolyl-4-hydroxylases are ?2?2 tetramers consisting of two ? subunits and two ? subunits. Each ? subunit contains the peptide substrate binding domain and the two catalytic sites of the enzyme and the ? subunits have been identified as protein disulfide isomerases [171925]. Three types of collagen prolyl-4-hydroxylases ? isoforms (P4HA1 P4HA2 and P4HA3) have been identified in human tissue. P4HA1 is expressed in most cell types; P4HA2 is mainly expressed in chondrocytes osteoblasts and capillary endothelial cells; P4HA3 expression is detected in adult and fetal tissues at very low levels compared to P4HA1 and P4HA2 [1826]. Increased P4HA2 expression has been detected in many solid tumors including oral cavity squamous cell carcinoma papillary thyroid cancer and breast cancer [27-30] however the function of P4HA2 in cancer progression largely remains to be determined. Here we showed that expression of P4HA2 and collagen genes (Col1A1 Col3A1 and Col4A1) is significantly correlated during breast cancer development and progression and that increased mRNA levels of P4HA2 are associated with poor prognosis in breast cancer patients. Silencing P4HA2 or treatment with the P4HA inhibitor attenuates cell proliferation and suppresses aggressive 3D phenotypes tumor growth and cancer metastasis"

Lung_Cancer

"Purpose The aim of this prospective study was to evaluate whether [18F]FDG-PET/CT performed within two weeks of starting erlotinib therapy can predict tumor response defined by RECIST 1.1 criteria after 8 weeks of treatment in patients with inoperable (stage IIIA to IV) non-small cell lung cancer patients. Patients and Methods Three [18F]FDG-PET/CT scans were acquired in 12 patients before (5±4 days) and after 9±3 days (early PET) and 60±6 days (late PET) of erlotinib therapy. Conventional evaluation including at least chest CT (baseline versus after 8 weeks of treatment) was performed according to RECIST 1.1 criteria. Change in [18F]FDG uptake was compared with conventional response progression-free survival (PFS) and overall survival (OS). Results By using ROC analysis the Area Under the Curve for prediction of metabolic non-progressive disease (mNP) by early PET was 0.86 (95% CI 0.62 to 1.1; P?=?0.04) at a cut-off of 21.6% reduction in maximum Standardized Uptake Value (SUVmax). This correctly classified 11/12 patients (7 with true progressive disease; 4 with true non-progressive disease; 1 with false progressive disease). Non-progressive disease after 8 weeks of treatment according to RECIST 1.1 criteria was significantly more frequent in patients classified mNP (P?=?0.01 Fisher's exact test). mNP patients showed prolonged PFS (HR?=?0.27; 95% CI 0.04 to 0.59; P<0.01) and OS (HR?=?0.34; 95% CI 0.06 to 0.84; P?=?0.03). Late PET analysis provided concordant results. Conclusion Morphologic response PFS and OS survival in non-small cell lung cancer patients can be predicted by [18F]FDG-PET/CT scan within 2 weeks after starting erlotinib therapy. The authors have no support or funding to report. Introduction Lung cancer is the leading cause of cancer-related death in both Europe[1] and the United States of America.[2] The most common forms of lung cancer are non-small cell lung cancer (NSCLC) histological subtypes. Systemic chemotherapy has contributed to a significant improvement in NSCLC therapy but progress appears to be stagnating.[3] [4] Over the last decade a better knowledge of cellular pathways has allowed the development of new therapies based on NSCLC-driving genetic abnormalities. Targeted therapies have been developed to block pathological cellular pathways involved in cancer cell survival proliferation and metastasis. Epidermal Growth Factor Receptor (EGFR) is overexpressed in NSCLC[5] and has been extensively studied as a potential therapeutic target. Two EGF Receptor blockers gefitinib and erlotinib have been demonstrated to be effective in front-line therapy in patients with inoperable NSCLC harboring EGFR-activating mutations.[6] [7] Erlotinib is also authorized after failure of previous chemotherapy and as maintenance therapy.[8] [9] In clinical practice evaluation of tumor response is based on changes in tumor size according to criteria proposed by the World Health anization[10] or RECIST criteria.[11] [12] This morphological evaluation may lead to underestimation of the efficacy of cytostatic therapeutic agents such as erlotinib that stabilize the disease in non-mutated patients whereas conventional cytotoxic drugs induce shrinkage of tumor dimensions in the case of tumor response. NSCLC tumor size evaluation can also be difficult due to atelectasis of normal lung. The major limitations to morphological imaging methods are their inability to assess response to therapy at an early stage and their inability to identify cancer in residual masses after treatment. In patients with NSCLC [18F]FDG-PET has been recognized as an adequate staging tool[13] [14] and several studies also suggest that the standardized uptake value (SUV) has a prognostic value in NSCLC.[15] [16] The value of SUV for evaluation of tumor response to targeted therapy is currently being investigated. We designed a preliminary study to evaluate tumor response in NSCLC patients eligible for erlotinib therapy. The aim of this prospective study was to determine whether [18F]FDG-PET/CT performed several days after starting erlotinib therapy could predict tumor response defined by RECIST 1.1 criteria and [18F]FDG-PET/CT after 8 weeks of treatment. Materials and Methods Patients Twelve consecutive eligible patients with stage IIIA to IV NSCLC (7 adenocarcinomas 3 large cell carcinomas 2 squamous cell carcinomas) in whom erlotinib therapy was indicated were studied at the Angers University Hospital France. Screening for EGF receptor mutations was carried out (patient characteristics are shown in ). Eligibility criteria were: histologically or cytologically proven NSCLC; unresectable stage III/IV disease or recurrent disease after surgery; age over 18 years; measurable disease according to RECIST 1.1 criteria; Eastern Cooperative Oncology Group (ECOG) performance status between 0 to 2; adequate bone marrow function liver function and renal function. Patients were not included if they had previous lung diseases such as interstitial pneumonitis or lung fibrosis identified by chest Computed Tomography (CT) scan or diabetes mellitus that could artefact PET imaging. Life expectancy was predicted to be longer than 12 weeks. Erlotinib was administered orally in a dosage of 150 mg/day on an empty stomach until clinical disease progression unacceptable toxicity or patient refusal. The medical ethics committee of the CHU of Angers approved the study protocol. All patients gave informed written consent before inclusion according to local medical ethical committee regulations and in accordance with the guidelines established by the World Medical Association Declaration of Helsinki. .0087629.t001 Clinical characteristics of the study population. Patients Male 6 (50) Female 6 (50) Total 12 (100) Histology Adenocarcinoma 7 (58) Large cell carcinoma 3 (25) Squamous cell carcinoma 2 (17) Clinical stage IIIA or IIIB 2 (17) IV 10 (83) Smoking status Current 5 (42) Former 2 (17) Never 5 (42) EGFR mutation status Presence 2 (17) Absence 10 (83) Previous chemotherapy Yes 10 (83) No 2 (17) Size of primary tumor (cm) 1.0“2.0 4 (33) 2.1“3.0 3 (25) 3.1“5.0 5 (42) >5.1 1 (8) Metastasis Lymph nodes 12 (100) Lung 4 (33) Liver 2 (17) Bone 4 (33) Adrenal glands 0 Work Plan (study design) [18F]FDG PET/CT imaging Three [18F]FDG PET/CT scans were planned: PET1 before starting therapy PET2 within 2 weeks after starting therapy and a third [18F]FDG PET/CT scan (PET3) 8 weeks after starting erlotinib therapy. PET/CT examinations were obtained in 2D mode from the vertex to mid-thighs (5 minutes of emission scan per bed position with an average of 7 bed positions at 15 cm intervals) (Discovery-ST GE Healthcare France). Patients were instructed to fast for at least 6 hours prior to scanning. Unenhanced CT scan was performed from the skull base to the upper thighs. CT parameters were 120 kVp 100 mAs 0.8 second rotation 3.27 mm slice collimation and Pitch 1.5. CT data were used for attenuation correction and PET images were reconstructed by clinical standard 2D-iterative algorithm (ordered subset expectation maximization using 4 iterations and 16 subsets; zoom 100%; image matrix size: 128—128; and Gaussian post-smoothing of 5 mm in full width at half maximum). No corrections for partial volume effect lean body mass or blood glucose levels were applied. Conventional evaluation Conventional staging and follow-up were performed according to standards of care.[11] [12] Conventional evaluation included at least clinical examination plus CT scan performed before (CT1; 7±6 days) and 8 weeks after (CT2; 58±8 days) starting erlotinib therapy. None of the patients underwent additional CT scanning during the 2 weeks after starting erlotinib therapy. Chest abdomen and pelvis CT scans (Brillance 64 PHILIPS Medical System® France) were acquired from the lung apex to the symphysis pubis after an intravenous embolus of 130 mL of iodinated contrast agent (Xenetix350®). Helical scanning parameters were 130 kVp 120 mAs 1 second rotation 4 mm slice collimation 8 mm/s bed speed and 3 mm section width. Image analysis and response evaluation CT data were interpreted by two experienced physicians specialists in thoracic oncology blinded to PET/CT results according to the Response Evaluation Criteria in Solid Tumors (RECIST 1.1 criteria[12]) by comparison of baseline CT scan (CT1) and final CT scan (CT2). Therapeutic response evaluation was defined as: 1) complete response (CR: disappearance of all target lesions); 2) partial response (PR: at least 30% decrease in the sum of the longest diameter of five target lesions); 3) progressive disease (PD: at least a 20% increase in the sum of the longest diameter of five target lesions); and 4) stable disease (SD: neither sufficient shrinkage to qualify for PR nor sufficient increase to qualify for PD). Patients were then classified in the progressive disease (P) group or the non-progressive disease (NP) group including CR PR and SD therapeutic response. [18F]FDG PET interpretation was performed on an Imagys® workstation (Keosys Saint-Herblain France) qualitatively and semi-quantitatively by two experienced nuclear medicine physicians blinded to clinical and conventional evaluation results. Any focus of increased [18F]FDG uptake over background not located in areas of normal [18F]FDG uptake and/or [18F]FDG excretion was considered to be positive for tumor. For semi-quantitative analyses of [18F]FDG uptake 3D regions of interest (VOIs) were placed over all lesions considered to be positive for tumor by using Imagys® software (Keosys France). The maximum standardized uptake value (SUVmax) was calculated using the single hottest pixel inside the tumor VOI. SUV peak was also calculated using a 1.2 cm diameter spherical VOI containing the SUVmax. Bone lesions were not taken into account as they were considered to be non-measurable lesions. For patients with more than one tumor lesion the sum of SUVmax and SUVpeak were calculated and used for evaluation of changes between PET1 and PET2. PET measurements were performed in up to a maximum of five measurable target lesions. All SUVs were normalized to the injected dose and patient body weight. The percentage changes in SUV between PET1 and PET2 were finally calculated as follows: ?SUV?=?(SUV1?SUV2)/SUV1. The same protocol was used for PET1 and PET3. Statistical analysis Data are expressed as mean±SD excepted for survival data that were expressed as the median. The primary endpoint of the study was comparison of changes in tumor [18F]FDG uptake on PET2 versus PET1 PET3 versus PET1 and subsequent CT scan evaluation at 8 weeks after initiation of erlotinib therapy. Friedman test was used for non-parametric comparison of repeated measures. The secondary endpoints were to determine the Receiver Operating Characteristic (ROC) analysis for [18F]FDG changes with regard to predicting response to erlotinib therapy. The relationship between metabolic response (patients stratified according to the median value of SUV variations) and clinical response was analyzed by Fisher's exact test. Progression-free survival (PFS) and overall survival (OS) were determined by standard Kaplan-Meier survival analysis and between-group comparison was performed by log-rank test. PFS was defined as the time interval from the date of enrolment in the study until the first signs of progression. OS was calculated from the date of enrolment until death from any cause. All analyses were performed using Graphpad prism version 4.0 b 2004 (Graphpad Software San Diego CA). The limit of significance was set at 0.05. Results Population Twelve eligible patients with NSCLC 6 women (50%) and 6 men (50%) with a mean age of 60±13 years were included. Two patients presented tumors harboring an activating Epidermal Growth Factor Receptor mutation (2573T>G substitution (p.Leu858Arg) in exon 21 in one patient; deletion (L747_E749del) in exon 19 in the other patient). Patient characteristics are described in . The median duration of erlotinib therapy was 75 days. Due to rapid progression and death PET3 and CT3 could not be performed in 2 patients. Tumor 18F-FDG uptake The three [18F]FDG PET/CT scans were acquired as follows: PET1 5±4 days before starting therapy PET2 9±3 days after starting therapy and PET3 60±6 days after starting erlotinib therapy. Scanning started 68±17 min (PET1) 71±16 min (PET2) and 64±13 min (PET3) after [18F]FDG injection of 271±53 MBq (PET1) 270±61 MBq (PET2) and 263±54 MBq (PET3). Blood glucose level was less than 1.5 g/L for all PET examinations i.e. 1.1±0.1 g/L for PET1 1.1±0.2 g/L for PET 2 and 1.1±0.2 g/L for PET3. Non-parametric Friedman tests did not show any significant difference between PET1 PET2 and PET3 for FDG uptake time injected FDG dose or blood glucose. Fifty-five lesions were described on PET1 before treatment and 45 lesions were defined as target lesions for PET evaluation of response to treatment (up to five most hypermetabolic lesions per patient; mean 3.8 lesions/patient). The mean tumor SUVmax of the most [18F]FDG“avid lesion (SUVmax) was 10.0±4.7 for PET1 and did not vary significantly over time with a mean of 10.1±6.6 for PET2 and a mean of 9.1±5.6 for PET3 (P?=?0.97). The SUVpeak was 8.6±4.3 for PET1 8.1±5.4 for PET2 and 7.1±4.6 for PET3 and did not vary over time (P?=?0.60). No variation over time was observed for the sums of SUV. The mean sum of tumor SUVmax of all target lesions was 30.1±19.5 for PET1 27.5±17.7 for PET2 and 28.3±22.4 for PET3 (P?=?0.83). Sums of SUVpeak of all target lesions were 22.7±14.3 for PET1 20.6±13.4 for PET2 and 22.2±18.6 for PET3 (P?=?0.44). [18F]FDG-PET response versus conventional evaluation CT scan data were interpreted by chest physicians blinded to PET/CT scan results (Table 2). Evaluation of response to treatment according to RECIST 1.1 criteria demonstrated 7 patients with progressive disease (group P) and 5 patients with non-progressive disease (group NP) including 4 cases of stable disease (SD) and 1 partial response (PR). .0087629.t002 Table 2 CT and PET assessments of response rates OS and PFS. Patient PET2 versus PET1 PET3 versus PET1 RECIST 1.1 Evaluation PFS OS New lesion ? SUVmax * ? SUVpeak * ? SUVmax * ? SUVpeak * Response to Treatment Progressive (P) or not (NP) days days on PET3 #1 ?21.6 ?17.6 18.6 ?1.5 SD NP 267 915 ? #2 25.9 26.9 70.3 77.4 PD P 57 316 + #3 9.0 7.6 23.4 23.3 PD P 216 447 + #4 ?18.6 ?15.0 ?3.2 ?2.6 PD P 67 414 + #5 ?20.3 ?11.1 42.1 51.1 PD P 53 152 + #6 ?56.7 ?59.9 ?72.1 ?70.6 PR NP 190 296 ? #7 ?22.0 ?26.0 ?31.3 ?24.3 SD NP 727 1249 + #8 ?32.0 ?25.1 3.9 ?3.9 SD NP 317 1146 ? #9 16.4 7.8 ?5.4 ?10.8 SD NP 77 359 ? #10 2.1 4.4 MD MD PD P 37 92 MD #11 36.1 20.0 30.3 25.7 PD P 104 734 ? #12 ?7.2 ?10.5 MD MD PD P 61 71 MD * For patient with more than one tumor lesion the sum of SUVmax and of SUVpeak were calculated and used for the evaluation of changes between PET1 and PET2 (or between PET1 and PET3). Missing data are indicated as MD. On ROC analysis the AUC for prediction of non-progressive disease by PET2 was 0.86 (95% CI 0.62 to 1.1; P?=?0.04) corresponding to a maximum specificity of 0.80 and sensitivity of 0.86 for non-progressive disease at a cut-off of 21.6% reduction in SUVmax (Figure 1) and a positive predictive value (PPV) of 0.86 a negative predictive value (NPV) of 0.80 an accuracy of 0.83 and a maximum Youden index of 0.65. The use of this SUVmax cut-off value correctly classified 11/12 patients (7 with true progressive disease (Figures 2 and 3); 4 with true non-progressive disease (Figures 4 and 5); 1 with false progressive disease (Figure 6). Non-progression after 2 months of treatment was significantly more frequent in patients with an early decrease in SUVmax of 21.6% or more (P?=?0.01 Fisher's exact test). The only misclassified patient (patient #9 false progressive disease on PET2 versus PET1) displayed a 16.4% increase of SUVmax but metabolic progression was not confirmed on PET3 with a 5.4% decrease of SUVmax compared to PET1. Similar results were observed for SUVpeak as non-progressive disease after 2 months of treatment was significantly more frequent in patients with a decrease in SUVpeak of at least 17.6% on PET2 (P?=?0.01 Fisher's exact test). Similar results were also obtained in terms of AUC sensitivity specificity PPV NPV and accuracy and with the same classification of patients (7 with true progressive disease; 4 with true non-progressive disease; 1 with false progressive disease). .0087629.g001 Figure 1 Percentage change in SUVmax on 18F-FDG PET/CT (cut-off: ?21.6%) within 2 weeks of starting erlotinib therapy in relation to conventional imaging response. Each red or green bar represents a patient NP or P respectively."

Lung_Cancer

"BronchioalveolarCarcinoma 1 (0.6) 2 (3.8) 5 (1.7) 16 (3.3) Other* 15 (8.7) 4 (7.5) 32 (10.6) 66 (13.5) *Other includes subjects with no information available. LDT ?=? laboratory-developed test; MD ?=? mutation detected; MND ?=? mutation not detected. SLCG inconclusive (n?=?27) data not shown. Statistical considerations Mutation Detected (MD) was defined as the presence of either an exon 19 deletion or L858R mutation. Mutation Not Detected (MND) was defined as the absence of both exon 19 deletions and the L858R mutation. SAS/STAT® software was used for all data analysis. Clinical outcome study statistics Kaplan-Meier survival curves were used to assess the PFS by treatment method (chemotherapy or erlotinib) among patients who were enrolled in the EURTAC trial and screened with the LDT as well as the subset of patients who were determined to be mutation-positive by the EGFR PCR test. Nonparametric log-rank test was performed to assess PFS between patients who were randomized to chemotherapy or erlotinib. The hazard ratio (chemotherapy vs. erlotinib) relative to PFS was also calculated. Best overall response was the best response recorded from the start of treatment until disease progression and BORR (Best overall response rate) was summarized with 95% confidence limits according to Pearson-Clopper methods based on investigators assessment for each treatment arm. Analytical performance statistics For analytical performance an agreement analysis was performed between the EGFR PCR test result and the LDT test. Mutation detection of exon 19 deletions and L858R mutations were analyzed in aggregate. Separately the EGFR PCR test was also compared to Sanger sequencing and MPP by a CLIA-certified laboratory. For the agreement analyses the positive percent agreement (PPA) negative percent agreement (NPA) and overall percent agreement (OPA) with their corresponding 95% confidence intervals (CIs) were calculated. In addition 3-way analyses using MPP as a second reference method was performed to resolve the discrepancy results. Mutation testing methods EGFR PCR Test The EGFR PCR test (cobas EGFR Mutation Test Roche Molecular Systems Inc Branchburg NJ USA) is a CE-IVD marked multiplex allele-specific PCR-based assay designed to detect 41 mutations in exons 181920 and 21 in FFPET specimens of human NSCLC.[28] DNA is isolated using the cobas DNA Sample Preparation Kit (Roche Molecular Systems Branchburg NJ). [29] A minimum of 150 ng of genomic DNA is required for PCR amplification which can typically be isolated from a single 5 µm FFPET section. The EGFR PCR test software version used in this study was designed to detect 29 deletions in exon 19 and 2 L858R variants in exon 21. Macrodissection is only recommended if tumor content is less than 10%; laser capture microdissection is not required. The EGFR PCR test was performed per manufacturer's package insert and results were automatically analyzed and reported. The limit of detection has been validated to 5% mutant alleles. The workflow from DNA isolation to results reporting can be performed in one 8 hour period.[27] LDT Patients in the EURTAC study were screened using a combination of methods developed by Laboratory of Oncology ICO-Hospital Germans Trias i Pujol Barcelona Spain.[11] In short EGFR activating mutations in exons 19 and 21 were initially identified by Sanger sequencing and confirmed by fragment length analysis for exon 19 deletions (FAM-labelled primer in an ABI prism 3130 DNA analyser (Applied Biosystems Foster City CA USA) and by Taqman assay for exon 21 (L858R) mutation. All tumor specimens were from the original biopsy taken prior to any treatment and before randomization. Testing was performed on ? 2mm2 of tissue obtained from one to three slides of 4-micron tissue sections which were subjected to laser capture microdissection to enrich for the presence of tumor cells. DNA was extracted using a standard laboratory protocol and tested at a single site in Spain in Laboratory of Oncology for EGFR activating mutations in exon 19 and 21 using a previously described method. The average turnaround time was approximately 5 days.[26] Bi-directional Sanger sequencing All samples tested by the EGFR PCR test were also tested by Sanger sequencing using DNA from FFPET specimens prepared by the cobas DNA Sample Preparation Kit and sequenced with 2— bidirectional Sanger sequencing by a CLIA-certified laboratory (SeqWright Houston TX USA) using a validated protocol. Repeat Sanger sequencing was performed to compare the detection of EGFR mutations from adjacent sections of tissue to minimize any impact of tissue heterogeneity used for the EGFR PCR test relative to the original LDT results. Also sequencing protocols vary by laboratory in terms of the percent tumor content/sample that requires macrodissection. DNA isolated with the cobas DNA Sample Preparation Kit and used for sequencing required ?10% tumor content. Average turnaround time to results was 7 days. The estimated limit of detection is approximately 20% mutant alleles.[30] Massively parallel pyrosequencing (MPP) Samples with valid EGFR PCR test results with adequate DNA remaining from the initial extraction were tested by a MPP method (454 GS Titanium 454 Life Sciences Branford CT USA) by a CLIA-certified laboratory (SeqWright Houston TX USA) using a validated protocol.[31] This method is a 5“7 day process that involves amplicon generation pooling ligation emulsion PCR amplification and massively parallel pyrosequencing with manual data analysis. The estimated limit of detection for the assay is 1.25% mutant alleles. [27] The MPP method was used to demonstrate performance of the EGFR PCR test to a more sensitive method and as an arbiter for discrepant cases observed between the LDT or the repeat Sanger sequencing. In order to preserve patient privacy associated with tested clinical samples raw MPP sequencing results were anonymized and presented in Table S1. Results Specimen demographics 487 (47%) of 1044 specimens screened for the EURTAC trial using LDTs were available for testing using the EGFR PCR test. The flow of samples through the study is shown in . Patient demographics and baseline tumor characteristics for all patients by LDT status are shown in . There were no significant differences between subsets of patients tested and patients not tested by the EGFR PCR test (p>0.05) for each LDT status (mutation detected mutation not detected) with the exception of country of the screening clinic. Clinical outcomes for patients based on the EGFR PCR test results Of the 174 patients enrolled in EURTAC trial specimens from 134 (77%) patients were available for testing using the EGFR PCR test. Excluding 11 patients with invalid EGFR PCR test results and 7 patients with a result of EGFR mutation not detected a total of 116 (67%) patients were mutation detected by the EGFR PCR test and evaluable for clinical outcome analysis (57 patients in the chemotherapy arm and 59 in the erlotinib arm). Clinical outcomes (PFS BORR and OS) are presented in . Among EGFR PCR test positive patients those treated with erlotinib had a significantly prolonged PFS when compared to patients treated with chemotherapy (p-value <0.0001 log-rank test); the median PFS was 10.4 months (95% CI: 8.0 to 13.8 months) and 5.4 months (95% CI: 4.4 to 6.8 months) for patients treated with erlotinib or chemotherapy respectively (). The HR based on the Cox proportional hazards model was reduced by 66% (HR 0.34; [95% CI: 0.21 to 0.54]) for patients in the erlotinib versus chemotherapy arm. One year after randomization a higher percentage of patients in the erlotinib compared with the chemotherapy arm were event-free (45% [95% CI: 32% to 59% versus 6% [95% CI: 0% to 15%] respectively). .0089518.g002 Kaplan-Meier curves of progression-free survival (PFS) for different treatments in treatment-na¯ve patients with non“small-cell lung cancer and EGFR mutation detected by the EGFR PCR test and LDT. .0089518.t002 Summary of Clinical Outcome Analysis among EGFR PCR test positive patients in the EURTAC trial. Chemotherapy (N?=?57) Erlotinib (N?=?59) PFS (Investigator) Patients with event 37 (64.9%) 47 (79.7%) Patients without eventa 20 (35.1%) 12 (20.3%) ?Time to event (months) ?Medianb (95%CI) 5.4 [4.4; 6.8] 10.4 [8.0; 13.8] ?p-Value (Log-Rank Test) <0.0001 ?Hazard Ratio (95% CI) 0.34 [0.21; 0.54] ?1 year estimate ?Patients remaining at risk 2 24 ?Event-free Rateb (95%CI) 6% [0%; 15%] 45% [32%; 59%] Best Overall Analysis Response rates (95% CI) 14.0% [ 6.3%; 25.8%] 59.3%[ 45.7%; 71.9%] Difference in Response Rates (%) 45.29% [ 28.8%; 61.7%] ?p-Value (Chi-squared Test) <.0001 Odds Ratio (95% CI) 8.93 [3.59; 22.19] OS Patients with event 35 (61.4%) 36 (61.0%) Patients without eventa 22 (38.6%) 23 (39.0%) ?Time to event (months) ?Medianb (95%CI) 20.8 [17.3; 29.4] 25.8 [16.1; 30.0] ?p-Value (Log-Rank Test) 0.5381 ?Hazard Ratio (95% CI) 0.86 [0.54; 1.38] ?2 - year estimate ?Patients remaining at risk 16 23 ?Event-free Rateb (95% CI) 43% [29%; 57%] 51% [38%; 64%] Note: All eligible patients enrolled in study ML20650 were determined as EGFR mutation detected by the LDT. Among those patients with EGFR mutation confirmed by the EGFR PCR test were included in this table. Event ?=? Death or progression free whichever comes first for PFS analysis and event?=?death for OS analysis. a censored. b Kaplan-Meier estimates. C including censored observations. BORR were higher in patients in the erlotinib arm (59.3% [95% CI: 45.7% to 71.9%]) compared to the chemotherapy arm (14.0% [95% CI: 6.3% to 25.8%]). Patients in the erlotinib arm were much more likely to respond to therapy than patients in the chemotherapy arm (odds ratio of 8.93 [95% CI: 3.59 to 22.19]). There was no significant difference in OS between the treatment arms (25.8 months in the erlotinib arm (95% CI: 16.1 to 30.0) and 20.8 months in the chemotherapy arm (95% CI: 17.3 to 29.4) (log-rank test p-value ?=?0.5381)). PFS BORR and OS results for EGFR PCR test positive patients did not differ significantly from those obtained in all patients enrolled in the EURTAC trial which suggests that the EGFR PCR test positive patients are representative of all EURTAC enrolled patients. For the 7 cases where the EGFR PCR test result was mutation not detected and discrepant with the LDT two cases resolved in favor of the LDT by MPP three cases resolved in favor of the EGFR PCR test and one sample was invalid for both Sanger and MPP and the other was in agreement between the EGFR PCR test and Sanger but not MPP (Table S2). Anecdotally 6 of the 7 patients were treated with erlotinib and only one patient achieved greater than or equal to median PFS based on the LDT or the EGFR PCR test. Comparison of EGFR PCR test and LDT results Among 432 specimens with valid results from both the EGFR PCR test and LDT the PPA NPA and OPA were 94.2% (146/155 CI: 89.3% 96.9%) 97.5% (270/277 CI: 94.9% 98.8%) and 96.3% (416/432 CI: 94.1% 97.7%) respectively (Table 3). Thus there was a high concordance between the original LDT and EGFR PCR test results. Among sixteen specimens with discordant results the EGFR PCR test result was confirmed by MPP in 68.8% (11/16) cases (Table S3). .0089518.t003 Table 3 Agreement analysis between EGFR PCR test and LDT. SLCG LDT Total N?=?432 Mutation detected Mutation not detected EGFR PCR test Mutation detected 146 7 153 Mutation not detected 9 270 279 Total 155 277 432* ¢12 samples with inconclusive LDT results and 43 samples with invalid EGFR PCR test results were excluded. Positive percent agreement ?=?94.2% (95% CI [89.3“96.9%]). Negative percent agreement ?=?97.5% (95% CI [94.9“98.8%]). Overall percent agreement ?=?96.3% (95% CI [94.1“97.7%]). Comparison of the EGFR PCR test results with Sanger Sequencing Of 487 specimens tested using the EGFR PCR test and Sanger sequencing 406 gave valid results by both methods (38 were invalid by both methods five were invalid by EGFR PCR test and 38 were invalid by Sanger sequencing). The PPA NPA and OPA for EGFR PCR test compared with Sanger sequencing were 96.6% (112/116 CI: 91.7% 98.7%) 88.3% (256/290 CI: 84.1% 91.5%) and 90.6% (368/406 CI: 87.4% 93.1%; Table 4) respectively. Among 38 discordant results between the EGFR PCR test and Sanger sequencing MPP agreed with the EGFR PCR test result in 30 (78.9%) cases (Table S4). Sanger sequencing detected one L858R not detected by MPP and failed to detect 22 exon 19 deletions and 7 L858R mutations confirmed by MPP. Four MPP results were invalid and the remaining four results agreed with Sanger. The range of percent mutant alleles of the cases missed by Sanger was 3% to 60% with several specimens (n?=?16) under the estimated limit of detection for Sanger. .0089518.t004 Table 4 Agreement analysis between EGFR PCR test and Sanger sequencing. Sanger sequencing Total N?=?406 Mutation detected Mutation not detected EGFR PCR test Mutation detected 112 34 146 Mutation not detected 4 256 260 Total 116 290 406 *81 samples with invalid EGFR PCR test or Sanger sequencing results were excluded. Positive percent agreement ?=?96.6% (95% CI [91.5“98.7%]). Negative percent agreement ?=?88.3% (95% CI [84.1“91.5%]). Overall percent agreement ?=?90.6% (95% CI [87.4“93.1%])."

Lung_Cancer

"Thymidylate synthase (TS) gene expression in primary lung cancer patients: a large-scale study in Japanese population Ann Oncol 2011 22 1791 1797 10.1093/annonc/mdq730 21321092 Bosch-Barrera J Gazta±aga M Ceballos J Prez-Gracia JL Lpez-Picazo JM Garc­a-Foncillas J Ferrer M Sanz ML Pretel M Idoate MA Gil-Bazo I Toxic epidermal necrolysis related to pemetrexed and carboplatin with vitamin B12 and folic acid supplementation for advanced non-small cell lung cancer Onkologie 2009 32 580 584 10.1159/000232315 19816075 Bosch-Barrera J Montero A Lpez-Picazo JM Garc­a-Foncillas J Ferrer M Yuste JR Gil-Bazo I Adult onset Still's disease after first cycle of pemetrexed and gemcitabine for non-small cell lung cancer Lung Cancer 2009 64 124 126 10.1016/j.lungcan.2008.09.013 19008012 Michels J Spano JP Brocheriou I Deray G Khayat D Izzedine H Acute tubular necrosis and interstitial nephritis during Pemetrexed therapy Case Rep Oncol 2009 2 53 56 10.1159/000208377 20740145 Lurje G Manegold PC Ning Y Pohl A Zhang W Lenz HJ Thymidylate synthase gene variations: predictive and prognostic markers Mol Cancer Ther 2009 8 1000 1007 19383851 Salgado J Zabalegui N Gil C Monreal I Rodr­guez J Garc­a-Foncillas J Polymorphisms in the thymidylate synthase and dihydropyrimidine dehydrogenase genes predict response and toxicity to capecitabine-raltitrexed in colorectal cancer Oncol Rep 2007 17 325 328 17203168 Bosch-Barrera J Garc­a-Franco C Guilln-Grima F Moreno-Jimnez M Lpez-Picazo JM Gºrpide A Prez-Gracia JL Aristu J Torre W Garc­a-Foncillas J Gil-Bazo I The multimodal management of locally advanced N2 non-small cell lung cancer: is there a role for surgical resection? A single institution's experience Clin Transl Oncol 2012 14 835 841 10.1007/s12094-012-0874-3 22855163 Takezawa K Okamoto I Okamoto W Takeda M Sakai K Tsukioka S Kuwata K Yamaguchi H Nishio K Nakagawa K Thymidylate synthase as a determinant of pemetrexed sensitivity in non-small cell lung cancer Br J Cancer 2011 104 1594 1601 10.1038/bjc.2011.129 21487406 Shintani Y Ohta M Hirabayashi H Tanaka H Iuchi K Nakagawa K Maeda H Kido T Miyoshi S Matsuda H New prognostic indicator for non-small-cell lung cancer quantitation of thymidylate synthase by real-time reverse transcription polymerase chain reaction Int J Cancer 2003 104 790 795 10.1002/ijc.11014 12640689 Hu Q Li X Su C Chen X Gao G Zhang J Zhao Y Li J Zhou C Correlation between thymidylate synthase gene polymorphisms and efficacy of pemetrexed in advanced non-small cell lung cancer Exp Ther Med 2012 4 1010 1016 23226765 Shi Q Zhang Z Neumann AS Li G Spitz MR Wei Q Case“control analysis of thymidylate synthase polymorphisms and risk of lung cancer Carcinogenesis 2005 26 649 656 15579479 Wang X Wang Y Wang Y Cheng J Wang Y Ha M Association of thymidylate synthase gene 3?-untranslated region polymorphism with sensitivity of non-small cell lung cancer to pemetrexed treatment: TS gene polymorphism and pemetrexed sensitivity in NSCLC J Biomed Sci 2013 20 5 10.1186/1423-0127-20-5 23350714 Giovannetti E Lemos C Tekle C Smid K Nannizzi S Rodriguez JA Ricciardi S Danesi R Giaccone G Peters GJ Molecular mechanisms underlying the synergistic interaction of erlotinib an epidermal growth factor receptor tyrosine kinase inhibitor with the multitargeted antifolate pemetrexed in non-small-cell lung cancer cells Mol Pharmacol 2008 73 1290 1300 10.1124/mol.107.042382 18187583 Cancer Cancer 10.1002/(ISSN)1097-0142 CNCR Cancer 0008-543X 1097-0142 Wiley 24501009 4164026 10.1002/cncr.28561 CNCR28561 Original Original s Disease Site Chest and Lung Disease A phase 2 trial of dacomitinib (PF?00299804) an oral irreversible pan?HER (human epidermal growth factor receptor) inhibitor in patients with advanced non“small cell lung cancer after failure of prior chemotherapy and erlotinib Dacomitinib After Chemotherapy and Erlotinib Reckamp et al Reckamp Karen L. MD * 1 Giaccone Giuseppe MD 2 Camidge D. Ross MD 3 Gadgeel Shirish M. MD 4 Khuri Fadlo R. MD 5 Engelman Jeff A. MD 6 Koczywas Marianna MD 1 Rajan Arun MD 2 Campbell Alicyn K. MPH 7 11 Gernhardt Diana 7 Ruiz?Garcia Ana PharmD PhD 8 Letrent Stephen PharmD 8 12 Liang Jane PhD 7 Taylor Ian PhD 7 O'Connell Joseph P. MD 9 Jnne Pasi A. MD 10 1 City of Hope Duarte California 2 National Cancer Institute Bethesda Maryland 3 University of Colorado Denver Aurora Colorado 4 Karmanos Cancer Institute/Wayne State University Detroit Michigan 5 Winship Cancer Institute of Emory University Atlanta Geia 6 Massachusetts General Hospital Cancer Center Boston Massachusetts 7 Pfizer Oncology Groton Connecticut 8 Pfizer Oncology La Jolla California 9 Pfizer Oncology New York New York 10 Dana?Farber Cancer Institute Boston Massachusetts 11 Genentech San Francisco California 12 Kyowa Hakko Kirin Co. Ltd. San Diego California *Corresponding author: Karen L. Reckamp MD City of Hope 1500 East Duarte Road Duarte CA 91010; Fax: (626) 930?5461; kreckampcoh. 08 4 2014 05 2 2014 120 8 10.1002/cncr.v120.8 1145 1154 23 9 2013 15 11 2013 12 12 2013 2014 The Authors. Cancer published by Wiley Periodicals Inc. on behalf of American Cancer Society. This is an open access under the terms of the Creative Commons Attribution?NonCommercial?NoDerivs License which permits use and distribution in any medium provided the original work is properly cited the use is non?commercial and no modifications or adaptations are made. BACKGROUND This phase 2 trial (ClinicalTrials.gov identifier NCT00548093) assessed the efficacy safety and impact on health?related quality of life of dacomitinib (PF?00299804) an irreversible tyrosine kinase inhibitor (TKI) of human epidermal growth factor receptors (EGFR)/HER1 HER2 and HER4 in patients with KRAS wild?type non“small cell lung cancer (NSCLC). METHODS Patients with advanced NSCLC progression on 1 or 2 regimens of chemotherapy and erlotinib KRAS wild?type or known EGFR?sensitizing mutant tumor and Eastern Cooperative Oncology Group performance status of 0 to 2 received 45 mg of dacomitinib once daily continuously in 21?day cycles. RESULTS A total of 66 patients enrolled (adenocarcinoma n?=?50; those without adenocarcinoma [nonadenocarcinoma] n?=?16)."

Lung_Cancer

" Total patient questionnaire scores by the multidisciplinary team in the intervention group at baseline (pre) and at the end of the study (post). A low score indicates better experience. Each symbol represents the mean score for each trust in the intervention group. The maximum possible score for the questionnaire is 11. Quality improvement plan themes Quality improvement plan theme Number of plans Multidisciplinary team effectiveness 31 Diagnostic pathways 13 Treatment pathways 9 Access to clinical nurse specialists 8 Clinical trial recruitment 4 Patient experience 2 Baseline (2009) national lung cancer audit indicators Control ( n =47) Intervention ( n =31) Excluded ( n =67) P -value Mean (%) s.e.m. Mean (%) s.e.m. Mean (%) s.e.m. Control vs intervention vs non-participant control vs intervention Case ascertainment 158.1 38.6 122.0 7.2 107.4 3.6 0.220 0.455 Discussed at the MDT meeting 95.2 0.7 93.7 1.7 90.9 1.9 0.155 0.370 Histological confirmation rate 75.7 1.2 76.4 1.8 78.4 1.6 0.409 0.739 Active treatment 59.5 1.2 55.9 2.2 59.5 1.5 0.305 0.131 Surgery (all cases) 13.4 0.6 13.0 0.8 14.2 0.7 0.469 0.648 SCLC (chemo) 65.1 2.2 66.5 3.9 63.3 2.7 0.746 0.733 Seen by CNS 70.3 3.8 76.6 3.2 58.3 4.2 0.007 0.243 CNS present diagnosis 44.0 3.8 49.4 5.4 38.7 3.8 0.237 0.403 Abbreviations: CNS=clinical nurse specialist; MDT=mulitdisciplinary team; SCLC=small-cell lung cancer. Data are shown as mean and s.e. proportion of patients. BMC Cancer BMC Cancer BMC Cancer 1471-2407 BioMed Central 24386906 3893473 1471-2407-14-3 10.1186/1471-2407-14-3 Study Protocol Study protocol of a randomized controlled trial comparing Mindfulness-Based Stress Reduction with treatment as usual in reducing psychological distress in patients with lung cancer and their partners: the MILON study Schellekens Melanie PJ 1 Melanie.Schellekensradboudumc.nl van den Hurk Desiree GM 2 Desiree.vandenHurkradboudumc.nl Prins Judith B 3 Judith.Prinsradboudumc.nl Molema Johan 2 Johan.Molemaradboudumc.nl Donders A Rogier T 4 Rogier.Dondersradboudumc.nl Woertman Willem H 4 Willem.Woertmanradboudumc.nl van der Drift Miep A 2 Miep.vanderDriftradboudumc.nl Speckens Anne EM 1 Anne.Speckensradboudumc.nl 1Department of Psychiatry Radboud University Nijmegen Medical Centre Nijmegen The Netherlands 2Department of Pulmonary Diseases Radboud University Nijmegen Medical Centre Nijmegen The Netherlands 3Department of Medical Psychology Radboud University Nijmegen Medical Centre Nijmegen The Netherlands 4Department of Epidemiology Biostatistics and Health Technology Assessment Radboud University Nijmegen Medical Centre Nijmegen The Netherlands 2014 3 1 2014 14 3 3 28 6 2013 19 12 2013 Copyright 2014 Schellekens et al.; licensee BioMed Central Ltd. 2014 Schellekens et al.; licensee BioMed Central Ltd. This is an open access distributed under the terms of the Creative Commons Attribution License (http://creativecommons./licenses/by/2.0) which permits unrestricted use distribution and reproduction in any medium provided the original work is properly cited. Background Lung cancer is the leading cause of cancer death worldwide and characterized by a poor prognosis. It has a major impact on the psychological wellbeing of patients and their partners. Recently it has been shown that Mindfulness-Based Stress Reduction (MBSR) is effective in reducing anxiety and depressive symptoms in cancer patients. The generalization of these results is limited since most participants were female patients with breast cancer. Moreover only one study examined the effectiveness of MBSR in partners of cancer patients. Therefore in the present trial we study the effectiveness of MBSR versus treatment as usual (TAU) in patients with lung cancer and their partners. Methods/Design A parallel group randomized controlled trial is conducted to compare MBSR with TAU. Lung cancer patients who have received or are still under treatment and their partners are recruited. Assessments will take place at baseline post intervention and at three-month follow-up. The primary outcome is psychological distress (i.e. anxiety and depressive symptoms). Secondary outcomes are quality of life (only for patients) caregiver appraisal (only for partners) relationship quality and spirituality. In addition cost-effectiveness ratio (only in patients) and several process variables are assessed. Discussion This trial will provide information about the clinical and cost-effectiveness of MBSR compared to TAU in patients with lung cancer and their partners. Trial registration ClinicalTrials.gov NCT01494883. Mindfulness-based stress reduction Lung cancer patients Partners Psychological distress Randomized controlled trial Background With an estimated 1.4 million deaths per year lung cancer is the leading cause of death by cancer worldwide. Even with the best available treatment five-year survival is merely 16% and about 60 to 70% of patients die within the first year after diagnosis [1]. This poor prognosis is often caused by a late diagnosis as the presentation usually occurs when the lung cancer is advanced. Patients may develop burdensome symptoms like pain dyspnoea fatigue and cough and they may undergo radical treatment including surgery chemo- and radiotherapy. Not surprisingly lung cancer has a major impact on the psychological wellbeing of patients and their family. Akechi and colleagues [2] showed that 19% of patients with advanced lung cancer meets the criteria of psychiatric disorders especially depressive and adjustment disorders. Of patients who had been successfully treated for lung cancer 15% met the criteria for a minor or major depressive disorder [3]. The prevalence rate of depressive and anxiety symptoms among lung cancer patients ranges from 20 to 47% [4-7]. Compared to patients with other cancer diagnoses lung cancer patients report the highest rates of distress (43 to 58%) [89] resulting in a lower quality of life [10]. Family friends and especially partners of patients with lung cancer also have to deal with its psychological impact [11-14]. Partners not only provide emotional and practical support they also have to cope with their own concerns including the uncertainty regarding the course of the illness and the fear of losing their partner [15]. More than 50% of partners of lung cancer patients report negative emotional effects of caregiving [16]. Around 40% of partners of patients with advanced lung cancer report high levels of distress [17]. The relationship between patient and partner can also be affected by the cancer. It has been shown that some partners report a lower quality of their relationship after the diagnosis of lung cancer [18]. Though numerous studies examined the psychological distress of lung cancer patients and their partners [2-22] not much research is done on how to alleviate distress in these groups [23]. In addition the available studies on managing the psychosocial care needs of cancer patients and their families have focused on care at the very end of life (e.g. [24-26]). Recently studies have demonstrated that palliative care initiated early in treatment improves the quality of life and depressive symptoms of lung cancer patients [1027]. This stresses the importance of integrating psychosocial care for lung cancer patients and their partners early in the treatment rather than instigating it once life-prolonging therapies fail. In the past ten years MBSR has become a promising psychosocial intervention for cancer patients. Mindfulness is defined as intentionally paying attention to moment-by-moment experiences in a non-judgmental way [28]. MBSR is an 8-week group-based training consisting of meditation practices such as the bodyscan gentle yoga sitting and walking meditation. By repeatedly bringing attention back to the current experience participants gradually learn to disengage from dysfunctional thoughts and directly experience the emotions and bodily sensations of the present moment. MBSR aims to provide participants with the ability to step back from ruminating about the past or worrying about the future and simply allow experiences to unfold [2829]. A recent meta-analysis [30] of 13 nonrandomized studies and 9 randomized controlled trials (RCT) concluded there is positive evidence for the use of mindfulness-based interventions in reducing psychological distress in cancer patients. Among the RCT€™s a reduction in symptom severity was found for both anxiety and depression corresponding to moderate pooled controlled effect sizes (Hedges€™s g = 0.37 and Hedges€™s g = 0.44 respectively) [30]. Though mindfulness-based interventions seem to be effective the authors note that across studies the majority of participants were women (85%) and diagnosed with breast cancer (77%). Compared to breast cancer patients patients with lung cancer are more often male older and have a poorer prognosis. Furthermore of these 22 studies only one study included the partners of the patients showing that partners also benefit from the MBSR training [31]. This is quite surprising since partners of cancer patients also report high levels of distress [32]. Aims The aim of the Mindfulness for Lung Oncology Nijmegen (MILON) study is to examine the effectiveness of MBSR compared to TAU in reducing psychological distress in patients with lung cancer and their partners. We hypothesize that patients in the MBSR group will report a lower level of psychological distress (i.e. anxiety and depressive symptoms) higher levels of quality of life quality of relationship and spirituality than those in the TAU group. Medical and societal costs will be lower in the MBSR versus TAU group. We expect partners in the MBSR group to report a lower level of psychological distress and higher levels of caregiver appraisal relationship quality and spirituality than their counterparts in the TAU group. With regard to the working mechanisms of the MBSR programme we will examine changes in mindfulness skills self-compassion rumination intrusion avoidance and adherence to MBSR. Methods/Design Study design The design of the €˜MILON€™ study is a parallel group randomized controlled trial with an embedded process study. Participants are randomized between MBSR and TAU. The study protocol has been approved by our ethical review board (CMO Arnhem-Nijmegen) and registered under number 2011€“519. Participants and procedure Patients and partners are recruited at the outpatient clinic of the Department of Pulmonary Diseases Radboud University Nijmegen Medical Centre (RUNMC) by a nurse practitioner and the attending physician. Patients and partners are invited to participate together but both are welcome to participate on their own if they do not have a partner or their partner is not willing to participate. Patients and/or partners who are interested are provided with an information leaflet. If they are willing to participate they are invited for a research interview in which in- and exclusion criteria are assessed and informed consent is taken. At other participating hospitals (Department of Pulmonary Diseases Canisius-Wilhelmina Hospital Nijmegen; Department of Pulmonary Medicine Rijnstate Arnhem; Department of Oncology Elkerliek Hospital Helmond; Department of Pulmonary Medicine Jeroen Bosch Hospital; Department of Pulmonary Diseases Maas hospital Pantein Boxmeer) patients and their partners will be sent a letter with the invitation to participate in the study. One week later the researcher calls the patients to answer possible questions and asks whether the patient and partner are interested in participation. If so they are invited for a research interview at the RUNMC. Eligibility We include patients and/or partners of patients who are (a) diagnosed with cytologically or histologically proven non-small cell lung cancer or small cell lung cancer and (b) have received or are still under treatment. Exclusion criteria for both patient and partner include: (a) being under 18 years of age (b) not being able to understand or use the Dutch language (c) former participation in MBSR or Mindfulness-Based Cognitive Therapy (MBCT) (d) current and regular treatment by psychologist or psychiatrist (e) current participation in other psychosocial programme and (f) physical or cognitive (<26 on the Mini-Mental State Examination (MMSE)) impairments hampering participation in MBSR training or completion of questionnaires. Baseline Patients and partners are interviewed to obtain demographics and clinical characteristics after which they are screened for cognitive impairments with the MMSE [33]. After that baseline questionnaires including the Distress Thermometer (DT) [3435] are administered followed by randomization. shows the assessment instruments and time points at which the questionnaires are administered to patients and partners. Measurements and corresponding time points for patient and partner Measure Target T0 T1 T2 pt pr pt pr pt pr MMSE Cognitive impairments x x DT General distress x x HADS Psychological distress x x x x x x QLQ-C30 Quality of life x x x QLQ-LC13 Quality of life x x x SIP Impact of sickness x x x SPPIC Caregiver burden x x x CRA-SE Caregiver self-esteem x x x IMS-S Relationship satisfaction x x x x x x MIS Communication about cancer x x x x x x SAIL Spirituality x x x x x x FFMQ Mindfulness skills x x x x x x SCS Self-compassion x x x x x x RRS-EXT Rumination x x x x x x IES Psychological stress reaction x x x x x x Diary Health care use work absence Monthly during study period for pt Calendar Mindfulness adherence Monthly during study period for pt and pr Note. T0 = Baseline measurement; T1 = Post-intervention measurement; T2= 3-month follow-up measurement; pt = Patient; pr = Partner; MMSE = Mini Mental State Examination; DT = Distress Thermometer; HADS = Hospital Anxiety and Depression Scale; QLQ-C30 = Quality of Life €“ Cancer; QLQ-LC13 = Quality of Life €“ Lung Cancer; SIP = Sickness Impact Profile; SPPIC = Self-Perceived Pressure from Informal Care; CRA-SE = Caregiver Reaction Assessment €“ Care-Derived Self-Esteem; IMS-S = Investment Model Scale-Satisfaction; MIS = Mutuality and Interpersonal Sensitivity; SAIL = Spiritual Attitude and Involvement List; FFMQ = Five Facet Mindfulness Questionnaire; SCS = Self-Compassion Scale; RRS-EXT = Rumination Response Scale €“ Extended Version; IES = Impact of Event Scale. Randomization Randomization is stratified according to setting and minimized for (a) stage of disease (curative versus palliative) (b) baseline level of anxiety and depressive symptoms (anxiety or depression subscale score of Hospital Anxiety and Depression Scale (HADS) <8 versus ?8) (c) treatment during MBSR (no treatment versus chemo- and/or radiotherapy) and (d) participation (patient alone versus partner alone versus patient and partner together). Randomization is computerized using a randomization website specifically designed for this study on which the researcher can fill out the required data. The researcher communicates treatment allocation to the nurse practitioner who informs the patient and/or partner. Follow-up assessments Follow-up assessments take place post intervention and at three-month follow-up. Participants who have access to the internet and have an email address receive the questionnaires online. If not they receive the questionnaires on paper along with a reply envelope. In case of drop-out the researcher tries to contact the participant by phone to complete a minimum set of outcome measures and to identify the main reason for drop-out. Intervention The MBSR curriculum used is primarily based on the Mindfulness-Based Stress Reduction programme as developed by Kabat-Zinn [28] but contains some elements of the MBCT programme by Segal Williams and Teasdale [29] like psycho-education on the interrelatedness of feelings and thoughts. Moreover some modifications have been made to make the intervention more suitable for patients with lung cancer and their partners such as psycho-education about grief [36]. In addition a mindful communication exercise in which partners talk with each other about the cancer was added. The programme consists of 8 weekly 2.5-hour sessions a silent day between session six and seven and home practice assignments of about 45 minutes 6 days per week. Participants receive a set of CDs with guided mindfulness meditation exercises for home practice and a folder with information and home practice instructions for the forthcoming week. shows the content of the MBSR programme per session. The MBSR courses are taught by mindfulness teachers with extensive training in MBSR. They all fulfil the advanced criteria of the Center for Mindfulness of the University of Massachusetts Medical School [37] and maintain a regular personal meditation practice. Teachers were trained supervised and assessed to ensure their competency levels met the qualification criteria to instruct the MBSR classes. During the trial teachers will receive weekly supervision and a number of sessions will be videotaped to evaluate competence and adherence with the Mindfulness-Based Interventions €“ Teaching Assessment Criteria [38]. Content of MBSR programme per session Theme of session Meditation exercise Didactic teaching Homework 1. Automatic pilot - Bodyscan - Intention of participating - Bodyscan - Raisin exercise - Eating one meal mindfully - Attention for routine activity 2. Mindfulness of the breath - Bodyscan - Imagery exercise to demonstrate relationship between thoughtsand feelings - Bodyscan - Sitting mediation with focus on breath - Attention for breath - Awareness of pleasant events - Attention for routine activity 3. Observing limits - Yoga while lying down - Seeing exercise to demonstrate difference between observation and interpretation - Bodyscan or yoga - 3-min breathing space - Sitting meditation - Awareness of unpleasant events - 3-min breathing space 4. Opening up to distress - Sitting mediation with focus on breath body and sound - Interrelatedness of feelings thoughts and bodily sensations - Bodyscan or yoga - Sitting meditation - 3-min breathing space - Psychoeducation about grief - Awareness of stress reactions - 3-min breathing space 5. Responding to distress - Sitting mediation with focus on breath body sound thoughts difficulty - Reacting versus responding - Meditation by choice - Coping with grief - Awareness of reaction in difficult situation - Walking meditation - Awareness of communication difficulties - 3-min breathing space - 3-min breathing space 6. Mindful communication - Yoga in standing position - Mindful communication exercise about effect of lung cancer with their own partner - Sitting meditation or yoga - 3-min breathing space - Awareness of communication - 3-min breathing space during stress Silent day - Varying meditation exercises "

Lung_Cancer

"Human cells were grown in 60-mm dishes to 90% confluence. Then a wound was produced by scraping the cell monolayer with a sterile P200 pipette tip. During the wound healing process time-lapse images were obtained every 10 min for 12 hours and the cell migration area was calculated ([healing area/wounding area]—100%) using the ImageJ program (http://rsbweb.nih.gov/ij/index.html). Invasion Assay The invasion assay was performed on the TE671 and TE671-hFTSJ2 cells using Trans-well chambers with an 8-µm pore size (Merck Millipore Darmstadt Germany). The upper chamber of the Trans-well was pre-coated with Geltrex matrix gel (30 µL/well) (Invitrogen Corp. Grand Island NY USA) and inserted into the lower chamber which contained DMEM with 10% FBS. The cells (1—104) were suspended in 200 µL of DMEM and added to the upper chamber. After 12 hours the cells on the upper surface of the membrane were removed with a cotton swab and the cells on the lower surface of the membrane were fixed with methanol for 10 min and subjected to Giemsa staining. The Giemsa-positive area of the membrane was calculated ([Giemsa positive area/total area]—100%) using the ImageJ program. Statistical Analysis All of the data are presented as the means±standard error (SE). The statistical comparisons were performed using Student™s t-test. The Duncan method of one-way ANOVA was used for multiple group comparisons. The P<0.05 or P<0.01 level was considered significant. Results FTSJ2 is Closely Related to E. coli RrmJ RrmJ is a 23S rRNA 2?-O-ribose MTase and is conserved in nearly all of the different species. To evaluate the relationship among the RrmJ homologs a phylogenic tree with 39 RrmJ homologs was constructed. The NCBI BLASTp program was used to identify the homologs of the E. coli RrmJ protein in M. jannaschii S. cerevisiae Caenorhabditis elegans Drosophila melanogaster and in vertebrates. Using the minimum evolution method the phylogenic tree showed the following three phylogenies: FTSJ1/Trm7p FTSJ2/Mrm2p and FTSJ3/Spb1p (). Using the JTT model to calculate the protein distances and comparing these distances within each phylogeny the protein distances within the FTSJ2/Mrm2p group were found to be larger than those within the FTSJ1/Trm7p and FTSJ3/Spb1p groups indicating that the RrmJ homologs FTSJ1 and FTSJ3 are more conserved between species than FTSJ2. However the distance between E. coli RrmJ and the root of the FTSJ2/Mrm2p group (distance: 0.84) was shorter than the roots of the FTSJ1/Trm7p and FTSJ3/Spb1p groups (distance: 1.25 and 1.28) suggesting that the FTSJ2/Mrm2p proteins are the most related to E. coli RrmJ and are presumed to be the orthologs of RrmJ. This assumption is supported by the known function of S. cerevisiae Mrm2p. Mrm2p catalyzes the methylation of 2?-O-ribose in the mitochondrial 21S rRNA [12] which has the same rRNA structure as the substrate of RrmJ. .0090818.g001 Phylogenetic tree of the E. coli RrmJ homologs from Eubacteria to Mammalia. This phylogenetic analysis represents the following three major homolog protein lineages: FTSJ1/Trm7p FTSJ2/Mrm2p and FTSJ3/Spb1p. The out-groups of the tree were catechol-O- methyltransferase VP39 and fibrillarin (PDB code 1VID 1AV6 and 1FBN respectively). These out-groups were chosen because of their similar functions and structures to E. coli RrmJ. The number at each branch node indicates the reliability of the splits (%) through the processing of 1000 bootstrap replicates. The GenBank accession numbers and species are shown for each protein. [F] and [S] denote proteins with known functions and protein structures respectively. The Protein Structures of the FTSJ2 Orthologs are Similar to that of E. coli RrmJ The protein sequence alignment of E. coli RrmJ M. jannaschii FtsJ S. cerevisiae Mrm2p and other FTSJ2 orthologs showed many similarities. The K50 D124 K164 and E199 residues which compose the catalytic center of RrmJ were present in all of the RrmJ orthologs. Furthermore the 19 residues involved in S-adenosylmethionine (S-AdoMet SAM) binding in RrmJ were also highly conserved in FTSJ2 (). A comparison of the similarity of the full-length amino acid sequences of human FTSJ2 with E. coli RrmJ S. cerevisiae Mrm2p and porcine FTSJ2 which represented the Eubacteria Eukaryota and Mammalia homologs respectively showed that the E-values (and amino acid identities) were 3e-43 (35%) 3e-33 (29%) and 7e-140 (76%) respectively. .0090818.g002 Protein sequence alignment of E. coli RrmJ with its FTSJ2 orthologs in 7 different species. The ?-helices and ?-strands were based on the RrmJ protein structure (PDB code: 1EIZ). The stars and triangles indicate the K-D-K-E catalytic center and the SAM binding residues in RrmJ respectively. The residues with identical and similar chemical properties are highlighted in black and gray respectively. In addition a comparison of the two published three-dimensional protein structures of E. coli RrmJ and human FTSJ2 and a predicted structure of porcine FTSJ2 showed that these structures contain five ?-helixes and seven ?-strands that compose an open-sheet structure. The positions of the SAM binding residues and the amino acids of the catalytic center showed similar arrangements in the protein structures. Notably the first residue of the catalytic center lysine (K50 in RrmJ) showed an approximately 120° rotation in human FTSJ2 (PDB code: 2NYU) [36] compared with E. coli RrmJ (Figure S1). This rotation may account for the different structures of the rRNA substrates of the E. coli and the human proteins. FTSJ2 is Localized in the Mitochondria of Human Cells Mrm2p the FTSJ2 ortholog in S. cerevisiae is located in the mitochondria and is responsible for the 2?-O-ribose methylation of the 21S rRNA. Thus we detected the subcellular localization of the FTSJ2 protein in the human cell lines. A vector for the overexpression of hFTSJ2 driven by the CMV promoter was constructed (pCMV-hFTSJ2-IRES2-DsRed2; A). The rhabdomyosarcoma (TE671) and hepatocarcinoma (HepG2) cell lines were transfected with the pCMV-hFTSJ2-IRES2-DsRed2 vector and the expression of the hFTSJ2 protein was detected by Western blot analysis. The results showed that the TE671-hFTSJ2 and HepG2-hFTSJ2 cells had higher expression levels of hFTSJ2 than the non-transfected cells (B). Immunofluorescence showed that most of the hFTSJ2 protein was located in the cytoplasm but not in the nuclei in both the TE671-hFTSJ2 and HepG2-hFTSJ2 cells and the mitochondria which were stained with MitoTracker Red showed the same localization as hFTSJ2 (C). In the analysis of the mitochondrial and cytosolic protein fractions hFTSJ2 was detected in the mitochondrial protein fraction but not in the cytosolic fraction (D). These results indicated that human FTSJ2 as its ortholog in S. cerevisiae is a mitochondrial protein. .0090818.g003 Subcellular localization of human FTSJ2 in TE671 and HepG2 cells. (A) Schematic of the hFTSJ2 over-expression vector. (B) Over-expression of the hFTSJ2 protein in the TE671-hFTSJ2 and HepG2-hFTSJ2 stable clones. (C) Immunofluorescence staining with anti-hFTSJ2 (green) MitoTracker for mitochondria (red) and DAPI for nuclei (blue) in the TE671-hFTSJ2 and HepG2-hFTSJ2 cells. (D) Mitochondrial localization of the hFTSJ2 protein in non-transfected TE671 cells. VDAC and MEK-1 were used as the mitochondrial and cytosolic fraction controls respectively in the Western blot analysis. Ftsj2 mRNA is Expressed in all of the Porcine Tissues but at Different Levels Because of the higher similarity between human and porcine FTSJ2 (amino acid identity?=?76% and RrmJ domain identity?=?81%; ) and the similar physiological responses of humans and pigs we further analyzed the expression of the porcine Ftsj2 gene and sequenced the coding region of the porcine Ftsj2 mRNA (GenBank accession number: EU694400). Then 13 tissues from a female piglet were analyzed for the expression of porcine Ftsj2 mRNA by RT-PCR. The results showed that all of the 13 tissues expressed Ftsj2 mRNA at different levels. The heart and kidney showed the highest expression; the large intestine muscle lung spleen and liver showed mid-level expression; and the small intestine ovary brain stomach mammary gland and bladder showed the lowest expression (Figure S2). The Level of Ftsj2 mRNA Expression Increases in Several Tissues after Heat Shock Stress Previous studies have shown that the mRNA of E. coli rrmJ increased nearly 20-folds under heat shock stress [3] and was involved in the thermal adaptation of E. coli [7]. Thus the heat shock protein characteristics of mammalian FTSJ2 were also evaluated in piglets which are known to be thermally sensitive in the livestock industry. Three-month-old female piglets were raised at room temperature (25°C) and to produce enough heat shock stress in the warm-blooded piglets temperatures of 30°C or 35°C were used to stimulate the heat shock response for at least 1 week. The porcine Ftsj2 mRNA expression in 11 tissues from these piglets was detected and Hsp70.2 mRNA expression was used as the heat shock response positive control (Figures 4A and 4B). The results showed that Ftsj2 mRNA expression was up-regulated in the large intestine stomach lung and bladder and down-regulated in the small intestine muscle heart mammary gland kidney spleen and liver in the 30°C and 35°C environments (Figure 4A). Notably the only tissue that showed an up-regulation of both Ftsj2 mRNA expression and Hsp70.2 mRNA expression which corresponds to a positive heat shock response was the lung (Figure 4B). "

Lung_Cancer

"trial in patients with advanced non-small-cell lung cancer. J Clin Oncol 2010 28 3076 3083 20479403 29. Miller VA Hirsh V Cadranel J Afatinib versus placebo for patients with advanced metastatic non-small-cell lung cancer after failure of erlotinib gefitinib or both and one or two lines of chemotherapy (LUX-Lung 1): a phase 2b/3 randomised trial. Lancet Oncol 2012 13 528 538 22452896 Clin Orthop Relat Res Clin. Orthop. Relat. Res Clinical Orthopaedics and Related Research 0009-921X 1528-1132 Springer US Boston 24249538 3971232 3385 10.1007/s11999-013-3385-9 Clinical Research Does Intensity of Surveillance Affect Survival After Surgery for Sarcomas? Results of a Randomized Noninferiority Trial Puri Ajay MS docpurigmail.com Gulia Ashish MS Hawaldar Rohini PhD Ranganathan Priya MD Badwe Rajendra A. MS Orthopaedic Oncology Tata Memorial Hospital Room No. 45 E Bes Road Mumbai India Tata Memorial Hospital Mumbai India Anaesthesiology Critical Care and Pain Tata Memorial Hospital Mumbai India Surgical Oncology Tata Memorial Hospital Mumbai India 19 11 2013 5 2014 472 5 1568 1575 30 7 2013 8 11 2013 The Association of Bone and Joint Surgeons® 2013 Background Whether current postoperative surveillance regimes result in improved overall survival (OS) of patients with extremity sarcomas is unknown. Questions/purposes We hypothesized that a less intensive followup protocol would not be inferior to the conventional followup protocol in terms of OS. We (1) assessed OS of patients to determine if less intensive followup regimens led to worsened survival and asked (2) whether chest radiograph followup group was inferior to CT scan followup group in detecting pulmonary metastasis; and (3) whether less frequent (6-monthly) followup interval was inferior to more frequent (3-monthly) followup in detecting pulmonary metastasis and local recurrence. Methods A prospective randomized single-center noninferiority trial was conducted between January 2006 and June 2010. On the basis of 3-year survival of 60% with intensive more frequent followup 500 nonmetastatic patients were randomized to demonstrate noninferiority by a margin (delta) of 10% (hazard ratio [HR] 1.36). The primary end point was OS at 3 years. The secondary objective was to compare disease-free survival (DFS) (time to recurrence) at 3 years. At minimum followup of 30 months (median 42 months; range 30“81 months) 178 deaths were documented. Results Three-year OS and DFS for all patients was 67% and 52% respectively. Three-year OS was 67% and 66% in chest radiography and CT groups respectively (HR 0.9; upper 90% confidence interval [CI] 1.13). DFS rate was 54% and 49% in chest radiography and CT groups respectively (HR 0.82; upper 90% CI 0.97). Three-year OS was 64% and 69% in 6-monthly and 3-monthly groups respectively (HR 1.2; upper 90% CI 1.47). DFS was 51% and 52% in 6-monthly and 3-monthly groups respectively (HR 1.01; upper 90% CI 1.2). Almost 90% of local recurrences were identified by patients themselves. Conclusions Inexpensive imaging detects the vast majority of recurrent disease in patients with sarcoma without deleterious effects on eventual outcomes. Patient education regarding self-examination will detect most instances of local recurrence although this was not directly assessed in this study. Although less frequent visits adequately detected metastasis and local recurrence this trial could not conclusively demonstrate noninferiority in OS for a 6-monthly interval of followup visits against 3-monthly visits."

Lung_Cancer

"The DICER algorithm (24) seeks one pair of linked modules at a time. A pair of modules is defined as linked if the sum of weights WG between them is high enough. We call the approach of DICER ˜local™ as it finds one module pair at a time. The algorithm of Ulitsky et al. (17) aims to maximize the ˜global score™ namely the total sum of scores within modules in H plus the sum of scores of links in G. In addition to increasing the global score links between modules are accepted only if they pass a statistical significance test. We call the second approach ˜global™. Both methods identify the links and the modules simultaneously.D demonstrates the differences between the local and global approaches. Assume that in both graphs edge weights are 1 non-edge weights are ?1 and that the local approach uses a threshold of 0 on the sum of WG weights between two modules for reporting a link. In both approaches modules are clusters of nodes with high density in H. According to both approaches module 1 is linked to module 2: the local score is 4 (8 edges and 4 non-edges) the global analysis P-value for linkage is <0.05 and the total score for the module pair is 13 (module score 6 + 3 + link score 4). The sum of WG weight between modules 2 and 3 is ?4 (10 edges and 14 non-edges) and the local method rejects that link. However the global approach will also link module 2 and 3: the linkage P-value is significant (P = 0.039) and adding this link will improve the global map score to 24 [13 for the (12) pair +15 for module 3“4 for the (23) link]. This example illustrates the advantage of the global approach on sparse graphs in which large modules are not expected to be densely interconnected.AlgorithmsWe conducted a systematic study and developed further a family of two-phase algorithms for module map detection that find an initial solution (possibly consisting of many small modules) and then improve it. We call algorithms for the first phase initiators and algorithms for the second phase improvers. For simplicity we describe the algorithms assuming that edges with positive weight are considered heavy. For unweighted graphs we assume edge weights to be 1 and non-edge weights to be ?1. For weighted graphs all node pairs (edges) have weights so there are no non-edges.InitiatorsWe tested five different initiators: (i) DICER (24) which finds one pair of linked modules at a time (ii) hierarchical clustering of the graph H (25) which finds a set of modules (iii) a greedy node addition algorithm for finding modules in H (iv) DICERk a variant of DICER wherein the minimum module size is set to k and (v) an algorithm based on enumeration of maximal bicliques in G using an exhaustive solver (2627) followed by the cleaning process of DICER. We call the latter algorithm MBC-DICER see Supplementary Text and Supplementary Figure S1 for a full description of all initiators. Each initiator creates an initial module set but modules in the map constructed by clustering algorithms are not necessarily linked.ImproversThe ˜local improver™ (24) extends module map links by either adding a single node to a module or by merging two module map links. One drawback of this approach is that it cannot create new modules that are not represented in the initial solution. Another disadvantage is that it cannot merge a module whose two parts are linked to different modules that are unlinked. See Supplementary Figure S2 for examples."

Lung_Cancer

"Former (quit ?1 y) 39 (48%) 30 (48%) 9 (50%) 10 (50%) 29 (48%) ?Never 9 (11%) 7 (11%) 2 (11%) 1.00e 2 (10%) 7 (11%) 1.00e Abbreviation: Adeno adenocarcinoma. a All P values shown are 2-sided. b White versus all other races. c Adenocarcinoma versus all other histologies. d Weight loss <5% versus ?5%. e Derived using the Freeman-Halton exact test. The distribution of assignment to chemotherapy and observation was 63 patients (78%) and 18 patients (22%) respectively which was not significantly different (P?=?.20 Fisher exact test) from the expected rates of 70% (129 patients) and 30% (55 patients) respectively.16 Based on protein levels in these 81 patients the number of those with low ERCC1 and low RRM1 was 31 patients (38%) 22 patients had low ERCC1 and high RRM1 (27%) 10 patients had high ERCC1 and low RRM1 (12%) and 18 patients had high ERCC1 and RRM1 (22%) which is not significantly different from prior results (P?=?.14 Fisher exact test; 54 of 184 29%; 38 of 184 21%; 37 of 184 20%; and 55 of 1840.3 respectively). We investigated whether treatment arm assignment varied by patients' smoking status histology age and sex. In bivariate comparisons no statistically significant associations were found. However the multivariable logistic model found that patients with adenocarcinoma (P?=?.03) and potentially stage IA disease (P?=?.06) were more likely to be assigned to adjuvant chemotherapy (ie they were more likely to have low levels of ERCC1 RRM1 or both). One of the 18 patients assigned to observation and 19 of the 63 patients assigned to chemotherapy rejected this choice and withdrew consent. There was no statistically significant difference in patient characteristics between those who accepted and those who refused their treatment assignment (). Feasibility The trial achieved its primary feasibility objective with a treatment assignment within the prespecified timeframe in 71 of 81 patients (88%). We successfully determined protein levels in all 85 patients. Ten of the 81 eligible patients did not achieve assignment to treatment versus observation within the 84-day time interval from surgical resection. The time interval from surgery to assignment ranged from 86 days to 105 days in these 10 patients. For 3 patients the specimens were received after the 84-day limit had passed. For the other 7 patients the time interval from receipt to reporting ranged from 7 days to 25 days (median 18 days). For the 71 patients with a successful assignment within the 84-day time interval from surgical resection the time from receipt to reporting ranged from 3 days to 26 days (median 8 days). The reasons for reporting results in excess of 14 days were equipment failure and inadequate expression values in control specimens which required equipment recalibration and a repeat processing of the specimens. Overall the time from receipt of specimens to reporting ranged from 1 day to 27 days (median 11 days; mean 12 days) which is similar to that reported for patients with advanced NSCLC (range 1 day-47 days; median 11 days; mean 12 days).18 Survival and Toxicity Survival analyses were performed on the 61 patients who accepted assignment to treatment (44 patients) or surveillance (17 patients). Patients who rejected their treatment assignment withdrew consent and thus could not be followed for survival. Fourteen patients had DFS events; 2 had died (1 from disease recurrence and the other from cardiac disease without recurrence). The median follow-up among those patients still alive at the time of last follow-up was 27 months (range 3 months-44 months). Six patients had <?24 months of follow-up. The collective 2-year DFS and OS rates were 80% (95% confidence interval [95% CI] 67%-88%) (Fig. 2A) and 96% (95% CI 87%-99%) from the date of registration. The 2-year DFS rate was 83% (95% CI 68%-92%) for patients who received chemotherapy (Fig. 2B) and it was 71% (95% CI 43%-87%) for those observed (Fig. 2C). includes 2-year DFS estimates within each of the 3 gene expression categories in the chemotherapy arm. The median time from surgery to enrollment was 41 days (range 11 days-79 days). The time from surgery was added as a covariate to a Cox regression model and was not found to be significantly related to DFS (P?=?.22) or OS (P?=?.36). Disease-Free Survival Rates Patient Group No. DFS (95% CI) 1-Year 2-Year Accepted assigned treatment 61 88% (77%-94%) 80% (67%-88%) Received chemotherapy 44 95% (83%-99%) 83% (68%-92%) By protein level category (for those that received chemotherapy) ?Low ERCC1/low RRM1 20 95% (69%-99%) 84% (59%-95%) ?Low ERCC1/high RRM1 18 94% (65%-99%) 82% (55%-94%) ?High ERCC1/low RRM1 6 100% (100%-100%) 100% (100%-100%) Abbreviations: 95% CI 95% confidence interval; DFS disease-free survival; ERCC1 excision repair cross-complementing group 1; RRM1 ribonucleotide reductase M1. Kaplan-Meier survival estimates are shown. (A) Collective disease-free survival is shown for patients who accepted adjuvant chemotherapy or observation based on gene expression analysis. (B) Disease-free survival is shown for patients who received adjuvant chemotherapy. (C) Disease-free survival is shown for patients in the observation group. Conf Int indicates confidence interval. A total of 22 patients discontinued chemotherapy because of treatment-related toxicity (50%). None of the patients died because of treatment-related toxicity. Details are provided in . Number of Patients With Grade 3 and Grade 4 Adverse Events Among the 44 Patients Who Received Chemotherapya Level of Severity Adverse Event Grade 3 Grade 4 No. of patients with events 13 14 Type of events ?Neutropenia 11 6 ?Thrombocytopenia 4 4 ?Nausea 4 0 ?Vomiting 4 0 ?Anemia 2 0 ?Anorexia 2 0 ?Fatigue 2 0 ?Febrile neutropenia 1 1 ?Thromboembolism 1 1 ?Dehydration 1 0 ?Hearing impairment 1 0 ?Mucositis 1 0 ?Pleural effusion 1 0 ?Renal failure 1 0 ?Bradycardia (sinus) 1 0 ?Syncope 1 0 ?ALT elevation 1 0 ?Hypokalemia 1 0 ?Hyponatremia 0 2 Abbreviation: ALT alanine aminotransferase. a Adverse events were assessed according to the Common Terminology Criteria for Adverse Events (version 3.0). In Situ ERCC1 and RRM1 Protein Levels RRM1 levels ranged from 2.4 to 234.3 (median 39.7; mean 48.1) which were not significantly different from the expected values (median 40.5; range 8.3-96.2) (P?=?.87).16 ERCC1 protein levels ranged from 4.3 to 211.2 (median 41.9; mean 58.8) and these values were significantly different from the expected values (median 65.9; range 1.9-178.7) (P?=? 0.02). There was a significant correlation noted between ERCC1 and RRM1 levels (correlation coefficient 0.39; P?=?.0003) (Fig. 3) as previously reported.91618 Distribution of excision repair cross-complementing group 1 (ERCC1) and ribonucleotide reductase M1 (RRM1) levels in eligible patients is shown. The median protein levels of ERCC1 in adenocarcinomas squamous cell carcinomas and the other histologies were 34.257.1 and 121.5 respectively. The corresponding median levels of RRM1 were 38.142.6 and 48.9 respectively. Although the levels were higher in squamous cell carcinomas compared with adenocarcinomas the medians were not statistically significant (ERCC1: P?=?.16; RRM1: P?=?.72). DISCUSSION Disease stage is a predictor of benefit from adjuvant chemotherapy in patients with NSCLC. Patients with stage III disease derive the most benefit and those with stage I are reported to derive the least.12419“23 Although not statistically significant for patients with stage I disease and a tumor diameter >?3 cm a numerical risk reduction of 7% has been reported and for those with tumors measuring ??3 cm a numerical risk increase of 40% has been reported.23 A significant treatment-related toxicity is febrile neutropenia which has been reported in 7% to 24% of patients.242022 Treatment-related deaths occur in 0.5% to 2% of patients.122022 The inclusion of molecular markers predictive of therapeutic efficacy into adjuvant decision algorithms would greatly improve the clinical benefit and reduce toxicity for patients with NSCLC. This approach is particularly attractive for patients with stage I disease in whom the parameters for weighing risks and benefits are to our knowledge the least well defined. Recent advances in molecular diagnostics have resulted in improved outcomes for patients whose tumors harbor mutations in oncogenic signal transduction molecules that can be inactivated by therapeutic agents. Similarly platinum agents target DNA and gemcitabine targets ribonucleotide reductase; both are unequivocally required not only for cellular proliferation but also for other essential cellular functions. Although to our knowledge specific oncogenic mutations have not been identified to date ERCC1 and RRM1 have emerged as promising predictors of efficacy for cisplatin and gemcitabine respectively. We conducted a phase 2 trial of treatment selection based on the levels of protein expression of ERCC1 and RRM1 for patients with completely resected stage I NSCLC and tumor diameters ??2 cm primarily to establish feasibility but also to evaluate preliminary efficacy as assessed by 2-year survival rates. We achieved our primary goal by demonstrating within a cooperative group environment that treatment assignment can be achieved for >?85% of patients within 84 days (12 weeks) the established timeframe for the initiation of adjuvant therapy from surgery in patients with NSCLC.12420“22 At first glance our demonstration of feasibility should not be surprising. However it is important to note that surgical practice has not usually engaged a medical oncologist at the time of initial therapeutic planning but rather after complete recovery which substantially reduces the time available for molecular testing before the initiation of adjuvant treatment. We found no difference (P?=?.20) between academic and community sites in the time elapsed from surgery to the receipt of specimens in the reference laboratory (community sites: 57 patients; median 48 days [range 18 days-90 days]; academic sites: 24 patients; median 53 days [range 20 days-90 days]). The time elapsed from specimen receipt to reporting (median 12 days; range 1 day-27 days) was similar to our previous experience in an international trial of patients with advanced NSCLC (median 11 days; range 1 day-47 days).18 Based on these observations we conclude that the current process for routine specimen procurement handling and shipping to a reference laboratory requires substantial improvements to facilitate implementation of molecularly based therapeutic decision-making. For example a developing National Cancer Institute-sponsored project Adjuvant Lung Cancer Enrichment Marker Identification and Sequencing Trial (ALCHEMIST) which will randomize patients with epidermal growth factor receptor-mutated or anaplastic lymphoma kinase (ALK)-rearranged NSCLC to targeted therapy or not will need to carefully consider these logistical issues. Prior results from adjuvant trials and a retrospective staging project in patients with stage I disease after complete surgical resection have reported 2-year DFS rates of 72% to 74%20 and rates of 68% to 75% for patients with stage IB disease.4 The corresponding 2-year OS rates were 80% to 88% for patients with stage I disease2024 65% to 90% for patients with stage IB disease242225 and 85% for those with stage IA disease.25 Thus our results of a 2-year DFS rate of 80% and OS rate of 96% appear favorable by comparison. However it is prudent to be cautious because we lost 20 of 81 patients from the survival analysis because of consent withdrawal and a direct comparison of outcomes data among trials cannot account for differences in study populations eligibility and staging criteria and provisions for data collection and analysis. The spectrum of protein levels for ERCC1 and RRM1 significant correlation of levels between both molecules and distribution of patients into the 4 gene expression categories in the current study is consistent with previous experience.91213161826 However the current analysis method for biomarker evaluation (ie antibody-based assessment of in situ protein levels) is not suitable for general clinical implementation for several reasons. First ERCC1 has multiple isoforms that cannot be specifically distinguished by the available reagents and only 1 isoform appears to be involved in platinum-induced DNA damage repair.27 Second the monoclonal antibody 8F1 which is consistently used for ERCC1 protein expression analysis detects a second and unrelated protein that shares a common epitope with ERCC1.28“30 This observation may account for the highly batch-dependent performance of this antibody1827 which may explain the significantly lower ERCC1 values in the current study compared with prior results.16 Third protein levels for RRM1 in particular and to a lesser degree for ERCC1 appear to be influenced by the specimen processing and handling procedures used at collection sites.26 Finally although the method for immunofluorescence-based quantitative detection of both molecules performs well if all specimens to be analyzed are processed simultaneously there is considerable interassay variability if specimens need to be processed individually over an extended period of time as required for real-time patient decision-making.18 However it is important to note that the biochemical biophysical and cell biological evidence for ERCC1 and RRM1 as predictive molecules for platinum and gemcitabine efficacy remains undisputed.510“12273132 A small number of recent clinical trials have used ERCC1 prospectively for therapeutic decision-making. These include 2 randomized phase 3 trials in patients with advanced-stage NSCLC (1 published [NCT00499109]18 and the other terminated and unpublished [NCT00801736]) and 2 adjuvant trials 1 of which was a terminated and not yet published phase 2 trial [TAilored Post-Surgical Therapy in Early Stage NSCLC (TASTE) NCT00775385] and the other an ongoing phase 3 trial [International TAilored Chemotherapy Adjuvant trial (ITACA); EudraCT 2008-001764-36]. Results from the first trial (NCT00499109) demonstrated no improvement in patient survival; however the authors raised the possibility of a false-negative result because of an inexplicably divergent survival in an internal control group.18 The second trial (NCT00801736) and third trial (NCT00775385) were terminated early after the discovery of ERCC1 isoforms27 and specificity problems with the 8F1 antibody.28“30 The fourth trial is using ERCC1 and tumor thymidylate synthase mRNA expression levels for treatment assignment compared with a cisplatin-based control treatment with OS as the primary endpoint and a planned accrual of 700 patients. Results from these trials will help to further delineate the feasibility and technical issues mentioned above. The results of the current study demonstrated the feasibility of our biomarker-based decision algorithm in a multiinstitutional cooperative group environment for patients with surgically resected NSCLC. We identified that the current practice of evaluation and treatment for these patients may present an obstacle to rapid molecular-based decision-making. Although encouraging efficacy data emerged from this trial bioassays that specifically measure platinum-induced DNA damage repair must be developed before further clinical trials are launched that seek to tailor the use of these agents. FUNDING SUPPORT Supported by National Cancer Institute grants CA014028 CA016385 CA020319 CA022453 CA027057 CA032102 CA 035090 CA035119 CA035178 CA035261 CA035431 CA 038926 CA042777 CA045377 CA045560 CA045807 CA0 46113 CA046368 CA046441 CA063844 CA063848 CA0 67575 CA067663 CA073590 CA074647 CA076429 CA10 5409 and CA129343. CONFLICT OF INTEREST DISCLOSURES Dr. Bepler has a patent pending for the use of RRM1 and ERCC1 as biomarkers of treatment benefit for therapeutic decision-making in patients with cancer. REFERENCES 1 Arriagada R Bergman B Dunant A Le Chevalier T Pignon JP Vansteenkiste J International Adjuvant Lung Cancer Trial Collaborative Group Cisplatin-based adjuvant chemotherapy in patients with completely resected non-small-cell lung cancer N Engl J Med 2004 350 351 360 14736927 2 Winton TL Livingston R Johnson D Vinorelbine plus cisplatin versus observation in resected non-small-cell lung cancer N Engl J Med 2005 352 2589 2597 15972865 3 Strauss GM Herndon J Maddaus MA Randomized clinical trial of adjuvant chemotherapy with paclitaxel and carboplatin following resection in stage IB non-small-cell lung cancer: report of the Cancer and Leukemia Group B protocol 9633 [abstract] Proc Am Soc Clin Oncol 2004 23 Page Abstract 7019 4 Strauss GM Herndon JE Maddaus MA Adjuvant paclitaxel plus carboplatin compared with observation in stage IB non-small-cell lung cancer: CALGB 9633 with the Cancer and Leukemia Group B Radiation Therapy Oncology Group and North Central Cancer Treatment Group Study Groups J Clin Oncol 2008 26 5043 5051 18809614 5 Dabholkar M Vionnet J Bostick-Bruton F Yu JJ Reed E Messenger RNA levels of XPAC and ERCC1 in ovarian cancer tissue correlate with response to platinum-based chemotherapy J Clin Invest 1994 94 703 708 8040325 6 Metzger R Leichman CG Danenberg KD ERCC1 mRNA levels complement thymidylate synthase mRNA levels in predicting response and survival for gastric cancer patients receiving combination cisplatin and fluorouracil chemotherapy J Clin Oncol 1998 16 309 316 9440758 7 Lord RV Brabender J Gandara D Low ERCC1 expression correlates with prolonged survival after cisplatin plus gemcitabine chemotherapy in non-small cell lung cancer Clin Cancer Res 2002 8 2286 2291 12114432 8 Olaussen KA Dunant A Fouret P DNA repair by ERCC1 in non-small-cell lung cancer and cisplatin-based adjuvant chemotherapy N Engl J Med 2006 355 983 991 16957145 9 Reynolds C Obasaju C Schell MJ Randomized phase III trial of gemcitabine-based chemotherapy with in situ RRM1 and ERCC1 protein levels for response prediction in non-small-cell lung cancer J Clin Oncol 2009 27 5808 5815 19884554 10 Davidson JD Ma L Flagella M Geeganage S Gelbert LM Slapak CA An increase in the expression of ribonucleotide reductase large subunit 1 is associated with gemcitabine resistance in non-small cell lung cancer cell lines Cancer Res 2004 64 3761 3766 15172981 11 Bergman A Eijk P van Haperen V In vivo induction of resistance to gemcitabine results in increased expression of ribonucleotide reductase subunit M1 as a major determinant Cancer Res 2005 65 9510 9516 16230416 12 Bepler G Kusmartseva I Sharma S RRM1 modulated in vitro and in vivo efficacy of gemcitabine and platinum in non-small-cell lung cancer J Clin Oncol 2006 24 4731 4737 16966686 13 Ceppi P Volante M Novello S ERCC1 and RRM1 gene expressions but not EGFR are predictive of shorter survival in advanced non-small-cell lung cancer treated with cisplatin and gemcitabine Ann Oncol 2006 17 1818 1825 16980606 14 Bepler G Sharma S Cantor A RRM1 and PTEN as prognostic parameters for overall and disease-free survival in patients with non-small-cell lung cancer J Clin Oncol 2004 22 1878 1885 15143080 15 Simon GR Sharma S Cantor A Smith P Bepler G ERCC1 expression is a predictor of survival in resected patients with non-small cell lung cancer Chest 2005 127 978 983 15764785 16 Zheng Z Chen T Li X Haura E Sharma A Bepler G The DNA synthesis and repair genes RRM1 and ERCC1 in lung cancer N Engl J Med 2007 356 800 808 17314339 17 Camp RL Chung GG Rimm DL Automated subcellular localization and quantification of protein expression in tissue microarrays Nat Med 2002 8 1323 1327 12389040 18 Bepler G Williams C Schell MJ Randomized international phase III trial of ERCC1 and RRM1 expression-based chemotherapy"

Lung_Cancer

"Lung cancer Background The complement system plays a critical role in the process of carcinogenesis. Despite of significant research controversial viewpoints remain on the exact relationship of complement system with cancer. Classically the complement system fights against cancer by exerting the effects of immunosurveillance in the immunologic microenvironment of tumors [1]. Recently it was found that complement may contribute to tumor growth by a wide variety of mechanisms including dysregulation of mitogenic signaling pathways sustained cellular proliferation angiogenesis insensitivity to apoptosis invasion and migration and escape from complement cytotoxicity [2]. This suggested complement just like a double-edged sword plays a dual role in carcinogenesis. In particular component C3 and its receptors have been demonstrated to be a key link between innate and adaptive immunity [3]. Complement receptor type 1 (CR1 CD35) is a multifunctional polymorphic glycoprotein which binds to C3b fragment of C3 and to C4b with lower affinity [45]. CR1 belongs to the regulators of complement activation (RCA) family of proteins and is expressed in a wide spectrum of cells and involved in T-cell and B-cell mediated immune regulation [67]. CR1 also modulates the complement cascade activation by preventing formation of classical and alternative pathway convertases and by acting as a cofactor for factor I mediated inactivation of C3b and C4b [89]. It has been demonstrated that chronic inflammation can predispose to cancer development and spread [10] as a fundamental component of innate immunity the complement cascade consists of potential proinflammatory molecules especially C3 and C5. Moreover complement activation and abnormal expression in tumor tissues has been demonstrated [11]. Considering the important role of CR1 in complement activation innate immunity and chronic inflammation CR1 has emerged as a molecule of immense interest in gaining insight into the susceptibility to cancer. CR1 gene is located on the Chromosome 1 at the locus 1q32 [12]. Various polymorphisms have been studied including the intronic and exonic density polymorphism for their ability to alter the density of erythrocyte CR1 on the cell membranes [13-15]. There are also the molecular weight variants due to insertion-deletion polymorphisms [16]. Up to now there have been very few studies on the association of genetic variants of CR1 with susceptibility to autoimmune and inflammatory diseases. It has been proposed that genetic variant at CR1 gene (rs6656401) might influence the susceptibility to late-onset Alzheimer™s disease [17]. CR1 expression in Peripheral Blood Mononuclear Cells (PBMCs) may be a new biomarker for prognosis of nasopharyngeal carcinoma and a potential therapeutic target [18]. Recently it has been indicated that CR1 A3650G (His1208Arg) polymorphism plays a critical role in conferring genetic susceptibility to gallbladder cancer in north Indian population [19]. However the association of genetic variants of CR1 with risk of lung cancer remains unexplored. Worldwide lung cancer is the most common cancer in terms of both incidence and mortality [20]. NSCLC is the most common subtype of lung cancer and less aggressive and metastic than SCLC. Although cigarette smoking is the predominant risk factor for lung cancer inherited genetic characteristics are presumed to account in part for this interindividual variation in lung cancer susceptibility. Recently several genome-wide association studies have demonstrated the common genetic variations associated with susceptibility to lung cancer [21-24]. Given the involvement of the complement system in coordinating innate immunity and inflammatory response [25] further examination of the potential association between genetic variation of CR1 genes and lung cancer is warranted. In the current study we conducted a case-control study to investigate the association of tag SNPs in CR1 gene with the risk of NSCLC and effect of the interaction of gene-environment on the risk of NSCLC. Results Subject characteristics The frequency distributions of select characteristics in cases and control subjects were shown in . The mean age (±SD) was 59.6?±?10.5 years for the cancer patients and 57.2?±?13.3 years for the controls. No significant difference was found in the mean age between cases and controls (P?=?0.470). There was no significant difference in proportion of sex and smoking status between cases and controls (P?=?0.832 and P?=?0.321 respectively). However there was significant difference between cases and controls when compared by pack-year smoked (P = 0.001). The heavy smokers (?25 pack-year) accounted for 61.5% in cases but only 45.5% in controls which suggested that cigarette smoking was a prominent contributor to the risk of lung cancer. Of the 470 case patients 178 (37.9%) were diagnosed as adenocarcinoma 238 (50.6%) as squamous cell carcinoma and 100 (%) as other types including large cell carcinoma (n?=?49) and mixed cell carcinoma (n?=?5). Distributions of select characteristics in cases and control subjects Variables ???Cases (n?=?470) ???Controls (n?=?470) No (%) No (%) P a ???Sex 0.832 ???Male 324 68.9 328 69.8 ???Female 146 31.1 142 30.2 ???Age 0.470 ???<50 84 17.9 96 20.4 ???50-59 177 37.7 187 39.8 ???60-69 129 27.4 111 23.6 ????70 80 17.0 76 16.2 ???Smoking status 0.321 ???Non-smoker 265 56.4 281 59.8 ???Smoker 205 43.6 189 40.2 ???Pack-year smoked 0.001 ???<25 75 36.6 96 50.8 ????25 130 63.4 93 49.2 aTwo-sided ?2 test. Association of CR1 tag SNP with NSCLC risk Total 13 selected tag SNPs of CR1 in HapMap database among Chinese population were analyzed. Except for rs9429782 polymorphism the genotype distributions of other SNPs in controls were consistent to Hardy-Weinberg equilibrium. Therefore we excluded the rs9429782 from further analysis. In order to screen the genetic variants that confer the susceptibility to lung cancer 12 candidate tagSNPs were genotyped in a case-control study consisting of 470 lung cancer patients and 470 cancer-free controls as shown in . Importantly genotype frequency of one intronic SNP (rs7525160 G?>?C) in cases was found to be significantly different from those of controls (?2?=?6.339 P=0.042). Further multivariate regression model with adjustment for age gender and smoking status was used to assess the association between rs7525160 G?>?C polymorphism and the risk of NSCLC. The results indicated that the rs7525160 CC genotype was associated with an increased risk of developing NSCLC with OR (95% CI) of 1.52 (1.02-2.28) compared with the GG genotype. Other tagSNPs of CR1 were not significantly associated with the risk of NSCLC in our study population (P >0.05). Genotype frequencies of CRI among cases and controls and their association with non-small cell lung cancers CRI Genotypes ??Controls (n?=?470) ??Cases (n?=?470) OR (95% CI ) * P No (%) No (%) rs7525160 ??GG 176 37.5 139 29.6 1.00 (ref.) ??CG 228 48.5 256 54.5 1.38 (1.04-1.85) 0.041 ??CC 66 14.0 75 15.9 1.52 (1.02-2.28) 0.028 rs3886100 ??GG 117 24.9 105 22.4 1.00 (ref.) ??AG 223 47.4 253 53.8 1.33 (0.97-1.81) 0.078 ??AA 130 27.7 112 23.8 1.06 (0.73-1.54) 0.755 rs11118167 ??TT 348 74.1 353 75.1 1.00 (ref.) ??CT 111 23.6 102 21.7 0.89 (0.65-1.21) 0.457 ??CC 11 2.3 15 3.2 1.35 (0.61-3.01) 0.461 rs9429782 ??GG 250 53.2 261 55.5 1.00 (ref.) ??GT 220 46.8 209 44.5 0.89 (0.69-1.16) 0.388 rs10494885 ??CC 178 37.9 164 34.9 1.00 (ref.) ??CT 224 47.6 232 49.4 1.11 (0.83-1.47) 0.490 ??TT 68 14.5 74 15.7 1.20 (0.81-1.78) 0.365 rs7542544 ??CC 128 27.2 108 23.0 1.00 (ref.) ??AC 223 47.5 252 53.6 1.21 (0.88-1.67) 0.239 ??AA 119 25.3 110 23.4 0.90 (0.62-1.30) 0.897 rs6691117 ??AA 324 68.9 327 69.6 1.00 (ref.) ??AG 131 27.9 128 27.2 0.98 (0.73-1.31) 0.888 ??GG 15 3.2 15 3.2 0.96 (0.46-2.02) 0.923 rs6656401 ??GG 436 92.8 447 95.1 1.00 (ref.) ??AG 34 7.2 23 4.9 0.68 (0.39-1.18) 0.174 ??AA 0 0.0 0 0.0 NC§ rs2296160 ??CC 185 39.4 194 41.3 1.00 (ref.) ??CT 226 48.1 220 46.8 0.91 (0.69-1.21) 0.521 ??TT 59 12.5 56 11.9 0.90 (0.59-1.37) 0.606 rs9429942 ??TT 452 96.2 457 97.2 1.00 (ref.) ??CT 18 3.8 13 2.8 0.77 (0.37-1.61) 0.482 ??CC 0 0.0 0 0.0 NC§ rs4844600 ??GG 171 36.4 179 38.1 1.00 (ref.) ??AG 230 48.9 228 48.5 0.92 (0.70-1.22) 0.571 ??AA 69 14.7 63 13.4 0.87 (0.58-1.31) 0.513 rs3818361 ??CC 187 39.8 188 40.0 1.00 (ref.) ??CT 224 47.7 224 47.7 0.98 (0.74-1.29) 0.868 ??TT 59 12.5 58 12.3 0.96 (0.63-1.46) 0.848 rs17048010 ??TT 301 64.0 286 60.8 1.00 (ref.) ??CT 154 32.8 164 34.9 1.09 (0.82-1.43) 0.556 ??CC 15 3.2 20 4.3 1.40 (0.70-2.79) 0.343 *Adjusted by age sex and smoking status; §NC not calculated. Table 3 Summary of MDR gene-gene interaction results Models Training bal. acc. (%) Testing bal. acc. (%) P value Cross-validation consistency rs7525160 54.03 50.53 0.828 7/10 rs4844600 rs10494885 55.45 49.32 0.989 3/10 rs4844600 rs10494885 rs7525160 57.60 48.48 0.623 6/10 Generalized Multifactor Dimensionality Reduction (GMDR) was used to evaluate gene-gene interaction. The summary of gene-gene interaction models is listed in Table 3. The SNP rs7525160 in CR1 had the highest testing balanced accuracy among 12 SNPs. The three-way interaction model among rs4844600 rs10494885 and rs7525160 showed high testing balance accuracy and cross validation consistency but the testing balanced accuracy was lower than the two-way gene-gene interaction in NSCLC. For each model the interaction was not significant (P?>?0.05). Table 4 Risk of CR1 genotypes with NSCLC by smoking status Smoking status CR1 genotype GG * OR (95% CI) § P value CG?+?CC * OR (95% CI) § P value Non-smoker 84/99 1.00 (reference) 181/182 1.15 (0.81-1.65) 0.440 Smoker 55/77 0.86 (0.54-1.38) 0.528 150/112 1.72 (1.15-2.59) 0.009 <25 pack-years 19/41 0.59 (0.31-1.10) 0.099 56/55 1.32 (0.81-2.61) 0.266 ?25 pack-years 36/36 1.18 (0.67-2.08) 0.562 94/57 2.01 (1.26-3.20) 0.003 *Number of cases/number of controls. §Data were calculated by logistic regression and adjusted for age and gender. Interaction of CR1 SNP with smoking Cigarette smoking is a well-known risk for lung cancer so stratification by smoking status was performed to investigate the association of rs7525160 G?>?C variant with the risk of NSCLC. As shown in Table 4 the risk of NSCLC was associated with the rs7525160 C allele carriers in smokers with OR (95% CI) of 1.72 (1.15-2.59) but not in non-smokers with OR (95% CI) of 1.15 (0.81-1.65) suggesting that the CR1 rs7525160 G?>?C polymorphism is a smoking-modifying risk factor for susceptibility to NSCLC. When the interaction between smoking status and rs7525160 G?>?C variant was analyzed with cumulative smoking dose (pack-year) consistently GC or CC genotype carriers have increased risk of NSCLC among heavy smokers (pack-year???25) with OR (95% CI) of 2.01 (1.26-3.20) but not among light smokers (pack-year <25) with OR (95% CI) of 1.32 (0.81-2.16). The P value for heterogeneity of the stratification analysis by smoking status is 0.015. However the P value for interaction between rs7525160 polymorphism and smoking is 0.172 and the power for the interaction is 0.49. Discussion The chronic airway inflammation and dysfunctional immune system might promote pulmonary carcinogenesis. Implicated in the immune and inflammatory responses the complement cascade plays a pivotal role in the development of cancer. Thus it is likely that the genetic variants of CR1 in the complement system confer the susceptibility to lung cancer. In this study we have for the first time demonstrated that one intronic SNP (rs7525160 G?>?C) out of 13 tag SNPs of CR1 was associated with the risk of NSCLC in Chinese population. Notably the rs7525160 CC genotype was associated with an increased risk of developing NSCLC (OR?=?1.52 95% CI?=?1.02-2.28; P?=?0.028) compared with the GG genotype. MDR analysis also showed that there was no gene-gene interaction among 12 tag SNPs in CR1 gene. Moreover the risk of NSCLC was associated with the rs7525160 C allele carriers in smokers with OR (95% CI) of 1.72 (1.15-2.59) but not in non-smokers with OR (95% CI) of 1.15 (0.81-1.65) indicating this SNP is a smoking-modifying risk factor for susceptibility to NSCLC. To the best of our knowledge this study shed new insight into the interplay of genetic variation of CR1 with lung cancer risk. More importantly it highlights the potential gene-environmental interaction influences the susceptibility to lung cancer. The complement system has been proposed to get involved in innate immunity with the ability to œcomplement antibody-mediated elimination of immune complex and foreign pathogens [26]. Upon complement activation the biologically active peptides C5a and C3a elicit a lot of pro-inflammatory effects and could be closely associated with tumorigenesis [27]. Complement proteins play a dual role in the tumor microenvironment. On one hand they exert a defensive effect against tumor through complement or antibody-dependent cytotoxicity [128]. On the other hand they may escape from immunosurveillance and facilitate carcinogenesis [2]. Specifically a number of experimental evidence has suggested an association between complement activation and tumor growth [2930] which provides a strong biologically link between the abnormal expression and activity of complement cascade and carcinogenesis. Till now a few studies have been carried out to demonstrate the association of genetic variants in complement proteins with susceptibility to cancer. A significant association of CR2 SNP (rs3813946) with the development of nasopharyngeal carcinoma was indicated in Cantonese population [31] and the genetic variations of complement system genes C5 and C9 plays a potential role in susceptibility to non-Hodgkin lymphoma (NHL) [32]. Recently it has been shown that complement factor H Y402H polymorphism interact with cigarette smoking to confer the susceptibility to lung cancer [33]. Furthermore it has been indicated that CR1 A3650G (His1208Arg) polymorphism plays a critical role in conferring genetic susceptibility to gallbladder cancer in north Indian population [19]. However whether the genetic variants of CR1 are related to the risk of lung cancer remains unknown. In this case-control study we found an intronic SNP (rs7525160 G?>?C) with CC genotype was significantly associated with an increased risk of NSCLC. Consistently our results were in accordance with the study that genetic polymorphisms in innate immunity genes may play a role in the carcinogenesis of lung cancer [34]. It is likely that some genetic variations in strong link disequilibrium with this intronic SNP (rs7525160 G?>?C) are functional which provides a new insight into the hallmarks in susceptibility to lung cancer and further functional experiments are warranted to address the proposal. Functionally human CR1 exists on the surface of almost all peripheral blood cells and plays a key role in immune complex clearance and complement inhibition at the cell surface by binding to activated products C3b and C4b [435]. CR1 also possesses cofactor activity for the serum protease factor I and is thus involved in the generation of further fragments of C3/4b with the activation of complement cascade and the cellular immune response [4]. In our study the association of CR1 polymorphism with lung cancer is biologically plausible in that the intronic polymorphism could affect the density of CR1 molecules on the cell surface thereby contributing to autoimmune disorders and neoplasm. Tobacco smoking is an established risk factor for susceptibility to lung cancer. However not all people who suffer from lung cancer are smokers. Lung cancer in non-smokers can be induced by second hand smoke air pollutants and diesel exhaust [36-39]. Our present data showed significant difference of pack-year smoked but not smoking status between NSCLC cases and controls which suggested the important role of other environmental factors in the development of NSCLC. Tobacco could induce chronic and sustained inflammation in lung microenvironment contributing to pulmonary carcinogenesis in smokers [40]. Support also comes from the epidemiologic data regarding inflammation and lung cancer [41]. CR1 an important molecule implicated in immunity and inflammation could protect the host from invasion of exogenous chemicals derived from cigarette smoking. Genetic variant of CR1 could alter gene function and result in deregulation of the inflammatory and immune responses thereby modulating the susceptibility to lung cancer. More importantly we observed a potential interaction of this SNP (rs7525160 G?>?C) with smoking status suggesting the gene-environmental interaction plays a prominent role in the susceptibility to lung cancer. Our present study has its limitation. Our patients may not be representative of total NSCLC patients at large because they were recruited from only one hospital. In addition due to the relatively small sample size further case-control studies are still needed to replicate and extend our findings. Conclusion We conducted a case-control study in Chinese subjects and found an intronic SNP (rs7525160 G?>?C) of CR1 was significantly associated with lung cancer risk. To the best of our knowledge this study provides the first evidence that genetic variant of CR1 (rs7525160 G?>?C) was a smoking-modifying contributor to the development of lung cancer. Methods Study subjects This case-control study consisted of 470 patients with histopathologically confirmed NSCLC and 470 cancer-free controls. All subjects were genetic unrelated ethnic Han Chinese. Patients were recruited between January 2008 and December 2012 at Tangshan Gongren Hospital (Tangshan China). There were no age gender or stage restrictions however patients with previous malignancy or metastasized cancer from other organs were excluded. The response rate for patients was 94%. The controls were randomly selected from a pool of a cancer-free population from a nutritional survey conducted in the same region. The selection criteria for control subjects included: i) no individual history of cancer; ii) frequency matched to cases according to gender age (±5 years); iii) the residential region; and iv) the time period for blood sample collection. At recruitment informed consent was obtained from each subject and each participant was then interviewed to collect detailed information on demographic characteristics. This study was approved by the institutional review board of Hebei United University. Tag SNPs selection and genotyping Based on the Chinese population data from HapMap database we used Haploview 4.2 program to select candidate tag SNPs with an r2 threshold of 0.80 and minor allele frequency (MAF) greater than 1%. Furthermore we also added two potential functional polymorphisms rs9429942 and rs6691117 [4243]. Therefore we included 13 SNPs in our study which represents common genetic variants in Chinese population. Genotyping was performed at Bomiao Tech (Beijing China) using iPlex Gold Genotyping Asssy and Sequenom MassArray (Sequenom San Diego CA USA). Sequenom™s MassArray Designer was used to design PCR and extension primers for each SNP. Primer information for selected tag SNPs was listed in Table 5. Table 5 Primers used in this study SNP_ID Alleles 1st-PCR primer sequences 2nd-PCR primer sequences UEP sequences rs7525160 G/C ACGTTGGATGCAAAATCAAGGTTTAAAGTC ACGTTGGATGTTCTGACATGTACTGCCTGC CCCTGTTGCCTGGGTTTTTCT rs3886100 G/A ACGTTGGATGGGCCTCAGATCCTCAAAATC ACGTTGGATGTGAGCTGTTTCAGCCAAGAG GAGCCAAGAGGACACTTAG rs11118167 T/C ACGTTGGATGATGTGTGTAGTCACTTAGCC ACGTTGGATGATAATGGCAGATTTAAGGGC CAATGATAAATGAATACTGTGTTCTATC rs9429782 G/T ACGTTGGATGACACGCGGGATCCATCGGAA ACGTTGGATGAACGAGTTTCGCTGGCAGAG GGTGCAGCAGCAGAG rs10494885 C/T ACGTTGGATGGTGTAATGCCACAGACATGC ACGTTGGATGCCAGCCAACTGACCTTTATG CTTCTGATTTTCTTTCCTGTTAC rs7542544 C/A ACGTTGGATGGCTAAGAGCCATTAGTGTGC ACGTTGGATGAACGTGGTGGTGCCCAAACA CCATGACCCCAAAGC rs6691117 A/G ACGTTGGATGAGAGTACCAGGAAACAGGAG ACGTTGGATGACCCTACCATGACAAACCCG CCGGGCTGACATCTAAATCTGA rs6656401 G/A ACGTTGGATGAAAGGACACACACAGAGGAG ACGTTGGATGCGTTGATGTTCCTTGGCTTG CTCTGTCTCCATCTTCTC rs2296160 C/T ACGTTGGATGCCAGAATTCCTCAGCAAAAC ACGTTGGATGCCAGAGTGATGTTTTGTGAC CGTGCCTTTTGTCTTCCTTTTAGGT rs9429942 T/C ACGTTGGATGTACATGTGCACAACGTGCAG ACGTTGGATGAAGGACGAGTTAATGGGTGC GGGAACGTCGCACATGTAT rs4844600 G/A ACGTTGGATGGAATGGCTTCCATTTGCCAG ACGTTGGATGGGGCGGCATTCATAGTTCAG CCCAATGGGAAACTCAAA rs3818361 C/T ACGTTGGATGTGGAAAGGACAGTTCCAGAG ACGTTGGATGTTTTAAGCCCTCTGGTAAGC TAATCCCTCTGGTAAGCATAAGATATA rs17048010 T/C ACGTTGGATGTTTCAAGGCTGCTCCTTGTT"

Lung_Cancer

"The lower replication rate of adipose meQTLs in whole-blood samples6 might be explained by the heterogeneity of different cell types in whole blood and by their more liberal P-value threshold (8.6—10?4) which led to the identification of a large number of weak cis-meQTLs. Compared with cis-regulation trans-eQTL regulation is typically considered to be more complex has smaller effect sizes and is more difficult to be replicated even in the same tissue. However in our study the lung trans-meQTLs are highly reproducible in TCGA lung breast and kidney tissues. Notably this similarity allows mapping meQTLs with substantially improved power by borrowing strength across tissues51. meQTL SNPs are strongly associated with multiple epigenetic marks. Chromatin regulators play a role in maintaining genomic integrity and anization52. We found that meQTL SNPs were strongly enriched for DNase hypersensitive sites and sequences bound by CTCF or modified histones. SNPs could affect these epigenetic marks by several mechanisms such as by affecting the core recognition sequences (exemplified for rs2816057 on chromosome 1 for CTCF) causing loss or gain of a CpG within a binding region which when methylated could affect binding27 or altering the binding sequence for interacting factors53. CTCF could cause changes in epigenetic marks through its multiple key roles including genome anization through mediating intra- and inter-chromosomal contacts5455 the regulation of transcription by binding between enhancers and promoters5456 and the regulation of splicing which may impact tissue specificity during tissue development39. These changes can impact regulation of distant genes and not the genes proximal to the SNPs that would be typically investigated in eQTL studies. This may be one reason for the previously observed lack of correlation between eQTLs and meQTLs347. Future large studies integrating SNP profiles the DNA methylome and transcriptome data through tissue developmental stages will hopefully shed light on this possibility. There may be a myriad of other DNA-binding factors whose binding is directly or indirectly affected by SNPs. For example among the histone marks the strongest enrichment of meQTLs in our study was for H3K4me3 in both SAEC and hAEC cell types. As H3K4me3 is the chromatin mark primarily associated with regulatory elements at promoters and enhancers this suggests a strong influence of meQTLs on regulating gene activity. Unfortunately transcription factor binding data in SAEC or hAEC are not available so we could not test whether SNPs in their core sequence could affect the deposition of epigenetic marks e.g. by recruiting DNA methyltransferases57. It will be important to obtain ChIP data from relevant primary cells for numerous DNA-binding regulatory factors to further elucidate the mechanisms whereby meQTLs and other SNP-affected epigenetic marks arise. In we show here that genetic variation has a profound impact on the DNA methylome with implications for cancer risk tissue specificity and chromatin structure and anization. The meQTL data (Supplementary Data) attached to this manuscript provides an important resource for studying genetic-DNA methylation interactions in lung tissue. Methods Sample collection We assayed 244 fresh frozen paired tumor and non-involved lung tissue samples from Stage I to IIIA non-small cell lung cancer (NSCLC) cases from the Environment And Genetics in Lung cancer Etiology (EAGLE) study18. EAGLE includes 2100 incident lung cancer cases and 2120 population controls enrolled in 2002“2005 within 216 municipalities of the Lombardy region of Italy. Cases were newly diagnosed primary cancers of lung trachea and bronchus verified by tissue pathology (67.0%) cytology (28.0%) or review of clinical records (5.0%). They were 35?79 years of age at diagnosis and were recruited from 13 hospitals which cover over 80% of the lung cancer cases from the study area. The study was approved by local and NCI Institutional Review Boards and all participants signed an informed consent form. Lung tissue samples were snap-frozen in liquid nitrogen within 20 minutes of surgical resection. Surgeons and pathologists were together in the surgery room at the time of resection and sample collection to ensure correct sampling of tissue from the tumor the area adjacent to the tumor and an additional area distant from the tumor (1“5 cm). The precise site of tissue sampling was indicated on a lung drawing and the pathologists classified the samples as tumor adjacent lung tissue and distant non-involved lung tissue. For the current study we used lung tissue sampled from an area distant from the tumor to reduce the potential effects of field cancerization. DNA methylation profiling and data quality control Fresh frozen lung tissue samples remained frozen while approximately 30 mg was subsampled for DNA extraction into pre-chilled 2.0 ml microcentrifuge tubes. Lysates for DNA extraction were generated by incubating 30 mg of tissue in 1 ml of 0.2 mg/ml Proteinase K (Ambion) in DNA Lysis Buffer (10 mM Tris-Cl (pH 8.0) 0.1 M EDTA (pH 8.0) and 0.5% (w/v) SDS) for 24 hrs at 56°C with shaking at 850 rpm in Thermomixer R (Eppendorf). DNA was extracted from the generated lysate using the QIAamp DNA Blood Maxi Kit (Qiagen) according to the manufacturer™s protocol. Bisulfite treatment and Illumina Infinium HumanMethylation450 BeadChip assays were performed by the Southern California Genotyping Consortium at the University of California Los Angeles (UCLA) following Illumina™s protocols. This assay generates DNA methylation data for 485512 cytosine targets (482421 CpG and 3091 CpH) and 65 SNP probes for the purpose of data quality control. Raw methylated and unmethylated intensities were background corrected and dye-bias equalized to correct for technical variation in signal between arrays. For background correction we applied a normal-exponential convolution using the intensity of the Infinium I probes in the channel opposite their design to measure non-specific signal58. "

Lung_Cancer

"One limitation of this study is the small number of cases under study although 15 FISH-positive cases is comparable to most other studies. The relatively small number of FISH-negative cases may have affected our ability to identify FISH-negative IHC-positive cases. However the study design does permit an assessment of the sensitivity of the IHC assay which is the most important consideration for a possible screening test. Our comparison of the immunohistochemical assays was not directly equivalent as the D5F3 assay included a proprietary tyramide signal amplification step whereas the ALK1 and 5A4 assays were conducted using our routine diagnostic detection system. However our study design also has several strengths. In particular the use of archival diagnostic paraffin blocks and FISH testing conducted in the course of routine diagnosis make the results of the study directly relevant to clinical practice. In summary we find IHC to be a highly sensitive (86%) and specific (100%) test for ALK rearrangement in lung adenocarcinoma. We find a slight advantage of a proprietary amplified assay (D5F3 Ventana) over two other antibodies with conventional DAB staining (ALK1 Dako and 5A4 Abcam) but only in scanty samples. Intensity of staining was the most discriminating measure and the proportion of cells staining did not contribute. We identified two cases that were positive for the ALK rearrangement by FISH but negative by all immunohistochemical assays and suggest that in discordant cases the IHC test result may be more predictive of treatment response than FISH. Further discordant cases need to be examined to help guide the treatment of these cases. Immunohistochemical testing is clearly at least a useful adjunct to FISH and we feel that it is reasonable in routine practice to use a sensitive IHC assay as a screening test. The danger of missing treatable cases using this method (i.e. FISH-positive IHC-negative crizotinib-sensitive tumors) appears very small especially when specimens contain adequate material. In difficult cases further investigations such as re-biopsy and repeated IHC/FISH may be helpful. Disclosure: This project was supported by the National Institute of Health Research Respiratory Disease Biomedical Research Unit at the Royal Brompton and Harefield NHS Foundation Trust and Imperial College London and the NIHR RM/ICR Biomedical Research Center. All other authors declare no conflict of interest. REFERENCES 1. Inamura K Takeuchi K Togashi Y EML4-ALK lung cancers are characterized by rare other mutations a TTF-1 cell lineage an acinar histology and young onset. Mod Pathol 2009 22 508 515 19234440 2. Koivunen JP Mermel C Zejnullahu K EML4-ALK fusion gene and efficacy of an ALK kinase inhibitor in lung cancer. Clin Cancer Res 2008 14 4275 4283 18594010 3. Shinmura K Kageyama S Tao H EML4-ALK fusion transcripts but no NPM- TPM3- CLTC- ATIC- or TFG-ALK fusion transcripts in non-small cell lung carcinomas. Lung Cancer 2008 61 163 169 18242762 4. Soda M Choi YL Enomoto M Identification of the transforming EML4-ALK fusion gene in non-small-cell lung cancer. Nature 2007 448 561 566 17625570 5. To KF Tong JH Yeung KS Detection of ALK rearrangement by immunohistochemistry in lung adenocarcinoma and the identification of a novel EML4-ALK variant. J Thorac Oncol 2013 8 883 891 23625156 6. McDermott U Iafrate AJ Gray NS Genomic alterations of anaplastic lymphoma kinase may sensitize tumors to anaplastic lymphoma kinase inhibitors. Cancer Res 2008 68 3389 3395 18451166 7. Kwak EL Bang YJ Camidge DR Anaplastic lymphoma kinase inhibition in non-small-cell lung cancer. N Engl J Med 2010 363 1693 1703 20979469 8. Lindeman NI Cagle PT Beasley MB Molecular testing guideline for selection of lung cancer patients for EGFR and ALK tyrosine kinase inhibitors: guideline from the College of American Pathologists International Association for the Study of Lung Cancer and Association for Molecular Pathology. J Thorac Oncol 2013 8 823 859 23552377 9. Murakami Y Mitsudomi T Yatabe Y A Screening Method for the ALK Fusion Gene in NSCLC. Front Oncol 2012 2 24 22655265 10. Rodig SJ Mino-Kenudson M Dacic S Unique clinicopathologic features characterize ALK-rearranged lung adenocarcinoma in the western population. Clin Cancer Res 2009 15 5216 5223 19671850 11. Peled N Palmer G Hirsch FR Next-generation sequencing identifies and immunohistochemistry confirms a novel crizotinib-sensitive ALK rearrangement in a patient with metastatic non-small-cell lung cancer. J Thorac Oncol 2012 7 e14 e16 22895149 12. Eisenhauer EA Therasse P Bogaerts J New response evaluation criteria in solid tumours: revised RECIST guideline (version 1.1). Eur J Cancer 2009 45 228 247 19097774 13. Selinger CI Rogers TM Russell PA Testing for ALK rearrangement in lung adenocarcinoma: a multicenter comparison of immunohistochemistry and fluorescent in situ hybridization. Mod Pathol 2013 26 1545 1553 23743928 14. Conklin CM Craddock KJ Have C Laskin J Couture C Ionescu DN Immunohistochemistry is a reliable screening tool for identification of ALK rearrangement in non-small-cell lung carcinoma and is antibody dependent. J Thorac Oncol 2013 8 45 51 23196275 15. Sholl LM Weremowicz S Gray SW Combined use of ALK immunohistochemistry and FISH for optimal detection of ALK-rearranged lung adenocarcinomas. J Thorac Oncol 2013 8 322 328 23407557 16. Savic S Bode B Diebold J Detection of ALK-positive non-small-cell lung cancers on cytological specimens: high accuracy of immunocytochemistry with the 5A4 clone. J Thorac Oncol 2013 8 1004 1011 23689429 Br J Cancer Br. J. Cancer British Journal of Cancer 0007-0920 1532-1827 Nature Publishing Group 24292447 3915116 bjc2013735 10.1038/bjc.2013.735 Clinical Study A phase II multicentre study of ziv-aflibercept in combination with cisplatin and pemetrexed in patients with previously untreated advanced/metastatic non-squamous non-small cell lung cancer Ziv-aflibercept/cisplatin/pemetrexed in NSCLC Chen H 1 * Modiano M R 2 Neal J W 3 Brahmer J R 4 Rigas J R 5 Jotte R M 6 Leighl N B 7 Riess J W 3 Kuo C J 3 Liu L 8 Gao B 8 DiCioccio A T 8 Adjei A A 1 Wakelee H A 3 1Department of Medicine Roswell Park Cancer Institute Elm & Carlton Streets Buffalo NY 14263 USA 2Arizona Oncology/Arizona Clinical Research Center 1620W. St Mary's Rd Tucson AZ 85745 USA 3Department of Medicine Stanford University School of Medicine and Cancer Institute 875 Blake Wilbur Dr Stanford CA 94305 USA 4Department of Oncology The Sidney Kimmel Comprehensive Cancer Center at Johns Hopkins Bunting/Blaustein CRB 1650 Orleans St. G94 Baltimore MD 21231 USA 5Department of Medicine Norris Cotton Cancer Center Geisel School of Medicine at Dartmouth 1 Medical Center Drive Lebanon NH 03756 USA 6Rocky Mountain Cancer Centers 1800 Williams Street Suite 200 Denver CO 80218 USA 7Department of Medicine Princess Margaret Hospital and University of Toronto 610 University Avenue Toronto ON M5G 2M9 Canada 8Regeneron Pharmaceuticals Inc. 777 Old Saw Mill River Road Tarrytown NY 10591 USA *E-mail: hongbin.chenroswellpark. 04 02 2014 28 11 2013 110 3 602 608 29 08 2013 27 10 2013 30 10 2013 Copyright 2014 Cancer Research UK 2014 Cancer Research UK From twelve months after its original publication this work is licensed under the Creative Commons Attribution-NonCommercial-Share Alike 3.0 Unported License. To view a copy of this license visit http://creativecommons./licenses/by-nc-sa/3.0/ Background: This study evaluated the efficacy and safety of ziv-aflibercept in combination with cisplatin and pemetrexed in non-small cell lung cancer (NSCLC). Methods: This single arm multicentre phase II trial enrolled patients with previously untreated locally advanced or metastatic non-squamous NSCLC. Patients received intravenous ziv-aflibercept 6?mg?kg?1 pemetrexed 500?mg?m?2 and cisplatin 75?mg?m?2 every 21 days for up to six cycles. Maintenance administration of ziv-aflibercept was to continue until disease progression intolerable toxicity or other cause for withdrawal. The co-primary end points were objective response rate (ORR) and progression-free survival (PFS). Planned sample size was 72 patients. Results: The study was closed prematurely because of three confirmed and two suspected cases of reversible posterior leukoencephalopathy syndrome (RPLS). A total of 42 patients were enrolled. Median age was 61.5 years;"

Lung_Cancer

"Therefore using the combined sample from the LSC and PLuSS ROC curves were generated using the 3-gene model the full 11-gene model and covariates-only model in male former smokers (Figure 1). Likelihood ratio tests confirmed that both the 3-gene and 11-gene models are significantly more discriminative than the covariates only model (p?=?0.0002 and p?=?0.002 respectively); however the 3- and 11-gene models were not significantly different from each other (p?=?0.29). Areas under the curve (AUC) were 0.74 and 0.80 for the 3- and 11-gene models respectively while the AUC was 0.55 for the covariates only model. Although sample sizes were small in cohort-stratified analyses of male former smokers these analyses demonstrate that the increased discriminative power of the 3-gene model is observed in two independent cohorts (Additional file 1: Figure S1). ROC curves comparing the sensitivity and specificity of 3- and 11-gene methylation panels for classifying CMH. ROC curves were generated by applying logistic regression models to male former smokers (n?=?139) from the combined PLuSS and LSC. The covariates included age pack years education and COPD. AUC is indicated in parentheses. Discussion This study demonstrates a significant association between CMH and prevalence of promoter methylation in sputum of lung cancer risk genes in two geographically distinct cohorts. This association was especially strong in males and in former smokers and SULF2 was the most consistently associated gene. Importantly the overall association between CMH and methylation and the specific effects of sex and smoking status were observed independently in both cohorts. Combining the two cohorts strengthened the statistical significance of these associations. The central finding of our study is that male former smokers with unresolved CMH may be at an increased risk of lung cancer. Given that 50% of persons diagnosed with lung cancer are former smokers prospective studies evaluating the methylation status of former smokers with CMH who subsequently develop lung cancer are needed [26]. The eleven genes examined in this study were selected based on prior evidence that they are associated with lung cancer risk [1718]. Therefore increased prevalence of methylation of these genes may predict lung cancer among subjects with CMH. These gene promoters have all been shown to be methylated in tumors [2728] and are proposed to represent an expanding field of precancerous epigenetic changes in the aerodigestive tract of smokers [1729]. This hypothesis is supported by the observation that the methylation prevalence of these gene promoters increases as the time to lung cancer diagnosis decreases [17]. Mounting evidence indicates that these changes are causal for tumor initiation [30-33]. The association between methylation and CMH was markedly stronger in males than in females (Table 4). Univariate analysis of males and females in both cohorts (Additional file 1: Tables S3 and S4) reveals that females with CMH are significantly younger than female controls in the LSC; however this was not true in the PLuSS. Additionally age was a covariate in all adjusted analyses and thus is unlikely to account for the lack of association between methylation and CMH in females. This apparent protective mechanism in females warrants further study. The association between methylation and CMH was also stronger in former than in current smokers (Table 5). The increase in effect size in former smokers may be due to several reasons: (1) the CMH phenotype in former smokers may not be confounded by cough and phlegm caused by irritation due to current smoking; (2) in susceptible smokers CMH that persists in spite of smoking cessation may represent a phenotype with a more distinct molecular pathology; (3) The association between CMH and gene promoter methylation may be stronger with age. In the LSC and PLuSS cohorts former smokers were significantly older than current smokers (mean age difference 4.2 years data not shown). This age difference between former and current smokers also likely explains the puzzling observation that current smokers have lower overall methylation compared to former smokers (Additional file 1: Table S2); current smokers are younger and younger age is associated with less total methylation in these lung cancer risk genes. Numerous studies have demonstrated that prior CMH significantly increases the risk for later development of lung cancer (reviewed in [1516]). Assessment of the latency period between diagnosis of CMH and diagnosis of lung cancer has shown that this risk increases with time since diagnosis of CMH [34]. In one study [34] the odds ratio nearly quadrupled at latency >15 years compared to latency 1“5 years. Importantly this suggests that CMH may serve as a precursor to lung carcinogenesis [34]. We hypothesize that the increased prevalence for methylation of the lung cancer risk genes seen in this study may help explain the epidemiological link between CMH and lung cancer. Further studies are needed to establish a direct link between gene methylation and lung cancer. Interestingly while SULF2 p16 JPH3 and PCDH20 all demonstrate evidence for association with CMH in the current study a previous study determined that GATA4 promoter methylation was associated with airflow obstruction [35]. These findings suggest that major differences exist in the genes affected by aberrant promoter methylation in distinct COPD sub-phenotypes. This is consistent with the major pathophysiological differences that underlie emphysema and chronic mucous hypersecretion [36] and suggests the role basal cell hyperplasia may play in development of lung cancer [37]. Of the 11 genes analyzed SULF2 demonstrated the strongest association with CMH. SULF-2 is an extracellular enzyme that catalyzes the hydrolysis of 6-O-sulfo groups from heparan sulfate polysaccharides [38-40]. Heparan sulfate proteoglycans (HSPGs) are widely distributed on cell membranes and the extracellular matrix and serve as coreceptors for many growth factors and cytokines [41] and the position of 6-O sulfates is of particular importance for ligand binding [38-40]. Epigenetic inactivation of SULF2 either by siRNA treatment or promoter methylation activates numerous type I interferon (IFN)-inducible genes [42]. It was proposed that silencing of SULF2 prevents the removal of sulfate groups from IFN-binding sites which may preserve either the binding affinity or bioavailability of interferons leading to increased transcription of multiple IFN-inducible genes [42]. It is plausible that CMH caused by metaplastic mucous cells that are sustained due to dysregulated cell death mechanisms that involve IFN signaling [43-45] creates an inflammatory milieu which causes methylation of SULF2. In turn the type 1 interferon response induced by methylation of SULF2 may help to perpetuate the inflammation associated with CMH. This is the first report of epigenetic changes in the airways of individuals with CMH. Strengths of the study include the use of the large well-characterized LSC for the initial phase of study and excellent replication of all main findings in the geographically distinct PLuSS. We chose the standard definition for chronic bronchitis in the LSC and a definition that most closely captured the standard clinical definition of chronic bronchitis in the PLuSS. While the differences in questionnaires used to define CMH could be considered a limitation in the study the definition for CMH was applied to PLuSS subjects prior to any data analysis and was not subsequently modified. We propose that this approach improves the rigor of our validation. "

Lung_Cancer

".0091577.g004 The peripheral mu opioid receptor antagonist methylnaltrexone (MNTX) inhibits EGF-induced phosphorylation of Src PI3 kinase and STAT3 in human lung cancer cells. Panel A: Human H358 non-small cell lung cancer (NSCLC) cells were either untreated (control) or treated with 100 nM MNTX alone 10 ng/ml EGF for 5 15 or 30 minutes or 100 nM MNTX and 10 ng/ml EGF for 515 or 30 minutes. Cell lysates were obtained and immunoblotted using anti-phospho-Src (pY416) (a) anti-phospho-p85/p55 PI3 kinase (pY458/pY199) (bc) anti-phospho-STAT3 (pY705) (d) and anti-actin (e) antibodies. Panel B: Graphical quantitation of immunoreactivity of experiments performed described in -B and Panel A with normalization to total specific protein and n?=?3 independent experiments per condition. An asterisk (*) indicates a statistically significant difference (p<0.05) from control. The error bars?=?standard deviation. We next examined the mechanism by which EGF and DAMGO ([D-Ala2 N-MePhe4 Gly-ol]-enkephalin) a synthetic opioid peptide with specificity for MOR) induce proliferation and migration. illustrates that siRNA and/or chemical inhibition of MOR Gab-1 Src PI3K Akt and STAT3 markedly decrease EGF and DAMGO-induced proliferation (-A) and migration (-B). .0091577.g005 Inhibiting the mu opioid receptor (MOR) Gab-1 Src PI3 kinase Akt or STAT3 attenuates EGF and DAMGO-induced proliferation and migration in human lung cancer cells. Panel A: Human H358 non-small cell lung cancer (NSCLC) cells were analyzed for EGF and DAMGO-mediated proliferation using a MTS proliferation assay. H358 human NSCLC cells were either untreated (control) or treated with 100 ng/ml epidermal growth factor (EGF) or 100 nM DAMGO for 72 hours with or without pretreatment of cells with the peripheral MOR antagonist methylnaltrexone (MNTX 100 nM) MOR siRNA Gab-1 siRNA Src siRNA the PI3 kinase inhibitor LY294002 (10 uM) Akt Inhibitor X (5 uM) the Src family kinase inhibitor PP2 (100 nM) or the STAT3 inhibitor Stattic (10 uM). There is a statistically significant difference (p<0.05 indicated by an asterisks) between control and treatment groups with n?=?3 independent experiments per condition and error bars?=?standard deviation. See the Methods section for experimental details. Panel B: Human H358 non-small cell lung cancer (NSCLC) cells were analyzed for EGF and DAMGO-mediated migration using a transwell assay (8 uM pore size). H358 human NSCLC cells were either untreated (control) or treated with 100 ng/ml epidermal growth factor (EGF) or 100 nM DAMGO for 18 hours with or without pretreatment of cells with the peripheral MOR antagonist methylnaltrexone (MNTX 100 nM) MOR siRNA Gab-1 siRNA Src siRNA the PI3 kinase inhibitor LY294002 (10 uM) Akt Inhibitor X (5 uM) the Src family kinase inhibitor PP2 (100 nM) or the STAT3 inhibitor Stattic (10 uM). There is a statistically significant difference (p<0.05 indicated by an asterisks) between control and treatment groups with n?=?3 independent experiments per condition and error bars?=?standard deviation. See the Methods section for experimental details. Since very little is known about MOR regulation of epithelial mesenchymal transformation (EMT) and the molecular mechanisms integrating cancer cell proliferation migration and EMT we next examined whether MOR1 overexpression regulates lung cancer EMT. In -AB we observed that MOR overexpression in human H358 NSCLC cells induced a change in EMT marker expression which is consistent with an epithelial mesenchymal transition [19]. Since the MOR is the main receptor for certain opioids [4] [43] we next evaluated whether opioids can induce EMT in human H358 NSCLC cells. -C indicates that DAMGO morphine and fentanyl all induce EMT in NSCLC in a dose-dependent manner. .0091577.g006 Overexpression or silencing of the mu opioid receptor (MOR) or addition of opioids in human lung cancer cells regulates epithelial mesenchymal transition (EMT). Panel A: Control (non-transfected)(C) stable vector control (VC) and MOR1 overexpressing (O/E) H358 cell lines were generated cell lysates obtained and immunoblotted with EMT markers anti-vimentin (a) anti-Snail (b) anti-Slug (c) anti-claudin-1 (d) anti-ZO-1 (e) anti-MOR (f) and anti-actin (g) antibodies. An increase in vimentin Snail and Slug expression and a decrease in claudin-1 and ZO-1 expression suggest an epithelial mesenchymal transition. Panel B: Graphical quantitation of immunoreactivity of experiments performed described in Panel A with n?=?3 independent experiments per condition. An asterisk (*) indicates a statistically significant difference (p<0.05) from control with error bars?=?standard deviation. Panel C: H358 human NSCLC cells were either untreated treated with 100 ng/ml epidermal growth factor (EGF) 100 nM DAMGO morphine or fentanyl or 100 ng/ml insulin growth factor (IGF) for 96 hours cell lysates obtained and immunoblotted with EMT markers anti-vimentin (a) anti-Snail (b) anti-Slug (c) anti-claudin-1 (d) anti-ZO-1 (e) anti-MOR (f) and anti-actin (g) antibodies. A decrease in vimentin Snail and Slug expression and an increase in claudin-1 and ZO-1 expression suggest inhibition of epithelial mesenchymal transition. Panel D: Control shRNA or MOR shRNA H358 cell lines were generated cell lysates obtained and immunoblotted with EMT markers anti-vimentin (a) anti-Snail (b) anti-Slug (c) anti-claudin-1 (d) anti-ZO-1 (e) anti-MOR (f) and anti-actin (g) antibodies. An increase in vimentin Snail and Slug expression and a decrease in claudin-1 and ZO-1 expression suggest an epithelial mesenchymal transition. Considering these H358 human NSCLC cells express basal levels of MOR and respond to opioid treatment we examined whether silencing (shRNA) of MOR would affect opioid and growth factor-induced EMT. -D indicates MOR silencing inhibits opioid and EGF/IGF-induced changes in EMT marker expression. -A indicates that H358 cells grow in colonies with well demarcated borders and strong cell-cell adhesions. In contrast morphine or IGF-treated H358 cells show a loss of cell-cell adhesions and a change from cuboidal to an elongated phenotype with several cellular projections visible. These changes are consistent with an epithelial mesenchymal transition (EMT). .0091577.g007 Morphologic and epithelial mesenchymal transition (EMT) marker changes in human lung cancer cells with opioids growth factors and signal transduction pathway inhibitors. Panel A: H358 human NSCLC cells were either untreated (control) treated with 100 nm morphine or 100 ng/ml insulin growth factor (IGF) for 96 hours and brightfield images were obtained (20—). H358 cells grow in colonies with well demarcated borders and strong cell-cell adhesions. In contrast morphine or IGF-treated H358 cells show a loss of cell-cell adhesions and a change from cuboidal to an elongated phenotype with several cellular projections visible. These changes are consistent with an epithelial mesenchymal transition (EMT). Panel B: H358 human NSCLC cells were either untreated treated with 100 ng/ml epidermal growth factor (EGF) 100 nM DAMGO morphine or fentanyl or 100 ng/ml insulin growth factor (IGF) for 96 hours with or without pretreatment with the peripheral MOR antagonist methylnaltrexone (MNTX 100 nM) the Src family kinase inhibitor PP2 (100 nM) or the STAT3 inhibitor Stattic (10 uM). Cell lysates were then obtained and immunoblotted with EMT markers anti-vimentin (ace) or anti-claudin-1 (bdf) antibodies. An increase in vimentin expression and a decrease in claudin-1 expression suggest an epithelial mesenchymal transition. We next examined potential signal transduction proteins that could potentially regulate opioid and growth factor-induced EMT. -B indicates pretreatment with the peripheral MOR antagonist methylnaltrexone (MNTX) the Src family kinase inhibitor PP2 or the STAT3 inhibitor Stattic reverse the opioid and growth factor-induced changes in vimentin and claudin-1 expression. In addition indicates siRNA and/or chemical inhibition of MOR Gab-1 Src PI3K Akt and STAT3 dramatically inhibits EMT (as determined by inhibition of opioid and growth factor-induced increase in vimentin expression and decrease in claudin-1 expression). Both MNTX and the MOR inhibitor naloxone attenuated opioid and growth factor-induced EMT indication a general effect of MOR antagonists on this process (Figures 7 and 8 and supporting data Figure S1). Taken together our data suggest MOR plays a central role in the processes of proliferation migration and epithelial mesenchymal transition alone and in conjunction with opioids and growth factors. .0091577.g008 Inhibiting the mu opioid receptor (MOR) Src Gab-1 PI3 kinase or STAT3 attenuates opioid and growth factor-induced epithelial mesenchymal transition (EMT) in human lung cancer cells. Panel A: Graphical representation of the % control vimentin expression. H358 human NSCLC cells were either untreated treated with 100 ng/ml epidermal growth factor (EGF) 100 nM DAMGO morphine or fentanyl or 100 ng/ml insulin growth factor (IGF) for 96 hours with or without pretreatment of cells with the peripheral MOR antagonist methylnaltrexone (MNTX 100 nM) MOR siRNA Gab-1 siRNA Src siRNA the PI3 kinase inhibitor LY294002 (10 uM) Akt Inhibitor X (5 uM) the Src family kinase inhibitor PP2 (100 nM) or the STAT3 inhibitor Stattic (10 uM). Cell lysates were then obtained and immunoblotted with the EMT marker anti-vimentin antibody. Experiments were repeated in triplicate and immunoreactive bands were analyzed using computer-assisted densitometry. There is a statistically significant difference (p<0.05 indicated by asterisks (*)) between control and treatment groups with error bars?=?standard deviation. An increase in vimentin expression is suggestive of an epithelial mesenchymal transition. Panel B: Graphical representation of the % control claudin-1 expression. H358 human NSCLC cells were either untreated treated with 100 ng/ml epidermal growth factor (EGF) 100 nM DAMGO morphine or fentanyl or 100 ng/ml insulin growth factor (IGF) for 96 hours with or without pretreatment of cells with the peripheral MOR antagonist methylnaltrexone (MNTX 100 nM) MOR siRNA Gab-1 siRNA Src siRNA the PI3 kinase inhibitor LY294002 (10 uM) Akt Inhibitor X (5 uM) the Src family kinase inhibitor PP2 (100 nM) or the STAT3 inhibitor Stattic (10 uM). Cell lysates were then obtained and immunoblotted with the EMT marker anti-claudin-1 antibody. Three independent experiments per condition were performed and immunoreactive bands were analyzed using computer-assisted densitometry. There is a statistically significant difference (p<0.05 indicated by asterisks (*)) between control and treatment groups with error bars?=?standard deviation. A decrease in claudin-1 expression is suggestive of an epithelial mesenchymal transition. Discussion NSCLC which accounts for ?80% of all lung cancers is a disease with high mortality and few treatment options [44] [45]."

Lung_Cancer

"However as in the phase I study a stabilisation of median haemoglobin values for multiple cycles as well as low rate of all-grade anaemia was observed. The result provides some support for the hypothesis that VEGF is a negative regulator of erythropoiesis and its inhibitors may have a role in the management of anaemia. The toxicity profile of this trial was consistent with published data on cisplatin plus pemetrexed and with the known effects of ziv-aflibercept with the exception of a higher than anticipated rate of RPLS (Gadgeel 2012). Hypertension was the third most frequent TEAE and is a known adverse effect of anti-VEGF therapies. However higher response rate was observed among patients who developed hypertension during the treatment than among those who did not in a post hoc analysis. This observation is consistent with data from ECOG 4599 that suggested improved outcomes associated with bevacizumab in patients developing hypertension on therapy (Dahlberg et al 2010). Although cases of RPLS have been observed in other ziv-aflibercept studies the 7% rate observed in this study was much higher. It should be noted that the dose and schedule of ziv-aflibercept in this study at 6?mg?kg?1 every 21 days is different from the one approved in colorectal cancer at 4?mg?kg?1 every 14 days (Van Cutsem et al 2012) although the dose intensity is the same at 2?mg?kg?1 per week. At the recommended phase II dose of 6?mg?kg?1 for ziv-aflibercept no RPLS was reported in the phase I study that used the same regimen (N=7 at that dose level; Diaz-Padilla et al 2012) or in another phase I study of ziv-aflibercept/cisplatin/docetaxel (N=17 at that dose level; Freyer et al 2012) nor in combination with docetaxel in the VITAL study (N=456 in the combination arm; Ramlau et al 2012). A meta-analysis of safety data from three large placebo-controlled studies reported no RPLS among 1333 patients treated with ziv-aflibercept in combination with standard chemotherapy (Allegra et al 2012). It is likely that the development of RPLS may be regimen dependent rather than dose or schedule dependent. Reversible posterior leukoencephalopathy syndrome is described as a brain-capillary leak syndrome frequently related to hypertension fluid retention and possibly the cytotoxic effects of immunosuppressive agents on the vascular endothelium (Hinchey et al 1996). Risk factors include female sex hypertension and renal dysfunction (Vaughn et al 2008) as well as anticancer agents: 75% were diagnosed in women and 71% were associated with combination regimens (Marinella and Markert 2009). Bevacizumab and gemcitabine have been most commonly associated with RPLS. Treatment including cisplatin without concomitant anti-VEGF therapy has been associated with RPLS (Ito et al 1998) whereas pemetrexed before this study was not. Consistent with the literature the three cases of RPLS were all diagnosed in women which may be related to an anticancer drug“oestrogen interaction inducing altered cerebral vasoreactivity and endothelial dysfunction. Agents that decrease VEGF signalling increases the risk of RPLS (including bevacizumab sunitinib sorafenib and ziv-aflibercept) suggesting a class effect toxicity (Glusker et al 2006). Clinical features of RPLS are neurological symptoms characterized by headaches altered mental status visual disturbances or seizures and systemic signs such as hypertension. Onset is variable ranging from hours to 1 month after completing therapy (Lee et al 2008). Characteristic findings in brain MRI demonstrate bilateral symmetric parieto-occipital subcortical and cortical vasogenic oedema (Bartynski 2008). Removal of the causative agent and treatment of hypertension and renal insufficiency are indicated for RPLS which is usually but not always reversible clinically. In this phase II study was designed to evaluate ziv-aflibercept in combination with cisplatin and pemetrexed in patients with untreated advanced/metastatic non-squamous NSCLC. However three confirmed and two suspected but unconfirmed cases of RPLS led to the early termination of the trial. The reason for the increased incidence of RPLS might be related to declining CrCL and/or increased BP. Although ORR and median PFS were in accordance with most historical first-line NSCLC studies this combination of ziv-aflibercept/cisplatin/pemetrexed will not be further pursued in NSCLC. Future efforts to identify predictive biomarkers of anti-VEGF agents are warranted. This study was supported by Sanofi and Regeneron Pharmaceuticals. We thank all the patients who participated in this study. We also thank all the participating study sites and the investigators and research staff. This work is published under the standard license to publish agreement. After 12 months the work will become freely available and the license terms will switch to a Creative Commons Attribution-NonCommercial-Share Alike 3.0 Unported License. Drs Liu Gao and DiCioccio are employees of Regeneron Pharmaceuticals Inc. The remaining authors declare no conflict of interest. Allegra CJ Tabernero J Rougier P Scagliotti GV Philip PA Lakomy R Ramlau R Assadourian S Chevalier S Van Cutsem E 2012 Meta-analysis of anti-VEGF class adverse events from three double-blind (Db) placebo (Pbo)-controlled phase III trials with IV aflibercept (Afl) J Clin Oncol 30 (Suppl 4 561 Bartynski WS 2008 Posterior reversible encephalopathy syndrome part 1: fundamental imaging and clinical features AJNR Am J Neuroradiol 29 1036 1042 18356474 Dahlberg SE Sandler AB Brahmer JR Schiller JH Johnson DH 2010 Clinical course of advanced non-small-cell lung cancer patients experiencing hypertension during treatment with bevacizumab in combination with carboplatin and paclitaxel on ECOG 4599 J Clin Oncol 28 949 954 20085937 de Groot JF Lamborn KR Chang SM Gilbert MR Cloughesy TF Aldape K Yao J Jackson EF Lieberman F Robins HI Mehta MP Lassman AB DeAngelis LM Yung WKA Chen A Prados MD Wen PY 2011 Phase II study of aflibercept in recurrent malignant glioma: A North American Brain Tumor Consortium Study "

Lung_Cancer

"]a 2 (29) [4?71] 2 (15) [2?45] 4 (20) [6?44] No. of patients n 10 13 23 No. of PFS eventsf n (%) 8 (80) 11 (85) 19 (83) PFS weeks [95% CI] 8 [2?25] 9 [5?18] 8 [5?18] PFS probability at 6 months [95% CI] 14 [1?45] “ 6 [0?25] No. of deaths n (%) 6 (60) 12 (92) 18 (78) OS weeks 36 [2 “] 26 [8?36] 26 [10?47] Survival probability at 6 months [95% CI] 50 [18?75] 46 [19?70] 48 [27?66] Survival probability at 12 months [95% CI] 40 [12?67] 23 [6?48] 30 [14?49] A total of 12 patients were censored for PFS 10 in arm A and 2 in arm B (Arm A: 7 patients discontinued treatment before the first on?study assessment [4 because of AE and 3 because of global deterioration]; 1 had inadequate baseline assessment; 1 was still ongoing with study treatment; 1 was no longer willing to participate and had no PD documented. Arm B: 1 patient discontinued because of AE and had SD; 1 was no longer willing to participate and had no PD documented). a Using exact method based on binomial distribution. b For arm A: one?sided P?value for the hypothesis testing H0: ORR was ?5% using exact binomial test. For arm B: one?sided P?value for the hypothesis testing H0: ORR was ?1% using exact binomial test. c Confirmed EGFR mutation. d EGFR status unknown. e Confirmed EGFR wild type. f Objective progression or death. g One patient had E746_A750del5 exon 19; 1 patient had G719C exon 18 and S768I exon 20. h This patient had HER2 amplification and mutation. Abbreviations: CI confidence interval; CR complete response; H0 null hypothesis; NA not applicable; ORR objective response rate; PFS progression?free survival; PR partial response; SD stable disease. Of the 36 patients with SD as BOR (median duration 15 weeks) 10 patients (28%) had prolonged clinical benefit (SD??6 months); of these 5 patients had EGFR?mutant tumors 3 had EGFR wild?type tumors and 2 had tumors of unknown EGFR status. Of 56 patients with both baseline and??1 postbaseline tumor measurement 26 (46%) had some degree of tumor shrinkage (Fig. 2). Among patients with tumor shrinkage 6 (23%) and 12 (46%) were confirmed as having EGFR?WT tumors and EGFR?mutant tumors respectively; 8 (31%) had tumors of unknown EGFR status. Tumor shrinkage was noted in 1 patient with an EGFR T790M tumor; all other EGFR T790M tumors increased in size. Maximum percentage change is shown in target lesions per RECIST (Response Evaluation Criteria in Solid Tumors) in 56 patients with both a baseline and at least one on?study measurement reflected in the database. Six patients had no change in the size of their tumor; of these 1 had EGFR mutation 1 had EGFR of unknown status and 4 had EGFR wild?type tumors. image Progression?Free Survival Overall median PFS (n?=?66) was 12 weeks with 54 (82%) patients reaching PFS events and similar values in the adenocarcinoma and nonadenocarcinoma populations. Median PFS in the adenocarcinoma group was 12 weeks based on 50 patients. In the nonadenocarcinoma group median PFS was 11 weeks (Fig. 3A). Median PFS in patients with EGFR mutation?positive tumors was 18 weeks based on 26 patients with 21 (81%) achieving PFS events; this median was longer than that seen in the overall population. The 6 patients with documented T790M had a median PFS of 7 weeks which was similar to that of patients with EGFR wild?type tumors (8 weeks). Kaplan?Meier curves show (A) progression?free survival and (B) overall survival by arm (all patients). CI indicates confidence interval. image Overall Survival At the time of data cutoff 47 patients (71%) had died and median OS was 37 weeks in the overall population 45 weeks in patients with adenocarcinoma and 27 weeks in patients with nonadenocarcinoma (Fig. 3B). Of the 26 patients with EGFR mutation?positive tumors (both arms) median OS was 57 weeks OS6M was 81% and OS12M was 59%. Safety and Tolerability The majority of treatment?related AEs were of grade 1 or 2 severity () and were manageable with standard supportive care. Common events included diarrhea (85%) dermatitis acneiform (68%) dry skin (38%) fatigue (38%) exfoliative rash (24%) stomatitis (24%) decreased appetite (23%) and pruritus (23%). One patient experienced treatment?related grade 4 AEs of dyspnea and pulmonary embolism considered by the investigator to be possibly related to study drug; 18 patients (27%) experienced treatment?related AEs with a maximum severity of grade 3. The majority of patients (n?=?44 67%) did not require a dose reduction and interruption of daily dosing was seen in 33% for evaluation and management of AEs. Of the 22 patients who did require dose reduction 17 patients had 1 dose reduction and 5 had 2 dose reductions. AEs resulting in dose modification were predominantly dermatologic or gastrointestinal. Six patients permanently discontinued dacomitinib due to treatment?related AEs which included grade 4 dyspnea (day 8) and grade 4 pulmonary embolism (day 9) (both in a single patient); grade 3 fatigue (day 14); grade 3 exfoliative rash (day 134); grade 2 allergic dermatitis (day 3); grade 2 fatigue (day 85); and grade 1 fatigue (day 43). Twelve deaths occurred within 28 days following the last dose of dacomitinib and were reported as serious AEs; none was considered to be treatment?related. Treatment?Related Adverse Events Occurring in ?10% of Patients in the Overall Population (N?=?66) and Hematologic Laboratory Values by Maximum CTCAE Grade (All Cycles; N?=?66) Adverse Event Grade 1/2n (%) Grade 3n (%) Total n (%) Any adverse events 46 (69.7) 18 (27.3)a 65 (98.5) Diarrhea 48 (72.7) 8 (12.1) 56 (84.8) Dermatitis acneiform 41 (62.1) 4 (6.1) 45 (68.2) Dry skin 25 (37.9) 0 25 (37.9) Fatigue 23 (34.8) 2 (3.0) 25 (37.9) Exfoliative rash 14 (21.2) 2 (3.0) 16 (24.2) Stomatitis 15 (22.7) 1 (1.5) 16 (24.2) Decreased appetite 15 (22.7) 0 15 (22.7) Pruritus 12 (18.2) 3 (4.5) 15 (22.7) Nausea 13 (19.7) 0 13 (19.7) Vomiting 8 (12.1) 1 (1.5) 9 (13.6) Aspartate aminotransferase increased 8 (12.1) 0 8 (12.1) Mucosal inflammation 7 (10.6) 0 7 (10.6) Hematologic Laboratory Values Grade 1/2n (%) Grade 3n (%) Total n (%) Hemoglobin 36 (54.5) 1 (1.5) 50 (75.8) Lymphopenia 10 (15.2) 12 (18.2)b 40 (60.6) Neutropenia 2 (3.0) 1 (1.5) 4 (6.1) Thrombocytopenia 4 (6.1) 1 (1.5)c 5 (7.6) Leukopenia 10 (15.2) 0 11 (16.7) a Includes two grade 4 events (dyspnea and pulmonary embolism) both experienced by the same patient. b Includes 2 patients with grade 4 events. c Grade 4. Patient?Reported Outcomes Completion rates for the EORTC QLQ?C30/?LC13 and DLQI questionnaires were high throughout the study (generally?>90% of patients answered at least one question). Patients with radiographic disease control reported improvement in lung cancer symptoms of dyspnea cough pain in chest and pain in arm/shoulder relative to baseline scores first observed after 3 weeks on therapy (Supporting Fig. 1A). Diarrhea was the most commonly reported class?related AE; diarrhea peaked at cycle 3 day 1 (week 6) and remained stable over time (Supporting Fig. 1B). With a score of 0?=?no symptoms and 100?=?most symptoms patients on dacomitinib reported scores that were at the midpoint in the range at their worst. The impact of dacomitinib on PRO for NSCLC symptoms and dermatologic toxicity has been previously presented and will be subsequently reported in full (Campbell AK et al; unpublished data). Pharmacokinetics PK parameters (overall and by histology) following a single dose (cycle 1 day 1) and mean Ctrough values after multiple doses for dose?compliant patients (Supporting ) were consistent with those previously reported.5 Pharmacodynamics Soluble HER2 and EGFR levels were slightly decreased on day 1 of most cycles compared with baseline for most patients. One patient with nonadenocarcinoma demonstrating HER2 amplification had elevated baseline soluble HER2 that significantly declined to population normal baseline levels upon treatment with dacomitinib. This patient's tumor also demonstrated a PR.16 Discussion In this phase 2 trial dacomitinib demonstrated an overall response rate of 5% but the primary endpoint of this study was not met. Three PRs were observed 2 in patients with EGFR mutation?positive tumors and 1 in a patient whose tumor was EGFR wild?type with HER2 amplification.16 In contrast patients with known EGFR T790M did not respond to dacomitinib therapy despite efficacy in preclinical models. These observations could be due to the presence of concurrent drug resistance mechanisms (such as MET amplification)18 or to the inability of dacomitinib to fully inhibit EGFR in tumors harboring EGFR T790M at the doses currently under clinical investigation.5 Strategies to improve EGFR inhibition in EGFR T790M cancers include the combination of irreversible EGFR inhibitors with the EGFR?directed antibody cetuximab (as reported for afatinib plus cetuximab)19; the development of more potent and specific inhibitors of EGFR T790M2021; and the use of intermittent but high doses of existing irreversible EGFR inhibitors.18 In contrast where resistance is mediated by compensatory signaling pathways or tumors harbor more than one concomitant drug resistance mechanism combination strategies with targeted agents in appropriately selected patients will be necessary to treat such cancers (eg inhibition of the MET pathway). In the absence of a known oncogene addiction patients with wild?type EGFR may still benefit from EGFR?directed therapy in the absence of a RECIST?defined radiographic response; endpoints such as PFS and patient report of HRQoL and symptom relief have become increasingly important in a noncurative setting.22 This is demonstrated in the BR21 trial of erlotinib versus placebo where the ORR was low and yet was associated with improvements versus placebo in OS and NSCLC symptoms.10 In the current study in refractory NSCLC 10 of 36 patients with SD as BOR derived prolonged clinical benefit (SD???6 months) with dacomitinib; patients also reported a rapid onset of improvement in key lung cancer symptoms with symptomatic improvements remaining durable over the course of therapy. Common AEs were typically gastrointestinal or dermatologic and consistent with targeting EGFR.24 By patient report both gastrointestinal and dermatologic symptoms peaked early in treatment and stabilized or improved over time (Campbell AK et al; unpublished data). The benefits seen in this study may reflect dacomitinib's broader mode of action in targeting all kinase?active HER family members irreversible binding to the tyrosine kinase domain retreatment in some of those patients with an EGFR?driven tumor following a period off treatment after a prior selective EGFR TKI or other as yet to be determined factors. Data from this and other phase 1 and 2 studies in post?EGFR TKI settings5 and from a head?to?head trial comparing dacomitinib with erlotinib in the second?line setting8 suggest that dacomitinib has clinically relevant activity in patients with NSCLC who do not harbor KRAS mutations. However in the absence of a control arm it remains unclear if this degree of benefit seen here could be due to patient selection or favorable prognostic factors. A phase 3 trial is underway to determine the efficacy and safety of dacomitinib compared with erlotinib in patients with KRAS wild?type NSCLC for whom first?line chemotherapy has failed (ARCHER 1009; ClinicalTrials.gov identifier NCT01360554). "

Lung_Cancer

"We split cis-meQTL SNPs into five categories according to the meQTL association strength (P>10?7 10?7>P>10?10 10?10>P>10?15 10?15>P>10?20 P<10?20). A SNP is determined to be related with a regulatory region if the SNP or any LD-related SNP (r2 ? 0.8) resides in the ChIP-Seq peaks of the regulatory regions. Regulatory elements include CTCF binding sites DNaseI hypersensitive sites and histone marks from small airway epithelial cells (SAEC) from ENCODE and human alveolar epithelial cells (hAEC) from our laboratory. For each p-value category we calculated the proportions of cis-meQTL SNPs related with regulatory regions. The figures show that the proportions of cis-meQTL SNPs related with regulatory regions increase with the significance of meQTL associations except for the repressive mark H3K27me3. DNA methylation regional associations for lung cancer GWAS SNPs in subjects of European ancestry (a b f and g) Symbols represent the association between established lung cancer GWAS genetic loci in four regions and methylation levels in nearby CpG probes. Y-coordinate P-value for association; x-coordinate genomic location. For each SNP the red solid circle or square represents the methylation probe with the strongest association whereas other methylation probes are colored on the basis of their correlation (measured as r2) to the most-associated probe. For the most-associated probes the P-values in EAGLE discovery set (n=210) and TCGA lung replication data (n=65) are shown. SNP locations are marked by a blue triangle. (c“e and h“j) show the associations between genotypes and methylation levels of the most associated CpG probes. The box plots show the distribution of the methylation levels in each genotype category with error bars representing the 25% and 75% quantiles. Enrichment of cis-meQTL SNPs for lung cancer risk Analysis based on NCI lung cancer GWAS data (5739 cases and 5848 controls). P-values were produced based on 10000 permutations. AD SQ and SC represent adenocarcinoma squamous cell carcinoma and small cell carcinoma. (a) Enrichment was tested using all cis-meQTL SNPs after LD pruning. (b and c) Strong enrichments were observed for cis-meQTL SNP associated with CpG probes annotated to north shores (b) and gene body (c) regions for SQ. (d) The enrichment in (c) was driven by the cis-meQTLs SNPs impacting CpG probes in non-CpG islands. (e) The enrichment in (d) is driven by the SNPs (or their LD SNPs with r2 > 0.95) overlapping with CTCF binding sites or H3K27me3 mark regions. Replication of EAGLE lung meQTLs in TCGA histologically normal tissue samples. Tissue N All cis associations in EAGLE(34304 associations P<4.0—10?5) Strong cis associations in EAGLE(12083 associations P<1.0—10?10) All trans associations in EAGLE(585 associations P<2.5—10?10) Consistentdirection FDR<0.05 Consistentdirection FDR<0.05 Consistentdirection FDR<0.05 Lung 65 32128 (93.7%) 22441 (65.4%) 11250 (99.3%) 11229 (92.9%) 556 (95.2%) 467 (79.8%) Breast 87 30391 (88.6%) 18762 (54.7%) 11640 (96.3%) 9987 (82.7%) 561 (96.1%) 488 (83.4%) Kidney 142 30975 (90.3%) 23984 (70.0%) 11634 (96.3%) 10783 (89.2%) 558 (95.5%) 506 (86.4%) N is the sample size in replication studies. FDR was calculated based on single-sided p-values. Chromatin marks are enriched on meQTL SNPs. control cis only trans only cis + trans cell line mark proportion proportion fold change proportion fold change proportion fold change SAEC CTCF 11.8% 35.3% 3.0 29.6% 2.5 45.4% 3.8 DnaseI 25.4% 54.0% 2.1 45.8% 1.8 59.6% 2.3 H3K27me3 20.4% 34.1% 1.7 25.4% 1.2 42.9% 2.1 H3K4me3 4.8% 29.7% 6.2 18.0% 3.8 39.9% 8.3 H3K36m3 13.4% 36.8% 2.7 22.8% 1.7 45.4% 3.4 HAEC H3K27me3 17.5% 25.3% 1.4 15.6% 0.9 33.2% 1.9 H3K4me3 7.6% 37.0% 4.9 25.0% 3.3 54.9% 7.2 H3K9-14Ac 17.3% 47.6% 2.8 32.3% 1.9 65.3% 3.8 meQTL SNPs were enriched in chromatin marks including CTCF binding sites DNaseI hypersensitive sites and histone marks from small airway epithelial cells (SAEC) from ENCODE and human alveolar epithelial cells (hAEC) from our laboratory. A SNP is determined to be related with a regulatory region if the SNP or any LD-related SNP (r2?0.8) resides in the ChIP-Seq peaks of the regulatory regions. Enrichment for cis-meQTL SNPs without trans effects (œcis only) trans-meQTL SNPs without cis effects (œtrans only) and SNPs with both trans and cis effects (œcis+trans). The baseline proportion (control set) was calculated based on SNPs not associated with meQTLs and with minor allele frequencies and local CpG probe density matching to the meQTL SNPs. The fold changes were calculated using the control set as baseline. PLoS One one 1932-6203 Public Library of Science San Francisco USA 24454925 3893268 PONE-D-13-29217 .0085738 Research Biology Genetics Gene Expression RNA interference Cancer Genetics Molecular Cell Biology Gene Expression RNA interference Medicine Oncology Cancers and Neoplasms Lung and Intrathoracic Tumors Non-Small Cell Lung Cancer Basic Cancer Research Downregulation of PAX6 by shRNA Inhibits Proliferation and Cell Cycle Progression of Human Non-Small Cell Lung Cancer Cell Lines PAX6 in NSCLC Zhao Xiaoting Yue Wentao * Zhang Lina Ma Li Jia Wenyun Qian Zhe Zhang Chunyan Wang Yue Department of Cellular Biology Beijing TB and Thoracic Tumor Research Institute/Beijing Chest Hospital Capital Medical University Beijing China Addison Christina Lynn Editor Ottawa Hospital Research Institute Canada * E-mail: yue.wentaogmail.com Competing Interests: The authors have declared that no competing interests exist. Conceived and designed the experiments: WY. Performed the experiments: XZ WJ ZQ CZ YW. Analyzed the data: LZ LM. Contributed reagents/materials/analysis tools: CZ YW. Wrote the paper: WY XZ. 2014 15 1 2014 9 1 e85738 16 7 2013 1 12 2013 2014 Zhao et al This is an open-access distributed under the terms of the Creative Commons Attribution License which permits unrestricted use distribution and reproduction in any medium provided the original author and source are credited. Background The transcription factor PAX6 is primarily expressed in embryos. PAX6 is also expressed in several tumors and plays an oncogenic role. However little is known about the role of PAX6 in lung cancer. Methods The function of PAX6 in lung cancer cells was evaluated by small interfering RNA-mediated depletion of the protein followed by analyses of cell proliferation anchorage-independent growth and cell cycle arrest. The changes of cyclin D1 pRB ERK1/2 p38 expression caused by PAX6 inhibition were detected using western-blotting. The PAX6 mRNA level in 52 pairs of tumors and corresponding matched adjacent normal tissues from non-small cell lung cancer patients and lung cancer cell lines was detected by real-time PCR. Results Suppression of PAX6 expression inhibited cell growth and colony formation in A549 and H1299 cells. The percentage of cells in G1-phase increased when PAX6 expression was inhibited. The cyclin D1 protein level as well as the pRB phosphorylation level decreased as a result of PAX6 down-regulation. The activity of ERK1/2 and p38 was also suppressed in PAX6 knock-down cells. The PAX6 mRNA was highly expressed in lung cancer tissue and lung cancer cell lines. In most patients (about 65%) the relative ratio of PAX6 mRNA in primary NSCLC versus adjacent tissues exceeded 100. Conclusions Our data implicated that PAX6 accelerates cell cycle progression by activating MAPK signal pathway. PAX6 mRNA levels were significantly elevated in primary lung cancer tissues compared to their matched adjacent tissues. This work was supported by Beijing Novel Program grant (No. 2006B34); Beijing Research Foundation for Excellent Talents (No. 20061D03); Beijing Cultivation Project for Key Technical and Medicine Product (No. Z101100055610030); the Scientific Research Common Program of Beijing Municipal Commission of Education (No. KM201210025024). The funders had no role in study design data collection and analysis decision to publish or preparation of the manuscript. Introduction A recent overview on global cancer statistics showed that lung cancer was the most commonly diagnosed cancer as well as the leading cause of cancer death [1]. Early detection and targeted therapy is a potential method for lung cancer prevention and therapy [2]. It is important to find which pathways or proteins are active in lung tumor progression [3]. On the basis of the ""cancer stem cell hypothesis tumors are thought to originate through tissue-specific stem cell expression [4]“[6]; in other words tumors are attributed to stem cell factor overexpression [3] [5] [7]. Paired-box 6 (Pax6) is an important transcription factor during embryogenesis and a stem cell factor [3]. Hence PAX6 may play an important role in tumorigenesis. PAX6 belongs to the PAX gene family which encodes a group of nine paired-box transcription factors with important roles in development and disease [3]. PAX6 is an important transcription factor in development of the eyes pancreas and central nervous system [3] [8]. PAX6 expression was recently found in tumors suggesting an oncogenic role [9]. PAX6 is frequently expressed in retinoblastoma pancreatic tumors and intestinal tumors [6] [10] [11]. PAX6 is also highly expressed in brain and breast cancer cell lines [9]. In pancreatic carcinoma cell lines the inhibition of PAX6 expression leads to a decrease in cell growth and survival [12]. PAX6 is also a regulator of MET tyrosine kinase receptor expression in pancreatic carcinoma cell lines [12]. MET is a potential biomarker and therapeutic target for tumors which confirms the oncogenic role of PAX6 in tumorigenesis [13]. It was previously reported that PAX8 and PAX5 are highly expressed in non-small cell lung cancer (NSCLC) and small cell lung cancer cell lines respectively [14]; but little is known regarding PAX6 expression and function in lung cancer. In this study we investigated whether PAX6 regulated cell proliferation of NSCLC. Our findings show that PAX6 promotes G1-S progression by activating the MAPK signal pathway. PAX6 mRNA was frequently expressed in lung cancer tissue as compared to corresponding adjacent non-neoplastic tissue. This suggests that PAX6 is a new potential target in lung cancer. Materials and Methods RPMI 1640 fetal bovine serum (FBS) and Trizol Reagent were purchased from Invitrogen (Carlsbad CA); M-MLV reverse transcription CellTiter 96® aqueous non-radioactive cell proliferation assay oligo-dT and dNTP were obtained from Promega (Madison WI); SYBR® Green PCR Master Mixture was from Applied Biosystems (Carlsbad CA); anti-PAX6 antibodies were purchased from Abnova (Taibei Taiwan) anti-pRB -ERK1/2 p38 -pERK -pp38 -cyclin D1 and -pRB (S780 phosphorylation) antibodies were obtained from Abcam (Cambridge England UK); and enhanced chemiluminescence (ECL) reagent was obtained from Pierce (Rockford IL). Propidium iodide (PI) RNase A and protease inhibitor cocktail were purchased from Sigma (St. Louis MO). Samples Fifty-two NSCLC specimens were obtained from patients undergoing surgical resection at Beijing Chest Hospital. Primary lung cancer samples and matched adjacent normal tissues were used. The study and use of specimens was reviewed and approved by Research Ethic Committee in Beijing Chest Hospital Capital Medical University (Beijing China). Written informed consent was obtained from all patients. The clinical characteristics of the patients are listed in . .0085738.t001 Patients and Clinical Characteristics. Characteristics Number of Patients Patient Age Years 0 “ 60 27 >60 25 Gender Male 40 Female 12 Smoke Status Nonsmoker 21 Smoker 31 Histologic Type SCC* 31 Adenocarcinoma 21 Histological Grade III 21 II 31 Tumor Size 0 “ 3 cm 14 >3 cm 38 Lymph Node Status Negative 27 Positive 25 Distant Metastasis Negative 44 Positive 8 TNM Stage Stage I 17 Stage II 10 Stage III 19 Stage IV 6 : Squamous Cell Carcinoma. Cell culture Human lung adenocarcinoma cell lines A549 and NCI-H1299 human large cell lung carcinoma cell lines NCI-H460 small cell lung cancer cell line NCI-H446 human embryo lung fibroblasts (MRC-5) were obtained from the National Platform of Experimental Cell Resources Sci-Tech. Human large cell lung carcinoma cell lines 95C 95D and 801D were obtained from the tumor center of Chinese Academy of Medical Sciences. Human lung adenocarcinoma cell line A2 and squamous cell carcinoma cell line L were isolated and established by our lab. The lung cancer cell lines were cultured in RPMI 1640 medium (Invitrogen Carlsbad CA USA) supplemented with 10% fetal bovine serum (FBS; Gibco Los Angeles CA USA). MRC-5 were maintained in MEM-EBSS supplemented with 10% FBS. Construction of a PAX6 shRNA lentiviral vector and infection into cells Four RNA interference (RNAi) candidate target sequences were designed based on the human pax6 mRNA sequence and cloned into the pGCSIL-GFP vector (GeneChem Shanghai China). The RNAi sequence GAGTAGCGACTCCAGAAGT was the most effective at suppressing PAX6 mRNA in H1299 and A549 cells and was used in subsequent experiments to knock down endogenous PAX6. Nonsilencing (NS)-small interfering RNA (shRNA) (TTCTCCGAACGTGTCACGT) was also cloned into the pGCSIL-GFP vector and used as a control (GeneChem). The recombinant virus was packaged in 293T cells using a Lentivector Expression System (GeneChem). For cellular infection H1299 and A549 cells were subcultured at 5000 cells/well in 96-well culture plates and infected with lentivirus-mediated pax6-shRNA or NS-shRNA. The GFP expression level was detected via fluorescence microscopy (Nikon Tokyo Japan) to determine the infection efficiency. RNA isolation and real-time PCR Total RNA from tissue and cells was isolated with Trizol Reagent according to the manufacturer™s protocol. The total RNA concentration was calculated by measuring the OD260 and the samples were stored at “80°C. Total RNA (2 µg) was reverse-transcribed using an M-MLV Reverse Transcriptase Kit according to the manufacturer™s protocol. The cDNA (20 ng) was mixed with SYBR® Green Master Mix and genes were amplified with appropriate primers using a real-time PCR detection system (ABI7500; Life Technologies Carlsbad CA). The relative expression levels of PAX6 mRNA were calculated by normalization to the ?-actin mRNA level. The PCR primers used were as follows: PAX6 forward 5'-TTCAGCACCAGTGTCTACCA-3'; PAX6 reverse 5'-GCTGTAGGTGTTTGTGAGGG-3'; ?-actin forward 5'-TTAGTTGCGTTACACCCTTTC-3'; and ?-actin reverse 5'-GCTGTCACCTTCACCGTTC - 3'. Cell proliferation assay A proliferation assay was carried out using Non-Radioactive Cell Proliferation Assay according to the manufacturer™s protocol. Briefly5000 cells/well were seeded into 96-well culture plates in RPMI 1640 containing 10% FBS. The cells were cultured for 5 days then 20 µL of 3-(45-dimethyl-thiazol-2yl)-5-(3-carboxymethoxyphenyl)-2- (4-sulfophenyl)-2H-tetrazolium (MTS) was added to each well and the cells were incubated at 37°C for 3 h every 24 h. The absorbance was recorded at 490 nm with a universal microplate reader (Bio-Rad Hercules CA). All the experiments were repeated three times. The data are presented as means ± SEM. Colony formation assay Cells were seeded in triplicate at 300 cells/well in a 6-well plate. After 7 days of culture the cells were washed twice with NaCl (0.9%) stained with 2% gentian violet for 20 min washed with water and air-dried. Foci were counted by microscopy. The experiments were repeated three times and data are presented as means ± SEM. Soft-agar assay Cells (1000) were seeded into 6-well plates in 2 mL of growth medium containing 0.3% agar and used to overlay 1.4-mL layers of growth medium containing 0.6% agar. After 21 days of culture the colonies were counted. All the experiments were repeated three times. The data are presented as means ± SEM. Cell cycle analysis Cells were harvested washed with cold PBS twice and fixed in 70% ethanol at “20°C overnight. The cells were then centrifuged (1500 rpm 10 min) and washed twice using phosphate-buffered saline (PBS). Next the cells were resuspended in 0.5 mL of PBS containing 50 µg/mL RNase A for 1 h at 37°C. The cells were then loaded with 65 ?g/mL PI for 30 min in the dark at 4°C. The percentage of cells in different phases of the cell cycle was measured by flow cytometry (Beijing Determination of Traditional Chinese Medicine Research Institute). The experiments were repeated three times. The data are presented as means ± SEM. Western blotting Cells were digested with trypsin and centrifuged. The cell pellet was washed twice with PBS. Next the cells were disrupted in lysis buffer (10 mM Tris-HCl pH 7.4 1 mM EDTA 0.1% Triton X-100 0.1% SDS and 1— protease inhibitor cocktail) on ice for 15 min and centrifuged at 12000 rpm for 20 min. Insoluble material was removed and protein concentrations were determined using a bicinchoninic acid kit. For Western blot analysis cell lysates (30 ?g/well) were subjected to SDS-PAGE and transferred to nitrocellulose filter membranes. The membranes were incubated with primary antibodies (anti-PAX6 -ERK1/2 p38 -pERK -pp38 -cyclin D1 -RB or -RB S780 phosphorylation) overnight at 4°C. Secondary antibodies conjugated with horseradish peroxidase were subsequently used. Signals were detected using ECL and exposed to Kodak X-OMAT film. The results were scanned and analyzed using Alpha View Analysis Tools. Statistical analysis All values are expressed as the mean ± SEM. Through real-time RT-PCR MTS assay colony formation soft-agar assays cell cycle analysis and western-blot assay for comparison between means of 2 groups statistical differences were tested with unpaired Student t-tests. Statistical significance was tested using SPSS Statistics version 13.0. P<0.05 (*) was considered different; P<0.01 (**) was considered significantly different. Results PAX6 mRNA expression was inhibited in cells infected with the PAX6 shRNA lentiviral vector PAX6 mRNA expression was determined in this study. As shown in Figure 1A PAX6 was highly expressed in most lung cancer cell lines. In contrast MRC-5 a normal human fetal lung fibroblast cell line did not express PAX6 (Figure 1A). .0085738.g001 Figure 1 PAX6 mRNA was highly expressed in lung cancer cells and its expression was suppressed by pax6-shRNA. A Real-time PCR analysis for the PAX6 mRNA expression level in H460 A2 95C 95D H1299 H446 801 D A549 and L lung cancer lines as well as in the normal human fetal lung fibroblast cell line MRC-5. B -C Confirmation of PAX6 mRNA knockdown by real-time RT-PCR assays performed on total RNA isolated from A549 (B) and H1299 (C) cells infected with pax6-shRNA or a random shRNA. The PAX6 mRNA expression levels in A549 and H1299 cells were measured by quantitative real-time RT-PCR. The y-axis represents the normalized PAX6 mRNA expression relative to A549 (B) or H1299 (C) cells. **P < <0.01. D The protein levels of PAX6 were determined by western-blot and GAPDH expression level was used as a control. Quantification was made by determining the gray level of PAX6 protein which was normalized against GAPDH levels. Data are expressed as mean ±SEM of independent experiments (times of the experiments are listed above the histograms). PAX6 expression was obviously weakened in A549 PAX6 KD and H1299 PAX6 KD cells. To elucidate whether PAX6 expression has any effect on the growth of lung cancer cells RNAi was used to generate pax6 knock-down (PAX6 KD) cell lines. We selected two target cell lines: H1299 which showed high levels of PAX6 expression and A549 which showed low levels of expression. In the present study pGCSIL-pax6 shRNA-GFP was infected into H1299 and A549 cells. Cells were also infected with pGCSIL-NS shRNA-GFP (PAX6 NS) as a negative control (NC). To determine the function of PAX6 H1299 H1299NC A549 or A549NC cells were used as controls in all assays. The PAX6 mRNA level in H1299 PAX6 KD and A549 PAX6 KD cells was determined by real-time PCR to confirm whether PAX6 expression was specifically inhibited through RNAi in A549 and H1299 cells. As shown in Figure 1B PAX6 expression in A549 PAX6 KD cells was inhibited by 80“90% compared to cells infected with lentivirus-mediated NS-shRNA. We found similar results in H1299 PAX6 KD cells. PAX6 mRNA expression in these cells was also inhibited by 90“95% as compared to NC cells (**P<0.01; Figure 1C). PAX6 protein expression in these cells was detected by Western blotting. As shown in Figure 1D PAX6 protein in H1299 PAX6 KD and A549 PAX6 KD cells was not readily detected whereas a clear PAX6 protein band was evident in the control cells. Inhibition of PAX6 expression leads to a decline in cell proliferation PAX6 is a critical transcription factor that plays an important role in regulating proliferation and differentiation during human embryonic development [3]. A cell proliferation assay was performed to determine whether PAX6 plays a role in cellular growth. A549 PAX6 KD H1299 PAX6 KD and control cells were seeded in 96-well plates and cell proliferation activity was measured using a Cell Proliferation Assay kit. A549 and H1299 cell growth was obviously suppressed when PAX6 expression was inhibited by RNAi (Figure 2A and B). As shown in Figure 2A and B the decrease in cell growth caused by the inhibition of PAX6 expression in H1299 was much stronger than that in A549 cells. These different results may be attributable to the different PAX6 expression levels between H1299 and A549 cells displayed in Figure 1A and D. .0085738.g002 Figure 2 The lentivirus-mediated pax6-shRNA knockdown of PAX6 expression could suppress lung cancer cell growth. A -B A549 PAX6 KD H1299 PAX6 KD cells and control cells were seeded in 96-well plates and an MTS assay was performed. The absorbance at 490 nm (y -axis) was measured at 24-h intervals up to 120 h. C -D Colony formation efficiency in A549 PAX6 KD H1299 PAX6 KD cells and control cells. The y -axis represents the normalized colony formation rate relative to A549 (C) or H1299 (D) cells. E -F A soft -agar assay was performed to investigate the effects of PAX6 on tumorigenesis in vitro. The y -axis represents the normalized soft -agar colony formation rate relative to A549 (E) or H1299 (F) cells. The data are expressed as the means ± SEM from three separate experiments. Times of the experiments are listed above the graph.*P <0.05 **P <0.01. Reduced colony formation and soft-agar colony formation in PAX6 KD cells Colony formation represents a loss of contact inhibition or the ability to maintain cell growth and movement despite contact with surrounding cells. To clarify whether PAX6 could confer a loss of contact inhibition cells infected with pGCSIL-pax6 shRNA-GFP as well as their control cells were seeded into 6-well plates and cultured for 7 days. After 2% gentian violet staining colonies containing more than 50 cells were counted under a light microscope. As displayed in Figure 2C and D the inhibition of PAX6 expression in A549 and H1299 cells led to an obvious decrease in the number of foci generated compared to the control cells (**P<0.01). To further study the function of PAX6 soft-agar colony formation was analyzed to determine whether PAX6 contributed to anchorage-independent colony formation in lung cancer cells. The rate of soft-agar colony formation declined in A549 PAX6 KD and H1299 PAX6 KD cells compared to NC cells (**P<0.01 *P<0.05; Figure 2E and F). PAX6 expression increased cell growth by promoting faster progression into S phase of the cell cycle To detect the effect of PAX6 on cell cycle progression the cell cycle progression of A549 PAX6 KD H1299 PAX6 KD A549 PAX6 NC H1299 PAX6 NC A549 and H1299 cells was analyzed by flow cytometry. As displayed in Figure 3A the percentage of cells entering S phase was decreased in the A549 PAX6 KD cell line along with an increase in the population of G0-G1 phase cells. A similar result was observed in H1299 PAX6 KD H1299 PAX6 NC and H1299 cells (Figure 3B). In these experiments PAX6 expression led to cell growth by inducing cell cycle progression. .0085738.g003 Figure 3 PAX6 expression promoted cell cycle progression. A B Cell cycle analysis. Cells were stained with propidium iodide (PI) and analyzed for cell cycle phase distribution. The histogram was the statistical data from three independent experimental replicates. *P <0.05 **P <0.01. In this study the expression level of cyclin D1 a relevant cyclin regulating G1-S progression [15] [16] was detected in A549 PAX6 KD and H1299 PAX6 KD cells. As indicated in A cyclin D1 expression was decreased in A549 PAX6 KD cell lines compared to control cells. We found a similar result in H1299 PAX6 KD cells (A). Another relevant cyclin regulating G1/S progression is cyclin E [17]. We also determined whether cyclin E was regulated by PAX6 expression. As a result cyclin E expression was not affected by the stable shRNA-mediated knockdown of PAX6 in lung cancer cells (data not shown). This demonstrates that PAX6 might promote cell growth by inducing cyclin D1 expression. .0085738.g004 Cyclin D1 expression and pRB phosphorylation was inhibited while PAX6 expression was suppressed. A B The expression of cyclin D1 pRB and the phosphorylated pRB in A549 PAX6 KD A549 NC A549 cells as well as H1299 PAX6KD H1299NC H1299 cells was determined by Western blotting. ?-actin and GAPDH expression level was measured as internal loading controls respectively. Cyclin D1 and pRB levels were measured by the gray level and were normalized by internal loading controls. Data are expressed as mean ±SEM. Times of the experiments are listed above the histograms. *P <0.05 **P <0.01. The major substrate of cyclin D1-CDK4/6 complexes is retinoblastoma protein (pRB) [18]. Thus pRB S780 protein phosphorylation was also detected by Western blotting (B). The S780 phosphorylation of pRB was decreased when PAX6 expression was inhibited in A549 cells. A similar result was obtained when H1299 PAX6 KD cells were used (B). MAPK signal pathway was suppressed by the inhibition of PAX6 The MAPK (mitogen activated protein kinase) pathway has been implicated in the regulation of G1/S transitions and cell mitosis [19]. In our study some central regulatory molecules of MAPK pathways were examined using western blot analysis. As shown in the phosphorylation levels of ERK1/2 and p38 were decreased both in A549 PAX6 KD and H1299 PAX6 KD cells. It indicated that the MAPK signal was weakened resulted from the RNAi interference of PAX6. .0085738.g005 The phosphorylation levels of ERK1/2 and p38 were suppressed by the inhibiton of PAX6 expression. Western-blot analysis of A549 A549 NC A549 PAX6 KD H1299 H1299NC H1299 PAX6 KD with antibodies to ERK1/2 (A) p38(B) and their phosphorylated forms were shown in the figure. GAPDH and ?-actin was used as internal loading controls respectively. ERK1/2 and p38 levels were normalized by GAPDH and ?-actin respectively. Data are expressed as mean ±SEM. All the experiments were repeated three times. *P <0.05 **P <0.01. PAX6 was highly expressed in lung cancer tissue Pax6 mRNA in lung cancer tissue as well as matched adjacent tissue was detected to confirm the role of PAX6 in lung cancer. The clinical characteristics of the 52 patients are listed in . As shown in Figure 6A PAX6 mRNA was abundantly expressed in tumor tissue as compared to adjacent normal tissues. The expression of PAX6 represented by a cancer-to-adjacent nontumorous tissue ratio for each individual was indicated in B. PAX6 expression in lung cancer tissue was higher than that in each matched adjacent normal tissue in all but three cases (Figure 6B). The statistic results were listed in table 2 and the ratio (tumor/adjacent tissue) of 65% patients (34 samples) exceeded 100. That is to say in most cases PAX6 was mainly expressed in lung cancer tissues. .0085738.g006 Figure 6 PAX6 mRNA was highly expressed in primary lung cancer tissues and lung cancer cell lines. A Real-time PCR analysis of the PAX6 expression level in lung cancer tissues as well as the matched adjacent tissues from 52 patients. The PAX6 mRNA level was normalized by ?-actin expression level. B Each column represents the relative ratio of PAX6 mRNA in primary NSCLC versus adjacent lung tissue and the line across the graph represents the value 1 and 10 respectively. All the experiments were repeated three times. **P <0.01. .0085738.t002 The relative ratio of PAX6 mRNA in primary NSCLC versus adjacent nontumorous lung tissue. PAX6 mRNA level (Tumor/adjacent tissue) 0“1 1“100 100“10000 10000“100000 Number of patients 3 15 19 15 Discussion In our study the function of PAX6 in lung cancer cells was investigated. The growth ability of A549 and H1299 cells was declined when PAX6 expression was inhibited by specific PAX6 shRNA. We suggest that PAX6 promotes G1-S progression by activating the MAPK signal pathway. And PAX6 was highly expressed in lung cancer tissues and lung cancer cell lines. The transcription factor PAX6 plays different roles in different tumors. It is frequently expressed in pancreatic cancer and retinoblastoma cells implicating an oncogenic function while PAX6 is recognized as a tumor suppressor in gliomas and prostate cancer [6] [10] [11] [20] [21].PAX6 expression is significantly reduced in glioblastomas and the expression level is correlated with longer patient survival [22]. PAX6 suppresses glioblastoma cell growth anchorage-independent growth and glioma angiogenesis as well as invasiveness of glioblastoma cell via inhibition of matrix metalloproteinase-2 (MMP2) expression and vascular endothelial growth factor A (VEGFA) expression [20] [23] [24]. In prostate cancer PAX6 expression was lower in cancer tissues and cancer cell lines than normal epithelial cells [21]. Overexpression of PAX6 suppressed the proliferation and colony formation of prostate cancer cells [8]."

Lung_Cancer

"Single agent and combination treatment protocols were well tolerated by mice with no weight loss or other signs of acute or delayed toxicity (A-C). Antitumor activity of AZD6244 and/or BEZ235 in mouse xenograft models of human tumors. Nude mice-bearing NCI-H1993 (A) NCI-H1975 (B) and NCI-H460 (C) tumors were administered 25 mg/kg AZD6244 twice daily and/or 20 mg/kg BEZ235 once daily up to 21 days. Tumors were resected from nude mice on day 21 (D). Tumor volume was measured using calipers on the indicated days. Mean?±?SD n?=?10. * P?<?0.05 vs control group. ** P?<?0.01 vs control group. Changes in body weight of mice treated with control group or AZD6244 and/or BEZ235. Nude mice-bearing NCI-H1993 (A) NCI-H1975 (B) and NCI-H460 (C) tumors were administered 25 mg/kg AZD6244 twice daily and/or 20 mg/kg BEZ235 once daily up to 21 days. Body weight was measured on the indicated days. Mean?±?SD n?=?10. Effect of MEK and PIK3/mTOR inhibitors on signaling transduction pathways in gefitinib-resistant NSCLC tumor models To assess the impact of both compounds on downstream molecules of the MEK and PI3K pathways we used Western blot analysis to observe phosphorylation status and total protein expression in tumor tissues. The results showed that p-MEK1/2 p-ERK1/2 p-AKT p-S6 and p-4E-BP1 appeared to be inhibited by AZD6244 and BEZ235 combination treatment whereas the total protein levels of MEK1/2 ERK1/2 AKT S6 and 4E-BP1 remained unchanged in each tumor model (). Western blot analysis of downstream signals also showed treatment with AZD6244 or BEZ235 inhibited the phosphorylation of ERK1/2 or AKT in all three tumor models respectively. In addition combined treatment with AZD6244 and BEZ235 showed greater inhibition of p-ERK1/2 and p-AKT than observed in control group or mice treated with each compound alone in vivo (). Interestingly the impact from both inhibitors on p-S6 and p-4E-BP1 levels was alternatively tumor model specific. For example AZD6244 and BEZ235 alone and in combination markedly inhibited p-S6 and p-4E-BP1 expression levels in NCI-H1993 tumor models compared with the minimal suppression observed in NCI-H460 tumor model (). Neither AZD6244 nor BEZ235 alone suppressed p-S6 and p-4E-BP1 in NCI-H1975 tumor model. We also found that the expression of MMP-9 was significantly inhibited by AZD6244 and BEZ235 combination treatment whereas the expression of MMP-2 was not affected by the treatment. Effects of AZD6244-BEZ235 combination therapy on PI3K/AKT and MEK/ERK pathways. All three gefitinib-resistant tumor xenograft models were treated with the AZD6244 and/or BEZ235 for 2 h on Day 21 of the efficacy study tumor tissues were then harvested to detect p-AKT (S473)/AKT p-ERK (T202/Y204)/ERK p-S6 (S240/244)/S6 and p-4E-BP1 (S65)/4E-BP1. Effect of MEK and PIK3/mTOR inhibitors on the expressions of Ki-67 and CD31 in gefitinib-resistant NSCLC tumor models To characterize the mechanism of tumor growth inhibition observed in our gefitinib-resistant NSCLC tumor models by AZD6244 and BEZ235 lung tumor tissues were assessed by evaluating Ki-67 expression using immunohistochemical analyses. We observed active cell proliferation in NCI-H1993 tumor model with a 56% proliferation index (A). Monotherapy with AZD6244 or BEZ235 slightly decreased the percentage of Ki-67-positive proliferating tumor tissues with proliferation indices of 42% and 39% respectively (A). Combined treatment with AZD6244 and BEZ235 markedly decreased the percentage of Ki-67-positive proliferating tumor tissues to 10% consistent with the marked inhibition of ERK1/2 and AKT phosphorylation. We also found the similar results in NCI-H1975 and NCI-H460 tumor models (A).To evaluate the potential antiangiogenic mechanism of AZD6244 and BEZ235 gefitinib-resistant NSCLC tumor tissues were analyzed by immunostaining for CD31 (platelet endothelial cell adhesion molecule 1). The results showed BEZ235 significantly decreased the vascular density of all three gefitinib-resistant NSCLC tumors whereas AZD6244 monotherapy had only a mildly effect upon lung tumor angiogenesis. The antiangiogenic effects AZD6244 and BEZ235 were markedly increased when they were combined (B). Effects of AZD6244 and/or BEZ235 on the expressions of Ki-67 (A) and CD31 (B) in NCI-1993 NCI-1975 and NCI-H460 xenograft models. All three gefitinib-resistant tumor xenograft models were treated with the AZD6244 and/or BEZ235 for 2 h on Day 21 of the efficacy study tumor tissues in each group were resected and immunostained with anti-Ki67 and anti-CD31 antibodies. N?=?10 * P?<?0.05 vs vehicle group. ** P?<?0.01 vs vehicle group. MEK and PIK3/mTOR inhibitors had no effect on caspase-3 8 and 9 activities in gefitinib-resistant NSCLC tumor models In order to investigate whether AZD6244 and/or BEZ235 would induce apoptosis in gefitinib-resistant NSCLC tumor models activity of caspase-3 8 and 9 were measured by the colorimetric assay. The results showed that AZD6244 and/or BEZ235 had no effect on caspase-3 8 and 9 activities in all three gefitinib-resistant NSCLC tumor models (). Effects of AZD6244 and/or BEZ235 on the activities of caspase-3 8 and 9 in NCI-1993 NCI-1975 and NCI-H460 xenograft models. All three gefitinib-resistant tumor xenograft models were treated with the AZD6244 and/or BEZ235 for 2 h on Day 21 of the efficacy study tumor tissues in each group were resected and measured by caspase colorimetric protease kits. N?=?10. Discussion Although advances have been made in cancer treatment with the development of selective molecular targeted therapies several relevant issues for their optimal and effective use remain unsolved. Recent studies have demonstrated that the EGFR-TKI gefitinib and erlotinib are associated with a high response rate and prolong progression-free survival in patients with EGFR mutant lung cancer [22]. Responders to these agents however later relapse after acquiring EGFR-TKI resistance making it urgent to develop novel therapeutic agents that can overcome acquired resistance to EGFR-TKI. Current clinical approaches to combat resistance in lung adenocarcinoma include irreversible and mutant-selective inhibitors of EGFR combination of cetuximab and afatinib [23] and combination of an EGFR inhibitor with a drug targeting a resistance pathway such as the combination of gefitinib and a MET inhibitor [24]. However alternative RTK pathways that are activated following EGFR inhibition are another area for investigation. These alternative pathways may bypass or evade inhibition of EGFR signaling thereby enabling combinations of agents to simultaneously attack multiple molecular targets for cancer growth inhibition. One potential solution to overcome multiple mechanisms of resistance is to target downstream pathways. In this study we show that the combination of a selective MEK inhibitor and a PI3K/mTOR inhibitor is effective against tumor cell lines refractory to gefitinib by three different mechanisms: an EGFR gatekeeper T790M mutation MET amplification and KRAS/PIK3CA mutation. To our knowledge this is the first report of the effects of MEK TKI with PI3K/mTOR TKI therapy in gefitinib-resistant models of NSCLC. MEK is a potentially relevant molecular therapeutic target since it is the activated downstream of the axis RAS/RAF proteins and in turn activates ERK to induce cell proliferation. Therefore several selective MEK inhibitors have been developed [25] and more than ten MEK inhibitors have entered early clinical trial evaluation [26]. Unfortunately clinical activity as single agent has been rarely observed with MEK inhibitors in gefitinib-resistant NSCLC patients [27]. The benefit of blocking an individual pathway has been largely limited by the presence of a compensatory feedback loop between PI3K and MEK. For example inhibition of the MEK pathway results in activation of the PI3K pathway [28] and PI3K activation mediates resistance to MEK inhibition [29]. In our study in order to circumvent this compensatory feedback concurrent blockade of the two pathways has been tested and synergy in antitumor effects was detected providing the rationale for phase I clinical trials. Moreover early signs of clinical benefit have been reported in advanced cancer by a retrospective analysis on patients receiving agents that target both pathways [30]. Gatekeeper mutations the T790M mutation in EGFR associated with resistance to gefitinib [31] are common mechanisms by which tumor cells acquire resistance to molecularly targeted drugs. Although irreversible EGFR-TKIs including BIBW2992 have been developed to overcome T790M-mediated resistance to gefitinib [32] recent clinical trials have failed to show that monotherapy with irreversible EGFR-TKIs has benefits in patients with NSCLC refractory to gefitinib [33]. This may be due at least in part to the low selectivity of this class of compounds to wild-type and mutant EGFR. In addition because HGF overexpression was frequently observed in tumors with the gatekeeper T790M mutation [34] monotherapy with a mutant-selective EGFR-TKI may not be sufficient to inhibit the growth of tumors with acquired resistance to gefitinib. Our findings suggest that the combination of a MEK-TKI and a PIK3/mTOR-TKI may be effective in controlling these resistant tumors. Many KRAS-mutant cancer cells have been shown to be sensitive to MEK inhibitors [35] and KRAS mutations can be detected in up to 30% of lung cancers dependent upon histology and ethnicity [36-38] suggesting that a subset of lung cancers would likely be highly sensitive to AZD6244. Our finding that AZD6244 was effective in one distinct KRAS mutant human lung cancer NCI-H460 models supports and validates this hypothesis. Although monotherapy with AZD6244 resulted in antitumor and some antiangiogenic effects in all of our lung cancer models the antitumor effects were more apparent in the NCI-H1993 lung adenocarcinoma model. The increased antitumor efficacy observed in this model is associated with differences in the inhibitory effect of p-AKT signaling pathway in NCI-H1975 and NCI-H460 lung tumors. However additional studies are needed to elucidate this phenomenon. In this study we evaluated therapy directed against MEK and PI3K/mTOR in distinct gefitinib-resistant NSCLC xenograft models. MEK or PI3K/mTOR inhibition resulted in antitumor effects for these gefitinib-resistance NSCLC models by blocking key intracellular pathways controlling cell proliferation and survival as demonstrated both in vitro and in vivo. Surprisingly PI3K/mTOR inhibition by BEZ235 also suppressed lung tumor angiogenesis and targeted both MEK and PI3K/mTOR activation in lung tumors resulting in substantial antiangiogenic effects which may due to the significantly reduced expression of MMP-9 in tumors. "

Lung_Cancer

"Ibuprofen suppresses the expression of Hsp70 in lung adenocarcinoma cells. (a) Upregulation of Hsp70 in lung cancer cell lines. Each cell extract was separated by SDS-PAGE and immunoblotted with an anti-Hsp70 or actin antibody (upper panel). The quantity of each protein was estimated by densitometric analysis using Scion Image (Scion Frederick MD USA). The Hsp70/actin ratios are shown in the lower panel. (b) Effect of ibuprofen on the expression of Hsp70 protein and mRNA in A549 cells. Top: expression of Hsp70 and Hsc70 proteins in A549 cells treated with ibuprofen at the specified concentrations for 48?h examined as described in a (left panel). Bottom: densitometric analysis of each protein level in arbitrary unit (arb-u). The alternation of each mRNA expression after ibuprofen treatment was analyzed by semiquantitative RT-PCR (top right panel). These results are representative of three separate experiments. (c) Effect of ibuprofen on the expression of Hsp70 protein in H358 cells. Expression of Hsp70 proteins in H358 cells treated with ibuprofen at the specified concentrations for 48?h (upper panel). The quantity of each protein was estimated by densitometric analysis (lower panel) Ibuprofen increased the antitumoural activity of cisplatin by suppressing Hsp70. (a) The viability of A549 (upper panel) and H358 (lower panel) cells treated with ibuprofen for 48?h was analyzed by MTT assay. The value is represented as the percentage of cell viability without ibuprofen set at 100%. (b) Synergistic effect of ibuprofen on cisplatin-induced apoptosis in A549 (upper panel) or H358 (lower panel) cells. The cells were treated with the specified concentrations of cisplatin in absence or presence of 400??M ibuprofen for 48?h and the cell viability was assessed by MTT assay. The results are shown as means±S.D. from triplicated experiments. The results shown are representative of three separate experiments. *P<0.05; **P<0.01 (by Student's t-test). (c) Time course of cisplatin-mediated cell death with ibuprofen. A549 cells were treated with 400??M ibuprofen alone or A549 cells with 10??M cisplatin were cultured in absence or presence of 400??M ibuprofen and the cell viability was analyzed by TUNEL staining. The results shown as means±S.D. **P<0.01 (by Student's t-test). (d) The silencing efficiency of Hsp70 determined by immunoblotting. (e) Effect of Hsp70 RNAi on the cisplatin-mediated death of A549 cells. The cells exposed to siRNA targeting Hsp70 or control siRNA were treated with 10??M cisplatin for 48?h and MTT assay was used to determine the cell viability. Data are presented as means±S.D. from triplicated experiments. The results shown are representative of three separate experiments. *P<0.05; **P<0.01 (by Student's t-test). (f) Cytofluorimetric dot plot analysis of the CF488A-Annexin V versus propidium iodide (PI) staining performed in 10??M cisplatin-treated or -untreated A549 cells in absence or presence of 400??M ibuprofen for 48?h. A representative experiment out of three performed with similar results is shown. (g) Effect of cisplatin on the expression of Hsp70. The data are representative of three separate experiments Ibuprofen inhibits the expression of Hsp70 by transcriptional inactivation. (a) ChIP assay for the association of HSF-1 with Hsp70 gene in A549 cells treated with or without ibuprofen. The DNA in the product immunoprecipitated by anti-HSF-1 or non-immune IgG was followed by PCR with a primer specific to the Hsp70 promoter. The immunoprecipitates with antibody against HSF-1 were confirmed by immunoblotting (bottom left). The actin signal is a control of DNA input (bottom right). (b) Effect of ibuprofen on the expression of HSF-1. Cell extracts from A549 cells with ibuprofen for 48?h were separated by SDS-PAGE and immunoblotted with a HSF-1-specific antibody (upper panel). The quantity of each protein was estimated by densitometric analysis (middle panel). The data are representative of three separate experiments. The effect of ibuprofen on the mRNA level of HSF-1 was confirmed by RT-PCR (lower panel). (c) HSF1-mediated inhibition of Hsp70 expression. A549 cells were treated with 10?nM siRNAs against HSF-1 or non-code siRNA. The HSF-1 silencing efficiency and its effect on the expression of Hsp70 were examined by immunoblotting using appropriate antibodies. Three separate siRNAs oligo against HSF-1 were used for its knock-down. The results shown are representative of three separate experiments Ibuprofen exposure enhanced the cisplatin-dependent mitochondrial membrane depolarization and cytochrome c release. (a) A549 cells were treated for 48?h with 10??M cisplatin 400??M ibuprofen or both and subjected to JC-1 staining to study the changes in mitochondrial membrane potential. The percentages indicate the green fluorescence intensity of JC-1 measuring with FACSCalibur. A representative experiment out of three performed with similar results is shown. (b) A549 cells treated as described earlier were fractionated into cytosol and the release of cytochrome c was analyzed by western blot using anti-cytochrome c antibody. The expression of Erk was monitored as an internal control of cytosol protein. The quantity of each protein was estimated by densitometric analysis. The results are means of three separate experiments from cells in different cultures The downregulation of Hsp70 increased the cisplatin-mediated activation of Bax and its translocation to the mitochondria. (a) Detection of active Bax. A549 cells were treated with cisplatin (10??M) and/or ibuprofen (400??M) for 48?h. Active Bax was immunoprecipitated with an active conformation-specific monoclonal antibody and revealed by immunoblotting with an anti-Bax polyclonal antibody. The quantity of active Bax was estimated by densitometric analysis. (b) A549 cells treated as described earlier were lysed and fractionated by differential centrifugation to separate the mitochondria from the cytosol. The translocation of Bax to the mitochondria was visualized by the immunoblot of mitochondrial fractions using an anti-Bax antibody. VDAC-1 was used as a loading control to ensure the use of equal amounts of mitochondria. (c) A decrease in Hsp70 by RNAi promoted cisplatin-dependent activation of Bax. A549 cells treated with Hsp70 or control siRNA were incubated in presence or absence of cisplatin; each cell extract was immunoprecipitated with an anti-active Bax antibody followed by immunoblotting with anti-Bax antibody. The data are representative of three separate experiments Synergistic effect of Hsp70 suppression on the cisplatin-mediated activation of caspase-9. (a) A549 cells were treated with cisplatin and/or ibuprofen and cell extracts were immunoblotted with active caspase-9 antibody. The lower panel shows the measurement of each caspase-9. (b) A549 cells exposed to siRNA targeting Hsp70 or control siRNA were incubated with or without cisplatin and the active caspase-9 was detected by western blot using an anti-caspase-9 antibody. The quantity of each protein was estimated by densitometric analysis (lower panels). (c and d). Assay for enzymatic activity of caspase-9 using a fluorogenic substrate. (c) After the incubation of the A549 cells with cisplatin (10??M) and/or ibuprofen (400??M) the caspase-9 activity of each cell extract was measured as described in Materials and methods section. (d) A549 cells transfected with Hsp70 siRNA or control siRNA were exposed to cisplatin for 48?h. The caspase-9 activity was then assessed using an enzymatic assay as described earlier. The value of caspase-9 activity was presented relative to the activity in untreated cells set at 1.0. The data represent mean values of three separate experiments. Significances were determined by Student's t-test (*P<0.05) Effects of nonsteroidal anti-inflammatory drugs on the expression of Hsp70 in A549 cells NSAIDs Hsp70 expression (%) Ibuprofen (400??M) 22.7±2.8 Aspirin (2500??M) 95.1±7.8 Diclofenac (200??M) 97.2±5.6 Sulindac (15??M) 98.9±2.9 Piroxicam (60??M) 96.6±6.2 Indometacin (10??M) 95.0±15.1 Mefenamic acid (25??M) 100.5±6.0 Values are shown as means±S.D. The expression of Hsp70 was measured by immunoblotting with an anti-Hsp70 antibody. The quantity of Hsp70 protein was estimated by densitometric analysis using Scion Image. The values in parentheses are the highest non-toxic concentrations (approximately 90% viability) used for each NSAID on the A549 cells for 48?h Table 2 Effects of nonsteroidal anti-inflammatory drugs on the expression of HSF-1 in A549 cells NSAIDs HSF-1 expression (%) Ibuprofen (400??M) 16.2±3.9 Aspirin (2500??M) 93.5±2.9 Diclofenac (200??M) 96.7±6.6 Sulindac (15??M) 99.8±3.6 Piroxicam (60??M) 96.3±4.7 Indometacin (10??M) 98.1±1.6 Mefenamic acid (25??M) 98.5±1.1 Values are shown as means±S.D. The expression of HSF-1 was measured by immunoblotting with anti-HSF-1 antibody. The quantity of HSF-1 protein was estimated by densitometric analysis using Scion Image. The values in parentheses are the highest non-toxic concentrations (approximately 90% viability) used for each of the NSAID on the A549 cells"

Lung_Cancer

" Control Asbestos Mesothelioma P TOL (mmol H2O2 equiv./L) 105.9 ± 92.5 145.1 ± 71.9b 196.3 ± 221.1cd 0.001 TAC (mmol Trolox equiv./L) 0.73 ± 0.34 1.27 ± 0.16c 0.8 ± 0.3f <0.001 OSI 159.3 ± 160.9 112.8 ± 48.3c 898.6 ± 129.7bf 0.007 CRP (mg/dL) 2.8 ± 1.7 4.4 ± 3.1 75.6 ± 54.8af <0.001 ?-1 antitrypsin (mg/dL) 146.7 ± 47.3 213.9 ± 33.9c 262.4 ± 94.9cf <0.001 Transferrin (g/L) 216.9 ± 62.3 282.8 ± 50.1c 171.2 ± 44.5cf <0.001 Ferritin (ng/mL) 112.3 ± 43.7 85.4 ± 110.6 370.7 ± 267.8cf <0.001 Copper (?g/mL) 0.8 ± 0.2 0.7 ± 0.3 1.2 ± 0.3cf <0.001 Ceruloplasmin (mg/L) 36.6 ± 8.6 40.1 ± 9.7 42.9 ± 8.2cd 0.001 TOL: total oxidant level; TAC: total antioxidant capacity; OSI: oxidative stree index; CRP: C-reactive protein; asignificantly different from control (P < 0.05) bsignificantly different from control (P < 0.01) csignificantly different from control (P < 0.001) dsignificantly different from asbestos (P < 0.05) esignificantly different from asbestos (P < 0.01) and fsignificantly different from asbestos (P < 0.001). Comput Math Methods Med Comput Math Methods Med CMMM Computational and Mathematical Methods in Medicine 1748-670X 1748-6718 Hindawi Publishing Corporation 24987451 4058834 10.1155/2014/401201 Research Automatic Lung Tumor Segmentation on PET/CT Images Using Fuzzy Markov Random Field Model Guo Yu 1 Feng Yuanming 1 2 Sun Jian 2 http://orcid./0000-0002-1559-111X Zhang Ning 1 Lin Wang 1 Sa Yu 1 Wang Ping 2 * 1Tianjin Key Lab of BME Measurement Tianjin University Tianjin 300072 China 2Department of Radiation Oncology Tianjin Medical University Cancer Institute and Hospital Tianjin 300060 China *Ping Wang: wangpingtjmuch.com Academic Editor: Lei Chen 2014 29 5 2014 2014 401201 28 3 2014 12 5 2014 Copyright 2014 Yu Guo et al. 2014 This is an open access distributed under the Creative Commons Attribution License which permits unrestricted use distribution and reproduction in any medium provided the original work is properly cited. The combination of positron emission tomography (PET) and CT images provides complementary functional and anatomical information of human tissues and it has been used for better tumor volume definition of lung cancer. This paper proposed a robust method for automatic lung tumor segmentation on PET/CT images. The new method is based on fuzzy Markov random field (MRF) model. The combination of PET and CT image information is achieved by using a proper joint posterior probability distribution of observed features in the fuzzy MRF model which performs better than the commonly used Gaussian joint distribution. In this study the PET and CT simulation images of 7 non-small cell lung cancer (NSCLC) patients were used to evaluate the proposed method. Tumor segmentations with the proposed method and manual method by an experienced radiation oncologist on the fused images were performed respectively. Segmentation results obtained with the two methods were similar and Dice's similarity coefficient (DSC) was 0.85 ± 0.013. It has been shown that effective and automatic segmentations can be achieved with this method for lung tumors which locate near other ans with similar intensities in PET and CT images such as when the tumors extend into chest wall or mediastinum. http://dx../10.13039/501100001809 National Natural Science Foundation of China 81171342 http://dx../10.13039/501100001809 National Natural Science Foundation of China 81201148 Tianjin Research Program of Application Foundation and Advanced Technology 14JCQNJC09500 National Research Foundation for the Doctoral Program of Higher Education of China 20130032120070 National Research Foundation for the Doctoral Program of Higher Education of China 20120032120073 Independent Innovation Foundation of Tianjin University 60302064 Independent Innovation Foundation of Tianjin University 60302069 1. Instruction Combination of positron emission tomography (PET) and CT images provides complementary functional and anatomical information which has been used for tumor volume definition in radiation treatment (RT) planning for lung cancer patients [1]. Automatic methods for tumor segmentation on PET/CT images are highly desired to avoid the inter- and intraobserver variability caused by manual method. Many automatic tumor segmentation techniques for identification and delineation of cancerous tissues have been reported such as for brain tumor [2] lung tumor [3] and prostate tumor [4]. The segmentation can be performed either on a single image set such as CT [5] PET [6] or MRI images [7] or on the fused image set of different image modalities such as CT/PET [8“10] or multiparametric MRI images [2 11]. Different types of tumors and image modalities have different image features and thus different segmentation strategy should be developed for effective and accurate tumor segmentations. CT images provide anatomical information with high spatial resolution. However for the lung tumors abutting or involved in adjacent structures such as chest wall mediastinum or diaphragm which show intensities similar to those of tumors on the images it is difficult to distinguish them from the adjacent tissues with commonly used autosegmentation algorithms. Lung tumors can be distinguished from the adjacent tissues on PET images but the segmentation accuracy is still limited due to the coarser spatial resolution of the image data and motion artifacts as the result of time-consuming procedure of data acquisition. Therefore one of the key points of lung tumor segmentation on PET/CT images is to combine the advantages of the two image modalities effectively. Several methods [8“10] are proposed for lung tumor segmentation on PET/CT images. Most of the reported methods fuse different features extracted from PET and CT images inside one single N-dimensional vector. In this paper we propose a new strategy for fusing PET and CT information. The method is based on fuzzy Markov random field (MRF) model which has shown effective performance for unsupervised image segmentation [12 13]. Different from traditional fuzzy MRF method the proposed method designs a new joint posterior probabilistic model for effective combination of PET and CT image information. The new method was evaluated using image data of 7 patients with lung cancer in this study and experimental results showed its good performance in automatic tumor delineation. This paper is anized as follows. We first present the basic theory about image segmentation using fuzzy MRF model in Section 2.1. The framework of lung tumor segmentation on CT/PET images using fuzzy MRF model is then described in Section 2.2. The evaluation of the proposed method and quantification results are shown in Section 3. Finally discussion and are presented at the end. 2. Materials and Methods 2.1."

Lung_Cancer

" In another study by the same group a set of different miRNAs could be used to differentiate hepatocellular carcinomas from metastatic tumors in the liver [25]. miRNA expression differs between tumor types within the same tumor type in different patients and between primary tumors and metastases. Hence it may not be surprising to find miR-182 to have divergent impact in different stages of NSCLC. Increasing evidence demonstrate that adenocarcinomas and SCC of the lung are separate lung cancer entities have dissimilar features and may respond differently to therapy. Targeted drugs with specific effects in certain histological subgroups have been developed. Certain miRNA-signatures can differentiate SCC from non-SCC and may facilitate the distinction between them [26]. Demonstrating a significant prognostic effect by miR-182 in SCC and not in adenocarcinomas underscores the diversity between the histological subgroups. In a previous published paper from our group [27] we explored the impact of miR-155 in the same cohort. We found this miRNA to be very stage- and tissue specific with a significant impact on survival only in node positive SCC patients. miR-182 has been regarded as an oncogene in most contexts. In a cohort of 253 glioma patients high miR-182 expression was found to be a negative prognostic factor [12]. In melanoma cell lines Segura and coworkers showed that high miR-182 expression stimulated migration and survival. The same group treated liver metastases in mice with anti-miR-182 and obtained a lower tumor burden and a lower mir-182-level than in untreated mice [1328]. Also in breast tumors and cervical cancers miR-182 seems to have an oncogenic impact [2930]. There are other studies that have identified miR-182 as a tumor suppressor. Kong et al. found miR-182 to be underexpressed in human gastric cancer cell lines. They showed that the oncogene cAMP responsive element binding protein 1 (CREB1) is a target of miR-182 and that high levels of miR-182 leads to lower levels of CREB1 and suppressed gastric adenocarcinoma cell growth [31]. In melanoma cell lines Poell et al. found miR-182 to be a strong inhibitor of cell proliferation [14]. Yan and coworkers found similar effects in uveal melanoma cells where they identified MITF BCL2 and cyclin D2 as potential targets of miR-182. Transfection of miR-182 into cultured uveal melanoma cells led to a significant decrease in cell growth migration and invasiveness [16]. In lung cancer data on miR-182 have been conflicting regarding its prognostic role. In 70 lung cancer tissue samples Zhu and coworkers observed an association between high expression of the members of the miR-183 family (miR-96 miR-182 and miR-183) and poor overall survival [11]. In contrast two in vitro studies using cell lines did not support the notion of miR-182 exerting an oncogene role in lung cancer. Sun et al. found miR-182 through regulation of RGS17 to suppresses lung tumorigenesis [15]. Consistently Zhang and coworkers reported miR-182 to inhibit proliferation and invasion of human lung adenocarcinoma cells via its effect on human cortical actin-associated protein (CTTN) [32]. miR-182 has a number of target genes and it is evident that the regulation of these genes can result in both inhibition and stimulation of tumorigenesis. In NSCLC our results suggest that tumor inhibiting miR-182 features dominate and thus make this miRNA a favorable prognostic factor. Based on the association with angiogenesis suggested from the GSEA [17] we investigated the correlation between miR-182 and a set of angiogenesis-related protein markers. There was a negative correlation between miR-182 and FGF2. Our group has published data on FGF2 which identify this marker as an independent negative prognostic factor in lung cancer cells [22]. Fibroblast growth factor receptor substrate 2 (FRS2) is a downstream mediator of the fibroblast growth factor pathway and is a target gene of miR-182. FRS2 is thought to induce tumor progression through stimulation of angiogenesis [1733]. In our total NSCLC cohort the coexpression between miR-182 and FGF2 showed an independent significantly worse prognosis for low miR-182/high FGF2 than for high miR-182/low FGF2 (P?=?0.015 ). A correlation was also detected between miR-182 and MMP-7. In a previous paper our group found high MMP-7 expression to be an independent favorable prognostic factor in this same NSCLC cohort [23]. When examining coexpression of the two variables those with high miR-182 and high MMP-7 expression had an independently better survival than those with low miR-182/low MMP-7 expression (HR 0.49 P?=?0.015). When stratifying on histology the SCC patients with high/high expression had a remarkably better prognosis than the rest of the groups (HR 0.26 P?=?0.012 ). To our knowledge there are no published data linking miR-182 and MMP-7. Few studies have described the connection between FGF2 and MMP-7 [3435]. Based on our strong results from the co-variations between miR-182 and particularly MMP-7 it would be interesting to see functional studies exploring potential relations between these two markers. In our previous pilot study on miRNA signatures [17] miR-182 appeared as an oncogene since it was up-regulated in short vs long term NSCLC survivors and in NSCLC vs normal tissues. In our large unselected NSCLC cohort presented herein we surprisingly observed that high miR-182 expression is associated with improved survival at least in subgroups of patients with NSCLC. It has to be kept in mind that the explorative study was based on a small sample only 20 NSCLC cases and 10 normal lung tissues. Hence the contrasting results may be due at least in part to selection bias in the explorative study. Besides in the present study the favorable prognostic impact by miR-182 was seen in subgroups of NSCLC patients and assessments were tissue specific (only in tumor cells) using in situ hybridization and not real time qPCR as in the pilot study [17]. When using qPCR a contribution from the stromal compartment will influence the result and the stromal expression of miR-182 may be different from that of the tumor cells. Conclusion In miR-182 tended to be a favorable prognostic factor in the total NSCLC cohort. Moreover in stage II and in SCC patients we found miR-182 to have tumor suppressor properties. Nevertheless our study must be regarded as hypotheses generating and needs to be confirmed in other cohorts and functional studies. We found a weak but significant association between mir-182 and the angiogenesis related markers FGF2 and MMP-7. It would be interesting to see further studies exploring these associations. Competing interests The authors declare that they have no competing interests. Authors™ contributions HS participated in the design of the study contributed to the clinical and demographic database did the statistical analysis and drafted the manuscript. TD SA and SAS contributed to the clinical and demographic database and SAS in making the TMAs. TD and SA contributed to the statistical analysis. SAS and HS scored the cores. RMB and LTB supervised and participated in the study design result interpretation and writing. All authors read and approved the final manuscript. Pre-publication history The pre-publication history for this paper can be accessed here: http://www.biomedcentral.com/1471-2407/14/138/prepub Acknowledgements The study was solely funded by the Northern Norway Regional Health Authority (Helse Nord RHF) which is responsible for the public hospitals in northern Norway. The funders had no role in study design data collection and analysis decision to publish or preparation of the manuscript. The authors thank the engineers Mona I Pedersen and Marta Uso who carried out the ISH-procedures. Jemal A Siegel R Xu J Ward E Cancer statistics 2010 CA Cancer J Clin 2010 60 277 300 10.3322/caac.20073 20610543 Drilon A Rekhtman N Ladanyi M Paik P Squamous-cell carcinomas of the lung: emerging biology controversies and the promise of targeted therapy Lancet Oncol "

Lung_Cancer

"This combination has two possible explanations. Firstly they might represent tumors which are not expressing ALK protein at detectable levels because of a false-positive FISH result or an absence of addiction to rearranged ALK protein despite presence of recombined ALK DNA. These tumors are unlikely to respond to crizotinib. Secondly they might represent a failure of the IHC assay because of poor preservation of antigen insufficient material or another technical error. In this case crizotinib therapy would still be likely to be effective. The study includes seven cases with positive FISH results with data on response to crizotinib. Six showed at least a partial response to crizotinib therapy as assessed by Response Evaluation Criteria in Solid Tumors criteria. A single case showed no response and this was one of the two œfalse negatives. Thus in this one case the IHC test would have correctly predicted response. This was a scanty cytological specimen in which FISH interpretation was difficult and only 20% of 515 cells showed rearranged ALK signals (fusion plus split red/green probes and fusion plus isolated red signal). Therefore it seems possible that this represents a technical failure of the FISH assay. The other case an excision specimen showed 39% of 626 cells with rearranged signals. It was also shown to harbor a driving mutation in a second gene; PCR testing demonstrated the loss of exon 19 of endothelial growth factor receptor. This has been described in another study that characterized two such œfalse-negative cases.15 Thus these tumors may well escape œoncogene addiction to the ALK kinase activity which would be consistent with indetectable ALK protein expression. Again IHC would be expected to be the best predictor of response to tyrosine kinase inhibitor therapy in such cases. It is essential to identify and molecularly characterize other œfalse-negative cases that have received crizotinib therapy. In addition it seems likely that IHC should guide treatments in œfalse-positive cases that express high levels of ALK from genetic lesions that are invisible to the current FISH assay. Although we identified no œfalse positives i.e. FISH-negative IHC-positive cases our sensitivity may be an overestimate (as judged by FISH) because of the small number of FISH-negative cases under study. Several studies have identified rare cases with rearrangements that are indetectable by FISH but detectable by IHC and confirmed by reverse-transcriptase PCR.5910 Such cases would be expected to respond to crizotinib and a recent study shows that at least one novel œFISH-indetectable rearrangement does indeed drive the malignant phenotype.5 One limitation of this study is the small number of cases under study although 15 FISH-positive cases is comparable to most other studies. The relatively small number of FISH-negative cases may have affected our ability to identify FISH-negative IHC-positive cases. However the study design does permit an assessment of the sensitivity of the IHC assay which is the most important consideration for a possible screening test. Our comparison of the immunohistochemical assays was not directly equivalent as the D5F3 assay included a proprietary tyramide signal amplification step whereas the ALK1 and 5A4 assays were conducted using our routine diagnostic detection system. However our study design also has several strengths. In particular the use of archival diagnostic paraffin blocks and FISH testing conducted in the course of routine diagnosis make the results of the study directly relevant to clinical practice. In summary we find IHC to be a highly sensitive (86%) and specific (100%) test for ALK rearrangement in lung adenocarcinoma. We find a slight advantage of a proprietary amplified assay (D5F3 Ventana) over two other antibodies with conventional DAB staining (ALK1 Dako and 5A4 Abcam) but only in scanty samples. Intensity of staining was the most discriminating measure and the proportion of cells staining did not contribute. We identified two cases that were positive for the ALK rearrangement by FISH but negative by all immunohistochemical assays and suggest that in discordant cases the IHC test result may be more predictive of treatment response than FISH. Further discordant cases need to be examined to help guide the treatment of these cases. Immunohistochemical testing is clearly at least a useful adjunct to FISH and we feel that it is reasonable in routine practice to use a sensitive IHC assay as a screening test. The danger of missing treatable cases using this method (i.e. FISH-positive IHC-negative crizotinib-sensitive tumors) appears very small especially when specimens contain adequate material. In difficult cases further investigations such as re-biopsy and repeated IHC/FISH may be helpful. Disclosure: This project was supported by the National Institute of Health Research Respiratory Disease Biomedical Research Unit at the Royal Brompton and Harefield NHS Foundation Trust and Imperial College London and the NIHR RM/ICR Biomedical Research Center. All other authors declare no conflict of interest. REFERENCES 1. Inamura K Takeuchi K Togashi Y EML4-ALK lung cancers are characterized by rare other mutations a TTF-1 cell lineage an acinar histology and young onset. Mod Pathol 2009 22 508 515 19234440 2. Koivunen JP Mermel C Zejnullahu K EML4-ALK fusion gene and efficacy of an ALK kinase inhibitor in lung cancer. Clin Cancer Res 2008 14 4275 4283 18594010 3. Shinmura K Kageyama S Tao H EML4-ALK fusion transcripts but no NPM- TPM3- CLTC- ATIC- or TFG-ALK fusion transcripts in non-small cell lung carcinomas. Lung Cancer 2008 61 163 169 18242762 4. Soda M Choi YL Enomoto M Identification of the transforming EML4-ALK fusion gene in non-small-cell lung cancer. Nature 2007 448 561 566 17625570 5. To KF Tong JH Yeung KS Detection of ALK rearrangement by immunohistochemistry in lung adenocarcinoma and the identification of a novel EML4-ALK variant. J Thorac Oncol 2013 8 883 891 23625156 6. McDermott U Iafrate AJ Gray NS Genomic alterations of anaplastic lymphoma kinase may sensitize tumors to anaplastic lymphoma kinase inhibitors. Cancer Res 2008 68 3389 3395 18451166 7. Kwak EL Bang YJ Camidge DR Anaplastic lymphoma kinase inhibition in non-small-cell lung cancer. N Engl J Med 2010 363 1693 1703 20979469 8. Lindeman NI Cagle PT Beasley MB Molecular testing guideline for selection of lung cancer patients for EGFR and ALK tyrosine kinase inhibitors: guideline from the College of American Pathologists International Association for the Study of Lung Cancer and Association for Molecular Pathology. J Thorac Oncol 2013 8 823 859 23552377 9. Murakami Y Mitsudomi T Yatabe Y A Screening Method for the ALK Fusion Gene in NSCLC. Front Oncol 2012 2 24 22655265 10. Rodig SJ Mino-Kenudson M Dacic S Unique clinicopathologic features characterize ALK-rearranged lung adenocarcinoma in the western population. Clin Cancer Res 2009 15 5216 5223 19671850 11. Peled N Palmer G Hirsch FR Next-generation sequencing identifies and immunohistochemistry confirms a novel crizotinib-sensitive ALK rearrangement in a patient with metastatic non-small-cell lung cancer. J Thorac Oncol 2012 7 e14 e16 22895149 12. Eisenhauer EA Therasse P Bogaerts J New response evaluation criteria in solid tumours: revised RECIST guideline (version 1.1). Eur J Cancer 2009 45 228 247 19097774 13. Selinger CI Rogers TM Russell PA Testing for ALK rearrangement in lung adenocarcinoma: a multicenter comparison of immunohistochemistry and fluorescent in situ hybridization. Mod Pathol 2013 26 1545 1553 23743928 14. Conklin CM Craddock KJ Have C Laskin J Couture C Ionescu DN Immunohistochemistry is a reliable screening tool for identification of ALK rearrangement in non-small-cell lung carcinoma and is antibody dependent. J Thorac Oncol 2013 8 45 51 23196275 15. Sholl LM Weremowicz S Gray SW Combined use of ALK immunohistochemistry and FISH for optimal detection of ALK-rearranged lung adenocarcinomas. J Thorac Oncol 2013 8 322 328 23407557 16. Savic S Bode B Diebold J Detection of ALK-positive non-small-cell lung cancers on cytological specimens: high accuracy of immunocytochemistry with the 5A4 clone. J Thorac Oncol 2013 8 1004 1011 23689429 Br J Cancer Br. J. Cancer British Journal of Cancer 0007-0920 1532-1827 Nature Publishing Group 24292447 3915116 bjc2013735 10.1038/bjc.2013.735 Clinical Study A phase II multicentre study of ziv-aflibercept in combination with cisplatin and pemetrexed in patients with previously untreated advanced/metastatic non-squamous non-small cell lung cancer Ziv-aflibercept/cisplatin/pemetrexed in NSCLC Chen H 1 * Modiano M R 2 Neal J W 3 Brahmer J R 4 Rigas J R 5 Jotte R M 6 Leighl N B 7 Riess J W 3 Kuo C J 3 Liu L 8 Gao B 8 DiCioccio A T 8 Adjei A A 1 Wakelee H A 3 1Department of Medicine Roswell Park Cancer Institute Elm & Carlton Streets Buffalo NY 14263 USA 2Arizona Oncology/Arizona Clinical Research Center 1620W. St Mary's Rd Tucson AZ 85745 USA 3Department of Medicine Stanford University School of Medicine and Cancer Institute 875 Blake Wilbur Dr Stanford CA 94305 USA 4Department of Oncology The Sidney Kimmel Comprehensive Cancer Center at Johns Hopkins Bunting/Blaustein CRB 1650 Orleans St. G94 Baltimore MD 21231 USA 5Department of Medicine Norris Cotton Cancer Center Geisel School of Medicine at Dartmouth 1 Medical Center Drive Lebanon NH 03756 USA 6Rocky Mountain Cancer Centers 1800 Williams Street Suite 200 Denver CO 80218 USA 7Department of Medicine Princess Margaret Hospital and University of Toronto 610 University Avenue Toronto ON M5G 2M9 Canada 8Regeneron Pharmaceuticals Inc. 777 Old Saw Mill River Road Tarrytown NY 10591 USA *E-mail: hongbin.chen@roswellpark.org 04 02 2014 28 11 2013 110 3 602 608 29 08 2013 27 10 2013 30 10 2013 Copyright © 2014 Cancer Research UK 2014 Cancer Research UK From twelve months after its original publication this work is licensed under the Creative Commons Attribution-NonCommercial-Share Alike 3.0 Unported License. To view a copy of this license visit http://creativecommons.org/licenses/by-nc-sa/3.0/ Background: This study evaluated the efficacy and safety of ziv-aflibercept in combination with cisplatin and pemetrexed in non-small cell lung cancer (NSCLC). Methods: This single arm multicentre phase II trial enrolled patients with previously untreated locally advanced or metastatic non-squamous NSCLC. Patients received intravenous ziv-aflibercept 6?mg?kg?1 pemetrexed 500?mg?m?2 and cisplatin 75?mg?m?2 every 21 days for up to six cycles. Maintenance administration of ziv-aflibercept was to continue until disease progression intolerable toxicity or other cause for withdrawal. The co-primary end points were objective response rate (ORR) and progression-free survival (PFS). Planned sample size was 72 patients. Results: The study was closed prematurely because of three confirmed and two suspected cases of reversible posterior leukoencephalopathy syndrome (RPLS). A total of 42 patients were enrolled. Median age was 61.5 years; 55% were male 86% Caucasian and 50% had Eastern Cooperative Oncology Group performance status (ECOG PS)=0. A median of four cycles of ziv-aflibercept was administered. The most common treatment-emergent adverse events (TEAEs) of any grade were nausea (69%) and fatigue (67%) with hypertension (36%) as the most common grade 3/4 TEAE. Of the 38 evaluable patients ORR was 26% and median PFS was 5 months. Conclusion: Cases of RPLS had been observed in other studies in the ziv-aflibercept clinical development programme but the rate observed in this study was higher than previously observed. This might be related to declining renal function and/or hypertension. Although ORR and PFS were in accordance with most historical first-line NSCLC studies this combination of ziv-aflibercept/cisplatin/pemetrexed will not be further explored in NSCLC. ziv-aflibercept non-small cell lung cancer reversible posterior leukoencephalopathy syndrome anti-angiogenesis Cancer growth is dependent upon angiogenesis to maintain a source of nutrition and oxygen (Folkman 1995) and vascular endothelial growth factor (VEGF) has a key role in tumour angiogenesis (Ferrara and Davis-Smyth 1997). Non-small cell lung cancer (NSCLC) produces VEGF and high serum levels of VEGF are correlated with poor prognosis (Korpanty et al 2010). Anti-angiogenic therapy thus aims to disrupt blood supply to tumours and has proven clinical benefit in non-squamous NSCLC (Jain 2001). Combination chemotherapy is used for the first-line treatment of advanced/metastatic NSCLC (Schiller et al 2002). The addition of the anti-VEGF antibody bevacizumab to carboplatin/paclitaxel in this setting improved response rate progression-free survival (PFS) and overall survival (OS; Sandler et al 2006). Similarly bevacizumab improved PFS when added to cisplatin/gemcitabine although OS was not significantly prolonged as a secondary end point in this case (Reck et al 2009). For non-squamous histology cisplatin/pemetrexed is a very active combination chemotherapy (Scagliotti et al 2008) and thus combinations of platinum/pemetrexed with bevacizumab or other anti-angiogenics are of strong interest for the first-line treatment of advanced/metastatic non-squamous NSCLC (Patel et al 2009b). Ziv-aflibercept (ZALTRAP Sanofi Bridgewater NJ USA and Regeneron Pharmaceuticals Tarrytown NY USA) is a recombinant fusion protein consisting of portions of human VEGF receptor extracellular domains fused to the Fc portion of human immunoglobulin (Gaya and Tse 2012). Ziv-aflibercept binds VEGF-A by acting as a high-affinity ligand trap to prevent binding to its endogenous receptor VEGFR-2 thereby inhibiting VEGF-induced angiogenesis in preclinical models (Lassoued et al 2010). Endothelial cells expressing high levels of VEGFR-2 were highly susceptible to blockade by ziv-aflibercept (Sitohy et al 2011). In addition ziv-aflibercept binds PIGF (placental growth factor) and VEGF-B which could potentially inhibit cancer invasion (Dowlati 2010). Studies have investigated ziv-aflibercept as a single agent or in combination with other chemotherapeutic agents in treatment of various types of cancers (Lockhart et al 2010; Tew et al 2010; de Groot et al 2011; Isambert et al 2012). In August 2012 ziv-aflibercept was approved by the US FDA for use in metastatic colorectal cancer based on the results of VELOUR trial (Van Cutsem et al 2012). A phase II study using ziv-aflibercept as monotherapy demonstrated objective responses in heavily pretreated patients with advanced adenocarcinoma of the lung (Leighl et al 2010) and improvement in response and PFS (but not OS) was observed in combination with docetaxel as second-line treatment of NSCLC (Ramlau et al 2012). We report the results of a phase II trial of ziv-aflibercept in combination with cisplatin and pemetrexed in patients with advanced or metastatic non-squamous NSCLC. This study was conducted after a phase I trial using the same regimen of ziv-aflibercept/cisplatin/pemetrexed (Diaz-Padilla et al 2012). That phase I trial determined the recommended dose of ziv-aflibercept (6?mg?kg?1 every 21 days) to be used in the current phase II trial which aimed to evaluate the efficacy and safety of ziv-aflibercept in combination with cisplatin and pemetrexed in the first-line treatment of advanced/metastatic NSCLC. Materials and methods Eligibility Patients eligible for this study had histologically/cytologically confirmed untreated locally advanced/metastatic NSCLC and they had to have measurable disease as per the Response Evaluation Criteria in Solid Tumors (RECIST) criteria (Therasse et al 2000). Patients with squamous histology and/or cavitating lesions were excluded. Patients were 18 years of age or older and had an Eastern Cooperative Oncology Group performance status (ECOG PS) of 0 or 1 with adequate bone marrow renal and hepatic functions and calculated creatinine clearance (CrCL) ?60?ml?min?1. Patients were excluded from the study if they had brain or central nervous system metastases; systolic blood pressure (BP) >150?mm?Hg and/or diastolic blood pressure >100?mm?Hg; bleeding diathesis or evidence of active bleeding; or recent significant cardiovascular cerebrovascular or thromboembolic conditions. The protocol was approved by the Institutional Review Boards at each participating institution. Informed consent was obtained from each patient. Study design This is a single arm open label multicentre phase II study (ClinicalTrials.gov identifier: NCT00794417). Patients received the three-drug combination intravenously on day 1 of every 21 days with ziv-aflibercept (6?mg?kg?1) first followed by pemetrexed (500?mg?m?2) and cisplatin (75?mg?m?2). Premedications consisted of folic acid vitamin B12 and dexamethasone as a prophylactic measure to reduce pemetrexed-related toxicities and standard anti-emetics. Patients could receive up to six cycles of combination therapy. For patients who completed the combined chemotherapy maintenance ziv-aflibercept every 21 days was to continue until disease progression intolerable toxicity or withdrawal from the study. End points and assessments The two co-primary end points were objective response rate (ORR) and PFS. The ORR was defined as the proportion of patients with complete response plus partial response (CR+PR). The PFS was defined as the time interval from the first dose of combination chemotherapy to tumour progression or death whichever occurred first. Secondary variables were the determination of the adverse events (AEs) pharmacokinetics (PK) and pharmacodynamic profiles (including anti-ziv-aflibercept antibody and hematopoiesis). Pharmacokinetic end points included the area under the concentration curve maximum concentration (Cmax) clearance and terminal half-life (t1/2). Tumour imaging (CT or MRI) was performed at screening on day 21 (±7 days) of every even numbered cycle (every 6 weeks) and when disease progression was suspected. Responses were assessed using RECIST version 1.0 (Therasse et al 2000). Safety and tolerability were assessed at baseline and at least every 21 days as evaluated by AEs and changes in laboratory parameters graded according to the Common Terminology Criteria for Adverse Events (CTCAE) version 3.0 (National Cancer Institute 2006). Ziv-aflibercept (free or bound to VEGF) in plasma samples was quantified using a validated direct enzyme-linked immunosorbent assay. A validated non-quantitative titre-based bridging assay was used to detect anti-ziv-aflibercept antibodies in serum samples. Correlative studies The exploratory objective of the correlative studies was to evaluate changes in erythropoiesis in response to VEGF inhibition. It was hypothesised that VEGF inhibition would result in an increase in haemoglobin via increased hepatic erythropoietin production. Statistical analysis Statistical testing was done to determine whether the ORR was larger than 20% or whether the PFS was greater than 4.5 months. Exact test (one-sided) was used to test the null hypothesis that ORR was ?20% versus the alternative hypothesis that ORR was ?35%. Assuming type I error was not >2.5% a sample of 72 patients would provide >80% power to test the hypothesis using exact binomial test. The calculated sample size of 72 patients would also provide >90% power to test the null hypothesis that median PFS was ?4.5 months versus the alternative hypothesis that PFS was ?6.5 months at one-sided alpha of 2.5% using one sample log-rank test. Safety data were to be summarised. Concentrations of free ziv-aflibercept and adjusted bound ziv-aflibercept: VEGF complex were to be summarised every 21 days over the duration of the study by nominal time point. Noncompartmental parameters were calculated using WinNonlin (version 5.3 Pharsight Corporation Mountain View CA USA) and model 202 (constant infusion) using nominal time points after a single dose of ziv-aflibercept. The noncompartmental analysis was performed over the dosing interval 21 days following the first dose. All analyses used statistical software SAS (version 9.1.3 Cary NC USA). Results Patients This study was closed prematurely because of three confirmed and two suspected but unconfirmed cases of reversible posterior leukoencephalopathy syndrome (RPLS). A total of 42 patients were enrolled from 17 participating sites across the United States and Canada between January 2009 and December 2010. Table 1 summarises the patient demographics. Median age was 61.5 years; 55% were male 86% were Caucasian and 50% had ECOG PS of 0. Safety evaluation Treatment exposure and dose modifications All 42 patients received at least one dose of each of the three study drugs with a median of 92 days of treatment (range 21“288 days). Twenty-seven (64%) patients completed four or more cycles of the combination treatment. A median of 4.5 (range 1“6) cycles of pemetrexed and 4 (range 1“6) cycles of cisplatin were administered. The median dose intensity was 163.9 (range 110.1“175.5)?mg?m?2 per week for pemetrexed and 24.6 (range 15.3“26.3)?mg?m?2 per week for cisplatin. The delivered dose intensities were 98.3% for pemetrexed and 98.5% for cisplatin. Seventeen (40%) completed six or more cycles of ziv-aflibercept. The median dose intensity of ziv-aflibercept was 1.97?mg?kg?1 per week close to the planned intensity of 2?mg?kg?1 per week. Reasons for treatment discontinuation were disease progression (33%) AEs (33%) and others (34% including withdrawal of consent and investigator request). Seventeen patients had at least one cycle delayed. Eleven patients (26%) had at least 1 dose modification of ziv-aflibercept 6 (14%) of pemetrexed and 11 of cisplatin. Adverse events Thirty-five patients (83%) experienced a treatment-emergent adverse event (TEAE) of grade 3 or 4 (3/4) and 16 patients (38%) experienced a serious TEAE. The most common TEAEs were nausea (69%) fatigue (67%) and hypertension (57%). Hypertension neutropaenia and hypokalaemia were the most common grade 3/4 TEAEs in 36%0.14 and 10% of patients respectively. Table 2 summarised the most common TEAEs. Thirty-nine patients (93%) experienced at least one haematologic abnormality with grade 3/4 in eight patients (19%) mostly neutropaenia. Every patient experienced at least one abnormal chemistry value with grade 3/4 in 15 (36%) most commonly hyponatraemia. Seven patients (17%) died before clinical cutoff of the study. Five died due to disease progression and two due to TEAEs: 1 pneumonia and 1 sepsis. Neurological toxicities Between 26 September 2010 and 30 December2010 five patients experienced neurological symptoms including altered mental status in four slurred speech in one seizure in two and headache in four patients. Three patients had a brain MRI that was consistent with RPLS (Figure 1B). Brain MRI was negative for RPLS in two other patients. The three patients diagnosed with RPLS were all Caucasian women aged 3851 and 72 years respectively. One of the three patients with RPLS entered the study with a history of hypertension. All three patients experienced elevated BP and two patients had reduced CrCL during the therapy: one patient's CrCL decreased by 45% from baseline (141 to 78?ml?min?1) after one cycle and the other's decreased by 20% (64 to 51?ml?min?1) after four cycles. They were diagnosed with RPLS after one two and five cycles of ziv-aflibercept respectively. Two patients recovered from RPLS and one died due to disease progression before RPLS resolution. Pharmacokinetic information was available for two of the three RPLS patients and for one suspected case: systemic concentrations of free ziv-aflibercept were within the range of other patients in the treatment cohort. In the phase I study using the same regimen (N=18) five patients experienced a mild neurocognitive disturbance but no RPLS was diagnosed (Diaz-Padilla et al 2012). Rare cases of RPLS have been observed in the ziv-aflibercept clinical development programme but the rate observed in this study (3 out of 42=7%) was much higher than previously reported (i.e. 0.5% of 3795 patients treated with ziv-aflibercept as monotherapy or in combination with chemotherapy ZALTRAP product insert). As a result this study was permanently closed to enrolment. Patients who remained on study were re-consented with updated safety information regarding RPLS in addition to continued close monitoring. Hypertension and renal insufficiency are two risk factors for RPLS. Twenty-four patients (57%) experienced hypertension (15 grade 3 but no grade 4) during the study 15 of whom had a history of hypertension and 12 had taken antihypertensive medications before entering the study. Eight patients with hypertension also experienced proteinuria. Fourteen patients (33%) experienced proteinuria (all grades 1 or 2 except a single grade 3) none of whom had a history of renal disease. Fourteen patients experienced CrCL decreases during treatment with six patients having CrCL decreases below 60?ml?min?1 after treatment cycle 4. Efficacy evaluation As the study was closed prematurely there was no statistical power to test the primary hypothesis. Of the 42 patients enrolled 4 patients discontinued early from the study due to AEs (2) consent withdrawal (1) and investigator decision (1). As they did not have a post-baseline tumour assessment they were excluded from the efficacy assessment per predefined statistical analysis plan. Of the 38 patients evaluable for efficacy the median PFS was 5 months (95% CI 4.3“7.1; Figure 1A) and ORR was 26% (95% CI 12“40%) all of which (10/38) were PR. The disease control rate (PR+stable disease) was 89% (26%+63%). "

Lung_Cancer

"Among the remaining fifty unamplified cases eight (14%) also showed enhanced SETDB1 expression that could be associated with other upstream regulatory events. Overall our results indicate that the histone methyltransferase SETDB1 undergoes gene amplification in the natural history of lung tumorigenesis in non-small and small cell lung cancers. The copy-number gain for SETDB1 is associated with overexpression of the transcript and protein in lung cancer cell lines and primary tumors. From a functional standpoint SETDB1 exerts growth enhancing activity in vitro and in vivo as we have shown by depletion and transfection experiments in cell culture and in the nude mice model. Lung cancer cells carrying a SETDB1 gene amplification event are also more sensitive to the antiproliferative action mediated by the antitumoral antibiotic mithramycin a proposed inhibitor of SETDB1 activity. Thus our results suggest an oncogenic role for SETDB1 in lung carcinogenesis and raise the possibility of exploring new targeted therapies for the subset of lung tumor patients harboring the SETDB1 gene amplification event. This work was supported by the European Community's Seventh Framework Programme (FP7/2007-2013) under Grant agreement number HEALTH-F2-2010-258677”CURELUNG project the Institute of Health Carlos III (ISCIII)”PI10/02992 Ministerio de Educacin Ciencia e Innovacin Grant SAF2010-14935 Kutxa-Fundacin INBIOMED and the Health and Science Departments of the Catalan Government (Generalitat de Catalunya). ME is an ICREA Research Professor. Supplementary Information accompanies this paper on the Oncogene website (http://www.nature.com/onc) The authors declare no conflict of interest. Jones PA Baylin SB The epigenomics of cancer Cell 2007 128 683 692 17320506 Berdasco M Esteller M Aberrant epigenetic landscape in cancer: how cellular identity goes awry Dev Cell 2010 19 698 711 21074720 F¼llgrabe J Kavanagh E Joseph B Histone onco-modifications Oncogene 2011 30 3391 3403 21516126 Fraga MF Ballestar E Villar-Garea A Boix-Chornet M Espada J Schotta G Loss of acetylation at Lys16 and trimethylation at Lys20 of histone H4 is a common hallmark of human cancer Nat Genet 2005 37 391 400 15765097 Seligson DB Horvath S Shi T Yu H Tze S Grunstein M Global histone modification patterns predict risk of prostate cancer recurrence Nature 2005 435 1262 1266 15988529 Schneider R Bannister AJ Kouzarides T Unsafe SETs: histone lysine methyltransferases and cancer Trends Biochem Sci 2002 27 396 402 12151224 Esteller M Epigenetics provides a new generation of oncogenes and tumour-suppressor genes Br J Cancer 2006 94 179 183 16404435 Yoshimi A Kurokawa M Key roles of histone methyltransferase and demethylase in leukemogenesis J Cell Biochem 2011 112 415 424 21268062 Rodr­guez-Paredes M Esteller M Cancer epigenetics reaches mainstream oncology Nat Med 2011 17 330 339 21386836 Chen H Tu SW Hsieh JT Down-regulation of human DAB2IP gene expression mediated by polycomb Ezh2 complex and histone deacetylase in prostate cancer J Biol Chem 2005 280 22437 22444 15817459 Yu J Cao Q Mehra R Laxman B Yu J Tomlins SA Integrative genomics analysis reveals silencing of beta-adrenergic signaling by polycomb"

Lung_Cancer

"Then 1—106 freshly prepared cells were suspended in 100 µl PBS and stained with combination of fluorochrome-coupled antibodies to CD11b and Gr1. Cells were collected by FCM. Data were analyzed with FlowJo software. Western Blot Analysis The western blot analysis was performed as described previously with some modifications [33]. Briefly 4T1 cells were treated with niclosamide in designed concentration for 24 hours then cells were washed with cold PBS twice and lysed in RIPA buffer. Protein concentrations were measured using the Lowry method and equalized before loading. Equal amounts of total protein from each sample was applied to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) gels and transferred onto polyvinylidene difluoride (PVDF) membranes (Amersham Bioscience Piscataway NJ). After electrophoresis the membranes were blocked for 2 h at 37°C and incubated with specific primary antibodies overnight at 4°C followed by the secondary antibody conjugated to horseradish peroxidase. The reactive bands were detected using a commercially available enhanced chemiluminescence kit (Amersham Piscataway NJ). Boyden Chamber Migration and Invasion Assay Boyden chamber (8 µm pore size) migration assay was performed as previously described with some modification [34]. Briefly 5—104 4T1 cells or MDA-MB-231 cells in 100 µl serum-free medium were added in the top chamber then 600 µl of medium with 10% FBS was added to the bottom chamber. Different concentrations of niclosamide were added in both chambers. Cells were allowed to migrate for 20 hours. Non-migrated cells in the top chamber were removed. The migrated cells were fixed in 4% paraformaldehyde and stained with 0.5% crystal violet. Migrated cells were counted and photographed under a light microscope. Invasion assay was conducted according to previous study [34]. Briefly the upper surface of the transwell plate was coated with 60 µl Matrigel (BD Biosciences). After Matrigel polymerization the bottom chambers were filled with 500 µl medium containing 10% FBS. 5—104 4T1 cells or MDA-MB-231 cells in 100 µl serum-free medium were added in the upper part of each transwell and treated with different concentrations of niclosamide. After incubation for 20 hours non-migrated cells on the top side of the filter were removed and migrated cells were fixed with 100% methanol and stained with 0.5% crystal violet then migrated cells were counted and photographed under a light microscope. Percentage of migrated cells inhibited by niclosamide was quantified. Mice and Tumor Model All animal experiments were approved and conducted by the Institutional Animal Care and Treatment Committee of Sichuan University in China (Permit Number: 20121101). Female BALB/c mice (Six- to eight-week-old) used in this study were obtained from Beijing HFK bioscience CO. Ltd Beijing China. Briefly 100 µL 4T1 tumor cell suspension containing 1.0—106 cells were injected subcutaneously in the right flank of BALB/c mice. About seven days after inoculation tumor cells the tumor-bearing mice were randomized into three groups (8 mice per group) and received intraperitoneally injection (i.p.) of niclosamide 20 mg/kg 10 mg/kg or vehicle respectively once daily for 21 days. Tumor volumes and body weight were assessed every three days. The tumor size was calculated according to the formula: Tumor volume (mm3)?=?0.52—L—W2 where L is the length and W is the width. Moreover when all animals were euthanized by cervical dislocation the lungs were harvested total number of lung metastases was counted. Immunohistochemistry Immunohistochemistry staining of tumor sections were described previously [18]. One part of paraffin tumor sections was stained with hematoxylin and eosin (H&E). The other part was stained with Ki67 cleaved casepase-3 VEGF antibodies using immunohistochemistry staining to investigate tumor cell proliferation and apoptosis respectively. In addition paraffin-embeded tumor sections were stained with an anti-CD31 antibody to examine blood vessel density. Images were taken with Leica microscope (Leica DM4000B). Toxicity Evaluation To test potential side effects or toxicity on mice during the treatment all the animals were observed continuously for relevant indexes such as body weight anorexia diarrhea and other clinical symptoms. At the 28th day all animals were euthanized by cervical dislocation after taking blood from eyeball. Blood was obtained for blood routine analysis by Nihon Kohden MEK-5216K Automatic Hematology Analyzer. The tissues of heart lung spleen liver and kidney were stained with H&E for histopathologic examination. Statistical Analysis Data represented as means±SD of three independent experiments. The statistical comparisons were made by Student™s T test and statistically significant p values were labeled as follows: *P<0.05; **P<0.01; ***P<0.001. Results The Anti-proliferation Effects of Niclosamide against Breast Cancer Cells In order to investigate whether niclosamide has direct effects on breast cancer cells we tested the proliferation inhibition caused by niclosamide treatment on different breast cancer cell lines by MTT. After exposure to niclosamide for 72 h the IC50 of MDA-MB-231 MCF-7 MDA-MB-468 were 0.95 µM 1.05 µM and 1.88 µM respectively (A). Exposure of 4T1 cells to niclosamide for 24 h 48 h and 72 h respectively resulted in decrease of the cell proliferation (B). Therefore these results demonstrated that niclosamide inhibited breast cancer cells proliferation in a time- and concentration-dependent manner. Thus we chose 4T1 and MDA-MB-231 cell lines for further experiments. .0085887.g001 The effect of niclosamide on breast cancer cells viability. (A) Proliferation of MDA-MB-231 MCF-7 MDA-MB-468 cells treated with various concentrations (0“10 µM) of niclosamide for 72 hours respectively. Cell viability was detected by MTT assay. The data are expressed as the means ± SD from three independent experiments. (B) MTT assays showed niclosamide inhibited 4T1 breast cancer cells proliferation concentration- and time-dependently. Values represented means ± SD from three experiments (*p<0.05; **p<0.01; ***p<0.001). (C) The effects of niclosamide (a-f:0“1.25 µM) on colony formation in 4T1 cells 12 days the statistic results of colony formation assays presented as surviving colonies. Data are expressed as means ± SD from three experiments (*p<0.05; **p<0.01). (D) The fluorescence microscopic appearance of Hoechst 33342 staining nuclei of 4T1 cells with various concentration niclosamide for 24 h (40—). Data are the representative from three parallel experiments. To further determine whether niclosamide could inhibit the proliferation of 4T1 we conducted colony formation assay after niclosamide treatment. As shown in C clonogenic assay clearly showed that clone formation of 4T1 cells was reduced in a concentration-dependent manner after exposure to niclosamide. Furthermore the size of the colonies treated with niclosamide was significantly smaller than the control. Induction of Apoptosis by Niclosamide As D indicates the 4T1 cells exhibited features of apoptosis as showed by Hoechst 33342 staining such as bright-blue fluorescent condensed nuclei nuclear fragmentation and reduction of cell volume. To further confirm the induction of apoptosis in 4T1 cells with niclosamide treatment we also investigated the levels of apoptosis using the AnnexinV-FITC/PI dual-labeling technique by FCM. As shown in A and B after niclosamide treatment for 24 h the apoptosis induction effect was apparently observed. When the 4T1 cells were treated with 1.25 µM niclosamide the apoptosis rate was 13.7% whereas the apoptosis cells increased to 19.0% 25.5% and 31.3% when cells were treated with 2.5 µM 5 µM and 10 µM niclosamide respectively. Moreover we examined Bcl-2 Mcl-1 Survivin and cleaved caspase-3 expression levels in 4T1 cells after niclosamide-treated for 24 h by western blotting analysis. The expression of Bcl-2 Mcl-1 and Survivin significantly decreased while that of cleaved caspase-3 increased in a concentration-dependent manner (C) which was coincident with the results of Hoechst 33342 staining and FCM assays. .0085887.g002 Niclosamid induces 4T1 breast cancer cells apoptosis. (A) 4T1 cells were treated with niclosamide at indicated doses for 24 hours and the level of apoptosis was evaluated using the Annexin V/PI dual-labeling technique as determined by FCM. Data shown are representative of three independent experiments. (B) Statistic results of apoptosis assays 4T1 cells positive for both Annexin V and PI were considered apoptotic. Data are expressed as means ± SD from three independent experiments (*p<0.05; **p<0.01). (C) Western blot analyses of 4T1 cells treated (24 h) with different concentrations of niclosamide to evaluate protein expression of Bcl-2 Mcl-1 Cleaved caspase-3 Survivin and ?-actin was employed as a standard. Niclosamide Suppresses Breast Cancer Cell Migration and Invasion Breast cancer metastasis poses a predominant threat to cancer related mortality. Moreover one of the key steps in successful cancer metastasis is tumor cell migration and invasion [34] [35]. Therefore in order to examine whether niclosamide could inhibit breast cancer cell migration and invasion we performed transwell migration and invasion assays on 4T1 and MDA-MB-231 cell lines. As shown in Figure 3A niclosamide-treated groups showed reduced migrated cell numbers on 4T1 cells similar results was obtained in invasion assay (Figure 3B). Meanwhile niclosamide obviously inhibited MDA-MB-231 migration and invasion were also observed (Figure 3C). Moreover we also investigated whether Stat3 Focal Adhesion Kinase (FAK) and Src which are considered to be related with cell migration and invasion are involved in niclosamide-mediated migration and invasion [34]. As Figure 3D indicates niclosamide treatment decreased the expression of phosphorylated-STAT3 (Tyr705) phosphorylated-FAK (Tyr925) and phosphorylated-Src (Tyr416) without affecting their total expression level. Taken together these results suggested that niclosamide could suppress breast cancer cell migration and invasion in a concentration-dependent manner. .0085887.g003 Figure 3 Niclosamide inhibits breast cancer cell 4T1 and MDA-MB-231 migration and invasion and inhibits FAK-involved pathway. (A) A total of 5—104 4T1 cells were seeded in the top chamber of transwell with serum-free medium and treated with different concentration of niclosamide. After 20 hours migrated cells were stained photographed (10—) and quantified. (B) A total of 5—104 4T1 cells were treated with various concentration of niclosamide and allowed to invade through Matrigel and Transwell membrance Invaded cell number was stained photographed (20—) and counted. (C) Niclosamide inhibited MDA-MB-231 migation and invasion. The number of migrated cells and invaded cells was counted respectively. Data represent means ±SD. (n?=?3 in triplicate; *p<0.05; **p<0.01; ***p<0.001). (D) 4T1 cells were treated with different concentration of niclosamide (0“5 µM). After 24 hours cell lysates were blotted with spectfic antibodies (anti-phospho-STAT3 anti-phospho-FAK anti-phospho-Src STAT3 FAK and Src) ?-actin was the loading control. Anti-tumor Efficacy of Niclosamide in 4T1 Mouse Mammary Tumor Model To study the antitumor activity of niclosamide in vivo 4T1 tumor-bearing mice were treated with niclosamide at the dose of 10 mg/kg and 20 mg/kg. From the results (Figure 4A) it was found that the tumor growth of the niclosamide groups become slowed 7 days after treatment. After 21 days treatment niclosamide substantially suppressed tumor growth in a dose-dependent manner compared with the control. Moreover after treatment with niclosamide for 21 days body weight of the mice were statisticed and no significant differences in body weight were found among the three groups (Figure 4B). Furthermore previous studies have showed that 4T1 mouse breast cancer have a high metastatic potential and spontaneously metastasize to secondary foci from the primary sites and one of the fatal metastatic organs is lung as early as 2 weeks after inoculation [36] [37]. In the present study we seek to evaluate whether treatment of niclosamide could reduce the occurrence of lung metastasis. The data in Figure 4C and D showed that niclosamide-treated at 20 mg/kg resulted in significant reduction in the number of lung metastases compared with other groups. In addition histological analyses proved that the number of micrometastatic nodules per field in the niclosamide-treated at 20 mg/kg group was also significant fewer than other groups (Figure 4C). These results further indicated that high dose of niclosamide could inhibit tumor metastasis in breast cancer. .0085887.g004 Figure 4 Effect of niclosamide treatment on primary tumor growth and pulmonary metastasis. (A) 4T1 tumor-bearing female BALB/c mice were treated as described with vehicle niclosamide at 10 and 20 mg/kg the mean tumor volumes ± SD of six mice per every group. (B) After 28 days of tumor cell inoculation the body weight of the niclosamide treatment and vehicle groups were statisticed and there were no significant difference among the groups. (C) Lung metastatic nodules were visualized to show the inhibitory effect of niclosamide on 4T1 tumor 21 days after treatment. Arrow indicated metastatic nodules (up) The H&E staining of lungs from each group (10—). (D) The mean lung metastasis nodules of each group the treatment with niclosamide at 20 mg/kg resulted in significant inhibition of lung metastasis versus vehicle control. "

Lung_Cancer

"The Center for Functional Cancer Epigenetics Dana-Farber Cancer Institute Boston MA 02215 14USC Epigenome Center and USC/Norris Comprehensive Cancer Center Los Angeles CA 90089 USA Correspondence: landimmail.nih.gov 4 4 2014 27 2 2014 27 8 2014 5 3365 3365 The genetic regulation of the human epigenome is not fully appreciated. Here we describe the effects of genetic variants on the DNA methylome in human lung based on methylation-quantitative trait loci (meQTL) analyses. We report 34304 cis- and 585 trans-meQTLs a genetic-epigenetic interaction of surprising magnitude including a regulatory hotspot. These findings are replicated in both breast and kidney tissues and show distinct patterns: cis-meQTLs mostly localize to CpG sites outside of genes promoters and CpG islands (CGIs) while trans-meQTLs are over-represented in promoter CGIs. meQTL SNPs are enriched in CTCF binding sites DNaseI hypersensitivity regions and histone marks. Importantly 4 of the 5 established lung cancer risk loci in European ancestry are cis-meQTLs and in aggregate cis-meQTLs are enriched for lung cancer risk in a genome-wide analysis of 11587 subjects. Thus inherited genetic variation may affect lung carcinogenesis by regulating the human methylome. Introduction DNA methylation plays a central role in epigenetic regulation. Twin studies have suggested that DNA methylation at specific CpG sites can be heritable12; however the genetic effects on DNA methylation have been investigated only in brain tissues34 adipose tissues56 and lymphoblastoid cell lines (LCL)7. Most studies were based on the Illumina HumanMethylation27 array which has a low density and mainly focuses on CpG-sites mapping to gene promoter regions. While the functional role of DNA methylation in non-promoter or non-CpG Island (CGI) regions remains largely unknown evidence shows roles in regulating gene splicing8 and alternative promoters9 silencing of intragenic repetitive DNA sequences10 and predisposing to germline and somatic mutations that could contribute to cancer development1112. Notably a recent study13 suggests that most DNA methylation alterations in colon cancer occur outside of promoters or CGIs in so called CpG island shores and shelves and the Cancer Genome Project has reported high mutation rates in CpG regions outside CGI in multiple cancers14. Although expression QTLs (eQTLs) have been extensively studied in different cell lines and tissues15 the minimal overlap observed between cis-acting meQTLs and eQTLs (?5“10%)347 emphasizes the necessity of mapping meQTLs that may function independently of nearby gene expression. This might reveal novel mechanisms for genetic effects on cancer risk particularly since many of the established cancer susceptibility SNPs map to non-genic regions. Lung diseases constitute a significant public health burden. About 10 million Americans had chronic obstructive pulmonary disease in 201216 and lung cancer continues to be the leading cancer-related cause of mortality worldwide17. To provide functional annotation of SNPs particularly those relevant to lung diseases and traits we systematically mapped meQTLs in 210 histologically normal human lung tissues using Illumina Infinium HumanMethylation450 BeadChip arrays which provide a comprehensive platform to interrogate the DNA methylation status of 485512 cytosine targets with excellent coverage in both promoter and non-promoter regions (Fig. 1a) CGI and non-CGI regions (Fig. 1b) and gene and non-gene regions. Thus our study enables the characterization of genetic effects across the methylome in unprecedented detail. Moreover since DNA methylation exhibits tissue specific features18 we investigated whether similar meQTLs could be identified in other tissues. Results Identification of cis-acting meQTLs We profiled DNA methylation for 244 fresh-frozen histologically normal lung samples from non-small cell lung cancer (NSCLC) patients from the Environment and Genetics in Lung cancer Etiology (EAGLE) study19. A subset of 210 tissue samples that passed quality control and had germline genotype data from blood samples20 was used for meQTL analysis. The analysis was restricted to 338456 autosomal CpG probes after excluding those annotated in repetitive genomic regions or that harbored genetic variants. The distribution of methylation levels differed strongly across distinct types of genomic regions (Supplementary Fig. 1ab). Consistent with previous studies21 CpG sites in promoter or CGI regions were largely unmethylated while those in other regions were largely methylated (Supplementary Fig. 1ab). We performed cis-meQTL analysis for each methylation trait by searching for SNPs within 500kb of the target CpG-site in each direction (1Mb overall). The genetic association was tested under an additive model between each SNP and each normalized methylation probe adjusting for sex age plate population stratification and methylation-based principal component analysis (PCA) scores. Controlling FDR at 5% (P=4.0—10?5) we detected cis-meQTLs for 34304 (10.1% of 338456) CpG probes (Supplementary ) mapping to 9330 genes. A more stringent threshold (P=6.0—10?6) at FDR=1% detected cis-meQTLs for 27043 CpG probes mapping to 8479 genes. Moreover with a 200kb window (100kb from both sides) instead than 1Mb we detected 40650 cis-meQTLs (P=2.0—10?4) controlling for FDR=5%. The methylation distribution in CpG sites detected with meQTLs differed substantially from those without meQTLs (Supplementary Fig. 1ab). The peak SNPs were equally distributed on either side of the target CpG-sites with a median distance (?) of 11.8 kb. The proportion of explained phenotypic variance (h2) ranged from 7.7% to 79.8% (Supplementary Fig. 1c) and inversely depended on ? (Supplementary Fig. 1d). We detected strong cis-meQTLs for DNMT1 a gene known for establishment and regulation of tissue-specific patterns of methylated cytosine residues and for DNMT3A/B two genes involved in de novo methylation in mammals but not for MTHFR which affects global methylation (Supplementary Fig. 1e). The likelihood of detecting cis-meQTLs varied across CpG regions and strongly depended on the variability of the methylation levels (Fig. 1d e). CpG probes in non-CGI regions were twice as likely to harbor cis-meQTLs than CpG probes in CGI regions (11.5% v.s. 4.8% t-test P<10?100); similarly CpG probes located in CGI of non-gene regions were twice as likely to harbor cis meQTL than those in gene regions (14.6% v.s. 6.6% t-test P<10?100). To verify the cis-meQTLs we analyzed data from The Cancer Genome Atlas (TCGA)22 NSCLC patients (n=65) for whom both DNA methylation data from llumina HumanMethylation450 BeadChip of histologically normal lung tissue and germline genotypes from Affymetrix Genome-Wide Human SNP Array 6.0 were available. Genetic associations were tested using the imputed genotypic dosages. EAGLE findings were strongly replicated in TCGA lung data: for the 34304 associations detected in EAGLE32128 (93.8%) had the same direction and 22441 (65.4%) had FDR<0.05 based on single-sided P-values (). For 34304 CpG probes detected with cis-meQTLs we searched for secondary independently associated SNPs in cis regions by conditioning on the primary cis-meQTL SNPs. We detected secondary cis-meQTL SNPs for 3546 CpG probes (FDR=5% P=4—10?5) 61.5% of which were replicated in TCGA lung data. Identification of trans-acting meQTLs Identification of trans-meQTLs was performed by searching for SNPs that were on different chromosomes from the target CpG-sites or on the same chromosome but more than 500kb away. We detected 615 CpG-probes with trans-meQTLs (FDR=5% P=2.5—10?10) including 438 interchromosomal and 177 intrachromosomal trans-meQTLs. Among 177 intrachromosomal trans-associations 30 lost significance after conditioning on the corresponding cis-regulating SNPs suggesting that these trans-associations were caused by cis-acting regulations through long range linkage disequilibrium (LD). Thus we detected 585 traits with œtrue trans-meQTLs (Fig. 2a) mapping to 373 genes. The number of trans-meQTLs was reduced to 500 if controlling for FDR=1% (P=4.0—10?11). We replicated 79.8% of the 585 trans-associations in TCGA lung data. Interestingly trans-meQTLs were strongly enriched in CGI sites in contrast to the observation that cis-meQTLs were strongly enriched in non-CGI sites (Fig. 2b). CpG dinucleotides in 3™UTR regions where microRNA target sites are typically located showed an opposite trend in both cis- and trans-meQTLs (Fig. 2b). In 62.8% of the trans-associations the SNPs involved were also detected to have cis-acting effects. We investigated whether trans-associations were mediated by these cis-regulated proximal CpG sites (Fig. 2cd). We found that 30 and 166 trans-associations had full and partial mediation respectively while 389 had no significant mediation. The trans-associations involving SNPs in gene desert regions are less likely to be mediated by proximal CpG probes (15.7% v.s. 34.3%; P=0.0067 Fisher™s exact test). To obtain mechanistic insight into the trans-associations showing mediation effects (n=196) we used the DAVID tool23 to characterize the function of genes harboring the mediating cis-CpG probes. The analysis was performed for 115 genes after excluding the major histocompatibility complex (MHC) region because of long range complex LD patterns. The GO analysis revealed three top gene categories with nominal significance involved in DNA methylation regulation including GTPase-activity related genes (P=0.004 Fisher™s exact test) genes regulating transcription (P=0.02) and genetic imprinting (P=0.04 Fisher™s exact test Supplementary Table 2). Notably 106 trans SNPs with P<2.5—10?10 were associated with multiple distal CpG probes suggesting that they are multi-CpG regulators. In particular we detected one master regulatory SNP rs12933229 located at 16p11.2 in a very large intron of the NPIPL1 gene which was associated with the methylation of CpG sites annotated to five genes on different chromosomes (Fig. 2a Supplementary Fig. 2 and Supplementary Table 3). These associations were partially mediated by a proximal CpG probe cg06871736. All five trans-associations were replicated in TCGA. The trans-associations show a consistent direction with the ˜C™ allele associated with higher methylation levels. All five regulated target sites are in CGIs and three are in gene promoter regions. We evaluated the association with gene expression for these three CpG probes using 28 TCGA histologically normal lung tissue samples with RNA sequencing data. Based on this limited sample size two of the target genes PABPC4 and STARD3 showed decreased expression with increased methylation (FDR=10%). Enrichment of meQTLs in DNA regulatory regions SNPs associated with complex diseases in GWAS or with eQTLs have been reported to be enriched in ENCODE-annotated regulatory regions2425. These include DNaseI hypersensitivity sites CCTC-binding factor (CTCF) binding sites and regions enriched in- active and repressive histone modification marks. The large number of meQTLs detected in our study both cis and trans enabled us to systematically investigate their enrichment in regulatory regions. We performed enrichment analysis using Chip-Seq data in small airway epithelial cells (SAEC) from the ENCODE project for histone marks26 CTCF occupancy27 and DNaseI hypersensitivity sites28; and histone marks in primary human alveolar epithelial cells (hAEC) from our own laboratory29. Compared to the œcontrol SNP set not associated with the methylation of CpG sites (with minor allele frequency and CpG probe density matched with meQTL SNPs) the meQTL SNPs were strongly enriched for sites of CTCF DNaseI hypersensitivity and histone marks (H3K4me3 H3K9-14Ac and H3K36me3) associated with active promoters enhancers and active transcription and to a lesser extent for the repressive mark H3K27me3 (Table 2). Enrichment of all regulatory regions became stronger with increasing significance of association with the exception of the H3K27me3 repressive mark (Fig. 3). Using SAEC CTCF ChIP data we found that meQTL SNPs or associated SNPs in high LD located within CTCF consensus sequences can affect allele-specific binding of CTCF (see two examples in Supplementary Fig. 3 and 4). Lung cancer risk SNPs affect methylation in human lung tissue To determine whether the identified meQTLs might provide functional annotation to the established genetic associations with lung cancer risks we examined SNPs in five genomic regions reported to be associated with lung cancer risk in genome-wide association studies (GWAS) of populations of European ancestry: 15q25.130“32 (CHRNA5-CHRNA3-CHRNB4) 5p15.33203334 6p21.3333 (BAT3 most strongly associated with squamous cell carcinoma or SQ) 12p13.335 (RAD52 for SQ) and 9p21.336 (CDKN2A/CDKN2B particularly for SQ). The GWAS SNPs at 15q25.1 were reported to be associated with total expression levels and multiple isoforms of CHRNA5 in normal lung tissue samples3738. The GWAS SNPs at the other four loci have not been reported to be associated with the total expression of nearby genes. Consistently we did not observe an association in RNA-seq data from TCGA lung normal tissue samples (n=59) although a detailed investigation of alternative promoters splice sites and allele-specific gene expression in larger studies is warranted. Here we investigated whether these SNPs contributed to lung cancer risk with epigenetic regulation by examining their associations with DNA methylation levels. The top GWAS SNPs located at 15q25.1 5p15.33 6p21.33 and 12p13.3 were all strongly associated with the methylation of the nearby CpG probes and the associations were replicated in TCGA lung data (Fig. 4). Importantly five of the six GWAS SNPs at these loci excluding the RAD52 locus were also the SNPs with the strongest association with the corresponding CpG probes. For the cg22937753 probe located in the RAD52 locus another SNP rs724709 with weak correlation with the GWAS SNP (r2=0.1) had the strongest association with meQTL. All involved CpG sites are located within gene bodies (which may affect gene splicing39) or the 3™UTR regions. No meQTL was detected for 9p21.3 (Supplementary Fig. 5) possibly because of fewer CpG dinucleotide probes available in this gene region on the Illumina platform. The location of these lung cancer GWAS-associated CpG sites might identify which genes within the relevant regions are more likely associated with the risk SNPs something that is particularly important for regions with complex LD structure as the MHC region on 6p21. In MHC two GWAS SNPs in complete LD (r2=1) rs3117582 (BAT3) and rs3131379 (MSH5) were most strongly associated with the methylation of CpG sites located nearby of MSH5 (involved in DNA mismatch repair and meiotic recombination process) suggesting that MSH5 (P=5.4—10?13 t-test) is more likely to be involved in lung carcinogenesis than BAT3 (P=8.8—10?5 t-test) or that the SNP closer to MSH5 (rs3131379) is more likely to be the SNP most responsible of the GWAS association with lung cancer risk (Fig. 4b). Our meQTL data also show that rs3131379 trans-regulated the methylation level of CpG probe cg12093005 located in the body of FBRSL1 at 12q24 (PEAGLE=4.0—10?9 PTCGA=7.2—10?4 and Pcombined=5. 4—10?11 t-test). Thus this known GWAS locus might affect lung cancer risk through a gene located on a different chromosome. Of note on the 15q25.1 locus two independent lung cancer risk SNPs rs2036534 and rs1051730 were associated with CpG probes not linked with CHRNA5 expression. In Supplementary Fig. 6 we show that the two SNPs jointly regulated another methylation probe cg22563815 within the CHRNA5 promoter which is associated with CHRNA5 expression. This extends and further confirms the complex regulatory pattern with multiple SNPs previously observed for this locus35. Most subjects in the analyses were smokers (n=206). Adjustment for smoking status (former and current) or intensity (pack/years) did not change the results. cis-meQTLs are enriched in lung squamous cell carcinoma risk We investigated whether the identified cis-meQTL SNPs were enriched in the National Cancer Institute (NCI) lung cancer GWAS including 5739 cases and 5848 controls of European ancestry19. To focus on potentially new genetic risk associations we excluded the top lung cancer GWAS SNPs mentioned above and their surrounding regions. We tested the enrichment by examining whether the GWAS P-values for the LD-pruned cis-meQTL SNPs deviated from the uniform distribution i.e. no enrichment. When all cis-meQTL SNPs were analyzed together we detected a strong enrichment for overall lung cancer risk (P<10?4 based on 10000 permutations) which was primarily driven by the enrichment in SQ (P<10?4 based on 10000 permutations) (Fig. 5a). The genomic control ?-values based on genome-wide SNPs showed that the type-I error rates of our enrichment test were not inflated (?=1.01 and 1.00 for overall lung cancer and SQ respectively). Stratified analyses further refined the enrichment to the cis-meQTL SNPs regulating CpG-sites mapping to north shore (Fig. 5b) and gene body (Fig. 5c) regions (see Supplementary Fig. 7 for the quantile-quantile plot). These gene bodies and north shores were enriched for genes involved in cancer pathways (P=2.5—10?4 Fisher™s exact test) and particularly those in NSCLC pathway (e.g. AKT1 MAPK1 RASSF5 etc. Supplementary Table 4). In contrast cis-meQTLs related with CGI regions or promoters were not enriched with the risk of overall lung cancer or any lung cancer subtype further emphasizing the need to comprehensively study the methylome to identify functional mechanisms for GWAS findings and identify new genetic loci. "

Lung_Cancer

" Bryant et al. Overall survivalAverage Za0.370.00011Beer (N = 442) Overall survivalAverage Zb0.620.00003Fisher0.500.00068GSEA0.650.00001Euclidean0.650.00001Mahalanobis0.670.00001GSE8894 (N = 61) Recurrent free survivalAverage Zb0.900.01163Fisher0.910.01076GSEA0.780.02899Euclidean0.870.01544Mahalanobis0.680.05485aDerived from mean and SD of all cancer samples in the dataset bDerived by mean and SD of the nRef.Prognostic gene expression signatures for Stages II and III colon cancers have been reported in seven papers yielding 207 genes in total (Bandres et al. 2007; Barrier et al.2006 2007; Eschrich et al. 2005; Kopetz and Abbruzzese 2009; Lin et al. 2007; Wang et al. 2004). The genes are enriched in 32 REACTOME pathways (False Discovery Rate (FDR) < 0.05 pathway size < 96). We assumed the 32 pathways were valid as ground truth to be identified and analyzed in the colon cancer dataset GSE39585 (Stages II and III were only considered). Average Z provided best performer (sensitivity = 0.88) with 28 pathways deemed as significant. GSEA Fisher Euclidean and Mahalanobis gave the following values0.780.66 0.06 and 0.03 respectively.These results satisfied us that our approach captures the fundamental knowledge of cancer thus it is reasonably considered as iPAS.To investigate which of the candidates for iPAS most robustly reflect phenotype association we evaluated the proposed methods by determining whether survival-associated pathways are validated in datasets never used for discovery using LUAD and colon cancer [LUAD: Beer™s set n = 442 for discovery GSE8894 (n = 61) GSE3141 (n = 58) for validation; colon cancer: GSE39582d (n = 443) for discovery GSE39582v (n = 123) and GSE17536 (n = 109) for validation logrank P < 0.05 comparing tumors in the top 50th percentile of aberrance scores to those in the bottom 50th percentile]. Validation rates varied depending on the dataset and these were possibly affected by the small sample size compared with that of the discovery set. In these cases we were not able to determine a superior method that outperformed the others. Average Z gave the highest validation rate in three of four dataset with validation rates of GSE8894 (43.6% 92/211) GSE3141 (13.3% 28/211) and GSE17536 (10.7% 24/224). When validation rates from four datasets are averaged Average Z gave the highest validation rate (21.9% Fig. 2 blue bars). Pathways validated as significantly associated with patient survival for each cancer are listed in the Supplementary Materials (Supplementary Tables S1 and S2). Fig. 2.Averaged validation rate of discovered survival-related pathway at four datasets. Proposed approach using nRef (blue) versus conventional approach that standardizes individual sample by mean and SD of entire cohort dataset (red)We also investigated the validation rate of iPAS candidates under the conditions where the same data are not standardized by the nRef but instead standardized by the mean and SD of the cohort dataset which consists of only cancers (Fig. 2 red bars). It is noteworthy that use of the nRef increased the validation rate for every iPAS candidate investigated. This implies that the strategy of using accumulated normal samples as a reference is beneficial in terms of pathway-based survival analysis.3.2 Identification of clinical importanceCluster analysis of using Average Z as the iPAS method on Beer™s data identified 12 pathway clusters (denoted by 1?12 in Fig. 3) and 3 sample clusters (S2?S4; S1 is from the nRef; Fig. 3). Sample clusters S2 and S4 represent well the differentiation status of LUAD (Fisher exact test P < 4.65 — 10?15). Well-differentiated adenocarcinoma resembles the normal glandular structure; therefore it is a reasonable result that cluster S2 is close to the nRef. The survival outcome of S2 and S4 are significantly different (P < 0.0028) and this assures us that unbiased clustering-based iPAS has enough sensitivity to capture clinically important associations. This finding is concordant with prior knowledge that well-differentiated LUAD patients are likely to have better prognosis (Barletta et al. 2010). Pathway cluster P9 is distinguished as commonly upregulated in tumor samples. The pathways are transfer RNA aminoacylation amino acid or purine synthesis DNA elongation and the extension of telomeres. Fig. 3.Clustered iPAS of LUAD dataset. Pathways (n = 583) and samples (n = 442) are clustered according to iPAS. Normal samples are clustered at left (S1). Tumors (S2?S4) deviate from normal in both up- and downregulated directions (darker red and blue respectively). Sample clusters are well-representing histopathological differentiation status (S2: for well-differentiated LUAD P < 4.65 — 10?15) and overall survivalUnbiased pathway-based clustering of colon cancer data also captures clinically important associations by revealing sample clusters that are survival related (S2 and S3 P = 0.0037 Supplementary Fig. S1). It is important to note that iPAS is not only sensitive enough to identify clinically meaningful substructure of patients but also reveals common characteristics of a cancer at the same time. For example pathways commonly up- or downregulated in all cancer samples for example P9 or P2 would have not been discovered if the analysis had been performed by a conventional approach that does not make use of ˜nRef™ (Supplementary Fig. S2).3.3 Pathway-based identification of cancerCancer develops unique mechanisms for malignancy. Therefore it is reasonable to believe that identifying the unique molecular aberrances of cancer will aid in cancer diagnosis. Our empirical study of iPAS-based clustering of LUAD revealed several pathways commonly up- or downregulated in all of the cancer samples. Further analysis was performed to determine whether iPAS could be successfully used in the accurate identification of cancer. We tested this in a simple unsupervised way by judging whether an unknown sample is significantly different against the nRef as a tumor if not as normal. We performed a 5-fold cross-validation one hundred times with the LUAD dataset which consisted of 120 cancers and 120 normal samples. Microarray data from the normal samples was randomly divided into five groups and four of the five served as the reference group. The remaining group was used as the true normal set for the test of pathway-based identification of cancer. To build true cancer set for the test the same number of cancer sample was randomly picked. We considered 583 pathways in REACTOME giving 293 500 (583 pathways — 5-fold — 100 repeats) AUCs and accuracy values. We averaged AUCs and accuracies from the five candidate methods for iPAS and used this as a representative AUC and accuracy of a given pathway.By ranking the pathways by AUC top pathways that marked averagely high performance by all iPAS candidates are listed (Supplementary Table S3). The ˜amino acid synthesis and interconversion and transamination™ pathway showed the highest classification performance. Unsurprisingly this pathway was one of the commonly upregulated pathways in the analysis of the Beer™s data (Fig. 3 pathway cluster P9). Among the tested iPAS candidates for this pathway Mahalanobis yielded the highest AUC (0.980) while Average Z gave 0.936 and Fisher™s exact test gave the lowest value (0.914). The standardized gene expression pattern for this pathway differed between tumor and normal. Many of the genes deviated from mean of the nRef by more than two orders of sigma contributing to its best performance out of all iPAS candidate methods including ORA method like Fisher™s exact test (Fig. 4a). Fig. 4.(a) Expression pattern of genes in the pathway. Each line represents sample. (gray: normal red: tumor). Dashed line represents expression value deviated 1.96? from the mean expression value of normal tissues. (b). Performance of classification of cancer by ˜amino acid synthesis and interconversion and transamination™. AUC of 0.980 has marked in discovery set (95% confidence interval provided as error bar) independent validation set results AUC of 0.982 (Validation 1: normal samples in validation set served as reference) and 0.982 (Validation 2: normal samples in discovery set served as reference)We also analyzed the influence of using the subset of normal samples as nRef. We compared the pathway-based cancer identification results using the full set of normal samples (n = 120) against 100 different runs using 75% (n = 90) 50% (n = 60) of randomly chosen normal samples. Among the pathways that marked averagely high performance in the identification of cancer the best and the second best pathways are considered ˜amino acid synthesis and interconversion and transamination™ and ˜unwind of DNA™ respectively. The result shows little loss of performance even though only a half of normal samples were used for the test (Fig. 5a and b). Fig. 5.Performance of pathway-based identification of cancer (AUC)"

Lung_Cancer

"The staining extent of MLM was significantly smaller than methylene blue (0.6 vs 1.0 cm P<0.001). MLM showed superior staining ability over methylene blue (2.8 vs 2.2 P=0.010). Excellent staining was achieved in 17 subjects (81%) with MLM and 8 (38%) with methylene blue (P=0.011). An acceptable or excellent radio-opacity of MLM was found in 13 subjects (62%). An appropriate localization rate of MLM was 100% with the use of the directly visible ability and radio-opacity of MLM. MLM provides a superior pulmonary localization ability over methylene blue. Lung Ethiodized Oil Methylene Blue Tomography X-Ray Computed Radiology Interventional Seoul National University College of Medicine 800-20120036 INTRODUCTION Preoperative localization is necessary for video-assisted thoracoscopic surgery (VATS) when pulmonary nodules are too small or distant from the visceral pleura to be detected (1-3). A failure to localize nodules disturbs the success of the thoracoscopic resection and leads to conversion to thoracotomy (4 5). There are two kinds of localizing procedures: marking with thoracoscopically directly visible materials and marking with radio-opaque materials. Examples of directly visible materials are hook wire methylene blue and indocyanine green. Ethiodized oil (lipiodol) barium and iodine contrast agents are used for radio-opaque markers. Each marking method has strong and weak points. Localization with a hook wire is easy to perform but carries a high risk of pneumothorax and a propensity to dislodge during transport and surgical preparation (6 7). Methylene blue and indigo carmine have a tendency to diffuse over a large area by the time the operation is done and render localization features inadequate (8 9). The use of a radio-opaque marker (such as barium or lipiodol) requires an intraoperative fluoroscopy to confirm an adequate excision as well as lead to increased radiation exposure (10-13). The use of mixture has been reported to make up for the weakness of marking materials. For example the problem of dye diffusion has led to attempts to use a mixture of dye with various materials such as cyanoacrylate adhesive or collagen or autologous blood (14-16). However they have not been widely used for localization due to difficulties in making and manipulation. Lipiodol and methylene blue are commonly used materials for localization (17-20). We hypothesized that lipiodol reduces the spread of methylene blue and provides additional localization opportunities by its radio-opacity. The use of a mixture of lipidol and methylene blue (MLM) for a percutaneous injection material requires a high success rate for appropriate localization and a low complication rate. To our knowledge there have been no reports that evaluate the availability of MLM as a percutaneous injection material in human lungs. This study compared MLM with methylene blue as a percutaneous injection material for pulmonary localization in rabbit lungs. MATERIALS AND METHODS Animal preparation This study was performed after approval by the Institutional Animal Care and Use Committee (IACUC) in Seoul National University Hospital biomedical research institute (IACUC approval No. 11-0356). Twenty-four adult New Zealand White rabbits were used. We recorded their weight before the procedures. The animals were randomly divided into two groups: Group A (n=12) and Group B (n=12) each sacrificed at about 6 hr and 24 hr after percutaneous injections respectively (Fig. 1). Six hours after percutaneous injections were same day operations of the preoperative localization; and 24 hr after percutaneous injections were next day operations of the preoperative localization. The injection of each material was done in all 24 subjects because we injected methylene blue and MLM at two different lung sites for each subject. Percutaneous injection materials: mixture of lipiodol and methylene blue versus methylene blue A pilot study was performed to decide the optimal amount of materials for percutaneous injections. Methylene blue (1% 100 mg/mL TERA Pharmaceuticals Buena Park CA USA) of 0.3 to 0.9 mL was used for human lung localization in previous studies by Wicky et al. (18) and Vandoni et al. (19). In the pilot study with rabbit lungs we injected 0.1 mL and 0.05 mL of methylene blue and MLM in four subjects. We found that staining was extensive (more than half height of one lobe) with 0.1 mL and localized (about 1 cm of staining diameter) with 0.05 mL for both methylene blue and MLM. Extensive dispersion made it difficult to find exact injecting sites; subsequently 0.05 mL of methylene blue was administered. We made variable mix ratios of lipiodol and methylene blue in vitro; 1:1 1:2 1:3 1:4 and 1:5 in order to find an appropriate mixing ratio of lipiodol (480 mg Iodine/mL Andre Guerbet Aulnay-sous-Bois France) and methylene blue. The separation of two materials occurred instantly after mechanical blending to the fat-soluble character of lipiodol and the water-soluble character of methylene blue. A higher concentration of lipiodol in MLM resulted in increased uneven blending and rapid separation. A mixture with a 1:6 (or lower) mixing ratio contained a minimal amount of lipiodol and it might make it difficult to be detected on the fluoroscopy; subsequently we decided that 1:5 was an appropriate mixing ratio for injection. A total of 0.06 mL of MLM (0.01 mL of lipiodol plus 0.05 mL of methylene blue) was administrated in each subject to avoid the effect of different volumes of methylene blue to the diffusion extent of the materials. CT guided percutaneous injections Percutaneous injection was performed with computed tomography (CT) guidance (Discovery CT750 HD; GE Healthcare Waukesha WI USA). We performed pre-procedural CT scans in order to determine an appropriate skin entry site for the successful placement of a needle in the desired location. The desired location was the basal portion of both caudal lobes around the mid-scapula line. We tried to situate the needle tip at 5 mm depth from the visceral pleura and avoid passing through the pulmonary vessels. We placed the needle of 20 gauze and 3.5 cm length in the lung parenchyma after marking the appropriate skin entry site. The parameters of CT used in our study were: tube voltage of 120 kV tube current of 25 mA slice thickness of 2 mm thickness and gantry rotation speed of 350 milliseconds. We connected 1 mL syringe to the needle hub and retracted the syringe piston to confirm that no blood was aspirated after the needle tip was accurately located within the desired location. We then injected the materials and immediately removed the needle. On the procedural CT scan we measured the distance from the skin-entry to the needle tip and the depth from visceral pleura to the needle tip. A post-procedural CT scan identified procedure-related complications that included the leakage of injecting materials and pneumothorax; in addition we recorded the extent shape and density of radio-opacity of MLM after injection. The extent of MLM was defined as a maximum diameter of the radio-opacities. The shape of radio-opacity was categorized into 3 groups (small faint nodular scattered nodular and discrete compact nodular). We recorded the injection time to measure the time interval between injection and sacrifice. Fluoroscopic examinations A successful localization of lipiodol was determined by fluoroscopic examination; subsequently we evaluated the radio-opacity of MLM using the fluoroscopy X-ray unit (BV Pulsera; Philips Medical Systems Best The Netherlands) at the immediate post-procedure session and the follow up session at 6 hr in Group A and 24 hr in Group B. The parameters of fluoroscopy were: tube voltage of 59 kV and tube current of 946 mA. We obtained anteroposterior fluoroscopic images of the thorax of the rabbit with a 17 cm of field of view. A radio-opaque ruler of 5 cm was located near the rabbit in order to estimate the exact size of lipiodol opacity. We recorded the time of the fluoroscopic examinations and the radiographic findings of MLM (size and shape of the radio-opacity). Evaluation of the staining and radio-opacity We assessed the directly visible staining on the freshly excised lung surface and radio-opacity of MLM on the fluoroscopic examinations using 4-point scoring in order to compare the localization ability of MLM and methylene blue as a percutaneous injection material. A blind reviewer who was unaware of the injection materials assessed the staining ability. In order to evaluate the staining ability the blind reader reviewed the photographic images of the freshly excised lung specimens obtained before formalin fixations and rated the staining by 4-point scores: 0=non-visualization of staining 1=inappropriate; extensive dispersion made it difficult to find accurate injecting locations 2=acceptable; available to estimate injecting locations in spite of the dispersion and 3=excellent definitely localized staining (Fig. 2). The maximum diameter of the staining extent on the lung surface was measured. We calculated and compared scores and extent of staining between two materials. For the fluoroscopic findings the radio-opacity of MLM was evaluated using 4-point scoring: 0=no detectable radio-opacity 1=inappropriate minimally increased opacity 2=acceptable low density of increased opacity 3=excellent compact nodular increased opacity (Fig. 3). We compared the average scores of initial and follow up fluoroscopic examinations. We considered a score of 0 or 1 as inappropriate and a score of 2 or 3 as appropriate for localization for both staining and radio-opacity. We compared the number of appropriate or excellent localization between MLM and methylene blue. Sacrifice and histopathologic examinations Both freshly excised entire lungs were used as final specimens. The lung tissues were fixed in 10% neutral formalin embedded in paraffin and cut into 5 µm thick slices after we took photographs to record staining on the lung surface. We made 4 axial slices that covered the center of the staining. The slices were subjected to hematoxylin-eosin (H-E) stain to the evaluate lung parenchymal change. We evaluated the presence or absence of neutrophil infiltration vasculitis necrosis hemorrhage and foam cell in alveolus. The extent of each histopathologic finding was estimated using visual grading scores as 0 (no) 1 (focal) or 2 (diffuse). Localized parenchymal change (<50% of total area) surrounded by normal lung was defined as focal. Extensive lung parenchymal change (?50% of total area) that replaced normal lung was defined as diffuse. An experienced pathologist with eight years of experience reviewed all slices. The overall severity of the lung parenchymal change was defined as a total score by adding visual grading scores for each histopathologic finding. We compared the overall severity score between MLM and methylene blue as well as between Group A and Group B. Statistical analysis All data are expressed as mean±standard deviation (SD) unless otherwise stated. Comparisons of the average scores were performed by two-tailed unpaired Student's t-test or Mann-Whitney test. We used a Fisher's exact test to compare the number of subjects in the subgroups. Linear by linear association evaluated the association of the extent of lung parenchymal change and materials or groups. Null hypotheses of no difference were rejected if the P values were less than 0.05. The statistical analysis was performed with commercially available statistical software IBM SPSS Statistics version 20.0 (IBM Corp. in Armonk NY USA). RESULTS Subject characteristics procedural records time interval of injection and examinations Among the 24 subjects included in our study successful CT-guided percutaneous injections into the desired location of the lung were achieved in 21 subjects (11 in Group A and 10 in Group B). Three subjects died during anesthesia. Mean weight was 3.2±0.2 kg for Group A and 3.3±0.2 kg for Group B. Injection depth from visceral pleura to needle tip was 0.4±0.1 cm (range: 0.3-0.6 cm) for MLM and 0.4±0.1 cm (range: 0.3-0.7 cm) for methylene blue (P=0.43). Distance from skin to needle tip was 2.8±0.6 cm (range: 2.1-5.0 cm) for MLM and 2.8±0.3 cm (range: 2.2-3.5 cm) for methylene blue (P=0.83). Of 42 CT-guided percutaneous injections total number of procedure related complications was 10 (24%) including 7 leakage (all in MLM) and 3 pneumothorax (2 in MLM 1 in methylene blue). The complication rate in MLM was significantly higher than methylene blue (43% vs 5%) (P=0.004). On post-procedural CT images the extent of the radio-opacity of MLM was 1.3±0.4 cm (range: 0.7-2.0 cm) for Group A and 0.6±0.3 cm (range: 0.3-1.1 cm) for Group B. Discrete compact nodular opacity was achieved in 15 subjects (72%) scattered nodular opacities in 3 (14%) and small faint opacity in 3 (14%) (Fig. 4). The average value of radio-opacity of MLM was 1415±856 HU (range: 307-2768 HU). The interval between injection and sacrifice was 7.9±0.1 hr (range: 7.8-8.0 hr) for Group A and 23.5±0.1 hr (range: 23.4-23.7 hr) for Group B. Time from injection to initial and follow up fluoroscopy was 3.4±0.5 hr (range: 2.5-4.2 hr) and 6.8±0.4 hr (range: 6.3-7.7 hr) for Group A and 1.5±0.4 hr (range: 0.9-2.1 hr) and 22.6±0.4 hr (range: 21.9-23.2 hr) for Group B respectively. Scores and extent of staining and radio-opacity Table 1 demonstrates the staining extent and localization ability of MLM and methylene blue. In total groups the staining extent of MLM was significant smaller than methylene blue (0.6 cm vs 1.0 cm P<0.001). MLM showed a significantly higher staining ability score than methylene blue (2.8 vs 2.2 P=0.010). Radio-opacity in the initial fluoroscopy was not significantly different from the follow up (2.0 vs 1.9 P=0.49). Table 2 showed the number of subjects in each score of localization ability of staining or radio-opacity. In Group A appropriate staining was 100% for both MLM and methylene blue. In Group B appropriate staining was 90% for MLM and 70% for methylene blue. Appropriate staining of MLM was not significantly different from that of methylene blue (95% vs 86% P=0.61); however excellent staining in MLM was significantly higher than methylene blue (81% vs 38% P=0.011) (Table 3). Table 4 shows the localization ability of MLM regarding both staining ability and radio-opacity. There was no subject with a score of 0 or 1 in both radio-opacity and staining. MLM achieved appropriate staining or radio-opacity in 21 subjects (100%) with a dual localization feature. Histopathologic findings Table 5 demonstrates the results of the histopathologic findings. In all lung specimens both methylene blue and MLM showed acute lung parenchymal change that included neutrophil infiltration hemorrhage and foam cell in alveolus (Fig. 4). Comparing the two materials the number of specimen having neutrophil infiltration vasculitis necrosis hemorrhage and foam cell in alveolus was similar in each extent. In terms of all features the number of specimen that showed diffuse extent was more in Group B than Group A for both MLM and methylene blue. The extent of the histopathologic findings was not significantly associated with the materials for all histopathologic features (Table 5). Among the histopathologic findings the extent of vasculitis was significantly associated with Group for both MLM and methylene blue (P=0.002 for both MLM and methylene blue). Focal or diffuse extent of vasculitis was more frequently found in Group A than Group B (P=0.001 for both MLM and methylene blue). The overall severity of lung parenchymal change was not different between MLM and methylene blue (5.6±1.6 vs 5.7±1.5 P=0.839); in addition Group B showed a significantly higher overall severity score of lung parenchymal change than Group A (6.6±1.6 vs 4.7±0.9 P=0.005). DISCUSSION The results of this study show that MLM is a useful percutaneous injection material for a successful localization in the lung. The average staining score of MLM was significantly higher than methylene blue (2.8±0.5 vs 2.2±0.7 P=0.010). In terms of staining the appropriate localization rate (acceptable or excellent staining) in our study was 95% using MLM. The result was in close agreement with previous studies that showed a high success performance rate of lipiodol localization (99%-100%) (21-23). An appropriate localization rate (acceptable or excellent staining) of methylene blue injection was 86% in our study. This is lower than the results found in previous studies where the success rate of methylene blue injection was 96%-100% (18 20). We found that an acceptable (or excellent staining rate) of MLM and methylene blue was not significantly different (95% vs 86% P=0.610). However MLM showed excellent staining for localization in 17 (81%) of 21 subjects and was significantly higher than methylene blue (38%) (P=0.011). The results indicate that lipiodol reduced the spread of methylene blue. This is the first study to indicate that MLM is an available percutaneous injection material for localization with superior staining ability compared to methylene blue. The complication rate was 43% in MLM and 5% in the methylene blue (P=0.004). Possible complications after percutaneous injection for pulmonary localization include pneumothorax leakage hemorrhage pain hemoptysis hemothorax and embolism. Previous studies reported that the complication rate was 17-29% for lipiodol and 33% for methylene blue (2023 24). The complication rate of MLM in the current study was higher than the results of previous studies mainly due to the leakage of MLM into the pleural cavity (n=9). This difference was probably because the distance from the pleura to the injecting needle tip (0.4±0.1 cm for MLM) was inadequate to avoid leakage into the pleural cavity. In the previous studies of lipiodol marking for localization the mean distance from the pleura to the target nodule was 1.0-1.9 cm (22-24) more than twice our study. The results indicate that the high complication rate of our study is associated with the inserting procedure of the needle rather than MLM itself. The dispersion of methylene blue throughout the lung parenchyma may lead to unnecessarily large wedge resections; in addition some have reported instances of the dispersion of methylene blue throughout the entire pleural surface or intraoperative identification failure due to severe anthracosis of the visceral pleura. The failure rate was reported to be 0%-13% with the use of methylene blue (1819 25). The results are similar to our study and indicate that inappropriate staining on the lung surface was 14% in methylene blue. In this study we found that the dispersion of methylene blue in MLM through the lung parenchyma was significantly smaller than methylene blue (0.6±0.3 cm vs 1.0±0.4 cm P<0.05). The result implies that lipiodol reduces the spread of methylene blue in lung parenchyma. Regarding the score of radio-opacity 38% of MLM showed non-visualization or minimally increased opacity on the fluoroscopic examinations. It means the proportion of lipiodol in MLM at the time of the percutaneous injection was too small to be detected. Post-procedural CT images also revealed that 3 subjects had small faint radio-opacity after the injection of MLM. It suggests that the uneven blending of lipiodol and methylene blue occurred during the preparation of MLM. Water-insolubility of lipiodol would result in the uneven mixing of water soluble methylene blue after mechanical blending of the two materials. Further research is required to reduce non-homogeneity of MLM at the time of injection. Previous studies reported the availability of a mixture of methylene blue with other materials such as collagen or autologous blood (15 16). They performed VATS resection on the same day as localization. In our study we evaluated the localization ability of MLM on the same day of localization (6 hr) as well as 24 hr after injection. Localization is usually performed on the day of surgery. This requires the simultaneous use of the CT and the operating room which is not always available. Surgeries on the next day of localization were reported in several published articles (26 27). MLM shows a prolonged localization ability of up to 24 hr in terms of staining ability and radio-opacity. Stable localization ability is the advantage of MLM in our study. Due to uneven blending of MLM one subject (10%) showed inappropriate staining and appropriate radio-opacity and required an intraoperative fluoroscopic examination to detect MLM. Possible radiation exposure is a drawback of MLM. We would like to justify the use of intraoperative fluoroscopy because the operator can avoid radiation exposure with a lead apron. In regards to the risk-benefit for patients lowering the risk of detection failure is thought to be more important than radiation exposure. Histopathologic examinations showed lung parenchymal changes in all specimens. Both methylene blue and MLM induced acute lung injury that included neutrophil infiltration vasculitis necrosis hemorrhage and foam cell in alveolus (Table 5). The results of our study are similar to those of a previous study by Kwon et al. (28) that showed that lipiodol led to acute lung injury. They described that lipiodol creates the histopathologic feature of acute lung injury such as peripheral endothelial cell damage neutrophil infiltration necrosis hemorrhage alveolar wall destruction vasculitis emboli (or thrombi in arteriole) and macrophages in the alveolar space (28). In our results the extent of lung parenchymal change was not associated with the materials for all histopathologic features. In addition the overall severity score of lung parenchymal change in MLM was not different from methylene blue (5.6 and 5.7 P=0.839). This suggests that MLM shows similar histopathologic effects in the lung parenchyma to methylene blue. The overall severity score of parenchymal change was higher in Group B (follow up interval of 24 hr) than Group A (follow up interval of 6 hr) (6.6 vs 4.7 P=0.005). The extent of lung parenchymal change depends on the time interval. Acute lung injury after the percutaneous injection of lipiodol or methylene blue was reported in animal studies (28 29); however there are no clinical results that show the adverse effect of acute lung injury in human lungs. Injection material (such as barium) can potentially complicate the pathologic diagnosis of the target lesion due to acute inflammation (29 30). To our knowledge no study has indicated that lipiodol or methylene blue hinders the histopathologic diagnosis of target lesions in human lungs. The small amount of material injection in human lungs might not create a significant parenchymal change or disrupt underlying lung disease. It is necessary to avoid directly injecting materials into the target lesion in human lungs in order to avoid the adverse effect of injection materials on underlying lung disease (especially ground glass opacity nodule or potential benign lesion). There were several limitations in our study. First we included only a small number of subjects. Second the overall localization success rate was low and the complication rate was high (compared to the results of previous studies) due to the difficulty in an accurate percutaneous injection at the desired location and depth in the small sized rabbit lung. Third we used a 1 mL syringe with manual administration to inject materials in the lung parenchyma and there were possible individual difference in the administering volume of materials. Fourth we could not evaluate complications such as intractable pain material related anaphylaxis or embolism. Fifth we could not evaluate if the histopathologic changes had any effect on underlying lung disease because the lung parenchyma of the experimental rabbits were normal. Finally we did not evaluate a successful localization for the true target lesion in lung parenchyma. The criteria for appropriate staining and radio-opacity were subjective. We expect that further clinical studies might provide an answer to if MLM can be a useful percutaneous injection material for localization in the human lung. In conclusion MLM is available for percutaneous injection for the pulmonary localization. The results of this study showed that MLM provides superior ability for appropriate localization than that of methylene blue. Further research on human lungs can clarify the availability of MLM as a CT guided percutaneous injection material. This study was supported by grant from the Seoul National University College of Medicine Research Fund 2012 (800-20120036). We have no potential conflicts of interest or commercial involvement to disclose. 1 Nakashima S Watanabe A Obama T Yamada G Takahashi H Higami T Need for preoperative computed tomography-guided localization in video-assisted thoracoscopic surgery pulmonary resections of metastatic pulmonary nodules Ann Thorac Surg 2010 89 212 218 20103238 2 Chen S Zhou J Zhang J Hu H Luo X Zhang Y Chen H Video-assisted thoracoscopic solitary pulmonary nodule resection after CT-guided hookwire localization: 43 cases report and literature review Surg Endosc 2011 25 1723 1729 21181200 3 Ciriaco P Negri G Puglisi A Nicoletti R Del Maschio A Zannini P Video-assisted thoracoscopic surgery for pulmonary nodules: rationale for preoperative computed tomography-guided hookwire localization Eur J Cardiothorac Surg 2004 25 429 433 15019673 4 Suzuki K Nagai K Yoshida J Ohmatsu H Takahashi K Nishimura M Nishiwaki Y Video-assisted thoracoscopic surgery for small indeterminate pulmonary nodules: indications for preoperative marking Chest 1999 115 563 568 10027460 5 Seo JM Lee HY Kim HK Choi YS Kim J Shim YM Lee KS Factors determining successful computed tomography-guided localization of lung nodules J Thorac Cardiovasc Surg 2012 143 809 814 22104686 6 Gossot D Miaux Y Guermazi A Celerier M Friga J The hook-wire technique for localization of pulmonary nodules during thoracoscopic resection Chest 1994 105 1467 1469 8181339 7 Pittet O Christodoulou M Pezzetta E Schmidt S Schnyder P Ris HB Video-assisted thoracoscopic resection of a small pulmonary nodule after computed tomography-guided localization with a hook-wire system: experience in 45 consecutive patients World J Surg 2007 31 575 578 17318707 8 Chen W Chen L Yang S Chen Z Qian G Zhang S Jing J A novel technique for localization of small pulmonary nodules Chest 2007 131 1526 1531 17494801 9 Bernard A Resection of pulmonary nodules using video-assisted thoracic surgery: the Thorax Group Ann Thorac Surg 1996 61 202 204 8561553 10 Martin AE Chen JY Muratore CS Mayo-Smith WW Luks FI Dual localization technique for thoracoscopic resection of lung lesions in children J Laparoendosc Adv Surg Tech A 2009 19 S161 S164 18999984 11 Kawanaka K Nomori H Mori T Ikeda K Ikeda O Tomiguchi S Yamashita Y Marking of small pulmonary nodules before thoracoscopic resection: injection of lipiodol under CT-fluoroscopic guidance Acad Radiol 2009 16 39 45 19064210 12 Yamagami T Miura H Yoshimatsu R Tanaka O Ono S Iehara T Hosoi H Nishimura T Experience of fluoroscopy-aided thoracoscopic resection of pulmonary nodule localised with Lipiodol in a child J Med Imaging Radiat Oncol 2011 55 401 403 21843175 13 Iwasaki Y Nagata K Yuba T Hosogi S Kohno K Ohsugi S Kuwahara H Takemura Y Yokomura I Fluoroscopy-guided barium marking for localizing small pulmonary lesions before video-assisted thoracic surgery Respir Med 2005 99 285 289 15733503 14 Yoshida J Nagai K Nishimura M Takahashi K Computed tomography-fluoroscopy guided injection of cyanoacrylate to mark a pulmonary nodule for thoracoscopic resection Jpn J Thorac Cardiovasc Surg 1999 47 210 213 10402768 15 Nomori H Horio H Colored collagen is a long-lasting point marker for small pulmonary nodules in thoracoscopic operations Ann Thorac Surg 1996 61 1070 1073 8607658 16 McConnell PI Feola GP Meyers RL Methylene blue-stained autologous blood for needle localization and thoracoscopic resection of deep pulmonary nodules J Pediatr Surg 2002 37 1729 1731 12483642 17 Hu J Zhang C Sun L Localization of small pulmonary nodules for videothoracoscopic surgery ANZ J Surg 2006 76 649 651 16813634 18 Wicky S Mayor B Cuttat JF Schnyder P CT-guided localizations of pulmonary nodules with methylene blue injections for thoracoscopic resections Chest 1994 106 1326 1328 7956378 19 Vandoni RE Cuttat JF Wicky S Suter M CT-guided methylene-blue labelling before thoracoscopic resection of pulmonary nodules Eur J Cardiothorac Surg 1998 14 265 270 9761435 20 Lenglinger FX Schwarz CD Artmann W Localization of pulmonary nodules before thoracoscopic surgery: value of percutaneous staining with methylene blue AJR Am J Roentgenol 1994 163 297 300 7518642 21 Ikeda K Nomori H Mori T Kobayashi H Iwatani K Yoshimoto K Kawanaka K Impalpable pulmonary nodules with ground-glass opacity: success for making pathologic sections with preoperative marking by lipiodol Chest 2007 131 502 506 17296654 22 Nomori H Horio H Naruke T Suemasu K Fluoroscopy-assisted thoracoscopic resection of lung nodules marked with lipiodol Ann Thorac Surg 2002 74 170 173 12118752 23 Watanabe K Nomori H Ohtsuka T Kaji M Naruke T Suemasu K Usefulness and complications of computed tomography-guided lipiodol marking for fluoroscopy-assisted thoracoscopic resection of small pulmonary nodules: experience with 174 nodules J Thorac Cardiovasc Surg 2006 132 320 324 16872957 24 Kim YD Jeong YJ I H Cho JS Lee JW Kim HJ Lee SH Kim DH Localization of pulmonary nodules with lipiodol prior to thoracoscopic surgery Acta Radiol 2011 52 64 69 21498328 25 Mayo JR Clifton JC Powell TI English JC Evans KG Yee J McWilliams AM Lam SC Finley RJ Lung nodules: CT-guided placement of microcoils to direct video-assisted thoracoscopic surgical resection Radiology 2009 250 576 585 19188326 26 Lee NK Park CM Kang CH Jeon YK Choo JY Lee HJ Goo JM CT-guided percutaneous transthoracic localization of pulmonary nodules prior to video-assisted thoracoscopic surgery using barium suspension Korean J Radiol 2012 13 694 701 23118567 27 Kamiyoshihara M Ishikawa S Morishita Y Pulmonary cryptococcosis diagnosed by video-assisted thoracoscopic surgery with CT-guided localization: report of a case Kyobu Geka 2000 53 795 797 10935411 28 Kwon WJ Kim HJ Jeong YJ Lee CH Kim KI Kim YD Lee JH Direct lipiodol injection used for a radio-opaque lung marker: stability and histopathologic effects Exp Lung Res 2011 37 310 317 21574876 29 Jang HS Effect of drugs for preoperative localization of thoracoscopy to histopathologic change in rabbit lung Seoul the Catholic University of Korea 2000 27 Dissertation 30 Okumura T Kondo H Suzuki K Asamura H Kobayashi T Kaneko M Tsuchiya R Fluoroscopy-assisted thoracoscopic surgery after computed tomography-guided bronchoscopic barium marking Ann Thorac Surg 2001 71 439 442 11235684 Fig. 1 Overview of the experimental design. Animals were randomly divided into two groups: Group A (n = 12) was sacrificed 6 hr after percutaneous injection and Group B (n = 12) was sacrificed 24 hr after a CT guided percutaneous injection of MLM and methylene blue. Fig. 2 Examples of evaluation of staining on the lung surface. Photographs show (A) the extensive staining (score 1) (B) localized dispersion of staining (score 2) and (C) minimal dispersion of staining (score 3). The white lines on the bottom of the figure are markings of the ruler. The distance between two lines is one centimeter. Fig. 3 Examples of assessment of radio-opacity on the fluoroscopic examinations. The fluoroscopic images show (A) a minimally increased opacity (arrow) (score 1) (B) a low density of increased opacity (arrow) (score 2) and (C) a compact nodular increased opacity (arrow) (score 3). Fig. 4 CT and corresponding photomicrograph of lung specimen. MLM in Group B (A-D); (A)"

Lung_Cancer

" non“small-cell lung cancer Clin Lung Cancer 10 252 256 19632943 Patel JD Hensing TA Rademaker A Hart EM Blum MG Milton DT Bonomi PD 2009 Phase II study of pemetrexed and carboplatin plus bevacizumab with maintenance pemetrexed and bevacizumab as first-line therapy for nonsquamous non“small-cell lung cancer J Clin Oncol 27 3284 3289 19433684 Ramlau R Gorbunova V Ciuleanu TE Novello S Ozguroglu M Goksel T Baldotto C Bennouna J Shepherd FA Le-Guennec S Rey A Miller VA Thatcher N Scagliotti GV 2012 Aflibercept and docetaxel versus docetaxel alone after platinum failure in patients with advanced or metastatic non-small-cell lung cancer: a randomized controlled phase III trial J Clin Oncol 30 3640 3647 22965962 Reck M von Pawel J Zatloukal P Ramlau R Gorbounova V Hirsh V Leighl N Mezger J Archer V Moore N Manegold C 2009 Phase III trial of cisplatin plus gemcitabine with either placebo or bevacizumab as first-line therapy for nonsquamous non-small-cell lung cancer: AVAiL J Clin Oncol 27 1227 1234 19188680 Riess JW Logan AC Krupitskaya Y Padda S Clement-Duchene C Ganjoo K Colevas AD Pedro-Salcedo MS Kuo CJ Wakelee HA 2012 Maintenance bevacizumab is associated with increased hemoglobin in patients with advanced nonsquamous non-small cell lung cancer Cancer Invest 30 231 235 22360362 Sandler AB Gray R Perry MC Brahmer J Schiller JH Dowlati A Lilenbaum R Johnson DH 2006 Paclitaxel-carboplatin alone or with bevacizumab for non-small-cell lung cancer N Engl J Med 355 2542 2550 17167137 Scagliotti GV Parikh P von Pawel J Biesma B Vansteenkiste J Manegold C Serwatowski P Gatzemeier U Digumarti R Zukin M Lee JS Mellemgaard A Park K Patil S Rolski J Goksel T de Marinis F Simms L Sugarman KP Gandara D 2008 Phase III study comparing cisplatin plus gemcitabine with cisplatin plus pemetrexed in chemotherapy-naive patients with advanced-stage non-small-cell lung cancer J Clin Oncol 26 3543 3551 18506025 Schiller JH Harrington DP Belani CP Langer CJ Sandler AB Krook JE Zhu J Johnson DH the Eastern Cooperative Oncology Group 2002 Comparison of four chemotherapy regimens for advanced non-small-cell lung cancer N Engl J Med 346 92 98 11784875 Sher A Wu S 2011 Anti-vascular endothelial growth factor antibody bevacizumab reduced the risk of anemia associated with chemotherapy“A meta-analysis Acta Oncol 50 997 1005 21554028 Sitohy B Nagy JA Jaminet S-CS Dvorak HF 2011 Tumor-surrogate blood vessel subtypes exhibit differential susceptibility to anti-VEGF therapy Cancer Res 71 7021 7028 21937680 Tam BYY Wei K Rudge JS Hoffman J Holash J Park S Yuan J Hefner C Chartier C Lee J-S Jiang S Nayak NR Kuypers FA Ma L Sundram U Wu G Garcia JA Schrier SL Maher JJ Johnson RS Yancopoulos GD Mulligan RC Kuo CJ 2006 VEGF modulates erythropoiesis through regulation of adult hepatic erythropoietin synthesis Nat Med 12 793 800 16799557 Tew WP Gordon M Murren J Dupont J Pezzulli S Aghajanian C Sabbatini P Mendelson D Schwartz L Gettinger S Psyrri A Cedarbaum JM Spriggs DR 2010 Phase 1 study of aflibercept administered subcutaneously to patients with advanced solid tumors Clin Cancer Res 16 358 366 20028764 Therasse P Arbuck SG Eisenhauer EA Wanders J Kaplan RS Rubinstein L Verweij J Van Glabbeke M van Oosterom AT Christian MC Gwyther SG 2000 New guidelines to evaluate the response to treatment in solid tumors (RECIST Guidelines) J Natl Cancer Inst 92 205 216 10655437 Van Cutsem E Tabernero J Lakomy R Prenen H Prausova J Macarulla T Ruff P van Hazel GA Moiseyenko V Ferry D McKendrick J Polikoff J Tellier A Castan R Allegra C 2012 Addition of aflibercept to fluorouracil leucovorin and irinotecan improves survival in a phase III randomized trial in patients with metastatic colorectal cancer previously treated with an oxaliplatin-based regimen J Clin Oncol 30 3499 3506 22949147 Vaughn C Zhang L Schiff D 2008 Reversible posterior leukoencephalopathy syndrome in cancer Curr Oncol Rep 10 86 91 18366965 (A) The Kaplan“Meier curve of PFS (N=38). Median PFS: 5 months (95% CI 4.3“7.1). (B) Brain MRI of a patient diagnosed with RPLS. Extensive increased T2 signal of a few scattered areas of restricted diffusion and vasogenic oedema in the frontal cortex/subcortical regions near the vertex and the parietal and occipital regions bilaterally (arrows). No focal enhancing lesions to suggest metastatic disease. Baseline demographics (N=42) Age (years) Median 61.5 Range (years) 38“77 Age (years) by category N (%) <65 23 (54.8) ?65 19 (45.2) Gender N (%) Male 23 (54.8) Female 19 (45.2) Race N (%) African American 2 (4.8) Asian American 4 (9.5) Caucasian American 36 (85.7) ECOG performance status N (%) 0 21 (50.0) 1 21 (50.0) Abbreviation: ECOG=Eastern Cooperative Oncology Group. Summary of most common (>10%) TEAEs by NCI CTCAE grade (N=42) All grades N (%) Grade 3/4 N (%) Number of patients with most common TEAE with NCI grade 40 (95.2) 27 (64.3) Nausea 29 (69.0) 0 Fatigue 28 (66.7) 3 (7.1) Hypertension 24 (57.1) 15 (35.7) Constipation 21 (50.0) 0 Diarrhoea 16 (38.1) 1 (2.4) Dysgeusia 15 (35.7) 0 Stomatitis 15 (35.7) 0 Dysphonia 14 (33.3) 0 Headache 14 (33.3) 1 (2.4) Proteinuria 14 (33.3) 1 (2.4) Anorexia 13 (31.0) 0 Dehydration 12 (28.6) 3 (7.1) Dyspepsia 12 (28.6) 0 Epistaxis 11 (26.2) 0 Vomiting 10 (23.8) 0 Weight loss 10 (23.8) 0 Blood creatinine increased 8 (19.0) 0 Cough 8 (19.0) 0 Dyspnoea 7 (16.7) 1 (2.4) Hyponatraemia 7 (16.7) 2 (4.8) Neutropaenia 7 (16.7) 6 (14.3) Thrombocytopaenia 7 (16.7) 3 (7.1) Dizziness 6 (14.3) 0 Hyperglycaemia 6 (14.3) 1 (2.4) Hypokalaemia 6 (14.3) 4 (9.5) Hypomagnesaemia 6 (14.3) 0 Insomnia 6 (14.3) 0 Rhinorrhaea 6 (14.3) 0 Anaemia 5 (11.9) 2 (4.8) Dry mouth 5 (11.9) 0 Hiccups 5 (11.9) 0 Hyperkalaemia 5 (11.9) 2 (4.8) Hypocalcaemia 5 (11.9) 1 (2.4) Musculoskeletal pain 5 (11.9) 0 Oedema peripheral 5 (11.9) 0 Pain in extremity 5 (11.9) 0 Pneumonia 5 (11.9) 2 (4.8) Abbreviations: CTCAE=Common Terminology Criteria for Adverse Events; TEAE=treatment-emergent adverse events. Mean (s.d.) observed noncompartmental pharmacokinetic parameters for free ziv-aflibercept Ziv-aflibercept Parameter N Mean s.d. t 1/2 Day 7 4.62 1.46 CL l per day per kg 7 0.016 0.004 V ss l?kg?1 7 0.081 0.015 C max mg?l?1 21 104 26.2 C last mg?l?1 21 65.2 50.8 t max Day 21 0.0695 0.019 t last Day 21 7.02 9.32 AUCinf Day — mg?l?1 7 402 100 MRTinf Day 7 5.35 1.28 Abbreviations: AUCinf=area under the concentration curve from time zero extrapolated to infinity; CL=clearance; Clast=last positive plasma concentration; Cmax=maximal plasma concentration; MRTinf=mean residence time extrapolated to infinity; tlast=time of the last positive plasma concentration; tmax=time required to reach maximal plasma concentration; t1/2=observed half-life; Vss=volume of distribution at steady state. PLoS One one 1932-6203 Public Library of Science San Francisco USA 24505377 3913724 PONE-D-13-49110 .0088064 Research Biology Molecular Cell Biology Signal Transduction Signaling in Selected Disciplines Oncogenic Signaling Medicine Oncology Basic Cancer Research Immune Evasion Metastasis Oxidative Damage Tumor Physiology Cancer Prevention Cancer Vaccines Cancer Treatment Gene Therapy Cancers and Neoplasms Lung and Intrathoracic Tumors Impact of p120-catenin Isoforms 1A and 3A on Epithelial Mesenchymal Transition of Lung Cancer Cells Expressing E-cadherin in Different Subcellular Locations Effect of p120ctn Isoforms on EMT of Lung Cancer Zhang Yijun 1 Zhao Yue 1 Jiang Guiyang 1 Zhang Xiupeng 1 Zhao Huanyu 1 Wu Junhua 1 Xu Ke 2 Wang Enhua 1 * 1 Department of Pathology First Affiliated Hospital and College of Basic Medical Sciences China Medical University Shenyang China 2 Department of Radiology First Affiliated Hospital of China Medical University Shenyang China Andr Frdric Editor Aix-Marseille University France * E-mail: wangehhotmail.com Competing Interests: The authors have declared that no competing interests exist. Conceived and designed the experiments: YJZ GYJ EHW. Performed the experiments: YJZ XPZ JHW. Analyzed the data: YJZ HYZ YZ. Contributed reagents/materials/analysis tools: YJZ YZ KX. Wrote the paper: YJZ KX EHW. 2014 4 2 2014 9 2 e88064 21 11 2013 6 1 2014 2014 Zhang et al This is an open-access distributed under the terms of the Creative Commons Attribution License which permits unrestricted use distribution and reproduction in any medium provided the original author and source are credited. The epithelial mesenchymal transition (EMT) is an important process in tumor development."

Lung_Cancer

"CR1 also modulates the complement cascade activation by preventing formation of classical and alternative pathway convertases and by acting as a cofactor for factor I mediated inactivation of C3b and C4b [89]. It has been demonstrated that chronic inflammation can predispose to cancer development and spread [10] as a fundamental component of innate immunity the complement cascade consists of potential proinflammatory molecules especially C3 and C5. Moreover complement activation and abnormal expression in tumor tissues has been demonstrated [11]. Considering the important role of CR1 in complement activation innate immunity and chronic inflammation CR1 has emerged as a molecule of immense interest in gaining insight into the susceptibility to cancer. CR1 gene is located on the Chromosome 1 at the locus 1q32 [12]. Various polymorphisms have been studied including the intronic and exonic density polymorphism for their ability to alter the density of erythrocyte CR1 on the cell membranes [13-15]. There are also the molecular weight variants due to insertion-deletion polymorphisms [16]. Up to now there have been very few studies on the association of genetic variants of CR1 with susceptibility to autoimmune and inflammatory diseases. It has been proposed that genetic variant at CR1 gene (rs6656401) might influence the susceptibility to late-onset Alzheimer™s disease [17]. CR1 expression in Peripheral Blood Mononuclear Cells (PBMCs) may be a new biomarker for prognosis of nasopharyngeal carcinoma and a potential therapeutic target [18]. Recently it has been indicated that CR1 A3650G (His1208Arg) polymorphism plays a critical role in conferring genetic susceptibility to gallbladder cancer in north Indian population [19]. However the association of genetic variants of CR1 with risk of lung cancer remains unexplored. Worldwide lung cancer is the most common cancer in terms of both incidence and mortality [20]. NSCLC is the most common subtype of lung cancer and less aggressive and metastic than SCLC. Although cigarette smoking is the predominant risk factor for lung cancer inherited genetic characteristics are presumed to account in part for this interindividual variation in lung cancer susceptibility. Recently several genome-wide association studies have demonstrated the common genetic variations associated with susceptibility to lung cancer [21-24]. Given the involvement of the complement system in coordinating innate immunity and inflammatory response [25] further examination of the potential association between genetic variation of CR1 genes and lung cancer is warranted. In the current study we conducted a case-control study to investigate the association of tag SNPs in CR1 gene with the risk of NSCLC and effect of the interaction of gene-environment on the risk of NSCLC. Results Subject characteristics The frequency distributions of select characteristics in cases and control subjects were shown in . The mean age (±SD) was 59.6?±?10.5 years for the cancer patients and 57.2?±?13.3 years for the controls. No significant difference was found in the mean age between cases and controls (P?=?0.470). There was no significant difference in proportion of sex and smoking status between cases and controls (P?=?0.832 and P?=?0.321 respectively). However there was significant difference between cases and controls when compared by pack-year smoked (P = 0.001). The heavy smokers (?25 pack-year) accounted for 61.5% in cases but only 45.5% in controls which suggested that cigarette smoking was a prominent contributor to the risk of lung cancer. Of the 470 case patients 178 (37.9%) were diagnosed as adenocarcinoma 238 (50.6%) as squamous cell carcinoma and 100 (%) as other types including large cell carcinoma (n?=?49) and mixed cell carcinoma (n?=?5). Distributions of select characteristics in cases and control subjects Variables ???Cases (n?=?470) ???Controls (n?=?470) No (%) No (%) P a ???Sex 0.832 ???Male 324 68.9 328 69.8 ???Female 146 31.1 142 30.2 ???Age 0.470 ???<50 84 17.9 96 20.4 ???50-59 177 37.7 187 39.8 ???60-69 129 27.4 111 23.6 ????70 80 17.0 76 16.2 ???Smoking status 0.321 ???Non-smoker 265 56.4 281 59.8 ???Smoker 205 43.6 189 40.2 ???Pack-year smoked 0.001 ???<25 75 36.6 96 50.8 ????25 130 63.4 93 49.2 aTwo-sided ?2 test. Association of CR1 tag SNP with NSCLC risk Total 13 selected tag SNPs of CR1 in HapMap database among Chinese population were analyzed. Except for rs9429782 polymorphism the genotype distributions of other SNPs in controls were consistent to Hardy-Weinberg equilibrium. Therefore we excluded the rs9429782 from further analysis. In order to screen the genetic variants that confer the susceptibility to lung cancer 12 candidate tagSNPs were genotyped in a case-control study consisting of 470 lung cancer patients and 470 cancer-free controls as shown in . Importantly genotype frequency of one intronic SNP (rs7525160 G?>?C) in cases was found to be significantly different from those of controls (?2?=?6.339 P=0.042). Further multivariate regression model with adjustment for age gender and smoking status was used to assess the association between rs7525160 G?>?C polymorphism and the risk of NSCLC. The results indicated that the rs7525160 CC genotype was associated with an increased risk of developing NSCLC with OR (95% CI) of 1.52 (1.02-2.28) compared with the GG genotype. Other tagSNPs of CR1 were not significantly associated with the risk of NSCLC in our study population (P >0.05). Genotype frequencies of CRI among cases and controls and their association with non-small cell lung cancers CRI Genotypes ??Controls (n?=?470) ??Cases (n?=?470) OR (95% CI ) * P No (%) No (%) rs7525160 ??GG 176 37.5 139 29.6 1.00 (ref.) ??CG 228 48.5 256 54.5 1.38 (1.04-1.85) 0.041 ??CC 66 14.0 75 15.9 1.52 (1.02-2.28) 0.028 rs3886100 ??GG 117 24.9 105 22.4 1.00 (ref.) ??AG 223 47.4 253 53.8 1.33 (0.97-1.81) 0.078 ??AA 130 27.7 112 23.8 1.06 (0.73-1.54) 0.755 rs11118167 ??TT 348 74.1 353 75.1 1.00 (ref.) ??CT 111 23.6 102 21.7 0.89 (0.65-1.21) 0.457 ??CC 11 2.3 15 3.2 1.35 (0.61-3.01) 0.461 rs9429782 ??GG 250 53.2 261 55.5 1.00 (ref.) ??GT 220 46.8 209 44.5 0.89 (0.69-1.16) 0.388 rs10494885 ??CC 178 37.9 164 34.9 1.00 (ref.) ??CT 224 47.6 232 49.4 1.11 (0.83-1.47) 0.490 ??TT 68 14.5 74 15.7 1.20 (0.81-1.78) 0.365 rs7542544 ??CC 128 27.2 108 23.0 1.00 (ref.) ??AC 223 47.5 252 53.6 1.21 (0.88-1.67) 0.239 ??AA 119 25.3 110 23.4 0.90 (0.62-1.30) 0.897 rs6691117 ??AA 324 68.9 327 69.6 1.00 (ref.) ??AG 131 27.9 128 27.2 0.98 (0.73-1.31) 0.888 ??GG 15 3.2 15 3.2 0.96 (0.46-2.02) 0.923 rs6656401 ??GG 436 92.8 447 95.1 1.00 (ref.) ??AG 34 7.2 23 4.9 0.68 (0.39-1.18) 0.174 ??AA 0 0.0 0 0.0 NC§ rs2296160 ??CC 185 39.4 194 41.3 1.00 (ref.) ??CT 226 48.1 220 46.8 0.91 (0.69-1.21) 0.521 ??TT 59 12.5 56 11.9 0.90 (0.59-1.37) 0.606 rs9429942 ??TT 452 96.2 457 97.2 1.00 (ref.) ??CT 18 3.8 13 2.8 0.77 (0.37-1.61) 0.482 ??CC 0 0.0 0 0.0 NC§ rs4844600 ??GG 171 36.4 179 38.1 1.00 (ref.) ??AG 230 48.9 228 48.5 0.92 (0.70-1.22) 0.571 ??AA 69 14.7 63 13.4 0.87 (0.58-1.31) 0.513 rs3818361 ??CC 187 39.8 188 40.0 1.00 (ref.) ??CT 224 47.7 224 47.7 0.98 (0.74-1.29) 0.868 ??TT 59 12.5 58 12.3 0.96 (0.63-1.46) 0.848 rs17048010 ??TT 301 64.0 286 60.8 1.00 (ref.) ??CT 154 32.8 164 34.9 1.09 (0.82-1.43) 0.556 ??CC 15 3.2 20 4.3 1.40 (0.70-2.79) 0.343 *Adjusted by age sex and smoking status; §NC not calculated. Summary of MDR gene-gene interaction results Models Training bal. acc. (%) Testing bal. acc. (%) P value Cross-validation consistency rs7525160 54.03 50.53 0.828 7/10 rs4844600 rs10494885 55.45 49.32 0.989 3/10 rs4844600 rs10494885 rs7525160 57.60 48.48 0.623 6/10 Generalized Multifactor Dimensionality Reduction (GMDR) was used to evaluate gene-gene interaction. The summary of gene-gene interaction models is listed in . The SNP rs7525160 in CR1 had the highest testing balanced accuracy among 12 SNPs. The three-way interaction model among rs4844600 rs10494885 and rs7525160 showed high testing balance accuracy and cross validation consistency but the testing balanced accuracy was lower than the two-way gene-gene interaction in NSCLC. For each model the interaction was not significant (P?>?0.05). Table 4 Risk of CR1 genotypes with NSCLC by smoking status Smoking status CR1 genotype GG * OR (95% CI) § P value CG?+?CC * OR (95% CI) § P value Non-smoker 84/99 1.00 (reference) 181/182 1.15 (0.81-1.65) 0.440 Smoker 55/77 0.86 (0.54-1.38) 0.528 150/112 1.72 (1.15-2.59) 0.009 <25 pack-years 19/41 0.59 (0.31-1.10) 0.099 56/55 1.32 (0.81-2.61) 0.266 ?25 pack-years 36/36 1.18 (0.67-2.08) 0.562 94/57 2.01 (1.26-3.20) 0.003 *Number of cases/number of controls. §Data were calculated by logistic regression and adjusted for age and gender. Interaction of CR1 SNP with smoking Cigarette smoking is a well-known risk for lung cancer so stratification by smoking status was performed to investigate the association of rs7525160 G?>?C variant with the risk of NSCLC. As shown in Table 4 the risk of NSCLC was associated with the rs7525160 C allele carriers in smokers with OR (95% CI) of 1.72 (1.15-2.59) but not in non-smokers with OR (95% CI) of 1.15 (0.81-1.65) suggesting that the CR1 rs7525160 G?>?C polymorphism is a smoking-modifying risk factor for susceptibility to NSCLC. When the interaction between smoking status and rs7525160 G?>?C variant was analyzed with cumulative smoking dose (pack-year) consistently GC or CC genotype carriers have increased risk of NSCLC among heavy smokers (pack-year???25) with OR (95% CI) of 2.01 (1.26-3.20) but not among light smokers (pack-year <25) with OR (95% CI) of 1.32 (0.81-2.16). The P value for heterogeneity of the stratification analysis by smoking status is 0.015. However the P value for interaction between rs7525160 polymorphism and smoking is 0.172 and the power for the interaction is 0.49. Discussion The chronic airway inflammation and dysfunctional immune system might promote pulmonary carcinogenesis. Implicated in the immune and inflammatory responses the complement cascade plays a pivotal role in the development of cancer. Thus it is likely that the genetic variants of CR1 in the complement system confer the susceptibility to lung cancer. In this study we have for the first time demonstrated that one intronic SNP (rs7525160 G?>?C) out of 13 tag SNPs of CR1 was associated with the risk of NSCLC in Chinese population. Notably the rs7525160 CC genotype was associated with an increased risk of developing NSCLC (OR?=?1.52 95% CI?=?1.02-2.28; P?=?0.028) compared with the GG genotype. MDR analysis also showed that there was no gene-gene interaction among 12 tag SNPs in CR1 gene. Moreover the risk of NSCLC was associated with the rs7525160 C allele carriers in smokers with OR (95% CI) of 1.72 (1.15-2.59) but not in non-smokers with OR (95% CI) of 1.15 (0.81-1.65) indicating this SNP is a smoking-modifying risk factor for susceptibility to NSCLC. To the best of our knowledge this study shed new insight into the interplay of genetic variation of CR1 with lung cancer risk. More importantly it highlights the potential gene-environmental interaction influences the susceptibility to lung cancer. The complement system has been proposed to get involved in innate immunity with the ability to œcomplement antibody-mediated elimination of immune complex and foreign pathogens [26]. Upon complement activation the biologically active peptides C5a and C3a elicit a lot of pro-inflammatory effects and could be closely associated with tumorigenesis [27]. Complement proteins play a dual role in the tumor microenvironment. On one hand they exert a defensive effect against tumor through complement or antibody-dependent cytotoxicity [128]. On the other hand they may escape from immunosurveillance and facilitate carcinogenesis [2]. Specifically a number of experimental evidence has suggested an association between complement activation and tumor growth [2930] which provides a strong biologically link between the abnormal expression and activity of complement cascade and carcinogenesis. Till now a few studies have been carried out to demonstrate the association of genetic variants in complement proteins with susceptibility to cancer. A significant association of CR2 SNP (rs3813946) with the development of nasopharyngeal carcinoma was indicated in Cantonese population [31] and the genetic variations of complement system genes C5 and C9 plays a potential role in susceptibility to non-Hodgkin lymphoma (NHL) [32]. Recently it has been shown that complement factor H Y402H polymorphism interact with cigarette smoking to confer the susceptibility to lung cancer [33]. Furthermore it has been indicated that CR1 A3650G (His1208Arg) polymorphism plays a critical role in conferring genetic susceptibility to gallbladder cancer in north Indian population [19]. However whether the genetic variants of CR1 are related to the risk of lung cancer remains unknown. In this case-control study we found an intronic SNP (rs7525160 G?>?C) with CC genotype was significantly associated with an increased risk of NSCLC. Consistently our results were in accordance with the study that genetic polymorphisms in innate immunity genes may play a role in the carcinogenesis of lung cancer [34]. It is likely that some genetic variations in strong link disequilibrium with this intronic SNP (rs7525160 G?>?C) are functional which provides a new insight into the hallmarks in susceptibility to lung cancer and further functional experiments are warranted to address the proposal. Functionally human CR1 exists on the surface of almost all peripheral blood cells and plays a key role in immune complex clearance and complement inhibition at the cell surface by binding to activated products C3b and C4b [435]. CR1 also possesses cofactor activity for the serum protease factor I and is thus involved in the generation of further fragments of C3/4b with the activation of complement cascade and the cellular immune response [4]. In our study the association of CR1 polymorphism with lung cancer is biologically plausible in that the intronic polymorphism could affect the density of CR1 molecules on the cell surface thereby contributing to autoimmune disorders and neoplasm. Tobacco smoking is an established risk factor for susceptibility to lung cancer. However not all people who suffer from lung cancer are smokers. Lung cancer in non-smokers can be induced by second hand smoke air pollutants and diesel exhaust [36-39]. Our present data showed significant difference of pack-year smoked but not smoking status between NSCLC cases and controls which suggested the important role of other environmental factors in the development of NSCLC. Tobacco could induce chronic and sustained inflammation in lung microenvironment contributing to pulmonary carcinogenesis in smokers [40]. Support also comes from the epidemiologic data regarding inflammation and lung cancer [41]. CR1 an important molecule implicated in immunity and inflammation could protect the host from invasion of exogenous chemicals derived from cigarette smoking. Genetic variant of CR1 could alter gene function and result in deregulation of the inflammatory and immune responses thereby modulating the susceptibility to lung cancer. More importantly we observed a potential interaction of this SNP (rs7525160 G?>?C) with smoking status suggesting the gene-environmental interaction plays a prominent role in the susceptibility to lung cancer. Our present study has its limitation. Our patients may not be representative of total NSCLC patients at large because they were recruited from only one hospital. In addition due to the relatively small sample size further case-control studies are still needed to replicate and extend our findings. Conclusion We conducted a case-control study in Chinese subjects and found an intronic SNP (rs7525160 G?>?C) of CR1 was significantly associated with lung cancer risk. To the best of our knowledge this study provides the first evidence that genetic variant of CR1 (rs7525160 G?>?C) was a smoking-modifying contributor to the development of lung cancer. Methods Study subjects This case-control study consisted of 470 patients with histopathologically confirmed NSCLC and 470 cancer-free controls. All subjects were genetic unrelated ethnic Han Chinese. Patients were recruited between January 2008 and December 2012 at Tangshan Gongren Hospital (Tangshan China). There were no age gender or stage restrictions however patients with previous malignancy or metastasized cancer from other organs were excluded. The response rate for patients was 94%. The controls were randomly selected from a pool of a cancer-free population from a nutritional survey conducted in the same region. The selection criteria for control subjects included: i) no individual history of cancer; ii) frequency matched to cases according to gender age (±5 years); iii) the residential region; and iv) the time period for blood sample collection. At recruitment informed consent was obtained from each subject and each participant was then interviewed to collect detailed information on demographic characteristics. This study was approved by the institutional review board of Hebei United University. Tag SNPs selection and genotyping Based on the Chinese population data from HapMap database we used Haploview 4.2 program to select candidate tag SNPs with an r2 threshold of 0.80 and minor allele frequency (MAF) greater than 1%. Furthermore we also added two potential functional polymorphisms rs9429942 and rs6691117 [4243]. Therefore we included 13 SNPs in our study which represents common genetic variants in Chinese population. Genotyping was performed at Bomiao Tech (Beijing China) using iPlex Gold Genotyping Asssy and Sequenom MassArray (Sequenom San Diego CA USA). Sequenom™s MassArray Designer was used to design PCR and extension primers for each SNP. Primer information for selected tag SNPs was listed in Table 5. Table 5 Primers used in this study SNP_ID Alleles 1st-PCR primer sequences 2nd-PCR primer sequences UEP sequences rs7525160 G/C ACGTTGGATGCAAAATCAAGGTTTAAAGTC ACGTTGGATGTTCTGACATGTACTGCCTGC CCCTGTTGCCTGGGTTTTTCT rs3886100 G/A ACGTTGGATGGGCCTCAGATCCTCAAAATC ACGTTGGATGTGAGCTGTTTCAGCCAAGAG GAGCCAAGAGGACACTTAG rs11118167 T/C ACGTTGGATGATGTGTGTAGTCACTTAGCC ACGTTGGATGATAATGGCAGATTTAAGGGC CAATGATAAATGAATACTGTGTTCTATC rs9429782 G/T ACGTTGGATGACACGCGGGATCCATCGGAA ACGTTGGATGAACGAGTTTCGCTGGCAGAG GGTGCAGCAGCAGAG rs10494885 C/T ACGTTGGATGGTGTAATGCCACAGACATGC ACGTTGGATGCCAGCCAACTGACCTTTATG CTTCTGATTTTCTTTCCTGTTAC rs7542544 C/A ACGTTGGATGGCTAAGAGCCATTAGTGTGC ACGTTGGATGAACGTGGTGGTGCCCAAACA CCATGACCCCAAAGC rs6691117 A/G ACGTTGGATGAGAGTACCAGGAAACAGGAG ACGTTGGATGACCCTACCATGACAAACCCG CCGGGCTGACATCTAAATCTGA rs6656401 G/A ACGTTGGATGAAAGGACACACACAGAGGAG ACGTTGGATGCGTTGATGTTCCTTGGCTTG CTCTGTCTCCATCTTCTC rs2296160 C/T ACGTTGGATGCCAGAATTCCTCAGCAAAAC ACGTTGGATGCCAGAGTGATGTTTTGTGAC CGTGCCTTTTGTCTTCCTTTTAGGT rs9429942 T/C"

Lung_Cancer

"The rates of assignment of patients to observation (22%) and chemotherapy (78%) were as expected. S Gene expression analysis for treatment assignment is feasible. Survival results are encouraging and require future validation. Real-time performance of quantitative in situ ERCC1 and RRM1 analysis requires further development. lung cancer adjuvant therapy personalized medicine ERCC1 (excision repair cross-complementing group 1) RRM1 (ribonucleotide reductase M1) INTRODUCTION After publication of the International Adjuvant Lung Cancer Trial in 2004 adjuvant chemotherapy containing a platinum agent has become the standard of care for patients with a complete surgical resection of American Joint Committee on Cancer stage II to III (version 6) non-small cell lung cancer (NSCLC).1 The trial included patients with stage I to III disease and demonstrated an absolute 4.1% improvement in overall survival (OS) and a subgroup analysis indicated that the OS benefit increased with stage: the hazards ratio (HR) for death among patients receiving adjuvant chemotherapy compared with controls was approximately 0.98 for patients with stage I disease 0.88 for patients with stage II disease and 0.79 for patients with stage III disease.1 The data were confirmed by the National Cancer Institute of Canada Clinical Trials Group JBR.10 trial in 2005 which included patients with stage IB and stage II disease.2 A third trial Cancer and Leukemia Group B (CALGB) 9633 which included only patients with stage IB disease was terminated early and also reported a therapeutic benefit for adjuvant chemotherapy.3 However a final analysis of mature data revealed no statistically significant OS benefit (HR 0.83) but demonstrated a benefit for patients with tumor diameters of ??4 cm (HR 0.69).4 During the same time period an increasing number of correlative biomarker analyses demonstrated that the efficacy of platinum agents was associated with intratumoral levels of the excision repair cross-complementing group 1 (ERCC1) gene with high levels indicating resistance.5“9 Similarly high intratumoral levels of the regulatory subunit of ribonucleotide reductase M1 (RRM1) were reported to be predictive of resistance to gemcitabine.9“13 Finally both biomarkers had also been reported to be prognostic of survival in patients who had not received chemotherapy or radiation with high levels indicating longer survival.814“16 Based on these data we designed an adjuvant trial in 2007. The underlying hypothesis was that patients with high intratumoral levels of ERCC1 and RRM1 would not benefit from chemotherapy and would have a good prognosis because of a less aggressive tumor phenotype. In contrast patients with low levels of ERCC1 and RRM1 would have tumors that were sensitive to chemotherapy but with a more aggressive phenotype. Because a biomarker-driven adjuvant chemotherapy selection trial had not been performed in patients with NSCLC we focused on demonstrating the feasibility of such an approach before launching a phase 3 trial. In addition because adjuvant chemotherapy had quickly become the standard of care for patients with stage II/IIIA disease we focused our efforts on patients with stage I disease. After discussions within the SWOG (formerly the Southwest Oncology Group) lung cancer working group and the National Cancer Institute (NCI)'s Cancer Therapy Evaluation Program and after peer review by a National Institutes of Health study section the consensus was to focus this feasibility trial on patients with stage I disease and tumor diameters of ?2 cm. MATERIALS AND METHODS Trial Design and Treatment Plan The trial (NCT00792701 SWOG-0720) complied with the Declaration of Helsinki and was approved by the Institutional Review Boards of the study institutions. Eligibility criteria included a diagnosis of NSCLC; stage I disease (according to version 6 of the American Joint Committee on Cancer staging manual) with a tumor diameter ??2?cm; a complete surgical resection by lobectomy bilobectomy or pneumonectomy; surgical staging of the mediastinum through sampling of at least 2 lymph node stations; a positron emission tomography scan; a computed tomographic scan of the chest and abdomen; adequate bone marrow liver and renal function; a Zubrod performance status of 0 or 1; and willingness to provide a smoking history. Patients with a prior malignancy prior radiation to the chest or other significant illnesses according to good medical practice were excluded. Patients had to be registered on the trial within 35 days of surgery. Tumor specimens were then retrieved and shipped to a central laboratory. They were analyzed for in situ tumor levels of ERCC1 and RRM1 using an immunofluorescence-based automated quantitative analysis method.17 Prespecified cutoff levels that had been determined in 187 patients with stage I disease (??65 for ERCC1 and ??40 for RRM1) were used to categorize specimens as high or low expressors for each marker (Fig. 1).16 The appropriate therapeutic assignment was then passed on to the statistical center and the participating therapeutic center; however specific protein levels were not communicated to the treatment center. Therapeutic assignment was based solely on biomarker categories and no other stratification parameters were used. CONSORT (Consolidated Standards Of Reporting Trials) diagram of the trial is shown. Patients with high levels of both biomarkers received active surveillance and patients with low levels of one or both biomarkers received 4 cycles of cisplatin (at a dose of 80 mg/m2 on day 1) and gemcitabine (at a dose of 1 g/m2 on days 1 and 8) every 21 days. The protocol included provisions for dose reductions or treatment delays. The addition of other targeted or cytotoxic agents during therapy or as maintenance was not permitted. Specimen Collection Processing and Gene Expression Analysis The study required the collection and shipment of formalin-fixed and paraffin-embedded tumor blocks before therapy. However if local policies did not permit submission of a tissue block 10 serial unstained sections could be submitted. Processing was done in a reference laboratory by 1 of 2 investigators (V.O. and Z.Z.). Sections measuring 5 ?m in thickness were placed on frosted glass slides and in situ quantification was performed by the automated quantitative analysis method (PM-2000 [version 1] HistoRx Inc New Haven CT) as previously described.91618 The primary antibody for the detection of ERCC1 was clone 8F1 (product code NB500-704 lots G412 and H347 from Novus Biologicals [Littleton Colo]) and the antiserum for RRM1 was R1AS-6 (generated in a rabbit in 2003 against a keyhole limpet hemocyanin [KLH]-conjugated 21-aminoacid peptide specific to the N-terminal of RRM1 column purification lot 09-2008). Slides were scanned with SpotGrabber (HistoRx New Haven Conn.) and image data were captured with a digital camera and fluorescence microscope and analyzed. Scores were adjusted to range from 1 to 255. Because full sections were evaluated for each specimen multiple spots with diameters of 0.6 mm were analyzed to obtain a representative level of protein expression. The number of spots was dependent on suitable areas with tumor cells and it ranged from 5 to 25 spots (median 10 spots) for both targets. Runs included a tissue microarray of 15 control specimens in triplicate for control purposes. Statistical Analysis The primary objective of the current study was the feasibility of a biomarker-based treatment assignment in the cooperative group setting. If the true success rate were ??75% then a biomarker-based treatment assignment would not be considered feasible but if the true success rate were ??90% it would be feasible. If ??47 of 55 eligible patients (85%) were successfully assigned to treatment or active monitoring within 84 days from surgery this would be considered evidence of feasibility. The design had 91% power using an exact binomial test with a 1-sided type I error of 5%. Secondary objectives included estimating the collective 2-year disease-free survival (DFS) for patients who accepted their treatment assignment and in the subset of patients who received adjuvant chemotherapy. However there would be no comparison made between treatment arms. "

Lung_Cancer

"or paclitaxel (200 mg/m2)/carboplatin (area under the curve 6.0) on day 1 every 3 weeks. Chemotherapy was continued for at least three cycles. Gefitinib was administered until the disease progressed intolerable toxicities developed or consent was withdrawn. The protocol recommended that the crossover regimen be used as a second-line treatment. Clinical Assessments The antitumor response to treatment was assessed using computed tomography every 2 months. Unidirectional measurements were adopted on the basis of the Response Evaluation Criteria in Solid Tumors (version 1.0).23 PFS was evaluated from the date of randomization to the date when disease progression was first observed or death occurred. The treatment response and PFS were determined by an external review of computed tomography scans by experts who were not aware of the treatment assignments. Overall survival (OS) was evaluated from the date of randomization to the date of death. Statistical Analysis To assess prognostic factors for OS we used univariate and multivariate Cox proportional hazards models. Kaplan“Meier survival curves were constructed for PFS and OS and differences between groups were identified using the log-rank test. Differences in response rates were identified using Fisher™s exact test. Each analysis was two sided with a 5% significance level and a 95% confidence interval. All analyses were performed using SAS for Windows software (release 9.1; SAS Institute Cary NC). RESULTS Patient Population A total of 230 chemonaive patients were enrolled in the NEJ002 study: 115 patients were assigned to receive gefitinib and 115 were assigned to receive carboplatin-paclitaxel (Fig. 1). To evaluate the efficacy of gefitinib in NSCLC patients with uncommon EGFR mutations we analyzed the data of 114 patients in the gefitinib group and 111 patients in the carboplatin-paclitaxel group. We identified five patients who had uncommon EGFR mutations in each group. Two patients who had common mutations and were treated with first-line chemotherapy consisting of carboplatin-paclitaxel were excluded from the PFS analysis in the NEJ002 study. However both were treated with gefitinib and were included in this post-hoc analysis. The demographic and disease characteristics of the patients with uncommon EGFR mutations were similar to those of patients with common EGFR mutations (). The characteristics of each patient with uncommon EGFR mutations are shown in supplementary Table S1 (Supplemental Digital Content 1 http://links.lww.com/JTO/A494). FIGURE 1. Enrollment randomization and follow-up of the study patients. TABLE 1. Patient Characteristics Survival Factors In the univariate analysis of 225 patients who received gefitinib at any point uncommon EGFR mutations had a significant detrimental effect on survival (). We also identified performance statuses 1 and 2 distant metastasis brain metastasis stable disease and progressive disease as significant predictors of worse prognosis for standard chemotherapy and stable disease and progressive disease as significant predictors of worse prognosis for gefitinib. When these variables were included in the Cox proportional hazards model we found that uncommon EGFR mutations performance statuses 1 and 2 stable disease and progressive disease for standard chemotherapy and stable disease and progressive disease for gefitinib had significant hazard ratios (). TABLE 2. Univariate and Multivariate Analysis by Cox Proportional Hazards Model Uncommon EGFR Mutations and Survival The Kaplan“Meier curve for OS for uncommon versus common EGFR mutations is shown in A. The OS was significantly shorter among patients with uncommon EGFR mutations compared with OS of those with common EGFR mutations in the overall population (12 versus 28.4 months; p = 0.002). A significantly shorter survival time was observed in patients with uncommon EGFR mutations compared with survival time in those with common EGFR mutations in the gefitinib group (11.9 versus 29.3 months; p < 0.001) (Fig. 2B). However a similar survival time was observed between the subgroups of uncommon and common EGFR mutations in the carboplatin-paclitaxel group (22.8 versus 28 months; p= 0.358) (Fig. 2C). FIGURE 2. The overall survival curves of patients with common mutations and uncommon mutations in the entire population (A) the gefitinib group (B) and the carboplatin-paclitaxel group (C). To examine whether the sequence of platinum doublet and gefitinib affected OS we performed a further subgroup analysis. The survival time tended to be shorter among patients receiving first-line gefitinib compared with the survival time among those receiving first-line carboplatin-paclitaxel in the uncommon EGFR mutation group (11.9 versus 22.8 months; p = 0.102). Consistent with previous publications a similar survival time was observed between patients receiving first-line gefitinib and those receiving first-line carboplatin-paclitaxel in the common EGFR mutation group (29.3 versus 28 months; p = 0.378). Uncommon EGFR Mutations PFS and Response In the gefitinib group the median PFS was significantly shorter for patients with uncommon EGFR mutations compared with median PFS of those with common EGFR mutations (2.2 versus 11.4 months; p < 0.001) (Fig. 3A). By contrast the median PFS did not differ significantly between patients with uncommon EGFR mutations and those with common EGFR mutations in the carboplatin-paclitaxel group (5.9 versus 5.4 months; p = 0.847) (Fig. 3B). The objective response rate was significantly lower in patients with uncommon EGFR mutations compared with the objective response rate in those with common EGFR mutations when treated with gefitinib (20% versus 76%; p = 0.017) (supplementary Table S2 Supplemental Digital Content 1 http://links.lww.com/JTO/A494). By contrast similar objective response rates were observed for patients with uncommon EGFR mutations and those with common EGFR mutations in the carboplatin-paclitaxel group (20% versus 32%; p = 0.336) (supplementary Table S2 Supplemental Digital Content 1 http://links.lww.com/JTO/A494). FIGURE 3. Progression-free survival curves in the gefitinib group (A) and the carboplatin-paclitaxel group (B) according to the type of epidermal growth factor receptor mutation. DISCUSSION Recent studies suggest that NSCLC patients with uncommon EGFR mutations are less responsive to EGFR-TKIs compared with patients with L858R and exon 19 deletions.9“20 However the efficacy of EGFR-TKIs in NSCLC patients with uncommon mutations has not been fully elucidated. We conducted a post-hoc analysis of the NEJ002 study to evaluate the effectiveness of gefitinib against NSCLC with G719X or L861Q. The NEJ002 study comparing gefitinib and standard carboplatin-paclitaxel chemotherapy as the first-line treatment for patients with EGFR mutations demonstrated no significant difference in OS between gefitinib and carboplatin-paclitaxel.6 In contrast to other phase 3 trials investigating EGFR-TKIs for patients with common EGFR mutations of exon 19 deletion and L858R the NEJ002 is the only study that included uncommon EGFR mutations of G719X and L861Q. The current study clearly demonstrated that NSCLC patients with the uncommon EGFR mutations G719X and L861Q had shorter survival than the survival of those with an exon 19 deletion or L858R mutation (Fig. 2). Our results are consistent with other clinical studies on EGFR-TKIs in patients with uncommon EGFR mutations (supplementary Table S3 Supplemental Digital Content 1 http://links.lww.com/JTO/A494). The overall response rate to EGFR-TKIs in patients with uncommon EGFR mutations was 41% which is lower than the response rate to TKIs (62%“83%) of patients with common EGFR mutations.7824 In the NEJ002 study G719X included G719C and G719S. No patients harbored G719A. To investigate the effectiveness of gefitinib on each uncommon EGFR mutations we evaluated the difference in OS between patients with uncommon EGFR mutations (G719C versus G719S and G719X versus L861Q). There was no significant difference between these subgroups (data not shown). This study showed that the PFS and OS tended to be shorter among patients treated with first-line gefitinib compared with PFS and OS among those treated with first-line carboplatin-paclitaxel in the uncommon EGFR mutation group (supplementary Table S2 Supplemental Digital Content 1 http://links.lww.com/JTO/A494). We also found poor disease control rate with gefitinib in patients with uncommon mutations. Three of five patients with uncommon mutations in the gefitinib group had progressive disease. By contrast no patients with uncommon mutations had progressive disease in the carboplatin-paclitaxel group. Although the number of patients with uncommon mutations in each treatment group was small platinum-doublet therapy might be a better choice than gefitinib for first-line therapy in patients with uncommon EGFR mutations. Because some of patients with uncommon mutations showed good clinical response to gefitinib in this study and they seemed to be heterogeneous in terms of response to gefitinib administration of gefitinib should be considered for patients with uncommon mutations when disease progression was observed after first-line chemotherapy. In vitro studies have indicated that the affinity of gefitinib for EGFR proteins with uncommon EGFR mutations is lower than the affinity of gefitinib for EGFR proteins with common EGFR mutations.25 A sixfold or 14-fold higher concentration of gefitinib was required to inhibit the growth of cells expressing G719X or L861Q respectively compared with cells expressing L858R.26 These results may explain the lack of response to gefitinib in patients with uncommon EGFR mutations. The authors also examined the sensitivity of G719X and L861Q mutations to erlotinib and irreversible TKIs.27 Cells expressing G719X were less resistant to erlotinib than gefitinib in vitro; however L861Q was resistant to both erlotinib and gefitinib. In contrast to erlotinib irreversible TKIs inhibited the growth of cells with G719X or L861Q at a lower concentration than those with wild-type EGFR. Indeed Sequist et al.28 reported that the effectiveness of an irreversible pan-ErbB receptor TKI neratinib on NSCLC patients with G719X. Niratinib induced partial responses in three of four patients with G719X and the fourth had durable stable disease for 40 weeks. It may be beneficial to evaluate erlotinib as a treatment for NSCLCs with G719X and irreversible EGFR-TKIs as treatments for NSCLCs with G719X and L861Q. Because previous phase 3 trials that investigated erlotinib or irreversible TKIs for NSCLC with EGFR mutations did not include uncommon EGFR mutations further clinical studies may need to be performed.7829 Another possible strategy for the treatment of uncommon EGFR mutations is the combination of EGFR-TKIs and cytotoxic agents. Our group has undertaken a randomized phase 3 trial to compare gefitinib plus carboplatin plus pemetrexed with gefitinib monotherapy for patients with NSCLC with an exon 19 deletion or an L858R G719X or L861Q EGFR mutation (NEJ009; University Hospital Medical Information Network Clinical Trials Registry [UMIN-CTR] number UMIN000006340). The data from this study will advance the treatment of NSCLC with uncommon EGFR mutations. In conclusion our post-hoc analysis clearly demonstrated shorter survival of TKI-treated patients with uncommon EGFR mutations compared with survival of those with common EGFR mutations. Furthermore the data suggest that the first-line chemotherapy may be relatively effective for NSCLC with uncommon EGFR mutations. ACKNOWLEDGMENTS Special thanks to Hiromi Odagiri for her expert assistance with data collection and management. This study was supported by the Tokyo Cooperative Oncology Group. The first two authors contributed equally to this work. Disclosure: Dr. Yoshizawa received grants and lecture fees from AstraZeneca; Dr. Maemondo received lecture fees from AstraZeneca and Chugai; Dr. Inoue received lecture fees from AstraZeneca and Chugai; Dr. Gemma received grants and lecture fees from AstraZeneca; Dr. Hagiwara received patent fees from Mitsubishi Chemical Medience consulting fees and lecture fees from AstraZeneca; Dr. Kobayashi received grants from Novartis Nihon Kayaku Chugai Shionogi Kyowa Kirin Yakult Taiho and AstraZeneca and lecture fees from AstraZeneca Chugai and Bristol-Myers Squibb. The remaining authors declare no conflict of interest. REFERENCES 1. Kim ES Hirsh V Mok T Gefitinib versus docetaxel in previously treated non-small-cell lung cancer (INTEREST): a randomised phase III trial. Lancet 2008 372 1809 1818 19027483 2. Shepherd FA Rodrigues Pereira J Ciuleanu T National Cancer Institute of Canada Clinical Trials Group Erlotinib in previously treated non-small-cell lung cancer. N Engl J Med 2005 353 123 132 16014882 3. Lynch TJ Bell DW Sordella R Activating mutations in the epidermal growth factor receptor underlying responsiveness of non-small-cell lung cancer to gefitinib. N Engl J Med 2004 350 2129 2139 15118073 4. Paez JG EGFR mutations in lung cancer: correlation with clinical response to gefitinib therapy. Science 2004 304 1497 1500 15118125 5. Mitsudomi T Morita S Yatabe Y West Japan Oncology Group Gefitinib versus cisplatin plus docetaxel in patients with non-small-cell lung cancer harbouring mutations of the epidermal growth factor receptor (WJTOG3405): an open label randomised phase 3 trial. Lancet Oncol 2010 11 121 128 20022809 6. Maemondo M Inoue A Kobayashi K North-East Japan Study Group Gefitinib or chemotherapy for non-small-cell lung cancer with mutated EGFR. N Engl J Med 2010 362 2380 2388 20573926 7. Rosell R Carcereny E Gervais R Spanish Lung Cancer Group in Collaboration with Groupe Français de Pneumo-Cancérologie and Associazione Italiana Oncologia Toracica Erlotinib versus standard chemotherapy as first-line treatment for European patients with advanced EGFR mutation-positive non-small-cell lung cancer (EURTAC): a multicentre open-label randomised phase 3 trial. Lancet Oncol 2012 13 239 246 22285168 8. Zhou C Wu YL Chen G Erlotinib versus chemotherapy as first-line treatment for patients with advanced EGFR mutation-positive non-small-cell lung cancer (OPTIMAL CTONG-0802): a multicentre open-label randomised phase 3 study. Lancet Oncol 2011 12 735 742 21783417 9. Mitsudomi T Yatabe Y Mutations of the epidermal growth factor receptor gene and related genes as determinants of epidermal growth factor receptor tyrosine kinase inhibitors sensitivity in lung cancer. Cancer Sci 2007 98 1817 1824 17888036 10. Pallis AG Voutsina A Kalikaki A ˜Classical™ but not ˜other™ mutations of EGFR kinase domain are associated with clinical outcome in gefitinib-treated patients with non-small cell lung cancer. Br J Cancer 2007 97 1560 1566 18000506 11. Maheswaran S Sequist LV Nagrath S Detection of mutations in EGFR in circulating lung-cancer cells. N Engl J Med 2008 359 366 377 18596266 12. Sequist LV Martins RG Spigel D First-line gefitinib in patients with advanced non-small-cell lung cancer harboring somatic EGFR mutations. J Clin Oncol 2008 26 2442 2449 18458038 13. Costa DB Nguyen KS Cho BC Effects of erlotinib in EGFR mutated non-small cell lung cancers with resistance to gefitinib. Clin Cancer Res 2008 14 7060 7067 18981003 14. Masago K Fujita S Irisa K Good clinical response to gefitinib in a non-small cell lung cancer patient harboring a rare somatic epidermal growth factor gene point mutation; codon 768 AGC > ATC in exon 20 (S768I). Jpn J Clin Oncol 2010 40 1105 1109 20522446 15. Rizvi NA Rusch V Pao W Molecular characteristics predict clinical outcomes: prospective trial correlating response to the EGFR tyrosine kinase inhibitor gefitinib with the presence of sensitizing mutations in the tyrosine binding domain of the EGFR gene. Clin Cancer Res 2011 17 3500 3506 21558399 16. De Pas T Toffalorio F Manzotti M Activity of epidermal growth factor receptor-tyrosine kinase inhibitors in patients with non-small cell lung cancer harboring rare epidermal growth factor receptor mutations. J Thorac Oncol 2011 6 1895 1901 21841502 17. Wu JY Yu CJ Chang YC Effectiveness of tyrosine kinase inhibitors on œuncommon epidermal growth factor receptor mutations of unknown clinical significance in non-small cell lung cancer. Clin Cancer Res 2011 17 3812 3821 21531810 18. Ong M Kwan K Kamel-Reid S Neoadjuvant erlotinib and surgical resection of a stage iiia papillary adenocarcinoma of the lung with an L861Q activating EGFR mutation. Curr Oncol 2012 19 e222 e226 22670114 19. Ackerman A Goldstein MA Kobayashi S Costa DB EGFR delE709_T710insD: a rare but potentially EGFR inhibitor responsive mutation in non-small-cell lung cancer. J Thorac Oncol 2012 7 e19 e20 22982663 20. Sharma A Tan TH Cheetham G Rare and novel epidermal growth factor receptor mutations in non-small-cell lung cancer and lack of clinical response to gefitinib in two cases. J Thorac Oncol 2012 7 941 942 22722798 21. Nagai Y Miyazawa H Huqun Genetic heterogeneity of the epidermal growth factor receptor in non-small cell lung cancer cell lines revealed by a rapid and sensitive detection system the peptide nucleic acid-locked nucleic acid PCR clamp. Cancer Res 2005 65 7276 7282 16105816 22. Tanaka T Matsuoka M Sutani A Frequency of and variables associated with the EGFR mutation and its subtypes. Int J Cancer 2010 126 651 655 19609951 23. Therasse P Arbuck SG Eisenhauer EA New guidelines to evaluate the response to treatment in solid tumors. European Organization for Research and Treatment of Cancer National Cancer Institute of the United States National Cancer Institute of Canada. J Natl Cancer Inst 2000 92 205 216 10655437 24. Mitsudomi T Yatabe Y Epidermal growth factor receptor in relation to tumor development: EGFR gene and cancer. FEBS J 2010 277 301 308 19922469 25. Yun CH Boggon TJ Li Y Structures of lung cancer-derived EGFR mutants and inhibitor complexes: mechanism of activation and insights into differential inhibitor sensitivity. Cancer Cell 2007 11 217 227 17349580 26. Kancha RK von Bubnoff N Peschel C Duyster J Functional analysis of epidermal growth factor receptor (EGFR) mutations and potential implications for EGFR targeted therapy. Clin Cancer Res 2009 15 460 467 19147750 27. Kancha RK Peschel C Duyster J The epidermal growth factor receptor-L861Q mutation increases kinase activity without leading to enhanced sensitivity toward epidermal growth factor receptor kinase inhibitors. J Thorac Oncol 2011 6 387 392 21252719 28. Sequist LV Besse B Lynch TJ Neratinib an irreversible pan-ErbB receptor tyrosine kinase inhibitor: results of a phase II trial in patients with advanced non-small-cell lung cancer. J Clin Oncol 2010 28 3076 3083 20479403 29. Miller VA Hirsh V Cadranel J Afatinib versus placebo for patients with advanced metastatic non-small-cell lung cancer after failure of erlotinib gefitinib or both and one or two lines of chemotherapy (LUX-Lung 1): a phase 2b/3 randomised trial. Lancet Oncol 2012 13 528 538 22452896 Clin Orthop Relat Res Clin. Orthop. Relat. Res Clinical Orthopaedics and Related Research 0009-921X 1528-1132 Springer US Boston 24249538 3971232 3385 10.1007/s11999-013-3385-9 Clinical Research Does Intensity of Surveillance Affect Survival After Surgery for Sarcomas? Results of a Randomized Noninferiority Trial Puri Ajay MS docpuri@gmail.com Gulia Ashish MS Hawaldar Rohini PhD Ranganathan Priya MD Badwe Rajendra A. MS Orthopaedic Oncology Tata Memorial Hospital Room No. 45 E Borges Road Mumbai India Tata Memorial Hospital Mumbai India Anaesthesiology Critical Care and Pain Tata Memorial Hospital Mumbai India Surgical Oncology Tata Memorial Hospital Mumbai India 19 11 2013 5 2014 472 5 1568 1575 30 7 2013 8 11 2013 © The Association of Bone and Joint Surgeons® 2013 Background Whether current postoperative surveillance regimes result in improved overall survival (OS) of patients with extremity sarcomas is unknown. Questions/purposes We hypothesized that a less intensive followup protocol would not be inferior to the conventional followup protocol in terms of OS. We (1) assessed OS of patients to determine if less intensive followup regimens led to worsened survival and asked (2) whether chest radiograph followup group was inferior to CT scan followup group in detecting pulmonary metastasis; and (3) whether less frequent (6-monthly) followup interval was inferior to more frequent (3-monthly) followup in detecting pulmonary metastasis and local recurrence. Methods A prospective randomized single-center noninferiority trial was conducted between January 2006 and June 2010. On the basis of 3-year survival of 60% with intensive more frequent followup 500 nonmetastatic patients were randomized to demonstrate noninferiority by a margin (delta) of 10% (hazard ratio [HR] 1.36). The primary end point was OS at 3 years. The secondary objective was to compare disease-free survival (DFS) (time to recurrence) at 3 years. At minimum followup of 30 months (median 42 months; range 30“81 months) 178 deaths were documented. Results Three-year OS and DFS for all patients was 67% and 52% respectively. Three-year OS was 67% and 66% in chest radiography and CT groups respectively (HR 0.9; upper 90% confidence interval [CI] 1.13). DFS rate was 54% and 49% in chest radiography and CT groups respectively (HR 0.82; upper 90% CI 0.97). Three-year OS was 64% and 69% in 6-monthly and 3-monthly groups respectively (HR 1.2; upper 90% CI 1.47). DFS was 51% and 52% in 6-monthly and 3-monthly groups respectively (HR 1.01; upper 90% CI 1.2). Almost 90% of local recurrences were identified by patients themselves. Conclusions Inexpensive imaging detects the vast majority of recurrent disease in patients with sarcoma without deleterious effects on eventual outcomes. Patient education regarding self-examination will detect most instances of local recurrence although this was not directly assessed in this study. Although less frequent visits adequately detected metastasis and local recurrence this trial could not conclusively demonstrate noninferiority in OS for a 6-monthly interval of followup visits against 3-monthly visits. Level of Evidence Level I therapeutic study. See Guidelines for Authors for a complete description of levels of evidence. issue-copyright-statement © The Association of Bone and Joint Surgeons® 2014 101528555 37539 Nat Commun Nat Commun Nature communications 2041-1723 24572595 3982882 10.1038/ncomms4365 NIHMS562641 Article Characterizing the genetic basis of methylome diversity in histologically normal human lung tissue Shi Jianxin 1 Marconett Crystal N. 2 3 Duan Jubao 4 Hyland Paula L. 1 Li Peng 1 Wang Zhaoming 1 Wheeler William 5 Zhou Beiyun 6 Campan Mihaela 2 3 Lee Diane S. 2 3 Huang Jing 7 Zhou Weiyin 1 Triche Tim 8 Amundadottir Laufey 1 Warner Andrew 9 Hutchinson Amy 1 Chen Po-Han 2 3 Chung Brian S.I. 2 3 Pesatori Angela C. 10 Consonni Dario 10 Bertazzi Pier Alberto 10 Bergen Andrew W. 11 Freedman Mathew 12 13 Siegmund Kimberly D. 8 Berman Benjamin P. 8 14 Borok Zea 3 6 Chatterjee Nilanjan 1 Tucker Margaret A. 1 Caporaso Neil E. 1 Chanock Stephen J. 1 Laird-Offringa Ite A. 2 3 Landi Maria Teresa 1 1Division of Cancer Epidemiology and Genetics National Cancer Institute NIH DHHS Bethesda MD 20892 USA 2Department of Surgery USC/Norris Comprehensive Cancer Center Keck School of Medicine Los Angeles CA 90089 USA 3Department of Biochemistry and Molecular Biology USC/Norris Comprehensive Cancer Center Keck School of Medicine Los Angeles CA 90089 USA 4Center for Psychiatric Genetics Department of Psychiatry and Behavioral Sciences North Shore University Health System Research Institute University of Chicago Pritzker School of Medicine Evanston IL 60201 USA 5Information Management Services Inc. Rockville MD 20852 USA 6Will Rogers Institute Pulmonary Research Center and Division of Pulmonary Critical Care and Sleep Medicine USC Keck School of Medicine Los Angeles CA 90089 USA 7Laboratory of Cancer Biology and Genetics Center for Cancer Research National Cancer Institute NIH DHHS Bethesda MD 20892 USA 8Bioinformatics Division Department of Preventive Medicine University of Southern California Los Angeles CA 90089 USA 9Pathology/Histotechnology Laboratory Laboratory Animal Sciences Program Frederick National Laboratory for Cancer Research Frederick Maryland21702 USA 10Unit of Epidemiology IRCCS Fondazione Ca™ Granda Ospedale Maggiore Policlinico and Department of Clinical Sciences and Community Health University of Milan Milan20122 Italy 11Molecular Genetics Program Center for Health Sciences SRI Menlo Park CA 94025 USA 12Program in Medical and Population Genetics The Broad Institute Cambridge MA 02142 USA 13Department of Medical Oncology The Center for Functional Cancer Epigenetics Dana-Farber Cancer Institute Boston MA 02215 14USC Epigenome Center and USC/Norris Comprehensive Cancer Center Los Angeles CA 90089 USA Correspondence: landim@mail.nih.gov 4 4 2014 27 2 2014 27 8 2014 5 3365 3365 The genetic regulation of the human epigenome is not fully appreciated. Here we describe the effects of genetic variants on the DNA methylome in human lung based on methylation-quantitative trait loci (meQTL) analyses. We report 34304 cis- and 585 trans-meQTLs a genetic-epigenetic interaction of surprising magnitude including a regulatory hotspot. These findings are replicated in both breast and kidney tissues and show distinct patterns: cis-meQTLs mostly localize to CpG sites outside of genes promoters and CpG islands (CGIs) while trans-meQTLs are over-represented in promoter CGIs. meQTL SNPs are enriched in CTCF binding sites DNaseI hypersensitivity regions and histone marks. Importantly 4 of the 5 established lung cancer risk loci in European ancestry are cis-meQTLs and in aggregate cis-meQTLs are enriched for lung cancer risk in a genome-wide analysis of 11587 subjects. Thus inherited genetic variation may affect lung carcinogenesis by regulating the human methylome. Introduction DNA methylation plays a central role in epigenetic regulation. Twin studies have suggested that DNA methylation at specific CpG sites can be heritable12; however the genetic effects on DNA methylation have been investigated only in brain tissues34 adipose tissues56 and lymphoblastoid cell lines (LCL)7. Most studies were based on the Illumina HumanMethylation27 array which has a low density and mainly focuses on CpG-sites mapping to gene promoter regions. While the functional role of DNA methylation in non-promoter or non-CpG Island (CGI) regions remains largely unknown evidence shows roles in regulating gene splicing8 and alternative promoters9 silencing of intragenic repetitive DNA sequences10 and predisposing to germline and somatic mutations that could contribute to cancer development1112. Notably a recent study13 suggests that most DNA methylation alterations in colon cancer occur outside of promoters or CGIs in so called CpG island shores and shelves and the Cancer Genome Project has reported high mutation rates in CpG regions outside CGI in multiple cancers14. Although expression QTLs (eQTLs) have been extensively studied in different cell lines and tissues15 the minimal overlap observed between cis-acting meQTLs and eQTLs (?5“10%)347 emphasizes the necessity of mapping meQTLs that may function independently of nearby gene expression. This might reveal novel mechanisms for genetic effects on cancer risk particularly since many of the established cancer susceptibility SNPs map to non-genic regions. Lung diseases constitute a significant public health burden. About 10 million Americans had chronic obstructive pulmonary disease in 201216 and lung cancer continues to be the leading cancer-related cause of mortality worldwide17. To provide functional annotation of SNPs particularly those relevant to lung diseases and traits we systematically mapped meQTLs in 210 histologically normal human lung tissues using Illumina Infinium HumanMethylation450 BeadChip arrays which provide a comprehensive platform to interrogate the DNA methylation status of 485512 cytosine targets with excellent coverage in both promoter and non-promoter regions (Fig. 1a) CGI and non-CGI regions (Fig. 1b) and gene and non-gene regions. Thus our study enables the characterization of genetic effects across the methylome in unprecedented detail. Moreover since DNA methylation exhibits tissue specific features18 we investigated whether similar meQTLs could be identified in other tissues. Results Identification of cis-acting meQTLs We profiled DNA methylation for 244 fresh-frozen histologically normal lung samples from non-small cell lung cancer (NSCLC) patients from the Environment and Genetics in Lung cancer Etiology (EAGLE) study19. A subset of 210 tissue samples that passed quality control and had germline genotype data from blood samples20 was used for meQTL analysis. The analysis was restricted to 338456 autosomal CpG probes after excluding those annotated in repetitive genomic regions or that harbored genetic variants. The distribution of methylation levels differed strongly across distinct types of genomic regions (Supplementary Fig. 1ab). Consistent with previous studies21 CpG sites in promoter or CGI regions were largely unmethylated while those in other regions were largely methylated (Supplementary Fig. 1ab). We performed cis-meQTL analysis for each methylation trait by searching for SNPs within 500kb of the target CpG-site in each direction (1Mb overall). The genetic association was tested under an additive model between each SNP and each normalized methylation probe adjusting for sex age plate population stratification and methylation-based principal component analysis (PCA) scores. Controlling FDR at 5% (P=4.0×10?5) we detected cis-meQTLs for 34304 (10.1% of 338456) CpG probes (Supplementary ) mapping to 9330 genes. A more stringent threshold (P=6.0×10?6) at FDR=1% detected cis-meQTLs for 27043 CpG probes mapping to 8479 genes. Moreover with a 200kb window (100kb from both sides) instead than 1Mb we detected 40650 cis-meQTLs (P=2.0×10?4) controlling for FDR=5%. The methylation distribution in CpG sites detected with meQTLs differed substantially from those without meQTLs (Supplementary Fig. 1ab). The peak SNPs were equally distributed on either side of the target CpG-sites with a median distance (?) of 11.8 kb. The proportion of explained phenotypic variance (h2) ranged from 7.7% to 79.8% (Supplementary Fig. 1c) "

Lung_Cancer

"n methylene blue (0.6 vs 1.0 cm P<0.001). MLM showed superior staining ability over methylene blue (2.8 vs 2.2 P=0.010). Excellent staining was achieved in 17 subjects (81%) with MLM and 8 (38%) with methylene blue (P=0.011). An acceptable or excellent radio-opacity of MLM was found in 13 subjects (62%). An appropriate localization rate of MLM was 100% with the use of the directly visible ability and radio-opacity of MLM. MLM provides a superior pulmonary localization ability over methylene blue. Lung Ethiodized Oil Methylene Blue Tomography X-Ray Computed Radiology Interventional Seoul National University College of Medicine 800-20120036 INTRODUCTION Preoperative localization is necessary for video-assisted thoracoscopic surgery (VATS) when pulmonary nodules are too small or distant from the visceral pleura to be detected (1-3). A failure to localize nodules disturbs the success of the thoracoscopic resection and leads to conversion to thoracotomy (4 5). There are two kinds of localizing procedures: marking with thoracoscopically directly visible materials and marking with radio-opaque materials. Examples of directly visible materials are hook wire methylene blue and indocyanine green. Ethiodized oil (lipiodol) barium and iodine contrast agents are used for radio-opaque markers. Each marking method has strong and weak points. Localization with a hook wire is easy to perform but carries a high risk of pneumothorax and a propensity to dislodge during transport and surgical preparation (6 7). Methylene blue and indigo carmine have a tendency to diffuse over a large area by the time the operation is done and render localization features inadequate (8 9). The use of a radio-opaque marker (such as barium or lipiodol) requires an intraoperative fluoroscopy to confirm an adequate excision as well as lead to increased radiation exposure (10-13). The use of mixture has been reported to make up for the weakness of marking materials. For example the problem of dye diffusion has led to attempts to use a mixture of dye with various materials such as cyanoacrylate adhesive or collagen or autologous blood (14-16). However they have not been widely used for localization due to difficulties in making and manipulation. Lipiodol and methylene blue are commonly used materials for localization (17-20). We hypothesized that lipiodol reduces the spread of methylene blue and provides additional localization opportunities by its radio-opacity. The use of a mixture of lipidol and methylene blue (MLM) for a percutaneous injection material requires a high success rate for appropriate localization and a low complication rate. To our knowledge there have been no reports that evaluate the availability of MLM as a percutaneous injection material in human lungs. This study compared MLM with methylene blue as a percutaneous injection material for pulmonary localization in rabbit lungs. MATERIALS AND METHODS Animal preparation This study was performed after approval by the Institutional Animal Care and Use Committee (IACUC) in Seoul National University Hospital biomedical research institute (IACUC approval No. 11-0356). Twenty-four adult New Zealand White rabbits were used. We recorded their weight before the procedures. The animals were randomly divided into two groups: Group A (n=12) and Group B (n=12) each sacrificed at about 6 hr and 24 hr after percutaneous injections respectively (Fig. 1). Six hours after percutaneous injections were same day operations of the preoperative localization; and 24 hr after percutaneous injections were next day operations of the preoperative localization. The injection of each material was done in all 24 subjects because we injected methylene blue and MLM at two different lung sites for each subject. Percutaneous injection materials: mixture of lipiodol and methylene blue versus methylene blue A pilot study was performed to decide the optimal amount of materials for percutaneous injections. Methylene blue (1% 100 mg/mL TERA Pharmaceuticals Buena Park CA USA) of 0.3 to 0.9 mL was used for human lung localization in previous studies by Wicky et al. (18) and Vandoni et al. (19). In the pilot study with rabbit lungs we injected 0.1 mL and 0.05 mL of methylene blue and MLM in four subjects. We found that staining was extensive (more than half height of one lobe) with 0.1 mL and localized (about 1 cm of staining diameter) with 0.05 mL for both methylene blue and MLM. Extensive dispersion made it difficult to find exact injecting sites; subsequently 0.05 mL of methylene blue was administered. We made variable mix ratios of lipiodol and methylene blue in vitro; 1:1 1:2 1:3 1:4 and 1:5 in order to find an appropriate mixing ratio of lipiodol (480 mg Iodine/mL Andre Guerbet Aulnay-sous-Bois France) and methylene blue. The separation of two materials occurred instantly after mechanical blending to the fat-soluble character of lipiodol and the water-soluble character of methylene blue. A higher concentration of lipiodol in MLM resulted in increased uneven blending and rapid separation. A mixture with a 1:6 (or lower) mixing ratio contained a minimal amount of lipiodol and it might make it difficult to be detected on the fluoroscopy; subsequently we decided that 1:5 was an appropriate mixing ratio for injection. A total of 0.06 mL of MLM (0.01 mL of lipiodol plus 0.05 mL of methylene blue) was administrated in each subject to avoid the effect of different volumes of methylene blue to the diffusion extent of the materials. CT guided percutaneous injections Percutaneous injection was performed with computed tomography (CT) guidance (Discovery CT750 HD; GE Healthcare Waukesha WI USA). We performed pre-procedural CT scans in order to determine an appropriate skin entry site for the successful placement of a needle in the desired location. The desired location was the basal portion of both caudal lobes around the mid-scapula line. We tried to situate the needle tip at 5 mm depth from the visceral pleura and avoid passing through the pulmonary vessels. We placed the needle of 20 gauze and 3.5 cm length in the lung parenchyma after marking the appropriate skin entry site. The parameters of CT used in our study were: tube voltage of 120 kV tube current of 25 mA slice thickness of 2 mm thickness and gantry rotation speed of 350 milliseconds. We connected 1 mL syringe to the needle hub and retracted the syringe piston to confirm that no blood was aspirated after the needle tip was accurately located within the desired location. We then injected the materials and immediately removed the needle. On the procedural CT scan we measured the distance from the skin-entry to the needle tip and the depth from visceral pleura to the needle tip. A post-procedural CT scan identified procedure-related complications that included the leakage of injecting materials and pneumothorax; in addition we recorded the extent shape and density of radio-opacity of MLM after injection. The extent of MLM was defined as a maximum diameter of the radio-opacities. The shape of radio-opacity was categorized into 3 groups (small faint nodular scattered nodular and discrete compact nodular). We recorded the injection time to measure the time interval between injection and sacrifice. Fluoroscopic examinations A successful localization of lipiodol was determined by fluoroscopic examination; subsequently we evaluated the radio-opacity of MLM using the fluoroscopy X-ray unit (BV Pulsera; Philips Medical Systems Best The Netherlands) at the immediate post-procedure session and the follow up session at 6 hr in Group A and 24 hr in Group B. The parameters of fluoroscopy were: tube voltage of 59 kV and tube current of 946 mA. We obtained anteroposterior fluoroscopic images of the thorax of the rabbit with a 17 cm of field of view. A radio-opaque ruler of 5 cm was located near the rabbit in order to estimate the exact size of lipiodol opacity. We recorded the time of the fluoroscopic examinations and the radiographic findings of MLM (size and shape of the radio-opacity). Evaluation of the staining and radio-opacity We assessed the directly visible staining on the freshly excised lung surface and radio-opacity of MLM on the fluoroscopic examinations using 4-point scoring in order to compare the localization ability of MLM and methylene blue as a percutaneous injection material. A blind reviewer who was unaware of the injection materials assessed the staining ability. In order to evaluate the staining ability the blind reader reviewed the photographic images of the freshly excised lung specimens obtained before formalin fixations and rated the staining by 4-point scores: 0=non-visualization of staining 1=inappropriate; extensive dispersion made it difficult to find accurate injecting locations 2=acceptable; available to estimate injecting locations in spite of the dispersion and 3=excellent definitely localized staining (Fig. 2). The maximum diameter of the staining extent on the lung surface was measured. We calculated and compared scores and extent of staining between two materials. For the fluoroscopic findings the radio-opacity of MLM was evaluated using 4-point scoring: 0=no detectable radio-opacity 1=inappropriate minimally increased opacity 2=acceptable low density of increased opacity 3=excellent compact nodular increased opacity (Fig. 3). We compared the average scores of initial and follow up fluoroscopic examinations. We considered a score of 0 or 1 as inappropriate and a score of 2 or 3 as appropriate for localization for both staining and radio-opacity. We compared the number of appropriate or excellent localization between MLM and methylene blue. Sacrifice and histopathologic examinations Both freshly excised entire lungs were used as final specimens. The lung tissues were fixed in 10% neutral formalin embedded in paraffin and cut into 5 µm thick slices after we took photographs to record staining on the lung surface. We made 4 axial slices that covered the center of the staining. The slices were subjected to hematoxylin-eosin (H-E) stain to the evaluate lung parenchymal change. We evaluated the presence or absence of neutrophil infiltration vasculitis necrosis hemorrhage and foam cell in alveolus. The extent of each histopathologic finding was estimated using visual grading scores as 0 (no) 1 (focal) or 2 (diffuse). Localized parenchymal change (<50% of total area) surrounded by normal lung was defined as focal. Extensive lung parenchymal change (?50% of total area) that replaced normal lung was defined as diffuse. An experienced pathologist with eight years of experience reviewed all slices. The overall severity of the lung parenchymal change was defined as a total score by adding visual grading scores for each histopathologic finding. We compared the overall severity score between MLM and methylene blue as well as between Group A and Group B. Statistical analysis All data are expressed as mean±standard deviation (SD) unless otherwise stated. Comparisons of the average scores were performed by two-tailed unpaired Student's t-test or Mann-Whitney test. We used a Fisher's exact test to compare the number of subjects in the subgroups. Linear by linear association evaluated the association of the extent of lung parenchymal change and materials or groups. Null hypotheses of no difference were rejected if the P values were less than 0.05. The statistical analysis was performed with commercially available statistical software IBM SPSS Statistics version 20.0 (IBM Corp. in Armonk NY USA). RESULTS Subject characteristics procedural records time interval of injection and examinations Among the 24 subjects included in our study successful CT-guided percutaneous injections into the desired location of the lung were achieved in 21 subjects (11 in Group A and 10 in Group B). Three subjects died during anesthesia. Mean weight was 3.2±0.2 kg for Group A and 3.3±0.2 kg for Group B. Injection depth from visceral pleura to needle tip was 0.4±0.1 cm (range: 0.3-0.6 cm) for MLM and 0.4±0.1 cm (range: 0.3-0.7 cm) for methylene blue (P=0.43). Distance from skin to needle tip was 2.8±0.6 cm (range: 2.1-5.0 cm) for MLM and 2.8±0.3 cm (range: 2.2-3.5 cm) for methylene blue (P=0.83). Of 42 CT-guided percutaneous injections total number of procedure related complications was 10 (24%) including 7 leakage (all in MLM) and 3 pneumothorax (2 in MLM 1 in methylene blue). The complication rate in MLM was significantly higher than methylene blue (43% vs 5%) (P=0.004). On post-procedural CT images the extent of the radio-opacity of MLM was 1.3±0.4 cm (range: 0.7-2.0 cm) for Group A and 0.6±0.3 cm (range: 0.3-1.1 cm) for Group B. Discrete compact nodular opacity was achieved in 15 subjects (72%) scattered nodular opacities in 3 (14%) and small faint opacity in 3 (14%) (Fig. 4). The average value of radio-opacity of MLM was 1415±856 HU (range: 307-2768 HU). The interval between injection and sacrifice was 7.9±0.1 hr (range: 7.8-8.0 hr) for Group A and 23.5±0.1 hr (range: 23.4-23.7 hr) for Group B. Time from injection to initial and follow up fluoroscopy was 3.4±0.5 hr (range: 2.5-4.2 hr) and 6.8±0.4 hr (range: 6.3-7.7 hr) for Group A and 1.5±0.4 hr (range: 0.9-2.1 hr) and 22.6±0.4 hr (range: 21.9-23.2 hr) for Group B respectively. Scores and extent of staining and radio-opacity Table 1 demonstrates the staining extent and localization ability of MLM and methylene blue. In total groups the staining extent of MLM was significant smaller than methylene blue (0.6 cm vs 1.0 cm P<0.001). MLM showed a significantly higher staining ability score than methylene blue (2.8 vs 2.2 P=0.010). Radio-opacity in the initial fluoroscopy was not significantly different from the follow up (2.0 vs 1.9 P=0.49). Table 2 showed the number of subjects in each score of localization ability of staining or radio-opacity. In Group A appropriate staining was 100% for both MLM and methylene blue. In Group B appropriate staining was 90% for MLM and 70% for methylene blue. Appropriate staining of MLM was not significantly different from that of methylene blue (95% vs 86% P=0.61); however excellent staining in MLM was significantly higher than methylene blue (81% vs 38% P=0.011) (Table 3). Table 4 shows the localization ability of MLM regarding both staining ability and radio-opacity. There was no subject with a score of 0 or 1 in both radio-opacity and staining. MLM achieved appropriate staining or radio-opacity in 21 subjects (100%) with a dual localization feature. Histopathologic findings Table 5 demonstrates the results of the histopathologic findings. In all lung specimens both methylene blue and MLM showed acute lung parenchymal change that included neutrophil infiltration hemorrhage and foam cell in alveolus (Fig. 4). Comparing the two materials the number of specimen having neutrophil infiltration vasculitis necrosis hemorrhage and foam cell in alveolus was similar in each extent. In terms of all features the number of specimen that showed diffuse extent was more in Group B than Group A for both MLM and methylene blue. The extent of the histopathologic findings was not significantly associated with the materials for all histopathologic features (Table 5). Among the histopathologic findings the extent of vasculitis was significantly associated with Group for both MLM and methylene blue (P=0.002 for both MLM and methylene blue). Focal or diffuse extent of vasculitis was more frequently found in Group A than Group B (P=0.001 for both MLM and methylene blue). The overall severity of lung parenchymal change was not different between MLM and methylene blue (5.6±1.6 vs 5.7±1.5 P=0.839); in addition Group B showed a significantly higher overall severity score of lung parenchymal change than Group A (6.6±1.6 vs 4.7±0.9 P=0.005). DISCUSSION The results of this study show that MLM is a useful percutaneous injection material for a successful localization in the lung. The average staining score of MLM was significantly higher than methylene blue (2.8±0.5 vs 2.2±0.7 P=0.010). In terms of staining the appropriate localization rate (acceptable or excellent staining) in our study was 95% using MLM. The result was in close agreement with previous studies that showed a high success performance rate of lipiodol localization (99%-100%) (21-23). An appropriate localization rate (acceptable or excellent staining) of methylene blue injection was 86% in our study. This is lower than the results found in previous studies where the success rate of methylene blue injection was 96%-100% (18 20). We found that an acceptable (or excellent staining rate) of MLM and methylene blue was not significantly different (95% vs 86% P=0.610). However MLM showed excellent staining for localization in 17 (81%) of 21 subjects and was significantly higher than methylene blue (38%) (P=0.011). The results indicate that lipiodol reduced the spread of methylene blue. This is the first study to indicate that MLM is an available percutaneous injection material for localization with superior staining ability compared to methylene blue. The complication rate was 43% in MLM and 5% in the methylene blue (P=0.004). Possible complications after percutaneous injection for pulmonary localization include pneumothorax leakage hemorrhage pain hemoptysis hemothorax and embolism. Previous studies reported that the complication rate was 17-29% for lipiodol and 33% for methylene blue (2023 24). The complication rate of MLM in the current study was higher than the results of previous studies mainly due to the leakage of MLM into the pleural cavity (n=9). This difference was probably because the distance from the pleura to the injecting needle tip (0.4±0.1 cm for MLM) was inadequate to avoid leakage into the pleural cavity. In the previous studies of lipiodol marking for localization the mean distance from the pleura to the target nodule was 1.0-1.9 cm (22-24) more than twice our study. The results indicate that the high complication rate of our study is associated with the inserting procedure of the needle rather than MLM itself. The dispersion of methylene blue throughout the lung parenchyma may lead to unnecessarily large wedge resections; in addition some have reported instances of the dispersion of methylene blue throughout the entire pleural surface or intraoperative identification failure due to severe anthracosis of the visceral pleura. The failure rate was reported to be 0%-13% with the use of methylene blue (1819 25). The results are similar to our study and indicate that inappropriate staining on the lung surface was 14% in methylene blue. In this study we found that the dispersion of methylene blue in MLM through the lung parenchyma was significantly smaller than methylene blue (0.6±0.3 cm vs 1.0±0.4 cm P<0.05). The result implies that lipiodol reduces the spread of methylene blue in lung parenchyma. Regarding the score of radio-opacity 38% of MLM showed non-visualization or minimally increased opacity on the fluoroscopic examinations. It means the proportion of lipiodol in MLM at the time of the percutaneous injection was too small to be detected. Post-procedural CT images also revealed that 3 subjects had small faint radio-opacity after the injection of MLM. It suggests that the uneven blending of lipiodol and methylene blue occurred during the preparation of MLM. Water-insolubility of lipiodol would result in the uneven mixing of water soluble methylene blue after mechanical blending of the two materials. Further research is required to reduce non-homogeneity of MLM at the time of injection. Previous studies reported the availability of a mixture of methylene blue with other materials such as collagen or autologous blood (15 16). They performed VATS resection on the same day as localization. In our study we evaluated the localization ability of MLM on the same day of localization (6 hr) as well as 24 hr after injection. Localization is usually performed on the day of surgery. This requires the simultaneous use of the CT and the operating room which is not always available. Surgeries on the next day of localization were reported in several published articles (26 27). MLM shows a prolonged localization ability of up to 24 hr in terms of staining ability and radio-opacity. Stable localization ability is the advantage of MLM in our study. Due to uneven blending of MLM one subject (10%) showed inappropriate staining and appropriate radio-opacity and required an intraoperative fluoroscopic examination to detect MLM. Possible radiation exposure is a drawback of MLM. We would like to justify the use of intraoperative fluoroscopy because the operator can avoid radiation exposure with a lead apron. In regards to the risk-benefit for patients lowering the risk of detection failure is thought to be more important than radiation exposure. Histopathologic examinations showed lung parenchymal changes in all specimens. Both methylene blue and MLM induced acute lung injury that included neutrophil infiltration vasculitis necrosis hemorrhage and foam cell in alveolus (Table 5). The results of our study are similar to those of a previous study by Kwon et al. (28) that showed that lipiodol led to acute lung injury. They described that lipiodol creates the histopathologic feature of acute lung injury such as peripheral endothelial cell damage neutrophil infiltration necrosis hemorrhage alveolar wall destruction vasculitis emboli (or thrombi in arteriole) and macrophages in the alveolar space (28). In our results the extent of lung parenchymal change was not associated with the materials for all histopathologic features. In addition the overall severity score of lung parenchymal change in MLM was not different from methylene blue (5.6 and 5.7 P=0.839). This suggests that MLM shows similar histopathologic effects in the lung parenchyma to methylene blue. The overall severity score of parenchymal change was higher in Group B (follow up interval of 24 hr) than Group A (follow up interval of 6 hr) (6.6 vs 4.7 P=0.005). The extent of lung parenchymal change depends on the time interval. Acute lung injury after the percutaneous injection of lipiodol or methylene blue was reported in animal studies (28 29); however there are no clinical results that show the adverse effect of acute lung injury in human lungs. Injection material (such as barium) can potentially complicate the pathologic diagnosis of the target lesion due to acute inflammation (29 30). To our knowledge no study has indicated that lipiodol or methylene blue hinders the histopathologic diagnosis of target lesions in human lungs. The small amount of material injection in human lungs might not create a significant parenchymal change or disrupt underlying lung disease. It is necessary to avoid directly injecting materials into the target lesion in human lungs in order to avoid the adverse effect of injection materials on underlying lung disease (especially ground glass opacity nodule or potential benign lesion). There were several limitations in our study. First we included only a small number of subjects. Second the overall localization success rate was low and the complication rate was high (compared to the results of previous studies) due to the difficulty in an accurate percutaneous injection at the desired location and depth in the small sized rabbit lung. Third we used a 1 mL syringe with manual administration to inject materials in the lung parenchyma and there were possible individual difference in the administering volume of materials. Fourth we could not evaluate complications such as intractable pain material related anaphylaxis or embolism. Fifth we could not evaluate if the histopathologic changes had any effect on underlying lung disease because the lung parenchyma of the experimental rabbits were normal. Finally we did not evaluate a successful localization for the true target lesion in lung parenchyma. The criteria for appropriate staining and radio-opacity were subjective. We expect that further clinical studies might provide an answer to if MLM can be a useful percutaneous injection material for localization in the human lung. In conclusion MLM is available for percutaneous injection for the pulmonary localization. The results of this study showed that MLM provides superior ability for appropriate localization than that of methylene blue. Further research on human lungs can clarify the availability of MLM as a CT guided percutaneous injection material. This study was supported by grant from the Seoul National University College of Medicine Research Fund 2012 (800-20120036). We have no potential conflicts of interest or commercial involvement to disclose. 1 Nakashima S Watanabe A Obama T Yamada G Takahashi H Higami T Need for preoperative computed tomography-guided localization in video-assisted thoracoscopic surgery pulmonary resections of metastatic pulmonary nodules Ann Thorac Surg 2010 89 212 218 20103238 2 Chen S Zhou J Zhang J Hu H Luo X Zhang Y Chen H Video-assisted thoracoscopic solitary pulmonary nodule resection after CT-guided hookwire localization: 43 cases report and literature review Surg Endosc 2011 25 1723 1729 21181200 3 Ciriaco P Negri G Puglisi A Nicoletti R Del Maschio A Zannini P Video-assisted thoracoscopic surgery for pulmonary nodules: rationale for preoperative computed tomography-guided hookwire localization Eur J Cardiothorac Surg 2004 25 429 433 15019673 4 Suzuki K Nagai K Yoshida J Ohmatsu H Takahashi K Nishimura M Nishiwaki Y Video-assisted thoracoscopic surgery for small indeterminate pulmonary nodules: indications for preoperative marking Chest 1999 115 563 568 10027460 5 Seo JM Lee HY Kim HK Choi YS Kim J Shim YM Lee KS Factors determining successful computed tomography-guided localization of lung nodules J Thorac Cardiovasc Surg 2012 143 809 814 22104686 6 Gossot D Miaux Y Guermazi A Celerier M Friga J The hook-wire technique for localization of pulmonary nodules during thoracoscopic resection Chest 1994 105 1467 1469 8181339 7 Pittet O Christodoulou M Pezzetta E Schmidt S Schnyder P Ris HB Video-assisted thoracoscopic"

Lung_Cancer

"Henry Ford Health System Detroit MI 48202 USA 7 2 2014 13 12 2013 6 1 2014 06 1 2015 59 1 173 188 The direct dose mapping (DDM) and energy/mass transfer mapping (EMT) are two essential algorithms for accumulating the dose from different anatomic phases to the reference phase when there is an motion or tumor/tissue deformation during the delivery of radiation therapy. DDM is based on interpolation of the dose values from one dose grid to another and thus lacks rigor in defining the dose when there are multiple dose values mapped to one dose voxel in the reference phase due to tissue/tumor deformation. On the other hand EMT counts the total energy and mass transferred to each voxel in the reference phase and calculates the dose by dividing the energy by mass. Therefore it is based on fundamentally sound physics principles. In this study we implemented the two algorithms and integrated them within the Eclipse TPS. We then compared the clinical dosimetric difference between the two algorithms for 10 lung cancer patients receiving stereotactic radiosurgery treatment by accumulating the delivered dose to the end-of-exhale (EE) phase. Specifically the respiratory period was divided into 10 phases and the dose to each phase was calculated and mapped to the EE phase and then accumulated. The displacement vector field (DVF) generated by Demons-based registration of the source and reference images was used to transfer the dose and energy. The DDM and EMT algorithms produced noticeably different cumulative dose in the regions with sharp mass density variations and/or high dose gradients. For the PTV and ITV minimum dose the difference was up to 11% and 4% respectively. This suggests that DDM might not be adequate for obtaining an accurate dose distribution of the cumulative plan instead EMT should be considered. BMC Genomics BMC Genomics BMC Genomics 1471-2164 BioMed Central London 24564564 4046697 5679 10.1186/1471-2164-15-S1-S6 Proceedings Concordant integrative gene set enrichment analysis of multiple large-scale two-sample expression data sets Lai Yinglei ylaigwu.edu Zhang Fanni fnzhanggwmail.gwu.edu Nayak Tapan K tapangwu.edu Modarres Reza rezagwu.edu Lee Norman H nhleegwu.edu McCaffrey Timothy A mccgwu.edu Department of Statistics The Gee Washington University 801 22nd St. NW. Rome Hall Room 553 Washington D.C 20052 USA Department of Pharmacology The Gee Washington University Medical Center Washington DC 20037 USA Department of Medicine Division of Genomic Medicine The Gee Washington University Medical Center Washington DC 20037 USA 24 1 2014 24 1 2014 2014 15 Suppl 1 S6 Lai et al.; licensee BioMed Central Ltd. 2014 This is published under license to BioMed Central Ltd. This is an Open Access distributed under the terms of the Creative Commons Attribution License (http://creativecommons./licenses/by/2.0) which permits unrestricted use distribution and reproduction in any medium provided the original work is properly cited. The Creative Commons Public Domain Dedication waiver (http://creativecommons./publicdomain/zero/1.0/) applies to the data made available in this unless otherwise stated. Background Gene set enrichment analysis (GSEA) is an important approach to the analysis of coordinate expression changes at a pathway level. Although many statistical and computational methods have been proposed for GSEA the issue of a concordant integrative GSEA of multiple expression data sets has not been well addressed. Among different related data sets collected for the same or similar study purposes it is important to identify pathways or gene sets with concordant enrichment. Methods We categorize the underlying true states of differential expression into three representative categories: no change positive change and negative change. Due to data noise what we observe from experiments may not indicate the underlying truth. Although these categories are not observed in practice they can be considered in a mixture model framework. Then we define the mathematical concept of concordant gene set enrichment and calculate its related probability based on a three-component multivariate normal mixture model. The related false discovery rate can be calculated and used to rank different gene sets. Results We used three published lung cancer microarray gene expression data sets to illustrate our proposed method. One analysis based on the first two data sets was conducted to compare our result with a previous published result based on a GSEA conducted separately for each individual data set. This comparison illustrates the advantage of our proposed concordant integrative gene set enrichment analysis. Then with a relatively new and larger pathway collection we used our method to conduct an integrative analysis of the first two data sets and also all three data sets. Both results showed that many gene sets could be identified with low false discovery rates. A consistency between both results was also observed. A further exploration based on the KEGG cancer pathway collection showed that a majority of these pathways could be identified by our proposed method. Conclusions This study illustrates that we can improve detection power and discovery consistency through a concordant integrative analysis of multiple large-scale two-sample gene expression data sets. issue-copyright-statement BioMed Central Ltd 2014 Background The recent large-scale technologies like microarrays [1“3] and RNA-seq [4 5] allow us to collect genome-wide expression profiles for biomedical studies. Genes showing significant differential expression are potentially important biomarkers [6]. Furthermore a gene set enrichment analysis enables us to identify groups of genes (e.g. pathways) showing coordinate differential expression [7 8]. For some disease studies multiple gene expression data sets have been collected and the related integrative analysis of multiple data sets has been investigated [9]. Since microarray and sequencing based genome-wide expression data sets have been increasingly collected it is necessary to further develop the computational and statistical methods for integrative data analysis studies. Genes and gene sets showing consistent behavior among multiple related studies can be of great biological interest. However since the sample sizes are usually small but the numbers of genes are large it is difficult to identify truly differentially expressed genes and determine whether a gene or a gene set behaves concordantly among different related studies. Although the integrative analysis of multiple gene expression data sets has been well studied in recent years [10 11] the genome-wide concordance has not been well considered. Misleading results may be generated if the concordance among different data sets is not considered in an integrative analysis. Our purpose is to identify pathways or gene sets with concordant enrichment. Recently there are several methods published for meta gene set enrichment analysis of expression data [12 13]. However these methods have not been specifically developed for our study purpose. Statistically we need analysis methods that are consistent with the study purpose. There is still a lack of methods and software for the concordant integrative gene set enrichment analysis. For a gene set enrichment analysis an enriched gene set in one data set may also be enriched in another data set. However this gene set is not necessarily concordantly enriched in both data sets. For an illustration let us consider a simple artificial example: gene set S contains five genes with the first three genes strongly up-regulated in the first data set (the last two genes non-differentially expressed) and the last three genes strongly up-regulated in the second data set (the first two genes non-differentially expressed). Then in general gene set S is enriched in up-regulated differential expression in both data sets. However there is only one gene up-regulated in both data sets; the remaining genes are showing inconsistent behavior. Therefore unless the proportions of differentially expressed genes are small there is a lack of evidence to conclude that gene set S is concordantly enriched in both data sets. Since a gene set concordantly enriched in several similar studies may be of great importance it is necessary to develop statistical methods for detecting these gene sets. It has been shown that a mixture model based approach can be an efficient approach to the differential expression analysis [14]. Furthermore Lung_Cancer we have also demonstrated the usefulness of mixture models in concordant analysis of differential expression among large-scale expression data sets [15 16]. The advantage of the mixture model based approach is that the probability of a particular behavior (up-regulated or down-regulated) can be modeled and estimated for a given gene. Thus it is feasible to address how likely this gene shows a concordant behavior. In this study we develop a mixture model based method for a concordant integrative gene set enrichment analysis. Methods Concordant gene set enrichment In this study we consider multiple large-scale two-sample gene expression data sets. We use K to denote the number of these data sets and m to denote the number of common genes in these data sets. For each of these data sets we usually use a t-type test to evaluate the differential expression of each gene and a gene set enrichment analysis (GSEA) method to evaluate the enrichment level of a given gene set. In order to define and evaluate a concordant gene set enrichment when an integrative analysis is conducted for all K data sets we categorize differential expression in each data set into three underlying (unobserved) representative categories: no change positive change (or up-regulated differential expression) and negative change (or down-regulated differential expression). Due to data noise what we observe from experiments may not indicate the underlying truth. (For example a gene with slight down-regulated differential expression may show a small positive t-type test value.) Although these categories are not observed in practice they can be considered in a mixture model framework. To understand the concept of concordant gene set enrichment let us consider an artificial example. Given a pathway with 30 genes we know all the underlying behavior of these genes: 20 genes have positive changes consistently among all different data sets. Furthermore if we randomly select 30 genes we also know that the expected number of genes with consistent positive changes among different data sets is just 5. In this case we would conclude that the given gene set is concordantly enriched in up-regulated differential expression (because 30 is clearly larger than 5). However in practice all the underlying differential expression categories are not observed. Instead they can be considered in a mixture model framework. Then we need to develop a mathematical formula for the probability of concordant enrichment score (CES) of a given gene set S that contains mS genes: which can be useful for prioritizing different gene sets in practice. Before we derive the mathematical formula for the above probability we need to explain the term ""enriched"". As suggested by Efron and Tibshirani [17] unless the test statistic for a gene set enrichment analysis (GSEA) considers the genome-wide background patterns (e.g. the statistics proposed in the original GSEA [7 8]) it is necessary to consider the ""row randomization"" for genes in addition to the ""column permutation"" for samples. Therefore the term ""enriched"" means ""higher/better than expected"". Although many test statistics have been developed for GSEA with one large-scale expression data set we still need to develop a new approach for this study. The motivation is: we need to address the component information of the genes in a gene set. The component information is whether a gene is up-regulated down-regulated or non-differentially expressed. Most existing test statistics for the gene set enrichment analysis are either nonparametric or functions of z-score. But it is difficult to analyze the component information with these test statistics. Therefore based on the above discussion for the term ""enriched"" we propose the following probability for measuring concordant gene set enrichment: For a gene in a given gene set S an event of interest can be: (1) the gene is concordantly up-regulated; (2) the gene is concordantly down-regulated; or (3) the gene is concordantly differentially expressed (either up-regulated or down-regulated). Our analysis methods for these different types of enrichment analysis are almost mathematically identical. For a mathematical notation of the above CES we denote Ui the indicator that the i-th gene in gene set S satisfies the event of interest. Let D be the observed data and ? be the probability of event of interest if the gene is randomly sampled. Then we have In order to calculate CES practically we propose a three-component multivariate mixture model. In the model each component is a normal distribution. The model configuration for these three components is consistent with the differential expression categories as described above. This model is conceptually analog to a simple normal mixture approach to differential expression analysis proposed by McLachlan et al. [14]. The special feature of our model is that we focus on some specific combination of components from different dimensions. A bivariate version of this model has been used by us to evaluate the concordance and discordance between two large-scale experiments with two sample groups [15] and to integrate two microarray data sets in differential expression analysis [16]. Before the model description we need to describe the related data preprocessing and differential expression test scores as follows. Data preprocessing Because our proposed statistical method is developed based on the differential expression test scores we assume that the given gene expression data sets have been preprocessed appropriately [18]. For a concordant integrative analysis of multiple data sets we also need to select genes shared commonly by different data sets. This can be achieved using the genes' unique identifiers. Differential expression test scores For each of the two-sample gene expression data sets we screen individual genes with the traditional two-sample Student's t-test. Several modified t-tests such as SAM t-test [19] and the moderated t-test [20] have been widely used in the differential expression analysis of microarray data. These test statistics can generally improve the control of false positives by ""softly"" filtering out genes with relatively small expression variance. However we intend to consider all the genes equally important in the concordant integrative analysis of multiple data sets. Furthermore a given gene can show different levels of variance in different data sets which may make it difficult to use these modified t-tests. Therefore we still recommend the traditional two-sample t-test as the differential expression test statistic. (In practice other test statistics like SAM t-test or the moderated t-test can still be considered when there is a strong reason to do so.) Because the sample size of a high-throughput study is usually not large it is generally difficult to validate the normal distribution assumptions for the t-test. Therefore instead of the theoretical t-distribution we use the permutation procedure to compute the p-value of an observed t-test [21]. This approach has been widely adopted in the analysis of gene expression data [6]. For K two-sample gene expression data sets with m common genes we compute the one-sided upper-tailed p-value pik for gene Xi in the k-th data set i = 12 . . . m and k = 12 . . . K. Then we perform an inverse normal transformation to obtain a z-score: zik = ?-1(1 - pik) where ?(·) is the cumulative distribution function (c.d.f.) of the standard normal distribution. This transformation has been widely used to improve the fitting of a mixture model [14]. Our proposed statistical methods for the concordant integrative analyses of multiple data sets are developed based on these sets of z-scores. A mixture model For each individual data set we assume that a mixture of three normal distributions can well fit the z-scores. Let denote the probability density function (p.d.f.) of a normal distribution with mean µ and variance ?2. Three representative components are considered for the k-th data set (k = 12 . . . K): for genes non-differentially expressed (no change) for genes with up-regulated differential expression (positive change) and for genes with down-regulated differential expression (negative change). Notice that µ0k= 0 and (a z-score under the null hypothesis follows the standard normal distribution because its associated p-value follows a standard uniform distribution). This configuration has been suggested in the analysis of gene expression data [14] although more components can be considered to improve the data fitting. Mathematically we have the following density function: which is a type of well-known simple normal mixture model. When the above simple model is extended to accommodate the analysis of multiple data sets we need to consider the combination of components from different dimensions (data sets). Then there are 3K different combinations. We assume that different data sets are collected independently. For the i-th gene with a list of z-scores from different data sets if we know all the related component information then the join density of these z-scores is the product of marginal densities of individual z-scores. Therefore the following formula defines our basic mixture model for a concordant analysis:1 where is the probability for this gene being in a particular combination of different components (j1 j2 . . . jK) in different data sets . We call this model a partial concordance/discordance (PCD) model. Notice that a bivariate version of this model has been used to evaluate the overall concordance or discordance of two large-scale data sets and to conduct an integrative analysis of differential expression for two large-scale two-sample data sets [15 16]. Model estimation Our mixture model can be estimated by the well-developed E-M algorithm [22]. In the model the differential expression categories are considered as missing information. For any z-score vector (zi1 zi2 . . . ziK) i = 12 . . . m this information can be mathematically represented as if each zik is sampled from the jk-th component (jk = 0 1 or 2 and k = 12 . . . K) or zero otherwise. With only the observed data the likelihood can be calculated by the following formula: where ? represents the parameter space described previously. The ""complete likelihood"" based on the observed data and missing information can be calculated by the following formula: Then we can derive the following E-step formula: We can also derive the following M-step formulas: In the E-M algorithm we iterate E-step and M-step until a numerical convergence of likelihood (not the ""complete likelihood""). Let L(t) and L(t+1) be the likelihood values calculated after the t-th and (t + 1)-th iterations respectively. A numerical convergence is claimed if |L(t+1) ? L(t)| < 0.001. Concordant enrichment score Suppose that we are interested in gene sets with coordinate up-regulated differential expression (the CES formulas for the other events of interest can be derived similarly). Then we need to focus on the combination of different components with (j1 = 1 j2 = 1 . . . jK = 1). Based on the mixture model we can derive the following probability for a gene XSi in a given gene set S = {XSi : i = 12 . . . mS}: This probability uSi can be estimated as by plugging-in the estimated parameters in the PCD model. Let hSi be either 0 or 1. Under the assumption that z-scores {zik : i = 12 . . . m} from different genes are independent in each data set k k = 12 . . . K we can calculate the concordant enrichment score (CES) for a gene set S = {XSi : i = 12 . . . mS}:2 which is the PCD model based estimate for the probability Pr(gene set S is concordantly enriched | observed z-score matrix of gene set S). In the formula I(true statement) = 1 and I(false statement) = 0 (indicator function). Notice that the formula can be simplified to a well-known binomial tail probability if all are the same. However are usually different in practice."

Lung_Cancer

" discrete and compact nodular opacity (arrowheads) (B) focal neutrophil infiltration necrosis and hemorrhage (arrowheads) (H&E —12.5) (C) scattered small nodular opacities of lipiodol (long arrows) and faint nodular opacity (arrowheads) (D) focal hemorrhage and necrosis (arrowheads) with diffuse neutrophil infiltration (short arrows) (H&E —12.5). MLM in Group A (E F); (E) faint nodular lipiodol opacity (arrows) (F) focal hemorrhage (arrows) with diffuse neutrophil infiltration (arrowheads) (H&E —12.5). Methylene blue in Group A (G H); (G) faint nodular opacity (arrowheads) and (H) focal extent of neutrophil infiltration necrosis and hemorrhage (arrowheads) (H&E —12.5). Staining extent and localization ability of MLM versus methylene blue Data are mean±standard deviation. Numbers in parentheses are ranges. N/A indicates not available. *Non-parametric Mann-Whitney test was performed to compare the average score of MLM and methylene blue. MLM mixture of lipiodol and methylene blue. Localization ability score of staining and radio-opacity for MLM as well as methylene blue Data are numbers of subjects. Numbers in parentheses are percentages. MLM mixture of lipiodol and methylene blue. Comparison of localization ability between MLM and methylene blue in total subjects (n = 42) We considered a score of 2 or 3 as appropriate and 3 as excellent for localization respectively. Numbers in parentheses are percentages. *Fisher's exact test compared the proportion of appropriate or excellent staining between the mixture and methylene blue. MLM mixture of lipiodol and methylene blue. Localization ability of MLM: Evaluation of radio-opacity and staining score Data are given as numbers of subjects. Numbers in parentheses are percentages. MLM mixture of lipiodol and methylene blue. Histopathologic findings of lung specimens after percutaneous injections Data are numbers of subjects. Numbers in parentheses are percentages. N/A indicates not available. *Linear by linear association was performed between material and the extent of the histopathologic findings.  Linear by linear association was performed between groups and the extent of the histopathologic findings. MLM mixture of lipiodol and methylene blue. PLoS One one 1932-6203 Public Library of Science San Francisco USA 24819391 4018408 PONE-D-13-46027 .0096911 Research Biology and Life Sciences Biochemistry Biomarkers Genetics Heredity Medicine and Health Sciences Diagnostic Medicine Epidemiology Biomarker Epidemiology Cancer Epidemiology Health Care Environmental Health Oncology Cancer Risk Factors Environmental Causes of Cancer Pathology and Laboratory Medicine Public and Occupational Health Pulmonology Environmental and Occupational Lung Diseases Single Nucleotide Polymorphism in ATM Gene Cooking Oil Fumes and Lung Adenocarcinoma Susceptibility in Chinese Female Non-Smokers: A Case-Control Study ATM Polymorphism and Risk of Lung Adenocarcinoma Shen Li 1 2 Yin Zhihua 1 2 Wu Wei 1 2 Ren Yangwu 1 2 Li Xuelian 1 2 Zhou Baosen 1 2 * 1 Department of Epidemiology School of Public Health China Medical University Heping District Shenyang Liaoning Province China 2 Key Laboratory of Cancer Etiology and Intervention University of Liaoning Province China Chang Jeffrey S. Editor National Health Research Institutes Taiwan * E-mail: bszhoumail.cmu.edu.cn Competing Interests: The authors have declared that no competing interests exist. Conceived and designed the experiments: LS. Performed the experiments: LS YR XL. Analyzed the data: LS WW ZY. Contributed reagents/materials/analysis tools: LS ZY XL BZ. Wrote the paper: LS. Obtained informed consent from subjects: Baosen Zhou. 2014 12 5 2014 9 5 e96911 3 11 2013 12 4 2014 2014 Shen et al This is an open-access distributed under the terms of the Creative Commons Attribution License which permits unrestricted use distribution and reproduction in any medium provided the original author and source are credited. Background The ataxia-telangiectasia mutated (ATM) gene plays an important role in the DNA double-strand breaks repair pathway. Single nucleotide polymorphisms (SNPs) of DNA repair genes are suspected to influence the risk of lung cancer. This study aimed to investigate the association between the ATM -111G>A (rs189037) polymorphism environmental risk factors and the risk of lung adenocarcinoma in Chinese female non-smokers. Methods A hospital-based case-control study of 487 lung cancer patients and 516 matched cancer-free controls was conducted. Information concerning demographic and environmental risk factors was obtained for each case and control by a trained interviewer. After informed consent was obtained 10 ml venous blood was collected from each subject for biomarker testing. Single nucleotide polymorphism was determined by using TaqMan method. Results This study showed that the individuals with ATM rs189037 AA genotype were at an increased risk for lung adenocarcinoma compared with those carrying the GA or GG genotype (adjusted odds ratios (OR) 1.44 95% confidence interval (CI) 1.02“2.02 P?=?0.039). The stratified analysis suggested that increased risk associated with ATM rs189037 AA genotype in individuals who never or seldom were exposed to cooking oil fumes (adjusted OR 1.89 95%CI 1.03“3.49 P?=?0.040). Conclusions ATM rs189037 might be associated with the risk of lung adenocarcinoma in Chinese non-smoking females. Furthermore ATM rs189037 AA genotype might be a risk factor of lung adenocarcinoma among female non-smokers without cooking oil fume exposure. This study was supported by grant no. 81272293 from National Natural Science Foundation of China grant no. 81102194 from National Natural Science Foundation of China and grant no. 00726 from China Medical Board. The funders had no role in study design data collection and analysis decision to publish or preparation of the manuscript. Introduction Lung cancer is the leading cause of cancer-related deaths both worldwide and in China. Although cigarette smoke is the major risk factor for lung cancer only a fraction of smokers develop this disease [1] suggesting that host genetic susceptibility may play an important role in the development of lung cancer. Recent genetic susceptibility studies of lung cancer have focused on single nucleotide polymorphisms (SNPs) in candidate genes among which DNA repair genes are increasingly studied because of their critical role in maintain genome integrity. Genetic variations in DNA repair genes are thought to affect DNA repair capacity and deficits in DNA repair capacity may lead to genetic instability and carcinogenesis [2] [3]. As one of the DNA repair genes ataxia-telangiectasia mutated (ATM) gene which is responsible for the multisystem autoxomal recessive disorder ataxia-telangiectasia (A“T) plays a crucial role in the recognition signaling and repair of DNA damage especially DNA double-strand breaks (DSBs) [4] [5]. The ATM protein is a member of phosphoinositide 3-kinase (PI-3 kinases) and can be activated by DSBs caused by ionizing radiation or reactive oxygen intermediates [6] [7]. Once activated ATM can phosphorylate various downstream substates that function in cell cycle arrest apoptosis and DNA repair such as p53 NBS1 BRCA1 and Chk2 [8] [9]. Therefore genetic variants in ATM gene may lead to the structure and function change of the protein and act as important factors indicating individual susceptibility to cancer. ATM -111G>A (rs189037) resides in the promoter of ATM gene. Increasing studies have shown that variations in the DNA promoter sequence may potentially alter the affinities of multiple regulatory proteins-DNA interactions or the specificity of the transcriptional process [10]“[13]. Although this polymorphism makes no amino acid change the alleles may have different binding affinity to the transcription factor and exhibit different levels of mRNA expression [14] [15]. Zhang et al. [16]declared that ATM rs189037 AA genotype was associated with a lower ATM mRNA levels than GG genotype in lung tissue samples. Their results showed that the G-to-A change might create a transcriptional inhibitor-binding site for ATM rs189037 A allele promoter and subsequently reduce the ATM mRNA expression. Consequently lower expression of ATM might cause elevated sensitivity to ionizing radiation defects in the activation of cell cycle checkpoints a reduced capacity for DNA repair and abnormal apoptosis. All of these features would contribute to increased individual cancer susceptibility. In recent years a number of studies have evaluated the association between this polymorphism and cancer risk such as thyroid carcinoma [17] oral cancer [18] breast cancer [19] leukemia [20] nasopharyngeal carcinoma [21] glioma [22] and lung caner [23]“[25]. Previous studies of ATM rs189037 have included cigarette smokers as cases and controls that made it difficult to judge whether this polymorphism were associated with lung cancer or tobacco use. Considering the facts in China the incidence and death rate of lung cancer in women continues to increase and this phenomenon is frequently occurring in those who have never smoked. In order to have a better control of confounding of gender or smoking we performed a case-control study to identify the association between the polymorphism of ATM rs189037 and the risk of lung cancer in the non-smoking females in Chinese Han population. We also investigated the interaction between genetic polymorphism and environmental exposure in lung cancer. Methods Subjects This hospital-based case-control study included 487 lung cancer patients and 516 cancer-free hospital controls. All subjects were female non-smokers and they were from unrelated ethic Han Chinese. The cases were recruited during January 2002 to November 2012 at Liaoning Cancer Hospital & Institute. All patients were histologically confirmed to have lung cancer before any radiotherapy and chemotherapy. During the same time controls were selected from patients with other lung diseases but free of cancer history and symptom. Controls suffered mainly from bronchitis pneumonias fibrosis sarcoidosis chronic obstructive pulmonary disease and emphysema. Controls were all non-smoking females and frequency-matched to case subjects for age (±5 years). This study was approved by the institutional review board of China Medical University and written informed consent was obtained from each participant or each participant's representatives if direct consent could not be obtained. Data Collection A total of 10 ml of venous blood was collected from each patient. Patients were interviewed to collect information for demographics and environmental exposure at the time they were admitted to hospital. Information concerning demographic characteristics passive smoking cooking oil fume exposure fuel smoke exposure family history of cancer occupational exposure and dietary habit was obtained for each case and control by trained interviewers. An individual was defined as a smoker if she had consumed a total of 100 cigarettes in her lifetime; otherwise she was considered as a non-smoker. About fuel smoke exposure participants who used coal-fuel-burning stoves without chimneys were regarded as fuel smoke exposure. For exposure to cooking oil fumes participants were mainly asked about the method of cooking and eyes or throat irritation. For cooking methods participants were asked whether they cooked food in a stir-frying way and how many times a week; for eyes or throat irritation participants were asked how often they felt eyes or throat irritated by the oily smoke. There were four possible responses ranging from œnever œseldom œsometimes and œfrequently. Subjects were considered as cooking oil fume exposure if they met criteria as follows: (1) have cooked for over 15 years; (2) cooked food in a stir-frying way for more than twice a week; (3) felt eyes or throat irritated by oily smoke. Exposure for cooking oil fume was categorized as an indicator variable equal to 1 if participants reported frequently or sometimes and equal to 0 otherwise. Genotype Analysis Genomic DNA was extracted from peripheral blood samples by the conventional phenol-chloroform extraction method. SNP was genotyped by investigators blinded to case-control status in order to avoid any genotyping bias using TaqMan methodology and read with the Sequence Detection Software on an Applied Biosystems 7500 FAST Real-Time PCR System according to the manufacturer's instructions (Applied Biosystems Foster City CA). Amplification was done under the following conditions: 95°C for 10 min followed by 47 cycles of 92°C for 30 s and 60°C for 1 min. In this study 487 lung cancer patients and 516 controls were all genotyped successfully and 5% duplicated samples were randomly selected to assess the reproducibility for quality control with a concordance rate of 100%. Statistical Analysis The x2 test and t test were applied to estimate differences in demographic variables and distributions of genotypes between cases and controls. The association of genotypes of ATM rs189037 with risk of lung cancer was estimated by computing the odds ratios (ORs) and 95% confidence intervals (CIs) in unconditional logistic regression analysis. The Hardy-Weinberg equilibrium (HWE) was tested using goodness-fit x2 test to compare the genotype frequencies in the control subjects from those expected. A logistic regression model was used to evaluate gene-environment interactions. All data were analyzed with Statistical Product and Service Solutions (SPSS) v13.0 for Windows if not otherwise specified. All statistical analysis were two-sided and the significance level was set at P<0.05. Results Population characteristics A total of 487 lung cancer and 516 age-matched cancer-free controls were enrolled in this study. As shown in the mean ages of cases and controls (mean ±S.D.) were almost identical (56.5±11.7 and 56.3±12.5 respectively). All cases were female non-smoking lung cancer patients. No statistically significant difference was found between cases and controls in terms of age (P?=?0.248) and monthly income (P?=?0.084). Cases included 434 non-small cell lung cancer (NSCLC) patients and 53 small cell carcinoma patients. In the NSCLC cases there were 320 adenocarcinomas 73 squamous cell carcinomas and 41 other tumors with a variety of different pathologies (such as large cell carcinomas mixed cell carcinomas or undifferentiated carcinomas). .0096911.t001 Characteristics of lung cancer cases and controls. Variables Cases(%) Controls(%) P value Female 487 516 Mean age (years) 56.5±11.7 56.3±12.5 0.248a Income (yuan/month) 628.9±419.3 563.5±387.6 0.084a Never smoker 487 516 Histological type NSCLC 434(89.1) Adenocarcinoma 320(65.7) Squamous cell carcinoma 73(15.0) Small cell carcinoma 53(10.9) Other 41(8.4) a Student's t-test was used to compare the frequency distributions of demographic variables between the cases and controls. Association analysis The observed genotype frequencies among the control subjects was in agreement with that expected under the Hardy-Weinberg equilibrium (P?=?0.119). The distribution of ATM rs189037 genotypes among subjects were displayed in . "

Lung_Cancer

"Range 41.6“84.2 41.6“84.2 41.6“81.7 44.2“82.9 41.6“84.2 Sex .18 .61 ?Female 44 (54%) 37 (59%) 7 (39%) 12 (60%) 32 (52%) ?Male 37 (46%) 26 (41%) 11 (61%) 8 (40%) 29 (48%) Ethnicity .65 .18 ?Unknown 7 (8%) 5 (8%) 2 (11%) 0 (0%) 7 (11%) ?Non-Hispanic 74 (91%) 58 (92%) 16 (89%) 20 (100%) 54 (89%) Race .73b .75b ?African American 8 (10%) 8 (13%) 0 (0%) 2 (10%) 6 (10%) ?Asian 3 (4%) 2 (3%) 1 (6%) 0 (0%) 3 (5%) ?Pacific Islander 2 (2%) 1 (2%) 1 (6%) 0 (0%) 2 (3%) ?White 66 (81%) 52 (83%) 14 (78%) 17 (85%) 49 (80%) ?Unspecified 2 (2%) 0 (0%) 2 (11%) 1 (5%) 1 (2%) Histology .06c .60c ?Adeno 52 (64%) 44 (70%) 8 (44%) 14 (70%) 38 (62%) ?Squamous 25 (31%) 17 (27%) 8 (44%) 6 (30%) 19 (31%) ?Large 1 (1%) 1 (2%) 0 (0%) 0 (0%) 1 (2%) ?Bronchioloalveolar 1 (1%) 0 (0%) 1 (6%) 0 (0%) 1 (2%) ?Other 2 (2%) 1 (2%) 1 (6%) 0 (0%) 2 (3%) Stage of disease .16 .27 ?IA (<3 cm) 25 (31%) 22 (35%) 3 (17%) 4 (20%) 21 (34%) ?IB (?3 cm) 56 (69%) 41 (65%) 15 (83%) 16 (80%) 40 (66%) Zubrod performance status .11 1.00 ?0 44 (54%) 31 (49%) 13 (72%) 11 (55%) 33 (54%) ?1 37 (46%) 32 (51%) 5 (28%) 9 (45%) 28 (46%) Weight loss (6 mo) 1.00d .31d ?<5% 64 (79%) 49 (78%) 15 (83%) 14 (70%) 50 (82%) ?5-<10% 9 (11%) 7 (11%) 2 (11%) 3 (15%) 6 (10%) ?10“20% 4 (5%) 3 (5%) 1 (6%) 2 (10%) 2 (3%) ?>20% 1 (1%) 1 (2%) 0 (0%) 0 (0%) 1 (2%) ?Unknown 3 (4%) 3 (5%) 0 (0%) 1 (5%) 2 (3%) Smoking status ?Current 33 (41%) 26 (41%) 7 (39%) 8 (40%) 25 (41%) ?Former (quit ?1 y) 39 (48%) 30 (48%) 9 (50%) 10 (50%) 29 (48%) ?Never 9 (11%) 7 (11%) 2 (11%) 1.00e 2 (10%) 7 (11%) 1.00e Abbreviation: Adeno adenocarcinoma. a All P values shown are 2-sided. b White versus all other races. c Adenocarcinoma versus all other histologies. d Weight loss <5% versus ?5%. e Derived using the Freeman-Halton exact test. The distribution of assignment to chemotherapy and observation was 63 patients (78%) and 18 patients (22%) respectively which was not significantly different (P?=?.20 Fisher exact test) from the expected rates of 70% (129 patients) and 30% (55 patients) respectively.16 Based on protein levels in these 81 patients the number of those with low ERCC1 and low RRM1 was 31 patients (38%) 22 patients had low ERCC1 and high RRM1 (27%) 10 patients had high ERCC1 and low RRM1 (12%) and 18 patients had high ERCC1 and RRM1 (22%) which is not significantly different from prior results (P?=?.14 Fisher exact test; 54 of 184 29%; 38 of 184 21%; 37 of 184 20%; and 55 of 1840.3 respectively). We investigated whether treatment arm assignment varied by patients' smoking status histology age and sex. In bivariate comparisons no statistically significant associations were found. However the multivariable logistic model found that patients with adenocarcinoma (P?=?.03) and potentially stage IA disease (P?=?.06) were more likely to be assigned to adjuvant chemotherapy (ie they were more likely to have low levels of ERCC1 RRM1 or both). One of the 18 patients assigned to observation and 19 of the 63 patients assigned to chemotherapy rejected this choice and withdrew consent. There was no statistically significant difference in patient characteristics between those who accepted and those who refused their treatment assignment (). Feasibility The trial achieved its primary feasibility objective with a treatment assignment within the prespecified timeframe in 71 of 81 patients (88%). We successfully determined protein levels in all 85 patients. Ten of the 81 eligible patients did not achieve assignment to treatment versus observation within the 84-day time interval from surgical resection. The time interval from surgery to assignment ranged from 86 days to 105 days in these 10 patients. For 3 patients the specimens were received after the 84-day limit had passed. For the other 7 patients the time interval from receipt to reporting ranged from 7 days to 25 days (median 18 days). For the 71 patients with a successful assignment within the 84-day time interval from surgical resection the time from receipt to reporting ranged from 3 days to 26 days (median 8 days). The reasons for reporting results in excess of 14 days were equipment failure and inadequate expression values in control specimens which required equipment recalibration and a repeat processing of the specimens. Overall the time from receipt of specimens to reporting ranged from 1 day to 27 days (median 11 days; mean 12 days) which is similar to that reported for patients with advanced NSCLC (range 1 day-47 days; median 11 days; mean 12 days).18 Survival and Toxicity Survival analyses were performed on the 61 patients who accepted assignment to treatment (44 patients) or surveillance (17 patients). Patients who rejected their treatment assignment withdrew consent and thus could not be followed for survival. Fourteen patients had DFS events; 2 had died (1 from disease recurrence and the other from cardiac disease without recurrence). The median follow-up among those patients still alive at the time of last follow-up was 27 months (range 3 months-44 months). Six patients had <?24 months of follow-up. The collective 2-year DFS and OS rates were 80% (95% confidence interval [95% CI] 67%-88%) (Fig. 2A) and 96% (95% CI 87%-99%) from the date of registration. The 2-year DFS rate was 83% (95% CI 68%-92%) for patients who received chemotherapy (Fig. 2B) and it was 71% (95% CI 43%-87%) for those observed (Fig. 2C). includes 2-year DFS estimates within each of the 3 gene expression categories in the chemotherapy arm. The median time from surgery to enrollment was 41 days (range 11 days-79 days). The time from surgery was added as a covariate to a Cox regression model and was not found to be significantly related to DFS (P?=?.22) or OS (P?=?.36). Disease-Free Survival Rates Patient Group No. DFS (95% CI) 1-Year 2-Year Accepted assigned treatment 61 88% (77%-94%) 80% (67%-88%) Received chemotherapy 44 95% (83%-99%) 83% (68%-92%) By protein level category (for those that received chemotherapy) ?Low ERCC1/low RRM1 20 95% (69%-99%) 84% (59%-95%) ?Low ERCC1/high RRM1 18 94% (65%-99%) 82% (55%-94%) ?High ERCC1/low RRM1 6 100% (100%-100%) 100% (100%-100%) Abbreviations: 95% CI 95% confidence interval; DFS disease-free survival; ERCC1 excision repair cross-complementing group 1; RRM1 ribonucleotide reductase M1. Kaplan-Meier survival estimates are shown. (A) Collective disease-free survival is shown for patients who accepted adjuvant chemotherapy or observation based on gene expression analysis. (B) Disease-free survival is shown for patients who received adjuvant chemotherapy. (C) Disease-free survival is shown for patients in the observation group. Conf Int indicates confidence interval. A total of 22 patients discontinued chemotherapy because of treatment-related toxicity (50%). None of the patients died because of treatment-related toxicity. Details are provided in . Number of Patients With Grade 3 and Grade 4 Adverse Events Among the 44 Patients Who Received Chemotherapya Level of Severity Adverse Event Grade 3 Grade 4 No. of patients with events 13 14 Type of events ?Neutropenia 11 6 ?Thrombocytopenia 4 4 ?Nausea 4 0 ?Vomiting 4 0 ?Anemia 2 0 ?Anorexia 2 0 ?Fatigue 2 0 ?Febrile neutropenia 1 1 ?Thromboembolism 1 1 ?Dehydration 1 0 ?Hearing impairment 1 0 ?Mucositis 1 0 ?Pleural effusion 1 0 ?Renal failure 1 0 ?Bradycardia (sinus) 1 0 ?Syncope 1 0 ?ALT elevation 1 0 ?Hypokalemia 1 0 ?Hyponatremia 0 2 Abbreviation: ALT alanine aminotransferase. a Adverse events were assessed according to the Common Terminology Criteria for Adverse Events (version 3.0). In Situ ERCC1 and RRM1 Protein Levels RRM1 levels ranged from 2.4 to 234.3 (median 39.7; mean 48.1) which were not significantly different from the expected values (median 40.5; range 8.3-96.2) (P?=?.87).16 ERCC1 protein levels ranged from 4.3 to 211.2 (median 41.9; mean 58.8) and these values were significantly different from the expected values (median 65.9; range 1.9-178.7) (P?=? 0.02). There was a significant correlation noted between ERCC1 and RRM1 levels (correlation coefficient 0.39; P?=?.0003) (Fig. 3) as previously reported.91618 Distribution of excision repair cross-complementing group 1 (ERCC1) and ribonucleotide reductase M1 (RRM1) levels in eligible patients is shown. The median protein levels of ERCC1 in adenocarcinomas squamous cell carcinomas and the other histologies were 34.257.1 and 121.5 respectively. The corresponding median levels of RRM1 were 38.142.6 and 48.9 respectively. Although the levels were higher in squamous cell carcinomas compared with adenocarcinomas the medians were not statistically significant (ERCC1: P?=?.16; RRM1: P?=?.72). DISCUSSION Disease stage is a predictor of benefit from adjuvant chemotherapy in patients with NSCLC. Patients with stage III disease derive the most benefit and those with stage I are reported to derive the least.12419“23 Although not statistically significant for patients with stage I disease and a tumor diameter >?3 cm a numerical risk reduction of 7% has been reported and for those with tumors measuring ??3 cm a numerical risk increase of 40% has been reported.23 A significant treatment-related toxicity is febrile neutropenia which has been reported in 7% to 24% of patients.242022 Treatment-related deaths occur in 0.5% to 2% of patients.122022 The inclusion of molecular markers predictive of therapeutic efficacy into adjuvant decision algorithms would greatly improve the clinical benefit and reduce toxicity for patients with NSCLC. This approach is particularly attractive for patients with stage I disease in whom the parameters for weighing risks and benefits are to our knowledge the least well defined. Recent advances in molecular diagnostics have resulted in improved outcomes for patients whose tumors harbor mutations in oncogenic signal transduction molecules that can be inactivated by therapeutic agents. Similarly platinum agents target DNA and gemcitabine targets ribonucleotide reductase; both are unequivocally required not only for cellular proliferation but also for other essential cellular functions. Although to our knowledge specific oncogenic mutations have not been identified to date ERCC1 and RRM1 have emerged as promising predictors of efficacy for cisplatin and gemcitabine respectively. We conducted a phase 2 trial of treatment selection based on the levels of protein expression of ERCC1 and RRM1 for patients with completely resected stage I NSCLC and tumor diameters ??2 cm primarily to establish feasibility but also to evaluate preliminary efficacy as assessed by 2-year survival rates. We achieved our primary goal by demonstrating within a cooperative group environment that treatment assignment can be achieved for >?85% of patients within 84 days (12 weeks) the established timeframe for the initiation of adjuvant therapy from surgery in patients with NSCLC.12420“22 At first glance our demonstration of feasibility should not be surprising. However it is important to note that surgical practice has not usually engaged a medical oncologist at the time of initial therapeutic planning but rather after complete recovery which substantially reduces the time available for molecular testing before the initiation of adjuvant treatment. We found no difference (P?=?.20) between academic and community sites in the time elapsed from surgery to the receipt of specimens in the reference laboratory (community sites: 57 patients; median 48 days [range 18 days-90 days]; academic sites: 24 patients; median 53 days [range 20 days-90 days]). The time elapsed from specimen receipt to reporting (median 12 days; range 1 day-27 days) was similar to our previous experience in an international trial of patients with advanced NSCLC (median 11 days; range 1 day-47 days).18 Based on these observations we conclude that the current process for routine specimen procurement handling and shipping to a reference laboratory requires substantial improvements to facilitate implementation of molecularly based therapeutic decision-making. For example a developing National Cancer Institute-sponsored project Adjuvant Lung Cancer Enrichment Marker Identification and Sequencing Trial (ALCHEMIST) which will randomize patients with epidermal growth factor receptor-mutated or anaplastic lymphoma kinase (ALK)-rearranged NSCLC to targeted therapy or not will need to carefully consider these logistical issues. Prior results from adjuvant trials and a retrospective staging project in patients with stage I disease after complete surgical resection have reported 2-year DFS rates of 72% to 74%20 and rates of 68% to 75% for patients with stage IB disease.4 The corresponding 2-year OS rates were 80% to 88% for patients with stage I disease2024 65% to 90% for patients with stage IB disease242225 and 85% for those with stage IA disease.25 Thus our results of a 2-year DFS rate of 80% and OS rate of 96% appear favorable by comparison. However it is prudent to be cautious because we lost 20 of 81 patients from the survival analysis because of consent withdrawal and a direct comparison of outcomes data among trials cannot account for differences in study populations eligibility and staging criteria and provisions for data collection and analysis. The spectrum of protein levels for ERCC1 and RRM1 significant correlation of levels between both molecules and distribution of patients into the 4 gene expression categories in the current study is consistent with previous experience.91213161826 However the current analysis method for biomarker evaluation (ie antibody-based assessment of in situ protein levels) is not suitable for general clinical implementation for several reasons. First ERCC1 has multiple isoforms that cannot be specifically distinguished by the available reagents and only 1 isoform appears to be involved in platinum-induced DNA damage repair.27 Second the monoclonal antibody 8F1 which is consistently used for ERCC1 protein expression analysis detects a second and unrelated protein that shares a common epitope with ERCC1.28“30 This observation may account for the highly batch-dependent performance of this antibody1827 which may explain the significantly lower ERCC1 values in the current study compared with prior results.16 Third protein levels for RRM1 in particular and to a lesser degree for ERCC1 appear to be influenced by the specimen processing and handling procedures used at collection sites.26 Finally although the method for immunofluorescence-based quantitative detection of both molecules performs well if all specimens to be analyzed are processed simultaneously there is considerable interassay variability if specimens need to be processed individually over an extended period of time as required for real-time patient decision-making.18 However it is important to note that the biochemical biophysical and cell biological evidence for ERCC1 and RRM1 as predictive molecules for platinum and gemcitabine efficacy remains undisputed.510“12273132 A small number of recent clinical trials have used ERCC1 prospectively for therapeutic decision-making. These include 2 randomized phase 3 trials in patients with advanced-stage NSCLC (1 published [NCT00499109]18 and the other terminated and unpublished [NCT00801736]) and 2 adjuvant trials 1 of which was a terminated and not yet published phase 2 trial [TAilored Post-Surgical Therapy in Early Stage NSCLC (TASTE) NCT00775385] and the other an ongoing phase 3 trial [International TAilored Chemotherapy Adjuvant trial (ITACA); EudraCT 2008-001764-36]. Results from the first trial (NCT00499109) demonstrated no improvement in patient survival; however the authors raised the possibility of a false-negative result because of an inexplicably divergent survival in an internal control group.18 The second trial (NCT00801736) and third trial (NCT00775385) were terminated early after the discovery of ERCC1 isoforms27 and specificity problems with the 8F1 antibody.28“30 The fourth trial is using ERCC1 and tumor thymidylate synthase mRNA expression levels for treatment assignment compared with a cisplatin-based control treatment with OS as the primary endpoint and a planned accrual of 700 patients. Results from these trials will help to further delineate the feasibility and technical issues mentioned above. The results of the current study demonstrated the feasibility of our biomarker-based decision algorithm in a multiinstitutional cooperative group environment for patients with surgically resected NSCLC. We identified that the current practice of evaluation and treatment for these patients may present an obstacle to rapid molecular-based decision-making. Although encouraging efficacy data emerged from this trial bioassays that specifically measure platinum-induced DNA damage repair must be developed before further clinical trials are launched that seek to tailor the use of these agents. FUNDING SUPPORT Supported by National Cancer Institute grants CA014028 CA016385 CA020319 CA022453 CA027057 CA032102 CA 035090 CA035119 CA035178 CA035261 CA035431 CA 038926 CA042777 CA045377 CA045560 CA045807 CA0 46113 CA046368 CA046441 CA063844 CA063848 CA0 67575 CA067663 CA073590 CA074647 CA076429 CA10 5409 and CA129343. CONFLICT OF INTEREST DISCLOSURES Dr. Bepler has a patent pending for the use of RRM1 and ERCC1 as biomarkers of treatment benefit for therapeutic decision-making in patients with cancer. REFERENCES 1 Arriagada R Bergman B Dunant A Le Chevalier T Pignon JP Vansteenkiste J International Adjuvant Lung Cancer Trial Collaborative Group Cisplatin-based adjuvant chemotherapy in patients with completely resected non-small-cell lung cancer N Engl J Med 2004 350 351 360 14736927 2 Winton TL Livingston R Johnson D Vinorelbine plus cisplatin versus observation in resected non-small-cell lung cancer N Engl J Med 2005 352 2589 2597 15972865 3 Strauss GM Herndon J Maddaus MA Randomized clinical trial of adjuvant chemotherapy with paclitaxel and carboplatin following resection in stage IB non-small-cell lung cancer: report of the Cancer and Leukemia Group B protocol 9633 [abstract] Proc Am Soc Clin Oncol 2004 23 Page Abstract 7019 4 Strauss GM Herndon JE Maddaus MA Adjuvant paclitaxel plus carboplatin compared with observation in stage IB non-small-cell lung cancer: CALGB 9633 with the Cancer and Leukemia Group B Radiation Therapy Oncology Group and North Central Cancer Treatment Group Study Groups J Clin Oncol 2008 26 5043 5051 18809614 5 Dabholkar M Vionnet J Bostick-Bruton F Yu JJ Reed E Messenger RNA levels of XPAC and ERCC1 in ovarian cancer tissue correlate with response to platinum-based chemotherapy J Clin Invest 1994 94 703 708 8040325 6 Metzger R Leichman CG Danenberg KD ERCC1 mRNA levels complement thymidylate synthase mRNA levels in predicting response and survival for gastric cancer patients receiving combination cisplatin and fluorouracil chemotherapy J Clin Oncol 1998 16 309 316 9440758 7 Lord RV Brabender J Gandara D Low ERCC1 expression correlates with prolonged survival after cisplatin plus gemcitabine chemotherapy in non-small cell lung cancer Clin Cancer Res 2002 8 2286 2291 12114432 8 Olaussen KA Dunant A Fouret P DNA repair by ERCC1 in non-small-cell lung cancer and cisplatin-based adjuvant chemotherapy N Engl J Med 2006 355 983 991 16957145 9 Reynolds C Obasaju C Schell MJ Randomized phase III trial of gemcitabine-based chemotherapy with in situ RRM1 and ERCC1 protein levels for response prediction in non-small-cell lung cancer J Clin Oncol 2009 27 5808 5815 19884554 10 Davidson JD Ma L Flagella M Geeganage S Gelbert LM Slapak CA An increase in the expression of ribonucleotide reductase large subunit 1 is associated with gemcitabine resistance in non-small cell lung cancer cell lines Cancer Res 2004 64 3761 3766 15172981 11 Bergman A Eijk P van Haperen V In vivo induction of resistance to gemcitabine results in increased expression of ribonucleotide reductase subunit M1 as a major determinant Cancer Res 2005 65 9510 9516 16230416 12 Bepler G Kusmartseva I Sharma S RRM1 modulated in vitro and in vivo efficacy of gemcitabine and platinum in non-small-cell lung cancer J Clin Oncol 2006 24 4731 4737 16966686 13 Ceppi P Volante M Novello S ERCC1 and RRM1 gene expressions but not EGFR are predictive of shorter survival in advanced non-small-cell lung cancer treated with cisplatin and gemcitabine Ann Oncol 2006 17 1818 1825 16980606 14 Bepler G Sharma S Cantor A RRM1 and PTEN as prognostic parameters for overall and disease-free survival in patients with non-small-cell lung cancer J Clin Oncol 2004 22 1878 1885 15143080 15 Simon GR Sharma S Cantor A Smith P Bepler G ERCC1 expression is a predictor of survival in resected patients with non-small cell lung cancer Chest 2005 127 978 983 15764785 16 Zheng Z Chen T Li X Haura E Sharma A Bepler G The DNA synthesis and repair genes RRM1 and ERCC1 in lung cancer N Engl J Med 2007 356 800 808 17314339 17 Camp RL Chung GG Rimm DL Automated subcellular localization and quantification of protein expression in tissue microarrays Nat Med 2002 8 1323 1327 12389040 18 Bepler G Williams C Schell MJ Randomized international phase III trial of ERCC1 and RRM1 expression-based chemotherapy versus gemcitabine/carboplatin in advanced non-small-cell lung cancer J Clin Oncol 2013 31 2404 2412 23690416 19 Chemotherapy in non-small cell lung cancer: a meta-analysis using updated data on individual patients from 52 randomised clinical trials Non-Small Cell Lung Cancer Collaborative Group BMJ 1995 311 899 909 7580546 20 Scagliotti GV Fossati R Torri V Randomized study of adjuvant chemotherapy for completely resected stage I II or IIIA non-small-cell lung cancer J Natl Cancer Inst 2003 95 1453 1461 14519751 21 Waller D Peake MD Stephens RJ Chemotherapy for patients with non-small cell lung cancer: the surgical setting of the Big Lung Trial Eur J Cardiothorac Surg 2004 26 173 182 15200998 22 Douillard JY Rosell R De Lena M Adjuvant vinorelbine plus cisplatin versus observation in patients with completely resected stage IB-IIIA non-small-cell lung cancer (Adjuvant Navelbine International Trialist Association [ANITA]): a randomised controlled trial Lancet Oncol 2006 7 719 727 16945766 23 Pignon JP Tribodet H Scagliotti GV LACE Collaborative Group Lung adjuvant cisplatin evaluation: a pooled analysis by the LACE Collaborative Group J Clin Oncol 2008 26 3552 3559 18506026 24 Waller D Fairlamb DJ Gower N The Big Lung Trial (BLT): determining the value of cisplatin-based chemotherapy for all patients with non-small cell lung cancer. Preliminary results in the surgical setting Lung Cancer 2003 41 54 25 Chansky K Sculier JP Crowley JJ Giroux D Van Meerbeeck J Goldstraw P International Staging Committee and Participating Institutions The International Association for the Study of Lung Cancer Staging Project: prognostic factors and pathologic TNM stage in surgically managed non-small cell lung cancer J Thorac Oncol 2009 4 792 801 19458556 26 Bepler G Olaussen KA Vataire AL ERCC1 and RRM1 in the International Adjuvant Lung Trial by automated quantitative in situ analysis Am J Pathol 2011 179 69 78 21224045 27 Friboulet L Olaussen KA Pignon JP ERCC1 isoform expression and DNA repair in non-small-cell lung cancer N Engl J Med 2013 369 1101 1110 23514287 28 Bhagwat NR Roginskaya VY Acquafondata MB Dhir R Wood RD Niedernhofer LJ Immunodetection of DNA repair endonuclease ERCC1-XPF in human tissue Cancer Res 2009 69 6831 6838 19723666 29 Ma D Baruch D Shu Y Using protein microarray technology to screen anti-ERCC1 monoclonal antibodies for specificity and applications in pathology BMC Biotechnol 2012 12 88 23171216 30 Vaezi A Bepler G Bhagwat N CCT? is a novel antigen detected by the anti-ERCC1 antibody 8F1 with biomarker value in lung and head and neck squamous cell carcinomas Cancer 31 Reed E Platinum-DNA adduct nucleotide excision repair and platinum based anti-cancer chemotherapy Cancer Treat Rev 1998 24 331 344 9861196 32 Chen Z Zhou J Zhang Y Bepler G Modulation of the ribonucleotide reductase M1-gemcitabine interaction in vivo by N-ethylmaleimide Biochem Biophys Res Commun 2011 413 383 388 21893046 World J Surg Oncol World J Surg Oncol World Journal of Surgical Oncology 1477-7819 BioMed Central 24755441 3999735 1477-7819-12-108 10.1186/1477-7819-12-108 Case Report Surgical treatment of a solitary pulmonary metastasis from eyelid sebaceous carcinoma: report of a case Kaseda Kaoru 1 kaseda@wb4.so-net.ne.jp Ohtsuka Takashi 1 t-oh@remus.dti.ne.jp Hayashi Yuichiro 2 yuichirohayashi72@gmail.com Emoto Katsura 2 emoto@a7.keio.jp Asakura Keisuke 1 asakurakeisuke@gmail.com Kamiyama Ikuo 1 i_kami@rc4.so-net.ne.jp Goto Taichiro 1 taichiro@gj9.so-net.ne.jp Kohno Mitsutomo 1 kohno@a3.keio.jp 1Department of Surgery Section of General Thoracic Surgery Keio University 35 Shinanomachi Shinjuku-ku Tokyo 160-8582 Japan 2Department of Pathology School of Medicine Keio University Tokyo Japan 2014 23 4 2014 12 108 108 19 2 2014 7 4 2014 Copyright © 2014 Kaseda et al.; licensee BioMed Central Ltd. 2014 Kaseda et al.; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0) which permits unrestricted use distribution and reproduction in any medium provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article unless otherwise stated. Background Ocular sebaceous carcinoma is an uncommon aggressive ocular neoplasm with potential for regional and distant metastasis. Case presentation A 77-year-old woman was found to have a solitary pulmonary lesion 6 years after the initial treatment of sebaceous carcinoma of the eyelid. Video-assisted lung wedge resection of an undetermined pulmonary nodule was carried out successfully. Microscopically the tumor showed foamy cytoplasm and atypical nuclei consistent with metastasis of eyelid sebaceous carcinoma. Conclusion This is the first case report of resected solitary pulmonary metastasis of eyelid sebaceous carcinoma. Pulmonary resection is a good option for the treatment and diagnosis of metastatic eyelid sebaceous carcinoma. Sebaceous carcinoma Lung metastasis Solitary metastasis Background Sebaceous carcinoma of the eyelid is a relatively rare malignant tumor and accounts for less than 1% of all eyelid tumors [1]. As well as being a rare tumor sebaceous carcinoma can mimic other benign inflammatory and malignant processes thus errors or delays in diagnosis are not unusual [2-5]. Although local management strategies for this tumor have previously been described [6-10] very few reports have focused on the patterns of metastasis of this tumor and the treatment strategies for such metastases [78]. "

Lung_Cancer

"Complete surgical excision was impossible due to the nodules™ diverse sites. Palliative treatment using 2 mg/kg tramadol (tramadol Dongkwang Pharm Seoul Korea) and 2.2 mg/kg carprofen (rimadyl Pfizer New York NY U.S.A.) was applied to the dog twice per day for 3 months. Finally after respiratory distress began to emerge the owner requested euthanasia of the dog in view of the poor prognosis and necropsy was performed. Histologically and immunochemically the lung nodules were diagnosed as undifferentiated pulmonary adenocarcinoma with extensive necrosis and there was no other tumor identified anywhere in the body including the mammary gland. This case had multiple pulmonary adenocarcinoma. Several studies evaluated the number of lung masses in dogs with primary lung tumors [15 16]. In a previous study of 15 dogs with primary lung tumors solitary and multiple masses were reported with frequencies of 87% and 13% respectively [15]. In a much larger study of 210 dogs with primary pulmonary tumors the incidence of multiple masses was 37.1% [16]. Therefore discrimination between primary and metastatic tumors is not possible based solely on the number of the masses. A dog with pulmonary metastasis is not a candidate for surgery so palliative treatment is usually applied. On the other hand in primary pulmonary tumors surgery should be considered for removing all lesions regardless of the number of pulmonary nodules or masses [21]. Therefore in cases with multiple pulmonary masses differentiation of the primary pulmonary tumor and metastatic tumors is very important for determining therapeutic options and for predicting the patient™s prognosis. In the generality of cases multiple pulmonary masses are considered as metastasis if there is a solitary mass in other viscera. Anatomic diagnostic imaging modalities especially those with higher spatial resolution such as CT can be helpful to determine smaller and uncertain lesions. CT specific features especially of the pulmonary tumor such as CT bronchus sign pleural indentation speculation ground glass opacity and pseudocavitation are used for the purpose of differentiating between benign and malignant tumors or determining the surgical plan in humans [1]. CT bronchus sign is a CT finding that is used to evaluate the relationship between a pulmonary mass and the adjacent bronchus. The bronchus can be affected by a pulmonary mass through obstruction displacement compression or narrowing. In this case the right cranial bronchus was displaced cranially by the pulmonary mass and the right caudal bronchus was abruptly obstructed by the mass. CT bronchus sign was not identified in the left bronchus around the pulmonary masses. A pleural indentation a term used when a part of the pulmonary parenchyma is pulled into the mass was also found in this case. The other human CT features of pulmonary tumors were not identified in this dog though all CT features are not currently applied in veterinary medicine. Unknown primary tumor is the diagnosis of a tumor based on metastatic lesions where the primary tumor is not clearly identified. Unknown primary tumor has been reported to be diagnosed for 5“10% of human patients in which various diagnostic methods have been used [6]. Therefore extensive investigation using more sensitive diagnostic methods is required. There are certain limits to detecting metastasis in anatomic diagnostic imaging because these modalities should accompany an increased size or change of the shape of the lesion. PET-CT one of the typical functional imaging tools for tumors can detect a tumor on the basis of increased tumor metabolism and physiologic uptake of FDG even before the development of an anatomic change of the lesion [9 18]. In humans PET-CT is recommended as a standard work-up in patients when a tumor is suspected on conventional imaging to identify characteristics of the primary tumor and regional or distant metastasis. In this dog the pulmonary masses were strongly suspected to be primary pulmonary tumors by excluding the other primary lesions and metastasis in pulmonary parenchyma. PET-CT results can be classified by the presence or absence of increased FDG uptake and can also be analyzed quantitatively such as through tumor-to-background ratios [20]. Increased FDG uptake from 3.8 to 6.4 was found from each nodule in this dog. In a study about the physiologic uptake of FDG in dogs the maximum value of SUV in lungs was about 0.90 which was the lowest uptake in the whole body [11]."

Lung_Cancer

"In one study the ferritin level was found to be higher in malignant pleural effusion than in benign pleural effusion [27]. An experimental study conducted in mesothelioma cases found raised copper levels in mesothelioma cells and reported copper as a possible marker of mesothelioma [28]. In our study the copper levels were similar in the asbestos and control groups; however MM group had a higher copper level as compared to the other two groups. Ceruloplasmin is a copper-carrying glycoprotein. It uses iron oxidase activity to prevent the occurrence of toxic iron products. In the present study ceruloplasmin level was higher in the asbestos group than in the control group while it was also higher in the MM group than in the asbestos group. One study investigated acute phase reactants in rats with asbestos exposure and found elevated ceruloplasmin concentrations [29]. In another study ceruloplasmin levels were observed to be high in lung cancer [30]. In a study in Finland high serum ceruloplasmin concentrations during the years prior to diagnosis were associated with an increased risk of cancer especially with lung cancer [31]. Determining markers that can predict MM development following environmental asbestos exposure are an important research field. Further prospective studies including long follow-up periods are needed to more clearly understand the predictive efficacy of inflammatory and oxidative markers. In the presence of higher transferrin lower ferritin and similar CRP levels in the asbestos group as compared to the control group shows the inflammation in the background. However we believe that elevated acute phase reactants and oxidative stress markers (TOL and OSI) in the MM group can be used as predictive markers for the development of asbestos-related malignancy. Conflict of Interests The authors declare that this paper has not been published anywhere previously and is not simultaneously being considered for any other publication. They are grateful to Dicle University DUBAP for their sponsorship about English editing of this paper. This study has not been published or submitted elsewhere and there is no conflict of interests for this study. 1 Mossman BT Churg A Mechanisms in the pathogenesis of asbestosis and silicosis American Journal of Respiratory and Critical Care Medicine 1998 157 5 1666 1680 2-s2.0-0031799746 9603153 2 Janssen YMW Marsh JP Absher MP Expression of antioxidant enzymes in rat lungs after inhalation of asbestos or silica The Journal of Biological Chemistry 1992 267 15 10625 10630 2-s2.0-0026658119 1316905 3 Sarban S Kocyigit A Yazar M Isikan UE Plasma total antioxidant capacity lipid peroxidation and erythrocyte antioxidant enzyme activities in patients with rheumatoid arthritis and osteoarthritis Clinical Biochemistry 2005 38 11 981 986 2-s2.0-27744591295 16150434 4 Blokhina O Fagerstedt KV Oxidative metabolism ROS and NO under oxygen deprivation Plant Physiology and Biochemistry 2010 48 5 359 373 2-s2.0-77953152723 20303775 5 Matsuzaki H Maeda M Lee S Asbestos-induced cellular and molecular alteration of immunocompetent cells and their relationship with chronic inflammation and carcinogenesis Journal of Biomedicine and Biotechnology 2012 2012 9 pages 492608 6 Janssen YMW Marsh JP Absher MP Oxidant stress responses in human pleural mesothelial cells exposed to asbestos American Journal of Respiratory and Critical Care Medicine 1994 149 3 795 802 2-s2.0-0028343981 8118652 7 Erel O A new automated colorimetric method for measuring total oxidant status Clinical Biochemistry 2005 38 12 1103 1111 2-s2.0-29144527533 16214125 8 Coussens LM Werb Z Inflammation and cancer Nature 2002 420 6917 860 867 2-s2.0-0037180757 12490959 9 Philip M Rowley DA Schreiber H Inflammation as a tumor promoter in cancer induction Seminars in Cancer Biology 2004 14 6 433 439 2-s2.0-5444256371 15489136 10 Robinson SC Coussens LM Soluble mediators of inflammation during tumor development Advances in Cancer Research 2005 93 159 187 2-s2.0-19844373824 15797447 11 Federico A Millo F Tuccillo C Ciardiello F Loguercio C Chronic inflammation and oxidative stress in human carcinogenesis International Journal of Cancer 2007 121 11 2381 2386 2-s2.0-35648946229 12 Craighead JE Abraham JL Churg A The pathology of asbestos-associated diseases of the lungs and pleural cavities: diagnostic criteria and proposed grading schema. Report of the Pneumoconiosis Committee of the College of American Pathologists and the National Institute for Occupational Safety and Health Archives of Pathology and Laboratory Medicine 1982 106 11 544 596 2-s2.0-0020477738 6897166 13 Manning CB Vallyathan V Mossman BT Diseases caused by asbestos: mechanisms of injury and disease development International Immunopharmacology 2002 2 2-3 191 200 2-s2.0-0036147411 11811924 14 Kinnula VL Crapo JD Superoxide dismutases in the lung and human lung diseases American Journal of Respiratory and Critical Care Medicine 2003 167 12 1600 1619 2-s2.0-0038545583 12796054 15 Matsuzaki H Maeda M Lee S Asbestos-induced cellular and molecular alteration of immunocompetent cells and their relationship with chronic inflammation and carcinogenesis Journal of Biomedicine and Biotechnology 2012 2012 9 pages 492608 16 Osada H Takahashi T Genetic alterations of multiple tumor suppressors and oncogenes in the carcinogenesis and progression of lung cancer Oncogene 2002 21 48 7421 7434 2-s2.0-0037152635 12379883 17 Syslov¡ K Kacer P Kuzma M Rapid and easy method for monitoring oxidative stress markers in body fluids of patients with asbestos or silica-induced lung diseases Journal of Chromatography B 2009 877 24 2477 2486 18 Tanrikulu AC Abakay A Kaplan MA A Clinical radiographic and laboratory evaluation of prognostic factors in 363 patients with malignant pleural mesothelioma Respiration 2010 80 6 480 487 2-s2.0-78649327372 20881372 19 Abu-Youssef H Amin S Amin H Osman E Value of C-reactive protein in etiologic diagnos?s of pleural effusion The Egyptian Journal of Bronchology 2010 4 124 130 20 Nojiri S Gemba K Aoe K Survival and prognostic factors in malignant pleural mesothelioma: a retrospective study of 314 patients in the west part of Japan Japanese Journal of Clinical Oncology 2011 41 1 32 39 2-s2.0-78650794570 20798232 21 Chan ED Pott GB Silkoff PE Ralston AH Bryan CL Shapiro L Alpha-1-antitrypsin inhibits nitric oxide production Journal of leukocyte biology 2012 92 6 1251 1260 22975343 22 Huuskonen MS Rsnen JA Hrk¶nen H Asp S Asbestos exposure as a cause of immunological stimulation Scandinavian Journal of Respiratory Diseases 1978 59 6 326 332 2-s2.0-0018217639 311941 23 Kasprzyk M Dyszkiewicz W Zwaru? D Szydlik S Le?niewska K Krzyzanowski M The quantitative evaluation of the serum acute phase proteins (APP) of patients undergoing a curative resection for non-small cell lung cancer (NSCLC) Przeg?d Lekarski 2006 63 10 936 940 2-s2.0-33947492701 24 Wu C Chen C Yang Y Hao C Ni J Che D Relationship between the expression of alpha 1-antitrypsinase in bronchioalveolar carcinoma and clinical pathology Journal of Tongji Medical University 2000 20 1 26 28 2-s2.0-0642366560 12845749 25 Y?ld?r?m A Meral M Kaynar H Polat H U§ar EY Relationship between serum levels of some acute-phase proteins and stage of disease and performance status in patients with lung cancer Medical Science Monitor 2007 13 4 CR195 CR200 2-s2.0-34147180985 17392651 26 Milman N Pedersen LM The serum ferritin concentration is a significant prognostic indicator of survival in primary lung cancer Oncology Reports"

Lung_Cancer

"Introduction Lung cancer is the leading cause of cancer-related deaths worldwide [1] whereas non-small cell lung cancer (NSCLC) represents the most frequent type of lung cancer [2]. NSCLC accounts for approximately 80% of all lung cancer cases and has a 5-year overall survival rate of less than 15% [3 4]. Approximately 40% of patients diagnosed with NSCLC have unresectable stage III disease or medically inoperable disease [5]. Radiation therapy has been regarded as the main treatment strategy for NSCLC for a long time. However radioresistance is the key issue limiting the effects of radiotherapy [2 6]. It is possibly due to tumor heterogeneity in terms of cell of origin pathology etiology and molecular/genetic pathogenesis [7]. NSCLC cells are often resistant to radiotherapy [8] which in turn induces the local recurrence of NSCLC [9 10]. Therefore the development of novel approaches for the treatment of NSCLC including targeted gene treatment as a radiosensitizer to treat this lethal disease is urgently needed to enhance the survival rate in patients. microRNAs (miRNAs) [11] are a class of short noncoding RNAs that function as a regulation for gene expression via targeting mRNA for degradation or inhibition of translation [12]. miRNAs are new factors implicated in regulating the expression of genes involved in tumorigenic processes such as inflammation cell cycle regulation stress response differentiation apoptosis and invasion and over the past decade they have been found to have key roles in cancers [13“15] including lung cancer [16]. Moreover recent studies have suggested a link between expression of some miRNAs and radiotherapy particularly in lung cancer [17“19]. microRNA-21 (miR-21) is a miRNA which has been reported to be overexpressed in many human malignancies including NSCLC [20“22]. Interestingly miR-21 was found to be upregulated in radiotherapy resistant NSCLC cells relative to radiosensitive counterparts [18]. In addition Wang et al. also reported that comparing with radiotherapy resistant NSCLC patients miR-21 was greatly downregulated in radiotherapy sensitive group [23]. Considering miR-21 as a putative regulator of NSCLC radiotherapy resistance we explore the role of miR-21 in radiotherapy resistance of NSCLC A549 cells and the potential molecular mechanism in the present study. 2. Materials and Methods 2.1. Cell Culture The NSCLC cell line A549 was cultured in Dulbecco's modified Eagle's medium (Invitrogen Carlsbad CA) supplemented with 10% fetal bovine serum 100?U/mL penicillin and 100??g/mL streptomycin. Cell cultures were incubated in a humidified atmosphere of 5% CO2 at 37°C. 2.2. Transfection Anti-miR-21 (5?-UCAACAUCA-GUCUGAUAAGCUA-3?) and the negative control oligonucleotides (NC 5?-CAGUACUUUUG-UGUAGUACAA-3?) were obtained from Ambion Inc. (Austin TX USA). The transfection was performed using LipofectamineTM 2000 (Invitrogen USA) according to the instructions provided by the manufacturer. The transfected cells were resuspended and cultured in regular culture medium for 48?h before analysis. 2.3. Detection of miR-21 by TaqMan Real-Time PCR PCR-based detection of miR-21 was performed by the TaqMan miRNA assays (ABI Forest City CA) as described previously [24 25]. The real-time PCR results recorded as threshold cycle numbers (Ct) were normalized against an internal control (U6 RNA) and then expressed as fold changes [25]. 2.4. Ionizing Radiation 48?h after anti-miR-21 or anti-miR-NC transfection subconfluent cell monolayers were treated with ?-ray ionizing radiation (IR) from a 60Co source (PLA General Hospital Beijing China) at a rate of 2.4?Gy/min. 2.5. Clonogenic Survival Analysis After exposure to various doses of IR cells were trypsinized washed and replated at 200 cells per 10-cm dishes. Cells were grown for 14 days fixed with ethanol and stained with Giemsa to detect colonies. The number of colonies containing at least 50 cells was determined and surviving fractions were calculated. 2.6. MTT Assay Twenty-four hours before IR 200??L cells were seeded to 96-well microtiter plate at 5 — 104 cells/mL. Three days after IR 10??L MTT reagent was added to each well followed by incubation for 4?h at 37°C. The supernatants were aspirated and the reaction was terminated by adding 100??L DMSO. The contents of the plates were mixed for 10?min and the absorbance was read at 490?nm. All experiments were performed three times and the average results were calculated. 2.7. Flow Cytometry Attached cells were harvested at 48?h after IR for apoptosis detection using the annexin V-FITC apoptosis detection kit (Sigma Louis MO). Briefly the cells were washed twice with DPBS and then were resuspended in 1— binding buffer at a concentration of 1 — 106 cells/mL. 5??L of annexin V-FITC conjugate and 10??L of propidium iodide solution were added to 500??L of each cell suspension in a plastic 12?mm — 75?mm test tube followed by incubation at room temperature for 15?min and protection from light. The fluorescence of the cells was determined immediately with a flow cytometer. 10?ng/mL of PI3K activator IGF-1 (Prospec-Tany Rehovot Israel) was used in the apoptosis assay. 2.8. Western Blot Analysis Cells were lysed in lysis buffer (20?mM Tris-HCl pH 7.4 150?mM?NaCl 1% Triton X-100 0.1?mM?EDTA 1?mM?EGTA 2?mM sodium orthovanadate 2?mM?NaF and Complete TM Protease Inhibitor Mix [Roche Applied Science Mannheim Germany]) for 20?min on ice and cleared by centrifugation at 12000?rpm and 4°C. Proteins were resolved on a 10% SDS PAGE gel transferred onto nitrocellulose membranes and blocked with 5% nonfat dry milk in TBST (10?mM Tris-HCl pH 7.5 100?mM?NaCl and 0.05% Tween 20) followed by incubation with a primary antibody [total and anti-phosphorylated-Akt (Ser473) antibody (Cell Signaling Biotechnology Beverly MA USA)]. Blots were washed and incubated with horseradish peroxidase-conjugated secondary antibody. Antibody complexes were visualized using an enhanced chemiluminescence-Western blotting detection system (Thermo Fisher Scientific Inc. Rockford IL USA). 2.9. Statistical Analysis Statistical analysis was performed using SPSS 13.0. The results from three independent experiments were presented as the means ± standard deviation. Statistical analyses were done by Student's t-test. P value < 0.05 was considered statistically significant. 3. Results 3.1. miR-21 Expression Was Knocked down in A549 Cells by Anti-miR-21 Transfection To confirm knockdown efficiency of anti-miR-21 transfection the relative of miR-21 expression level was detected by real-time quantitative RT-PCR. Compared with anti-miR-NC-transfected A549 cells the level of miR-21 expression in anti-miR-21-transfected cells was significantly decreased by about 64% (). 3.2. Downregulation of miR-21 Inhibited Survival Capacity of A549 Cells after IR To assess whether miR-21 downregulation could sensitize NSCLC A549 cells to IR the A549 cells transfected with either anti-miR-NC or anti-miR-21 were irradiated and their response was analysed. In clonogenic survival analysis we observed the expected decreased survival capacity of A549 cells transfected with anti-miR-21 14 days after IR (). Forty-eight hours after transfection A549 cells were treated with various doses of IR (0246 or 8?Gy) and the survival fractions upon IR were detected. As shown in after IR at 46 or 8?Gy the survival fraction of A549 cells in anti-miR-21-transfected group (0.61 ± 0.06 0.43 ± 0.08 and 0.27 ± 0.07 resp.) was significantly lower than that in anti-miR-NC-transfected group (0.83 ± 0.08 0.76 ± 0.11 and 0.65 ± 0.10 resp.) indicating that downregulation of miR-21 could significantly enhance the sensitivity of A549 cells to IR. 3.3. Downregulation of miR-21 Suppressed Proliferation of A549 Cells after IR To confirm the increased IR sensitivity of A549 cells the effect of miR-21 on cell proliferation was further analysed at 72?h after IR (). Downregulation of miR-21 expression was found to reduce cell proliferation as demonstrated by the decreased proliferation index of cells transfected with anti-miR-21 compared with anti-miR-NC (75.6 ± 18.96% versus 100% P < 0.05). Importantly a more pronounced growth inhibition of A549 cells was found when miR-21 was knocked down in combination with IR. This inhibition of cell growth in the combined treatment (anti-miR-21 + IR) was found to be significantly higher compared with that in the sole IR treatment group (proliferation index: 36.1 ± 8.48% versus 73.2 ± 21.37% P < 0.05 ). This indicates that knockdown of miR-21 sensitizes radioresistant NSCLC A549 cells to radiation. 3.4. Downregulation of miR-21 Enhanced Apoptosis of A549 Cells Induced by IR We next explored the role of miR-21 in the apoptosis of NSCLC A549 cells induced by IR. Anti-miR-21 or anti-miR-NC was transfected into A549 cells and was exposed (or sham exposed) to 8?Gy of IR. As shown in Figure 4 the percentage of apoptosis cells in miR-21 knockdown group (anti-miR-21) was significantly higher than that of negative control group (anti-miRNA-NC) at the dose 8?Gy (61.5 ± 15.62 versus 21.2 ± 5.35 P < 0.05) indicating that miR-21 knockdown may enhance radiosensitivity of A549 cells by promoting apoptosis and thus confirm a role for miR-21 in the regulation of radiotherapy response of NSCLC. 3.5. Downregulation of miR-21 Inactivated PI3K/Akt Signaling Pathway Induced by IR Because the PI3K/Akt signaling pathway is associated with apoptosis we subsequently examined the potential effects of miR-21 on the activation of PI3K/Akt pathways by IR to explore the potential molecular mechanisms. The activation of PI3K/Akt signaling pathways was measured by Akt phosphorylation on Ser473. By Western blot we found that the endogenous level of phospho-Akt expression (Ser473) in anti-miR-21-transfected A549 cells was downregulated compared to that in anti-miR-NC-transfected A549 cells after IR (Figure 5). Interestingly phospho-Akt (Ser473) expression was significantly increased in the case of being treated with IGF-1 a PI3K activator in anti-miR-NC-transfected A549 cells and even in anti-miR-21-transfected A549 cells after IR (Figure 5). This suggested that activation of PI3K/Akt signaling pathway by IR in A549 cells was suppressed by knockdown of miR-21 and the suppression was reversed by PI3K activator IGF-1. 3.6. miR-21 Knockdown Caused Promotion on Apoptosis Induced by IR Was Mediated by PI3K/Akt Signaling Pathway To further confirm the molecular mechanisms of radiosensitization by miR-21 knockdown in NSCLC A549 cells we next treated the cells with or without PI3K activator IGF-1 and then examined the effects of miR-21 downregulation on cell apoptosis induced by IR. As shown in Figure 6 without IGF-1 treatment the cell apoptosis induced by IR was significantly increased in anti-miR-21-transfected A549 cells (61.5 ± 15.62%) compared with that in anti-miR-NC-transfected A549 cells (21.2 ± 5.35% P < 0.05). However after activation of PI3K/Akt signaling pathway the cell apoptosis induced by IR was inhibited in either anti-miR-21-transfected or anti-miR-NC-transfected A549 cells. The percentage of cell apoptosis was not significantly different between these two groups (18.1 ± 5.55% versus 18.3 ± 5.15% P > 0.05). These data showed that in the condition of PI3K/Akt activation knockdown of miR-21 did not promote the apoptosis of A549 cells induced by IR suggesting that PI3K/Akt signaling pathway was the downstream target of miR-21 and the promotive effects of miR-21 knockdown on apoptosis induced by IR were mediated by PI3K/Akt signaling pathway. 4. Discussion It is well known that the acquisition of resistance to radiotherapy which greatly increases patient morbidity and mortality is a significant problem in the treatment of NSCLC. Effective treatment which can sensitize the radioresistant NSCLC to radiotherapy is always being sought. Recently some miRNAs were found to be related to radioresistance. Among them miR-21 is reported to play a role in radioresistance of cancer including glioblastoma [26 27] breast cancer [28] and rectal cancer [29]. But up to now few researches have studied the correlations between miR-21 expression and radiotherapy sensitivity of NSCLC. Liu et al. reported that miR-21 expression promotes radioresistance in NSCLC but the related molecular mechanisms were not revealed [30]. The roles of miR-21 in the radiotherapy response of NSCLC are not fully understood and remain to be elucidated. Thus in the current study we investigated whether miR-21 could affect the radiosensitivity of NSCLC A549 cells and found that downregulation of miR-21 significantly enhanced the sensitivity of A549 cells to radiotherapy through inhibition of PI3K/Akt signaling pathway. Our data showed that following the transfection of anti-miR-21 into A549 cells the inhibition of survival fraction caused by various doses of IR was enhanced compared with radiotherapy alone. This result suggests that miR-21 is closely associated with the therapeutic efficiency of IR on radioresistant A549 cells and downregulation of miR-21 may sensitize A549 cells to IR. It is reported that miR-21 could stimulate growth in NSCLC [30 31]. Accordingly we also found that the proliferation of A549 cells was inhibited after miR-21 knockdown. Moreover the inhibition of cell proliferation induced by combination of miR-21 knockdown and IR was more pronounced compared with either miR-21 knockdown or IR treatment indicating that miR-21 knockdown plays a crucial role in the combined inhibition of cell proliferation and silencing miR-21 may increase the sensitivity of A549 cells to IR. Cell apoptosis induced by IR is one of the most important effects of tumor radiotherapy. Furthermore miR-21 is reported to be an antiapoptotic factor in lung cancer [32 33]. So we hypothesized that it is possible that miR-21 could affect the apoptosis of NSCLC induced by IR. Our current results demonstrated that miR-21 knockdown promoted apoptosis of A549 cells induced by IR indicating that the expression of miR-21 could affect radiosensitivity of NSCLC cells which might be associated with inhibition of apoptosis. This is also in agreement with the previous report [30]. To explore the potential molecular mechanisms of radiosensitization by miR-21 knockdown in NSCLC A549 cells we focused on analysis of PI3K/Akt signaling pathway because the influence of PI3K/Akt signaling pathway on IR-induced apoptotic propensity is well documented [34 35]. We examined whether downregulation of miR-21 could affect Akt phosphorylation at Ser473 and/or its total expression and found that miR-21 knockdown suppressed the activation of PI3K/Akt signaling pathway by IR in A549 cells. In addition the apoptosis induced by IR was enhanced in A549 cells after miR-21 knockdown. This data indicates that the stimulative effects of miR-21 knockdown on A549 cell apoptosis induced by IR are related to the inactivation of PI3K/Akt signaling pathway. Furthermore with the treatment of PI3K activator IGF-1 we found that the apoptosis of A549 cells induced by IR was not promoted even if miR-21 was downregulated. Our results suggest that the promotive effects of miR-21 knockdown on A549 cell apoptosis induced by IR depend on the inactivation of PI3K/Akt signaling pathway."

Lung_Cancer

"Overexpression of GFP-Sp1 decreased FOXO3 mRNA and protein levels in a dose-dependent manner (C panel a) whereas knockdown of Sp1 expression increased FOXO3 mRNA and protein levels (C panel b). These results indicate that Sp1 negatively regulates FOXO3 expression. Sp1 negatively regulates FOXO3 expression through regulating miR-182 (A) The Sp1 and FOXO3 levels in clinical lung tissue samples were studied by IHC staining using antibodies against Sp1 and FOXO3 respectively. (B) Cell lysates were harvested from various cell lines for Western blotting using antibodies against FOXO3 and Sp1 and tubulin as an internal control. (C) Adeno-GFP-Sp1 viruses were infected into IMR-90 cells for 48 h and FOXO3 mRNA and protein were studied by RT-PCR and Western blotting respectively. GAPDH served as the internal control (panel a). Scramble and Sp1 shRNAs were transfected into H1299 for 48 h then FOXO3 mRNA and protein levels were studied by RT-PCR and Western blotting (panel b). (D) Scramble and Sp1 shRNAs were transfected into H1299 for 48 h and then cells were harvested at indicated time points following cycloheximide treatment for studying the Sp1 and FOXO3 levels with Western blotting. The levels of FOXO3 protein from three independent experiments were quantified using tubulin as an internal control. (E) Plasmids pGL2 or pGL2-FOXO3 (-1000/+50) were cotransfected with GFP or GFP-Sp1 into H1299 cells for 24 h then cell lysates were harvested for luciferase activity assays. (F) Adeno-GFP-Sp1 viruses were infected into H1299 cells for 24 h and cells were then transfected with pGL3 or pGL3-FOXO3-3'UTR plasmid for 24 h. Cells lysates were harvested for luciferase activity assays. (G) H1299 cells which were infected with GFP-Sp1 adenovirus for 24 h were then transfected with pGL3 or pGL3-FOXO3-3'UTR plasmid for 24 h. Total RNA was extracted at various time points following actinomycin D treatment. The mRNA levels of luciferase were determined by using quantitative RT-PCR and quantified using GAPDH as an internal control. Data are representative of three independent experiments each of which was performed in triplicate and presented as the mean ± SEM. The level of statistical significance determined by t-test (* p<0.05; ** p<0.01). Next we investigated the mechanism by which Sp1 regulates FOXO3 expression. FOXO3 protein half-life was studied after Sp1 knockdown. Knockdown of Sp1 expression did not affect FOXO3 protein stability (D). We then constructed a luciferase reporter construct containing the FOXO3 promoter (-1000/+50) to study the effect of Sp1 on the promoter-mediated transcription of FOXO3 (E). GFP-Sp1 overexpression significantly enhanced the luciferase activity indicating that Sp1 positively regulated FOXO3 transcription (E). However FOXO3 mRNA and protein levels decreased as shown in C. The data shown in indicated that Sp1 increased miR-182 expression which suggests that post-transcriptional processing contributes to the regulation of FOXO3 expression. Thus the 3'-UTR of FOXO3 might play an important role in stabilizing FOXO3 mRNA and in FOXO3 translation. Consequently a luciferase reporter construct containing the 3?-UTR of FOXO3 was generated. GFP-Sp1 overexpression reduced the luciferase activity (F). Furthermore the stability of the luciferase mRNA containing the 3?-UTR sequence of FOXO3 decreased dramatically upon GFP-Sp1 overexpression (G). These results indicate that Sp1 regulates FOXO3 expression through transcriptional and post-transcriptional regulation with a net negative effect on FOXO3 expression. miR-182 inhibits lung cancer metastasis activity The data shown in indicated that miR-182 positively regulated lung cancer cell growth. Therefore the role of miR-182 in lung cancer metastasis was studied (). The morphology of miRZip-182 cells was markedly altered: circular structures of actin filaments were absence and pseudopodia were enriched suggesting that miR-182 decreased the cells' migratory ability (A). Indeed knockdown of miR-182 expression increased the migration ability of lung cancer cells suggesting that miR-182 inhibits lung cancer migration (B). Moreover transwell migration assays showed that knockdown of miR-182 expression enhanced cell's invasive capacity (C). In mice injected with miRZip-182-treated cells the knockdown of miR-182 expression also increased the number of nodules in the lung suggesting that miR-182 represses metastatic ability in vivo (D). The effects of miR-182 knockdown were partially reversed by knockdown of FOXO3 suggesting that miR-182 functions as a suppressor of lung cancer metastasis by repressing FOXO3 expression (E panel a). The endothelial-mesenchymal transition (EMT) marker N-cadherin increased after miR-182 knockdown but this effect was abolished by FOXO3 knockdown. Thus miR-182 might repress lung cancer metastasis by decreasing the expression of N-cadherin (E panel b). However the expression of other genes regulated by miR-182 might also play a role in metastasis (F and Supplementary Figure S3). Therefore we generated gene expression profiles using microarray analysis. Functional grouping analysis using DAVID bioinformatics resources showed that 19 of the genes differentially regulated by miR-182 knockdown were related to cell migration. The expression of these genes was increased in miR-182-knockdown cells indicating that they are potential targets of miR-182 (F). Many metastasis-related genes such as CD44 CDH9 and ADAM9 were upregulated after the knockdown of miR-182 expression (F). miR-182 attenuates lung cancer cell metastasis (A) Immunofluorescent staining of Alexa Fluor 568-conjugated phalloidin that is a high-affinity probe for F-actin (red) in miRZip and miRZip-182 stably expressed H1299 cells. DNA was stained with DAPI (blue). Stained cells were photographed under a fluorescence microscope at x 600 magnification. (B) Confluent monolayers of miRZip or miRZip-182 stably expressed H1299 cells were wounded and incubated for an additional 16 h (panel a). Migratory area was calculated for quantification (panel b). (C) The migration activities of H1299 cells (2 x 104) expressing miRZip or miRZip-182 were studied by Transwell chambers. (D) The miRZip or miRZip-182 stably expressed H1299 cells (4 x 106) were suspended in 100 ?l of PBS and injected into the lateral tail vein of SCID mice. After 8 weeks all mice were killed and the number of pulmonary tumor nodules was calculated after fixation of lungs with 4% formaldehyde for 48 h (panel a) and the number of pulmonary metastatic tumor nodules was counted (panel b). (E) FOXO3 and miR-182 in H1299 cells were knockdown by shFOXO3 and miRZip-182 respectively and then migration of cells (3 x 104) was studies by Transwell chambers (panel a). In addition cell lysates were harvested from FOXO3 and miR-182 knockdown cells for Western blotting using antibodies against N-cadherin ?-catenin vimentin FOXO3 and tubulin (panel b) respectively. (F) Heat map of the 19 of genes from miRZip and miRZip-182 microarray data the red color represents genes that are upregulated and the green color represents genes that are downregulated. The level of statistical significance determined by t-test (* p<0.05; ** p<0.01; *** p<0.001). DISCUSSION Our recent studies showed that Sp1 increased the growth of lung cancer cells but inhibits metastatic activity [23 32]. In the present study we found that Sp1 which accumulated in the early stages of cancer positively regulated miR-182 gene expression to silence FOXO3 expression and thereby promote cancer cell growth. In addition decreased levels of Sp1 in the late stages of cancer increased the expression of FOXO3 and N-cadherin leading to cancer metastasis (). (A) Clinical samples from lung cancer patients of stage I and IV were used to study the Sp1 level by IHC staining with anti-Sp1 antibodies (B) Schematic diagram illustrates Sp1 regulates miR-182 to silence FOXO3 expression in early and late stages of lung cancer progression. Sp1 functions as a transcriptional activator by recruiting p300 to its target genes and as a repressor by the recruiting HDACs. Because Sp1 accumulates in several types of cancer including lung cancer [33] understanding the Sp1 transcriptional regulatory network may provide novel insights into the molecular origins and treatment of lung cancer. In our previous studies of lung cancer we found that Sp1 was highly upregulated in the early stages of cancer progression but partially down regulated in the late stages. Our previous studies also showed that regulation of Sp1 protein stability by phosphorylation and sumoylation contributed to its expression in the early and late stages of cancer respectively [32]. Kras activation and the Notch pathway might activate ERK1/2 to phosphorylate Sp1 thus stabilizing Sp1 in the early stages of cancer [32 34]. In the late stages Sp1 could be sumoylated leading to recruitment of its E3-ligase RNF4 followed by polyubiquitination and degradation [32]. To clarify the molecular mechanism underlying gene regulation by Sp1 we used microarray analysis to assess gene expression in KrasG12D-induced lung tumor transgenic mice and identified thousands of genes potentially regulated by Sp1 [23]. However some of the genes do not harbor a conserved Sp1 binding motif within their promoter region suggesting that another regulatory mechanism is involved in Sp1-mediated gene regulation. "

Lung_Cancer

"MB was supported by the European Regional Development Fund grant number FKZ:005-111-0027. GVM was supported by the Victorian Cancer Agency grant TS10_01. KKW is supported by the NIH CA122794 CA140594 CA163896 CA166480 and CA154303 grants. PKP was supported by a Uniting Against Lung Cancer grant. RKT is supported by the EU-Framework Programme CURELUNG (HEALTH-F2-2010-258677) by the Deutsche Forschungsgemeinschaft through TH1386/3-1 and through SFB832 (TP6) by the German Ministry of Science and Education (BMBF) as part of the NGFNplus program (grant 01GS08100) and by the Deutsche Krebshilfe as part of the Oncology Centers of Excellence funding program. SP was supported by a grant from the Rudolph Becker Foundation. JW was supported by the German Cancer Aid (CIO K¶ln Bonn) the Federal Ministry of Education and Research (NGFNplus) and the Ministry of Economy Energy Industry and Craft of North Rhine-Westfalia in the PerMed. NRW framework program. ZZ was supported by the NIH R01LM011177. We thank J. Sosman and C. Arteaga for their critical review of this manuscript C. Liang for providing X-376 and A. Nashabi for administrative assistance. Australian specimens were processed by the Victorian Cancer Biobank. The human anaplastic lymphoma cell line SUDHL-1 was a generous gift from Dr. S. Morris of St. Jude Children's Research Hospital. Author Contributions: C.M.L. and W.P. conceived the project and wrote the manuscript. C.M.L. N.T.M. Y.Y. H.J. and M.R.B performed the molecular biology experiments. H.C. P.L. X.C. and R.S. performed the statistical analysis. S.C.O. L.C.H. A.F. and R.K.T. performed all the IGF-1R and IRS-1 immunohistochemistry experiments. S.C.O. L.O. P.K.P. R.B. S.A. S.P. M.B. M.B. J.W. M.G. G.V.M. B.S. P.A.R. T.M.R. and R.K.T. provided clinical samples. D.H.J. and L.H. provided clinical care for the index patient. Z.C. and K.K.W. provided the EML4-ALK E13;A20 transgenic mice. D.L. L.W. Y.S. and M.L. performed all the FISH and nanostring experiments. R.T. and E.D.S. performed the xenograft studies. Q.W. and Z.Z. analyzed the whole-genome sequencing data. Conflicts of Interest: CML and WP have filed a provisional patent describing the improved efficacy of combined treatment of ALK inhibitors plus IGF-1R inhibitors compared to ALK inhibitors alone (serial number 61/768072). CML has served on an Advisory Board for Pfizer and has served as a speaker for Abbott and Qiagen. WP has done consulting for MolecularMD AstraZeneca Bristol-Myers Squibb Symphony Evolution Clovis Oncology Exelixis Clarient Champions Clarient (MDOutlook) and WebMD. WP has received research funding from Enzon Xcovery AstraZeneca Symphogen Clovis Oncology and Bristol-Myers Squibb. Rights to EGFR T790M testing were licensed on behalf of WP and colleagues to MolecularMD. RKT is a founder and shareholder of Blackfield AG a company focused on cancer genome diagnostics and cancer genomics-based drug discovery. LCH received lecture fees (Roche Novartis Pfizer Qiagen). RKT received consulting and lecture fees (Sanofi-Aventis Merck Roche Lilly Boehringer Ingelheim Astra-Zeneca Atlas-Biolabs Daiichi-Sankyo Blackfield AG) as well as research support (Merck EOS and AstraZeneca). RB is a cofounder and owner of Targos Molecular Inc. and served on advisory boards for Pfizer Roche Boehringer Ingelheim Merck Serono Novartis and Lilly. JW has served as a Consultant or Advisory Role for Roche Novartis Pfizer Boehringer-Ingelheim AstraZeneca Bayer Pharmaceuticals Eli Lilly and Merck. GVM has served on an Advisory board for Pfizer. BS has served on Advisory Boards for Pfizer and Novartis. KKW received sponsored research grants from Takeda AstraZeneca Roche and Infinity Pharmaceuticals. He is also a consultant for G1 Therapeutics. PKP has served on an Advisory Board for Bristol-Myers-Squibb. SP received consulting and lecture fees (Novartis Curagita Roche Abbot Definiens) as well as research support (Ventana-Roche). JW has served as a Consultant or Advisory Role for Roche Novartis Pfizer Boehringer-Ingelheim AstraZeneca Bayer Pharmaceuticals Eli Lilly Merck. GVM has served on an Advisory board for Pfizer. BS has served on Advisory Boards for Pfizer and Novartis. LH has served on Advisory Boards for Bristol-Myers-Squibb (compensated) PUMA (uncompensated) and HelixBio (uncompensated). LH has also received research grants from Astellas and has served as a speaker for Boehringer Ingelheim. References 1 Grande E Bolos MV Arriola E Targeting oncogenic ALK: a promising strategy for cancer treatment. Mol Cancer Ther 2011 10 569 579 21474455 2 Camidge DR Activity and safety of crizotinib in patients with ALK-positive non-small-cell lung cancer: updated results from a phase 1 study. Lancet Oncol 2012 3 Katayama R Mechanisms of acquired crizotinib resistance in ALK-rearranged lung Cancers. Sci Transl Med 2012 4 120ra117 4 Doebele RC Mechanisms of Resistance to Crizotinib in Patients with ALK Gene Rearranged Non-Small Cell Lung Cancer. Clin Cancer Res 2012 5 Lovly CM Pao W Escaping ALK inhibition: mechanisms of and strategies to overcome resistance. Sci Transl Med 2012 4 120ps122 6 Tanizaki J Activation of HER family signaling as a mechanism of acquired resistance to ALK inhibitors in EML4-ALK-positive non-small cell lung cancer. Clin Cancer Res 2012 7 Iyer G Genome sequencing identifies a basis for everolimus sensitivity. Science 2012 338 221 22923433 8 Shaw AT Clinical features and outcome of patients with non-small-cell lung cancer who harbor EML4-ALK. J Clin Oncol 2009 27 4247 4253 19667264 9 Boik JC Newman RA Boik RJ Quantifying synergism/antagonism using nonlinear mixed-effects modeling: a simulation study. Stat Med 2008 27 1040 1061 17768754 10 Mulvihill MJ Discovery of OSI-906: a selective and orally efficacious dual inhibitor of the IGF-1 receptor and insulin receptor. Future Med Chem 2009 1 1153 1171 21425998 11 Metz HE Houghton AM Insulin receptor substrate regulation of phosphoinositide 3-kinase. Clin Cancer Res 2011 17 206 211 20966354 12 Yang X Using tandem mass spectrometry in targeted mode to identify activators of class IA PI3K in cancer. Cancer Res 2011 71 5965 5975 21775521 13 Chen Z Inhibition of ALK PI3K/MEK and HSP90 in murine lung adenocarcinoma induced by EML4-ALK fusion oncogene. Cancer Res 2010 70 9827 9836 20952506 14 Lovly CM Insights into ALK-driven cancers revealed through development of novel ALK tyrosine kinase inhibitors. Cancer Res 2011 71 4920 4931 21613408 15 Katayama R Therapeutic strategies to overcome crizotinib resistance in non-small cell lung cancers harboring the fusion oncogene EML4-ALK. Proc Natl Acad Sci U S A 2011 108 7535 7540 21502504 16 Guix M Acquired resistance to EGFR tyrosine kinase inhibitors in cancer cells is mediated by loss of IGF-binding proteins. J Clin Invest 2008 118 2609 2619 18568074 17 Cortot AB Resistance to irreversible EGF receptor tyrosine kinase inhibitors through a multistep mechanism involving the IGF1R pathway. Cancer Res 2013 73 834 843 23172312 18 Garcia-Echeverria C In vivo antitumor activity of NVP-AEW541-A novel potent and selective inhibitor of the IGF-IR kinase. Cancer Cell 2004 5 231 239 15050915 19 Millo F Implication of the insulin-like growth factor-IR pathway in the resistance of non-small cell lung cancer cells to treatment with gefitinib. Clin Cancer Res 2007 13 2795 2803 17473213 20 Vazquez-Martin A IGF-1R/epithelial-to-mesenchymal transition (EMT) crosstalk suppresses the erlotinib-sensitizing effect of EGFR exon 19 deletion mutations. Scientific reports 2013 3 2560 23994953 21 Chmielecki J Optimization of dosing for EGFR-mutant non-small cell lung cancer with evolutionary cancer modeling."

Lung_Cancer

" Silent lunch and tea break 7. Taking care of yourself - Sitting meditation ending in choiceless awareness - Exercise on taking care of yourself by examining how to improve balance in life - Meditation without CD - Yoga or walking meditation - Reflect on training - 3-min breathing space 8. The rest of your life - Bodyscan - Reflection on training - Further sources of information - Short sitting meditation - Maintaining practice Outcome measures Primary outcome measure Psychological distress The primary outcome measure is the total score on the HADS [39-41] which is developed to measure psychological distress in somatic patient populations. It consists of a 7-item anxiety (HADS-A) and 7-item depression (HADS-D) subscale. The HADS shows good psychometric properties in the general medical population including oncology patients [42]. Internal consistency as measured with Cronbach™s ? varied from .84 to .90 [4042].Test-retest reliability was good as Pearson™s r > .80 were obtained [4043]. Though the cut-off scores of the HADS vary among populations [44] in lung cancer patients they have found to be <8 versus ?8 on the HADS-A or HADS-D [45]. The HADS has been shown to be highly correlated with the Beck Depression Inventory [42]. It has previously been used in intervention studies of mindfulness and shown to be sensitive to change (e.g. [46]). Secondary outcome measures Quality of life (only for patients) The European anisation for Research and Treatment of Cancer (EORTC) Core Quality of Life Questionnaire (QLQ-C30) [47] is included along with the supplemental Lung Cancer questionnaire module (QLQ-LC13) [48]. The QLQ-C30 is designed to use in clinical trials on physical treatments for cancer patients. It incorporates five functional scales (physical role cognitive emotional social) three symptom scales (fatigue pain nausea and vomiting) a global health and quality of life scale and an array of single-item symptom measures. After revisions in the role functioning global health and physical functioning scale internal consistency of the subscales varied between .65 and .94 except for the cognitive functioning scale with ? varying from .56 to .63 [474950]. Test-retest reliability varied from .63 to .86 [51]. The lung cancer questionnaire module is designed to supplement the core questionnaire and comprises specific symptoms associated with lung cancer (coughing haemoptysis dyspnoea pain) and side-effects from conventional chemo- and radiotherapy (hair loss neuropathy sore mouth dysphagia). While the multi-item dyspnoea scale showed high internal consistency the pain subscale did not. When combined with the dyspnoea and pain items of the core questionnaire both the dyspnoea (? = .86) and pain (? = .71) subscale showed high internal consistency. Since the QLQ-C30 and QLQ-LC13 are mainly focused on physical symptoms we added the items Social Interaction and Alertness Behavior of the Sickness Impact Profile (SIP) [52]. Internal consistency was .94 and test-retest reliability was .92. The SIP correlated with self-assessed sickness and dysfunction [52]. Caregiver appraisal (only for partners) We use the 9-item Self-Perceived Pressure from Informal Care (SPPIC) [53] to assess the extent to which caregiving is experienced as burdensome. To also measure positive aspects of caregiving the 9-item subscale Care-Derived Self-Esteem of the Caregiver Reaction Assessment (CRA-SE) [54] is included. Internal consistency of the SPPIC was .79 and of the CRA-SE was .73. The SPPIC and CRA-SE were unrelated to each other [55]. Relationship quality To measure relationship satisfaction we included the 10-item Satisfaction subscale of the Investment Model Scale (IMS-S) [56]. The IMS-S starts with 5 items that measure concrete examplars of satisfaction to enhance the comprehensibility of the global items which are utilized to form the construct. Internal consistency varied from .79 to .95 and the IMS-S was related to the Dyadic Adjustment Scale. Also the Mutual Interpersonal Sensitivity scale (MIS) [57] is included to measure communication between partners about the cancer. It contains 18 items and is divided into two scales: open communication and avoiding negative thoughts about the cancer. Spirituality is measured with the Spiritual Attitude and Involvement List (SAIL) [58] and consists of 26 items divided into the subscales meaningfulness trust acceptance caring for others connectedness with nature transcendent experiences and spiritual activities. The internal consistency varied from .74 to .88 and test-retest reliability varied from .77 to .92. All subscales except for connectedness with nature were related with the Functional Assessment of Chronic Illness Therapy “ Spiritual Well-Being Scale. Costs (only for patients) The cost-effectiveness evaluation is carried out from a societal perspective considering direct as well as indirect health costs. Data on costs are collected prospectively using a diary in which participants register a) health care utilization: the type of care and its duration and b) cancer-related absence from work. Unit cost estimates are derived from the national manual for cost prices in the health care sector [59]. Costs of reduced ability to work are estimated using the friction costs method which results in a more realistic estimate than the human capital approach [60]. Treatment costs of MBSR are calculated using activity-based-costing methods thus measuring actual resources (time of therapist time of patients facilities) used. All unit cost prices are adjusted to 2013 prices. Unit cost estimates are combined with resource utilization data to obtain a net cost per patient over the entire follow-up period. Process measures Mindfulness skills are examined with the 39-item Five Facet Mindfulness Questionnaire (FFMQ) [6162]. The FFMQ is based on an exploratory factor analysis of five mindfulness measures which allowed items from different instruments to form factors providing an empirical integration of these independent attempts to operationalize mindfulness. This led to the following five subscales: observing describing acting with awareness non-judging of inner experience and non-reactivity to inner experience. Internal consistency varied from .72 to .93 among the different subscales. Most subscales were related to meditation experience Psychological Well-Being scales and psychological symptoms including the Brief Symptom Inventory [61]. FFMQ is sensitive to change in mindfulness-based interventions and is found to mediate the relationship between mindfulness practice and improvements in psychological symptoms (e.g. [63]). Self-compassion is assessed with the Self Compassion Scale (SCS) [6465] which has 26 items and is divided into six subscales: self-kindness versus self-judgment common humanity versus isolation and mindfulness versus over-identification. Internal consistency of the different subscales varied from .75 to .81 and test-retest reliability varied from .80 to .93. SCS correlated moderately with self-esteem measures including the Rosenberg Self-Esteem Scale. Furthermore whereas the self-esteem measures correlated significantly with the Narcissistic Personality Inventory the SCS was unrelated to narcissism [64]. SCS is sensitive to change through mindfulness-based interventions and is found to mediate MBCT™s treatment effects [66]. To measure rumination we administered the extended version of the Ruminative Response Scale (RRS-EXT) [67] Raes and Hermans: The revised version of the Dutch Ruminative Response Scale unpublished instrument]. The RRS-EXT contains 26 items in which a more adaptive thinking style (i.e. reflection) is distinguished from a more maladaptive one (i.e. brooding). Internal consistency varied from .72 to .77 and test-retest reliability varied from .60 to .62 for the brooding and reflection subscales. The concept of rumination seems to be sensitive to change through mindfulness-based interventions and has been shown to mediate the effect of MBSR on depressive symptoms in oncology patients [68]. The psychological stress reaction is measured with the 15-item Impact of Event Scale (IES) [6970] which assesses two categories of responses: intrusive experiences and avoidance of thoughts and images associated with the event. Internal consistency varied from .65 to .92 [71] and test-retest reliability varied from .79 to .87 among the subscales [69]. IES correlated with anxiety and depression subscales of the General Health Questionaire. Adherence to MBSR is assessed during the entire study period with a calendar on which participants in the MBSR condition fill out on a daily basis whether they adhere to the mindfulness exercises: either formal practice (e.g. meditation exercise like the bodyscan) informal practice (e.g. activity with awareness) or no exercise. Adherence to MBSR has been shown to mediate the effects of MBCT on depressive symptoms [72]. Statistical analysis plan Sample size To determine the required sample size first the sample size was calculated that would be needed for a simple t-test and subsequently it was corrected for clustering repeated measurements and baseline. A two-sided t-test on the total HADS score [3940] (i.e. our primary outcome measure examining psychological distress (HADS-total) anxiety symptoms (HADS-A) and depressive symptoms (HADS-D)) would require 64 participants in each group to have 80% power to detect a medium-sized difference (effect size = 0.5) with alpha = 0.05. To correct for clustering we multiplied this sample size of 64 with the design factor (1 + (n ? 1) * ICC) where n denotes the cluster size and where ICC denotes the intra-cluster correlation. In our study the treatment groups will consist of 14 people of whom about 7 will be patients. With n = 7 and an estimated ICC = 0.01. [72] the correction factor equals 1.06. To correct for repeated measurements and the use of the baseline measurement as a covariate we multiplied the required sample size by the design factor 1+?/2??02 where ? denotes the correlation between the post-treatment HADS measurements and ?0 denotes the correlation between the baseline HADS with the post-treatment HADS measurements. With ? = 0.8 and ? = 0.5 as conservative estimates the second design factor equals 0.65. Consequently after correction for clustering and covariates we arrived at a required sample size of 0.65 * 1.06 * 64 = 44 patients per arm. So 88 patients with lung cancer would be required for the study. Based on our pilot study [van den Hurk Schellekens Molema Speckens and van der Drift in preparation] we expect a 20% drop-out rate. Therefore we intend to include 110 patients and 110 partners. Primary analyses The samples of lung cancer patients and partners will be analyzed separately. Baseline characteristics of the population will be compared between MBSR and control group to ensure that key variables were evenly distributed by randomization. First analyses will be based on the intention-to-treat approach. Next we will perform per-protocol analyses with the treatment-adherent sample (i.e. in the MBSR condition participants have to attend at least four of the eight MBSR sessions [73] and in the TAU condition participants do not attend a mindfulness-based programme). We will use linear mixed models to analyze all outcome variables (i.e. psychological distress quality of life (only for patient) caregiver appraisal (only for partner) relationship quality and spirituality) with treatment as fixed factor baseline measurement as covariate and a random intercept based on MBSR group. This procedure will use all observed data in our analyses. In addition Cohen™s d effect size [74] will be reported based on the difference between the group means on baseline and follow-up scores divided by the pooled standard deviation at baseline and follow-up. Secondary analyses Cost effectiveness The quality of life measures (i.e. QLQ-C30; QLQ-LC13) will be used to calculate Quality of Adjusted Life Years (QALYs) for each individual. Costs and effects (in terms of QALYs) will be combined in the incremental cost-effectiveness ratio (ICER). The ICER expresses cost-effectiveness in terms of incremental costs per QALY gained. To estimate confidence intervals for the mean of the ICER a non-parametric bootstrapping method will be used performing 1000 replications of the original data. In order to express the implications of the cost-effectiveness results more clearly a cost-acceptability curve will be constructed. In case of dominance a full cost analysis will be conducted to estimate the mean savings per patient per year. Mediation analyses To examine the possible underlying mechanisms of change in MBSR mediation analyses will be conducted. Only the data of the treatment-adherent sample will be included in these analyses. By means of a multiple mediation model suggested by Preacher and Hayes [75] we will test the mediating effect of mindfulness skills self-compassion rumination and adherence to MBSR on psychological distress quality of life (only in patients) caregiver appraisal (only in partners) relationship quality and spirituality. Discussion In the last ten years MBSR has not only proven to be a feasible and acceptable intervention in cancer patients [76] but it also seems to be effective in reducing psychological distress [30]. However the generalization of these results is limited because most participants were female patients with breast cancer. A large part of lung cancer patients already have advanced cancer at time of diagnosis and are confronted with a poor prognosis and low health status. Consequently they more often report psychological distress than patients with other diagnoses of cancer [89]. Hence it is not yet clear whether MBSR is a feasible acceptable and effective intervention in patients with lung cancer. Moreover little is known about the effectiveness of MBSR in partners of cancer patients [30] though they also often report psychological distress. Our pilot study of 19 lung cancer patients and 16 partners participating in an MBSR course provides preliminary evidence that MBSR is feasible and acceptable in this population (van den Hurk Schellekens Molema Speckens and van der Drift in preparation). The current trial will answer the question whether MBSR is effective in patients with lung cancer and their partners. We started enrolment of participants in February 2012. At the moment we think recruiting a sufficient number of patients and partners will be a challenge due to rapidly fluctuating health status and sudden changes in cancer treatment [77]. The main reasons for declining participation in patients is ˜being too ill™ or that it is ˜too much of a burden during chemo and/or radiotherapy™. Furthermore no perceived need or motivation for the training is commonly mentioned. Among partners participation is highly depending on whether the patient is willing to participate. Although partners can take part separately partners who are interested do often not participate when the patients decline participation. Considering the difficulty of studying lung cancer patients and their partners [77] our trial will offer valuable information on whether MBSR as one of the few available psychosocial care programmes contributes to the alleviation of their psychological distress. Abbreviations MBSR: Mindfulness-based stress reduction; RCT: Randomized controlled trial; RUNMC: Radboud University Nijmegen Medical Centre; MBCT: Mindfulness-based cognitive therapy; MMSE: Mini mental state examination; DT: Distress thermometer; HADS: Hospital anxiety and depression scale; QLQ-C30: Quality of life “ cancer; QLQ-LC13: Quality of life “ lung cancer; SIP: Sickness impact profile; SPPIC: Self-perceived pressure from informal care; CRA-SE: Caregiver reaction assessment “ care-derived self-esteem; IMS-S: Investment model scale-satisfaction; MIS: Mutuality and interpersonal sensitivity; SAIL: Spiritual attitude and involvement list; FFMQ: Five facet mindfulness questionnaire; SCS: Self-compassion scale; RRS-EXT: Rumination response scale “ extended version; IES: Impact of event scale. Competing interests The authors declare that they have no competing interests. Authors™ contributions All authors contributed to the design of the study. AS MD and JP are the principal investigators of the study. MS drafted the paper which was modified and supplemented by all other authors. DH MS and MD are involved in recruiting participants while MS and DH take care of the logistics of the study and data collection. RD contributed specifically to the statistical analysis plan and WW contributed specifically to the design of the cost-effectiveness evaluation. All authors read and approved the final manuscript. Pre-publication history The pre-publication history for this paper can be accessed here: http://www.biomedcentral.com/1471-2407/14/3/prepub Acknowledgements This research is funded by Foundation Alpe d™HuZes and the Dutch Cancer Society (Grant number KUN 2011“5077 awarded to Prof. dr. Anne E. M. Speckens Dr. Miep A. van der Drift and Prof. dr. Judith B. Prins). Jemal A Bray F Center MM Ferlay J Ward E Forman D Global cancer statistics CA Cancer J Clin 2011 61 2 69 90 10.3322/caac.20107 21296855 Akechi T Okamura H Nishiwaki Y Uchitomi Y Psychiatric disorders and associated and predictive factors in patients with unresectable nonsmall cell lung carcinoma: a longitudinal study Cancer 2001 92 10 2609 2622 10.1002/1097-0142(20011115)92:10<2609::AID-CNCR1614>3.0.CO;2-K 11745196 Uchitomi Y Mikami I Kugaya A Akizuki N Nagai K Nishiwaki Y Akechi T Okamura H Depression after successful treatment for nonsmall cell lung carcinoma: a 3-month follow-up study Cancer 2000 89 5 1172 1179 10.1002/1097-0142(20000901)89:5<1172::AID-CNCR27>3.0.CO;2-U 10964348 Montazeri A Milroy R Hole D McEwen J Gillis CR Anxiety and depression in patients with lung cancer before and after diagnosis: findings from a population in Glasgow Scotland J Epidemiol Community Health 1998 52 3 203 204 10.1136/jech.52.3.203 9616429 Hyodo I Eguchi K Takigawa N Segawa Y Hosokawa Y Kamejima K Inoue R Psychological impact of informed consent in hospitalized cancer patients: a sequential study of anxiety and depression using the Hospital Anxiety and Depression scale Support Care Cancer 1999 7 6 396 399 10.1007/s005200050299 10541981 Turner NJ Muers MF Haward RA Mulley GP Psychological distress and concerns of elderly patients treated with palliative radiotherapy for lung cancer Psychooncology 2007 16 8 707 713 10.1002/pon.1109 17115458 Hopwood P Stephens RJ Depression in patients with lung cancer: prevalence and risk factors derived from quality-of-life data J Clin Oncol 2000 18 4 893 903 10673533 Zabora J Brintzenhofeszoc K Curbow B Hooker C Piantadosi S The prevalence of psychological distress by cancer site Psychooncology 2001 10 1 19 28 10.1002/1099-1611(200101/02)10:1<19::AID-PON501>3.0.CO;2-6 11180574 Carlson LE Angen M Cullum J Goodey E Koopmans J Lamont L MacRae JH Martin M Pelletier G Robinson J High levels of untreated distress and fatigue in cancer patients Br J Cancer 2004 90 12 2297 2304 15162149 Temel JS Greer JA Muzikansky A Gallagher ER Admane S Jackson VA Dahlin CM Blinderman CD Jacobsen J Pirl WF Early Palliative Care for Patients with Metastatic Non-Small-Cell Lung Cancer N Engl J Med 2010 363 8 733 742 10.1056/NEJMoa1000678 20818875 Abernethy AD Chang HT Seidlitz L Evinger JS Duberstein PR Religious coping and depression among spouses of people with lung cancer Psychosomatics 2002 43 6 456 463 10.1176/appi.psy.43.6.456 12444228 Thielemann PA Conner NE Social support as a mediator of depression in caregivers of patients with end-stage disease J Hosp Palliat Nurs 2009 11 2 82 90 10.1097/NJH.0b013e31819974f9 Pinquart M Duberstein PR Optimism pessimism and depressive symptoms in spouses of lung cancer patients Psychol Health 2005 20 5 565 578 10.1080/08870440412331337101 Kim Y Duberstein PR Sorensen S Larson MR Levels of depressive symptoms in spouses of people with lung cancer: effects of personality social support and caregiving burden Psychosomatics 2005 46 2 123 130 10.1176/appi.psy.46.2.123 15774950 Mosher CE Jaynes HA Hanna N Ostroff JS Distressed family caregivers of lung cancer patients: an examination of psychosocial and practical challenges Support Care Cancer 2013 21 2 431 437 10.1007/s00520-012-1532-6 22797839 Mosher CE Bakas T Champion VL Physical health mental health and life changes among family caregivers of patients with lung cancer Oncol Nurs Forum 2013 40 1 53 61 10.1188/13.ONF.53-61 23269770 Ostlund U Wennman-Larsen A Persson C Gustavsson P Wengstrom Y Mental health in significant others of patients dying from lung cancer Psychooncology 2010 19 1 29 37 10.1002/pon.1433 19253315 Wennman-Larsen A Persson C Ostlund U Wengstrom Y Gustavsson JP Development in quality of relationship between the significant other and the lung cancer patient as perceived by the significant other Eur J Oncol Nurs 2008 12 5 430 435 10.1016/j.ejon.2008.07.004 18845476 Siminoff LA Wilson-Genderson M Baker S Jr Depressive symptoms in lung cancer patients and their family caregivers and the influence of family environment Psychooncology 2010 19 12 1285 1293 10.1002/pon.1696 20119935 Manne S Badr H Intimacy processes and psychological distress among couples coping with head and neck or lung cancers Psychooncology 2010 19 9 941 954 10.1002/pon.1645 19885852 Badr H Taylor CLC Effects of relationship maintenance on psychological distress and dyadic adjustment among couples coping with lung cancer Health Psychol 2008 27 5 616 627 18823188 Buccheri G Depressive reactions to lung cancer are common and often followed by a poor outcome Eur Respir J 1998 11 1 173 178 10.1183/09031936.98.11010173 9543289 Walker J Sawhney A Hansen CH Symeonides S Martin P Murray G Sharpe M Treatment of depression in people with lung cancer: a systematic review Lung Cancer 2013 79 1 46 53 10.1016/j.lungcan.2012.09.014 23102652 Follwell M Burman D Le LW Wakimoto K Seccareccia D Bryson J Rodin G Zimmermann C Phase II study of an outpatient palliative care intervention in patients with metastatic cancer J Clin Oncol 2009 27 2 206 213 10.1200/JCO.2008.17.7568 19064979 Jordhoy MS Fayers P Loge JH Ahlner-Elmqvist M Kaasa S Quality of life in palliative cancer care: results from a cluster randomized trial J Clin Oncol 2001 19 18 3884 3894 11559726 Gustafson DH DuBenske LL Namkoong K Hawkins R Chih M-Y Atwood AK Johnson R Bhattacharya A Carmack CL Traynor AM An eHealth system supporting palliative care for patients with non“small cell lung cancer Cancer 2013 119 9 1744 1751 10.1002/cncr.27939 23355273 Greer JA Pirl WF Jackson VA Muzikansky A Lennes IT Heist RS Gallagher ER Temel JS Effect of early palliative care on chemotherapy use and end-of-life care in patients with metastatic non-small-cell lung cancer J Clin Oncol 2012 30 4 394 400 10.1200/JCO.2011.35.7996 22203758 Kabat-zinn J Full catastrophe living: using the wisdom of your body and mind to face stress pain and illness 1990 New York: Delacourt Segal ZV Williams JMG Teasdale JD Mindfulness-Based Cognitive Therapy for depression: a new approach to preventing relapse 2002 New York: Guilford Press Piet J Wurtzen H Zachariae R The effect of Mindfulness-Based Therapy on symptomps of anxiety and depression in adult cancer patients and survivors: a systematic review and meta-analysis J Consult Clin Psychol 2012 80 6 1007 1020 22563637 Birnie K Garland SN Carlson LE Psychological benefits for cancer patients and their partners participating in Mindfulness-Based Stress Reduction (MBSR) Psychooncology 2010 19 9 1004 1009 10.1002/pon.1651 19918956 Hagedoorn M Sanderman R Bolks HN Tuinstra J Coyne JC Distress in couples coping with cancer: a meta-analysis and critical review of role and gender effects Psychol Bull 2008 134 1 1 30 18193993 Folstein MF Folstein SE McHugh PR Mini-mental state: practical method for grading cognitive state of patiens for clinician J Psychiatr Res 1975 12 3 189 198 10.1016/0022-3956(75)90026-6 1202204 Roth AJ Kornblith AB Batel-Copel L Peabody E Scher HI Holland JC Rapid screening for psychologic distress in men with prostate carcinoma Cancer 1998 82 10 1904 1908 10.1002/(SICI)1097-0142(19980515)82:10<1904::AID-CNCR13>3.0.CO;2-X 9587123 Tuinman MA Gazendam-Donofrio SM Hoekstra-Weebers JE Screening and referral for psychosocial distress in oncologic practice Cancer 2008 113 4 870 878 10.1002/cncr.23622 18618581 Kübler-Ross E On death and dying 1969 New York: Macmillan MBSR teacher certification pathway: complete checklist"

Lung_Cancer

"We therefore envision that the effects of phenothiazines per se as well as its potential chemosensitizing properties can help improve the outcome for relapsed SCLC patients who no longer respond to conventional treatment. In summary the present work uncovered a novel activity of phenothiazines as agents capable of inhibiting survival and inducing cell death in human SCLC () a tumor type that is notoriously difficult to treat with conventional CT because of its ability to rapidly acquire resistance. Moreover we provide evidence showing that phenothiazine-induced disruption of lysosomal functions is critically required for phenothiazine-induced cell death effects with SCLC especially susceptible because of their inherently low lysosomal number and/or pH. Finally our data suggest that analysis of intrinsic lysosomal functions may identify SCLC cases that are most likely to respond to phenothiazine-based regimens however extended cell line analyses as well as in vivo studies are needed to formulate such . On the basis of these findings we conclude that phenothiazines are suitable lead compounds for further development of lysosome-targeted treatment to combat SCLC and which merit further analysis for antitumor efficacy in patient-derived xenograft models and/or genetically modified mice models of SCLC. Materials and Methods Cells lines and culture conditions The following human LC cell lines were used: H69 H82 H592 U-1258 U-1568 U-1690 U-1906 and U-2020 (all SCLC); A549 H125 H1299 H157 H23 H661 U-1752 and U-1810 (all NSCLC). Cell lines whose name begin with the letter ˜U' were established at the University of Uppsala Sweden while others were obtained from American Type Culture Collection (ATCC Manassas VA USA) or Coriell Cell Repositories (Camden NJ USA). The characteristics of these cell lines as well as for some of them their p53 status is indicated in Supplementary Table S1. For comparison we also used the non-cancerous cell line WI-38 (primary fetal lung fibroblasts).32 WI-38 was grown in MEM medium containing L-glutamine and supplemented with 15% fetal bovine serum (FBS). All other cell lines were maintained in RPMI-1640 medium containing L-glutamine and supplemented with 10% FBS. Chemicals and reagents TFP FPZ CPZ TFPZ PZ (all from Sigma-Aldrich Stockholm Sweden) and cis-FPX (H Lundbeck A/S Copenhangen Denmark) were prepared in dimethyl sulfoxide and used at a final concentration of 0“20??M. TMX CQ diphosphate BafA1 NH4Cl N-(6-aminohexyl)-5-chloro-1-naphthalenesulfonamide hydrochloride (W7) L-741626 acridine orange fluorescein di-?-D-galactopyranoside (FDG) and carboxyfluorescein diacetate N-succinimidyl ester (CFSE) were from Sigma-Aldrich. z-VAD-fmk E-64d and CHX were from BD PharMingen (San Jose CA USA) Enzo Life Sciences (Ann Arbor MI USA) and Sigma-Aldrich respectively. PI tetramethylrhodamine ethyl ester perchlorate (TMRE) and LysoTracker Green DND-26 were from Invitrogen Stockholm Sweden. Cell viability analysis Cell viability was analyzed with MTT (3-(45-dimethylthiazol-2-yl)-25-diphenyl-tetrazolium bromide) assay as previously described.33 Briefly 5000“10?000 cells per well were seeded in 96-well plates. Twenty-four hours after seeding cells were subjected to a concentration range of phenothiazines alone as indicated in the figures or were treated with cisplatin gemcitabine or etoposide. Cell viability was determined after 72?h of continuous treatment where the viability of untreated cells was arbitrary set to 1. Alternatively area under the curve was calculated in the GraphPad Prism software (GraphPad Prism Software Inc. La Jolla CA USA). Cytotoxicity values reported in and Supplementary Figure S1 were calculated by the following formula: cytotoxicity=100%?viability (%). Flow cytometry Fluorescent probe-based analyses of intracellular anelles were performed in non-fixed cells. Labeling of lysosomes was performed using LysoTracker Green DND-26 (50?nM 1?h). Lysosome-associated ?-gal activity was assayed by enzymatic cleavage of FDG (50??M 30?min). Mitochondrial transmembrane potential was determined by retention of the potentiometric dye TMRE (50?nM 30?min). Cellular proliferative capacity was assessed using the CFSE-labeling method as previously described.34 DNA content analysis was performed in ethanol-fixed cells by PI staining. At least 10?000 events were recorded on a Becton-Dickinson FACSCalibur flow cytometer (BD Biosciences San Jose CA USA). Data analysis was conducted using the built-in Cell Quest software of FACSCalibur flow cytometer (BD Biosciences). Cell cycle distribution was assigned using ModFit (Verity Software House Topsham ME USA). Microscopy Gross morphology of cells was examined under a Nikon Eclipse TS100 light microscope (Nikon Instruments Europe B.V. Amsterdam The Netherlands) at — 10 magnification. Immunoblotting Whole-cell lysate (WCL) was obtained by lysing cells in radio-immunoprecipitation assay buffer (50?mM Tris-HCl pH 7.4 150?mM NaCl 1?mM ethylenediaminetetraacetic acid 0.1% Na-deoxycholate 1% NP-40) supplemented with protease and phosphatase inhibitor cocktail tablets (Roche Diagnostics AB Stockholm Sweden). "

Lung_Cancer

"To understand the functional consequences of GWAS loci is challenging and multiple principles for post-GWAS™ functional characterization of genetic loci have been proposed including the exploration of epigenetic mechanisms46. In our study the top GWAS lung cancer loci were strongly associated with methylation levels of CpG sites in nearby gene bodies through cis-regulation and adjusting for smoking status or intensity did not change the results. Furthermore SNPs affecting the DNA methylation of gene bodies (which are typically methylated) were also collectively associated with risk for squamous cell carcinoma after excluding the established GWAS loci and were enriched for genes in cancer pathways. In contrast no enrichment was observed for SNPs affecting the methylation of gene promoters or CGI regions which are typically not methylated in normal tissues. This suggests a potential novel mechanism for genetic effects on cancer risk. In fact gene body-enriched cis-meQTLs outside CGI regions may increase the risk for germline and somatic mutations due to their increased propensity to become mutated1112. Upon spontaneous hydrolytic deamination methylated cytosine residues turn into thymine which are less likely to be efficiently repaired than the uracils that result from deamination of unmethylated cytosine residues. For example about 25% of mutations in TP53 in cancers are thought to be due to epigenetic effects47. Indeed analyses of comprehensive human catalogues of lung tumors have identified frequent G>T mutations enriched for CpG dinucleotides outside CGI regions suggesting a role for methylated cytosine since CGI as we confirmed are usually unmethylated48. A similar signature was recently observed in other tumors14. Thus inherited genetic variation may have a profound impact on carcinogenesis by regulating the human methylome. We observed a high similarity of genetic control on DNA methylation across tissues. Since tissue of origin determines cancer-associated CpG island promoter hypermethylation patterns49 a natural question is whether the genetic regulation of methylation is tissue specific. While the tissue-specificity of eQTLs has been investigated for a few tissues50 for cis-meQTL only a recent investigation was conducted6 showing that 35.7% of 88751 cis meQTLs detected in 662 adipose samples were replicated in ~200 whole blood samples. We found that a large proportion of meQTLs in EAGLE lung samples particularly those with large effect sizes were robustly replicated in breast and kidney tissue samples from TCGA suggesting a high similarity of genetic regulation of methylation across these tissues and related impact on somatic mutation rates1448. The lower replication rate of adipose meQTLs in whole-blood samples6 might be explained by the heterogeneity of different cell types in whole blood and by their more liberal P-value threshold (8.6—10?4) which led to the identification of a large number of weak cis-meQTLs. Compared with cis-regulation trans-eQTL regulation is typically considered to be more complex has smaller effect sizes and is more difficult to be replicated even in the same tissue. However in our study the lung trans-meQTLs are highly reproducible in TCGA lung breast and kidney tissues. Notably this similarity allows mapping meQTLs with substantially improved power by borrowing strength across tissues51. meQTL SNPs are strongly associated with multiple epigenetic marks. Chromatin regulators play a role in maintaining genomic integrity and anization52. We found that meQTL SNPs were strongly enriched for DNase hypersensitive sites and sequences bound by CTCF or modified histones. SNPs could affect these epigenetic marks by several mechanisms such as by affecting the core recognition sequences (exemplified for rs2816057 on chromosome 1 for CTCF) causing loss or gain of a CpG within a binding region which when methylated could affect binding27 or altering the binding sequence for interacting factors53. CTCF could cause changes in epigenetic marks through its multiple key roles including genome anization through mediating intra- and inter-chromosomal contacts5455 the regulation of transcription by binding between enhancers and promoters5456 and the regulation of splicing which may impact tissue specificity during tissue development39. These changes can impact regulation of distant genes and not the genes proximal to the SNPs that would be typically investigated in eQTL studies. This may be one reason for the previously observed lack of correlation between eQTLs and meQTLs347. Future large studies integrating SNP profiles the DNA methylome and transcriptome data through tissue developmental stages will hopefully shed light on this possibility. There may be a myriad of other DNA-binding factors whose binding is directly or indirectly affected by SNPs. For example among the histone marks the strongest enrichment of meQTLs in our study was for H3K4me3 in both SAEC and hAEC cell types. As H3K4me3 is the chromatin mark primarily associated with regulatory elements at promoters and enhancers this suggests a strong influence of meQTLs on regulating gene activity. Unfortunately transcription factor binding data in SAEC or hAEC are not available so we could not test whether SNPs in their core sequence could affect the deposition of epigenetic marks e.g. by recruiting DNA methyltransferases57. It will be important to obtain ChIP data from relevant primary cells for numerous DNA-binding regulatory factors to further elucidate the mechanisms whereby meQTLs and other SNP-affected epigenetic marks arise. In we show here that genetic variation has a profound impact on the DNA methylome with implications for cancer risk tissue specificity and chromatin structure and anization. The meQTL data (Supplementary Data) attached to this manuscript provides an important resource for studying genetic-DNA methylation interactions in lung tissue. Methods Sample collection We assayed 244 fresh frozen paired tumor and non-involved lung tissue samples from Stage I to IIIA non-small cell lung cancer (NSCLC) cases from the Environment And Genetics in Lung cancer Etiology (EAGLE) study18. EAGLE includes 2100 incident lung cancer cases and 2120 population controls enrolled in 2002“2005 within 216 municipalities of the Lombardy region of Italy. Cases were newly diagnosed primary cancers of lung trachea and bronchus verified by tissue pathology (67.0%) cytology (28.0%) or review of clinical records (5.0%). They were 35?79 years of age at diagnosis and were recruited from 13 hospitals which cover over 80% of the lung cancer cases from the study area. The study was approved by local and NCI Institutional Review Boards and all participants signed an informed consent form. Lung tissue samples were snap-frozen in liquid nitrogen within 20 minutes of surgical resection. Surgeons and pathologists were together in the surgery room at the time of resection and sample collection to ensure correct sampling of tissue from the tumor the area adjacent to the tumor and an additional area distant from the tumor (1“5 cm). The precise site of tissue sampling was indicated on a lung drawing and the pathologists classified the samples as tumor adjacent lung tissue and distant non-involved lung tissue. For the current study we used lung tissue sampled from an area distant from the tumor to reduce the potential effects of field cancerization. DNA methylation profiling and data quality control Fresh frozen lung tissue samples remained frozen while approximately 30 mg was subsampled for DNA extraction into pre-chilled 2.0 ml microcentrifuge tubes. Lysates for DNA extraction were generated by incubating 30 mg of tissue in 1 ml of 0.2 mg/ml Proteinase K (Ambion) in DNA Lysis Buffer (10 mM Tris-Cl (pH 8.0) 0.1 M EDTA (pH 8.0) and 0.5% (w/v) SDS) for 24 hrs at 56°C with shaking at 850 rpm in Thermomixer R (Eppendorf). DNA was extracted from the generated lysate using the QIAamp DNA Blood Maxi Kit (Qiagen) according to the manufacturer™s protocol. Bisulfite treatment and Illumina Infinium HumanMethylation450 BeadChip assays were performed by the Southern California Genotyping Consortium at the University of California Los Angeles (UCLA) following Illumina™s protocols. This assay generates DNA methylation data for 485512 cytosine targets (482421 CpG and 3091 CpH) and 65 SNP probes for the purpose of data quality control. Raw methylated and unmethylated intensities were background corrected and dye-bias equalized to correct for technical variation in signal between arrays. For background correction we applied a normal-exponential convolution using the intensity of the Infinium I probes in the channel opposite their design to measure non-specific signal58. Dye-bias equalization used a global scaling factor computed from the ratio of the average red and green fluorescing normalization control probes. Both methods were conducted using the methylumi package in Bioconductor version 2.11. For each probe DNA methylation level is summarized as a ?-value estimated as the fraction of signal intensity obtained from the methylated beads over the total signal intensity. Probes with detection P-values of >0.05 were considered not significantly different from background noise and were labeled as missing. Methylation probes were excluded from meQTL analysis if any of the following criteria was met: on X/Y chromosome annotated in repetitive genomic regions annotated to harbor SNPs missing rate>5%. Because the ?-values for the 65 SNP probes are expected to be similar in matched pair of normal and tumor tissues we performed principal component analysis (PCA) using these 65 SNP probes to confirm the labeled pairs. We then performed PCA using the 5000 most variable methylation probes with var>0.02 and found that the normal tissues were clustered together and well separated from the tumor tissues. We further excluded 5 normal tissues that were relatively close to the tumor cluster. From the remaining 239 normal tissue samples we analyzed 210 with genotype data from a previous GWAS of lung cancer20. Genotype data and genetic association analysis The blood samples were genotyped using the Illumina HumanHap550K SNP arrays in EAGLE GWAS20. The SNPs with call rate >99% minor allele frequency (MAF) >3% and Hardy-Weinberg Equilibrium (HWE) P-value >10?5 were included for analysis. Prior to meQTL analysis each methylation trait was regressed against sex age batches and PCA scores based on methylation profiles. The regression residues were then quantile-normalized to the standard normal distribution N(01) as traits. The genetic association testing was performed using PLINK and R adjusted for the top three PCA scores based on GWAS SNPs to control for potential population stratification. Identification of cis-meQTLs For each CpG methylation probe the cis region was defined as being less than 500kb upstream and downstream from the target CpG-site (1Mb total). A methylation trait was detected to harbor a cis-meQTL if any SNP in the cis region had a SNP-CpG nominal association P-value less than P0 where P0 was chosen to control FDR at 5% by permutations. Here we describe a permutation procedure to choose P0 to control FDR at 5%. For a given P0 let N(P0) be the total number of CpG probes with detected cis-meQTLs and N0(P0) the expected number of CpG probes falsely determined to have cis-meQTLs. FDR is defined as N0(P0)/N(P0). The key is to estimate N0(P0) under the global null hypothesis that no CpG probe has cis-meQTLs. We randomly permuted the genotypes across subjects for 100 times keeping the correlation structure of the 338456 methylation traits in each permutation. Then N0(P0) was estimated as the average number of methylation traits that were detected to harbor cis-meQTL SNPs with nominal P<P0. Control FDR at 5% requires P0=4.0—10?5. The same procedure was applied to detect secondary independently associated cis-meQTL SNPs. With our sample size h2>0.12 is required to detect cis-meQTLs with power greater than 0.8. We note that although we excluded all CpG probes annotated with SNPs there is still the possibility that rare not annotated variants could be associated with the cis-meQTL SNPs. However since common variants and rare variants are known to be poorly correlated and rare variants are uncommon by definition we do not expect this event to be frequent. Identification of trans-meQTLs For each CpG probe the trans region was defined as being more than 500kb from the target CpG-site in the same chromosome or on different chromosomes. For the kth methylation trait with m SNPs in the trans region let (qk1?qkm) be the P-values for testing the marginal association between the trait and the m SNPs. Let pk=min(qk1?qkm) be the minimum P-value for m SNPs and converted pk into genome-wide P-value Pk by performing one million permutations for SNPs in the trans region. Because a cis region is very short (~1M) compared to the whole genome (~3000M) Pk computed based on SNPs in trans regions is very close to that based on permutations using genome-wide SNPs. Thus we use the genome-wide p-value computed based on all SNPs to approximate Pk. Furthermore all quantile-normalized traits follow the same standard normal distribution N(01); thus the permutation-based null distributions are the same for all traits. We then applied the Benjamini-Hochberg procedure to (P1?PN) to identify trans-meQTLs by controlling FDR at 5%. With our sample size h2 >0.24 is required to detect trans-meQTLs with power greater than 0.8. Replication of meQTLs in TCGA samples The replication was performed in TCGA histologically normal tissue samples that had genome-wide genotype (Affymetrix Genome-Wide Human SNP Array 6.0) and methylation profiling (Illumina Infinium HumanMethylation450 BeadChip). We downloaded genotype (level 2) and methylation data (level 3) from the TCGA website22. We also downloaded methylation data for tumor tissue samples and performed PCA analysis to confirm that normal tissue samples were separated from tumor tissue samples. Autosomal SNPs with MAF >3% calling rate >0.99 and HWE P-value > 10?5 were included for imputation using IMPUTE259 and reference haplotypes in the 1000 Genome Project60 (version 2012/03). We only included samples of European ancestry based on EIGENSTRAT analysis. The replication set had 65 lung 87 breast and 142 kidney histologically normal tissue samples after QC. Again each methylation trait was regressed against sex age batches and PCA scores based on methylation profiles. The regression residues were then quantile-normalized to the standard normal distribution N(01) as traits for meQTL analysis. The associations were tested between the quantile-normalized methylation traits and imputed genotypic dosages adjusting for sex age and PCA scores based on SNPs. A genetic association detected in EAGLE lung data was considered replicated if the association had the same direction and FDR<0.05 based on single-sided P-values. Testing genetic associations with methylation and gene expression traits We downloaded gene expression data (level 3) from RNA-seq analysis of 59 histologically normal tissue samples from NSCL patients from TCGA. All samples also had genome-wide genotype data and 28 samples had additional methylation data from Illumina Infinium HumanMethylation450 BeadChips. Regression analysis was performed to test the association of gene expression with methylation levels in the CHRNA5 gene and with methylation levels in PABPC4 STARD3 and SLC35A3 genes. We tested the association between lung cancer GWAS risk SNPs and gene expression using regression analysis under an additive model adjusting for age sex and PCA scores based on genome-wide SNPs. Testing for enrichment of cis-meQTLs in lung cancer GWAS We tested for enrichment in NCI lung cancer GWAS of European ancestry which included three main histologic subtypes of lung cancer (adenocarcinoma (AD) squamous cell carcinoma (SQ) small cell carcinoma (SC)) and a small number of other lung cancer subtypes. We investigated whether the identified cis-meQTL SNPs were collectively associated with lung cancer risk which was tested by examining whether the GWAS P-values for these SNPs deviated from the uniform distribution (i.e. no enrichment). Because the high linkage disequilibrium (LD) in SNPs increased variability of the enrichment statistic and caused a loss of power we first performed LD-pruning using PLINK so that no pair of remaining SNPs had a r2 ?0.8. The enrichment significance was evaluated by 10000 random permutations. The genomic control ?-values61 based on genome-wide SNPs were 1.010.995 0.977 and 1.00 for overall lung cancer AD SC and SQ respectively. Thus the type-I error rates of our enrichment tests were not inflated. The detailed procedure for testing a set of cis-meQTL SNPs is described as follows: Firstly we performed LD-pruning using PLINK so that no pair of remaining SNPs had an r2 ?0.8. Secondly we tested the association for the LD-pruned SNPs (assuming K SNPs left) in a GWAS and computed the P-values (p1?pK). We then tested whether (p1?pK) followed a uniform distribution i.e. no enrichment. Thirdly we transformed P-values into ?12 quantitles qk = F?1(1 ? pk) with F(·) being the cumulative distribution function (CDF) of ?12. We defined a statistic for testing enrichment as Q=?k=1Klog(1?f+fexp(qk/2))3562 where f is a pre-specified constant reflecting the expected proportion of SNPs associated with the disease. Because only a small proportion of SNPs may be associated with the disease we set f=0.05 for this paper. The statistical power was insensitive to the choice of f in the range of [0.01 0.1]62. Finally the significance of the test Q was evaluated by 10000 random permutations. meQTL mediation analysis We investigated whether trans associations were mediated by the methylation levels of CpG probes nearby the trans-acting SNPs. Note that this analysis was only for trans associations with cis effects i.e. the SNP was associated with at least one proximal CpG probes with p<4—10?5. See Fig. 2c. Suppose a SNP G cis-regulates K proximal (<500kb) CpG sites A1?AK with P<4—10?5 and trans-regulates a distal CpG site B. We performed a linear regression: B~?+?G +?kAk. We also computed marginal correlation coefficient cor(GB) and partial correlation coefficient cor(GB|Ak) using an R package œppcor63. A full mediation was detected if G and B were not significantly correlated after conditioning on Ak or equivalently G was not significant (p>0.01) in regression analysis B~?+?G +?kAk for any k. A partial mediation was detected if any Ak had a P<0.05/K (Bonferroni correction) in the regression analysis and |cor(GB)|?| cor(GB|A) |>0.1. An independent effect model (i.e. no mediation) was detected otherwise. Testing enrichment of meQTL SNPs in regulatory regions We obtained peak data for CTCF DNaseI H3K27me3 H3K4me3 and H3K36me of small airway epithelial cells (SAEC) from the ENCODE project and for H3K27me3 H3K4me3 and H3K9-14Ac from human alveolar epithelial cells (hAEC) from our own laboratory. A SNP is determined to be functionally related to a given mark or CTCF binding site if the SNP or any of its LD SNPs (r2 ?0.8 with LD computed using the genotype data of European population in The 1000 Genome Project) resided in any of the mark regions or CTCF binding sites. We explain our enrichment testing using CTCF as an example. We classified genome-wide SNPs into four categories: SNPs not associated with CpG probes in trans or cis (defined as control SNP set) SNPs only associated with proximal CpG probes via cis-regulation (cis-only21119 SNPs) SNPs only associated with distal CpG probes via trans-regulation (trans-only 192 SNPs) and SNPs detected with both trans and cis effects (cis+trans 277 SNPs). For SNPs in the category of cis-only trans-only and cis+trans we computed the proportion of SNPs functionally related to CTCF. To compute the enrichment of cis-meQTLs in CTCF binding sites we defined a control set of SNPs that are not associated with CpG probes via cis- or trans regulation. The selection of the control set was further complicated by the following two observations. (1) cis-meQTL SNPs tended to be more common (data now shown). (2) The probability of a SNP detected as a cis-meQTL SNP positively depended on the density of the CpG probes in the nearby region. Choosing a control set while ignoring these two factors could underestimate the proportion of functionally related SNPs in the control set and thus overestimate the enrichment for cis-meQTLs. Therefore we created 1000 sets of control SNPs with CpG probe density (measured as the number of CpG probes in the cis region of each SNP) and MAF matched with the meQTL SNP set and then averaged the proportions on the 1000 sets. The enrichment was calculated as the fold change with the proportion in the control SNP set as baseline. Next we investigated whether the enrichment was stronger for SNPs more significantly associated with CpG sites. Because we detected only a few hundred trans-meQTLs we focused this analysis on the set of cis-meQTLs. We classified cis-meQTL SNPs into five categories according to the cis-association P-values: P >10?7 (the weakest) 10?10< P ?10?7 10?15 < P ? 10?10 10?20 < P ? 10?15 and P ? 10?20 (the strongest). For each category we computed the proportion of SNPs functionally related to CTCF binding sites. meQTL SNPs affect CTCF binding We found that meQTL SNPs are strongly enriched in CTCF consensus sequences. We used SAEC data from ENCODE to test whether meQTL heterozygous SNPs directly affect CTCF binding by disrupting the CTCF recognition sites. P-values were calculated based on a binomial distribution Binom(N 0.5). Here N is the total number reads covering the SNPs. Raw sequencing data (.fasstq format) from SAEC cells were generated at the University of Washington as part of the ENCODE project and downloaded from the UCSC genome browser. Raw data was aligned to the hg19 genome using CLC genomics workbench (v 5.5.1) parsing out data with less than 80% contiguous alignment to the genome and duplicate reads in excess of 10 copies. We used the CTCFBSDB 2.0 program64 to predict whether the meQTL SNPs or their LD SNPs (r2 ? 0.8) were within CTCF peaks and then examined in SAEC whether CTCF exhibited allele-specific binding. Because common SNPs are more likely to be heterozygous we only looked for SNPs with MAF ?0.4. Here we present two such examples. Systematic investigation of all meQTL SNPs that are heterozygous in SAEC is warranted once more samples with genotypic data are available. Supplementary Material 1 Acknowledgements This study utilized the high-performance computational capabilities of the Biowulf Linux cluster at the NIH Bethesda MD (http://biowulf.nih.gov). We are grateful to the EAGLE participants and the large number of EAGLE collaborators (listed in http://dceg.cancer.gov/eagle) The Cancer Genome Atlas project for the genotype and methylation data and the ENCODE project for the regulatory region data. This work was supported by the Intramural Research Program of NIH NCI Division of Cancer Epidemiology and Genetics and in part by the Norris Comprehensive Cancer Center core grant (P30CA014089) from NCI the Trandisciplinary Research in Cancer of the Lung (TRICL) and the Genetic Associations and Mechanisms in Oncology (GAME-ON) Network (U19CA148127). AW ZW WZ and AH were also funded by the NCI NIH (HSN261200800001E). IALO and ZB were also funded by NIH grants (1 R01 HL114094 1 P30 H101258 and R37HL062569-13) Whittier Foundation and Hastings Foundation. ZB was also funded by the Ralph Edgington Chair in Medicine. CNM was funded by ACS/Canary postdoctoral fellowship (FTED-10-207-01-SIED). Author contributions M.T.L conceived the study. I.A.L.O. supervised DNA methylome analysis. J.S. performed EAGLE TCGA and ENCODE genetic analyses. C.M. performed allele-specific binding analyses. J.D. contributed to genetic analyses and performed GO analyses. J.S. P.L. I.A.L.O. and M.T.L. performed quality control analyses. A.C.P D.C. P.A.B A.W.B N.E.C. and M.T.L. conducted the EAGLE study and provided tissue samples. AW and AH prepared the tissue samples for the analyses. BZ and ZB isolated and cultured alveolar epithelial cells. T.T. and K.D.S. performed methylation normalization. Z.W. and W.W. performed LD analyses. J.S. C.M. J.D. P.L.H. M.C. D.S.L J.H. P-H.C B.S.I.C.W.Z. L.A. M.F. B.P.B. N.C M.A.T. S.J. C. I.A.L.O. M.T.L. contributed to the data interpretation. J.S. and M.T.L. wrote the manuscript. All authors participated in the discussion and reviewed the manuscript."

Lung_Cancer

"The formal evaluation consists in the computation of different ?ci at each ith iteration given an exposure history qhi evaluated at a random time t between 41 and 100 for a random individual among the ns subjects. Indices of relative bias coverage and relative RMSE are derived from the following: (13) where I is an indicator function and ?? 1(1 ? ?) is the quantile function of the cumulative normal distribution related to probability 1 ? ? with ? = 0.05. The effect summary ?ci corresponds to the true effect from while is estimated from the best fitting model selected by AIC and BIC by using given the specific exposure history qhi of the random subject at the random time. This approach assures that the performance indicators in (13) are evaluated on the whole range of simulated exposure histories and do not depend on a specific choice. A visual inspection of performance is also provided by computing from the best-fitting models the grid of risk contributions defined in (9) composing the exposure“lag“response surface. Bias is then assessed across the surface by comparing the average fit of the the m = 500 models with the true exposure“lag“response relationship. A bidimensional display of coverage is also provided for each scenario. The performance of the AIC and BIC are also evaluated through their empirical rejection rate for the hypotheses of linearity or constant effect namely the proportion of times the selection procedure favors a model with a non-linear term for fe(x) and a non-constant term for we(?). When H0 is true namely fs(x) = x or ws(?) = c the rejection rate is an estimate of the probability of error of the selection criteria which wrongly select unnecessarily complex models. When H0 is false namely fs(x) ? x or ws(?) ? c the rejection rate is an estimate of the power of the selection criteria for identifying non-linearity and constant lag structures. In a formal hypothesis testing setting these measures would be interpreted as the type I error and the power of the test. 4.3. Results of the simulation study The results of simulations under the nine scenarios with ns = 400 producing approximately 300 uncensored events are summarized in tables in graphs. Table IV reports the formal evaluation of performance on the synthetic risk summary ?c in terms of relative bias coverage and relative RMSE. A visual assessment for three scenarios is provided in each column of the multi-panel . The true simulated exposure“lag response associations are displayed in the top panels while the other panels offer a comparison of the true lag“response and exposure“response curves at specific values with the average of the estimates from AIC and BIC-selected models together with a sample of 25 individual curves. Table IV Synthetic indices of relative bias coverage and relative root mean square error (RSME) for the nine scenarios of exposure“lag“response associations. Results from m = 500 simulated data sets with ns = 400 subjects Bias Coverage RMSE f(x) ? w(?) AIC BIC AIC BIC AIC BIC Linear-constant 0.01 0.01 0.91 0.94 0.07 0.04 Linear-decay 0.00 0.00 0.93 0.94 0.07 0.05 Linear-peak 0.01 0.01 0.92 0.90 0.08 0.07 Plateau-constant 0.06 0.13 0.84 0.72 0.08 0.09 Plateau-decay 0.04 0.14 0.90 0.74 0.09 0.13 Plateau-peak 0.07 0.21 0.87 0.62 0.11 0.18 Exponential-constant 0.01 0.03 0.90 0.80 0.09 0.09 Exponential-decay 0.05 0.04 0.93 0.87 0.12 0.13 Exponential-peak 0.00 0.17 0.91 0.75 0.12 0.17 Generally AIC-selected models offer a better performance with a lower relative bias and a coverage of confidence intervals closer to the 95% nominal value. The values of relative RMSE suggest that the higher variability of AIC-based estimators is often balanced by the higher bias affecting BIC. At least part of the bias can be attributed to lack of fit due to the insufficient flexibility of quadratic spline functions when used to fit logarithmic or exponential shapes. This phenomenon appears quite relevant for the plateau-type exposure response characterized by the highest relative bias in the order of 4“7% for AIC but up to 21% for BIC (see Table IV and second column). This pattern is confirmed by the results in Table V showing the average df in each dimension and the empirical rejection rates for the hypotheses of linearity and constant risk. The AIC selection is affected by moderate overfitting sometimes suggesting flexible models in scenarios of linear and/or constant risk. In contrast BIC shows severe underfitting often selecting simple models for complex exposure“lag“response associations in particular regarding linearity. Table V Average df in each dimension for the best fitting models selected through AIC and BIC (left part) and empirical rejection rate for the AIC and BIC-based selection for the hypotheses of linearity and constant risk (right part) for the nine scenarios of exposure“lag“response associations. Results from m = 500 simulated data sets with ns = 400 subjects Average df Empirical rejection rate f(x) w(?) H0 : f(x) = x H0 : w(?) = c f(x) ? w(?) AIC BIC AIC BIC AIC BIC AIC BIC Linear-constant 1.50 1.03 1.57 1.02 0.29* 0.03* 0.23* 0.01* Linear-decay 1.26 1.00 3.60 3.17 0.18* 0.00* 1.00 1.00 Linear-peak 1.22 1.00 4.02 3.72 0.15* 0.00* 1.00 0.98 Plateau-constant 2.26 1.54 1.47 1.00 0.82 0.47 0.19* 0.00* Plateau-decay 2.53 1.55 3.49 3.10 0.97 0.54 1.00 1.00 Plateau-peak 2.18 1.21 4.01 3.56 0.85 0.19 1.00 0.93 Exponential-onstant 2.20 1.56 1.43 1.00 0.83 0.52 0.16* 0.00* Exponential-decay 2.36 1.81 3.58 3.12 0.99 0.80 1.00 1.00 Exponential-peak 2.15 1.29 4.05 3.69 0.90 0.27 1.00 0.93 * H0 is true The undercoverage of confidence intervals as shown in Table IV can be attributed to both lack of fit and a posteriori model selection. The latter as discussed in Section 2.5 may generate undercoverage through the underestimation of the true sampling (co)variance. A comparison of the importance of the two sources can be provided by the assessment of undercoverage in the first scenario where linear and constant functions are actually among the options of the selection procedure and the underlying simulated association can be potentially recovered with no lack of fit. In this scenario AIC-selected models affected by overfitting show a coverage of 91% very close to the nominal value as illustrated in Table IV. The under-coverage seems to be proportional to the bias as confirmed by with a lower coverage corresponding to sections of the bidimensional space characterized by worse fit. Empirical coverage across the risk surfaces for three scenarios of exposure“lag“response associations (linear-constant plateau-decay and exponential-peak in each column). Results from m = 500 simulated data sets with ns = 400 subjects. The simulated examples with ns = 200 and ns = 800 generate approximately 150 and 600 uncensored events respectively. The versions of Tables IV“V and for these examples are reported in Tables S2“S5 and Figures S9“S10 of the supporting information. The comparison suggests that varying the sample size does not dramatically affect the performance of the AIC-based test apart from the expected different power in identifying nonlinear and noncostant exposure“time“response associations. Consistently AIC-based selection seems to perform well across the range of number of subjects included in the analysis with a small bias and reasonable coverage. The results of this simulation study are consistent with previous findings on one-dimensional models for exposure“lag“response associations assuming a linear exposure“response relationship 18. 5. Discussion In this contribution I illustrate a statistical framework for modeling temporal dependencies with time-varying exposures defined here as exposure“lag“response associations. The approach is based on the extension of distributed lag non-linear models a modeling class previously proposed in time series analysis 2324. The extended DLNM methodology brings together and extends previous methodological developments on the topic as summarized in. Briefly it provides a unified framework for different study designs and regression methods and is applicable to time series cross-sectional case-control survival and longitudinal data. A major advantage is the possibility to describe the lag structure of either linear or nonlinear exposure“response relationships through the choice of two functions that define the association along the dimensions of the predictor and lags including most of the previous approaches as special cases. The example in illustrates how such flexibility is important for obtaining correct estimates of the association. Model specification easily accounts for previous knowledge on the association and incorporates assumptions on the phenomenon to be investigated through the choice of specific functions lag period and constraints. Interpretation of complex exposure“lag“response associations is aided by the definition of simple summary measures of effect and prediction and by graphical representation. The modeling framework is defined through a neat and compact algebraic representation including the derivation of measures of uncertainty such as standard errors and confidence intervals. Estimation is carried out with standard regression models which do not require specialized optimization procedures and may include terms for multiple exposure“lag“response dependencies as shown for radon and smoking here. The parameterization prediction and graphical representation are carried out with few general functions implemented in a freely available and documented software as discussed in. A key issue of the DLNM methodology is about selecting the appropriate model among different options for modeling the bidimensional exposure“lag“response relationship. The simulation study in indicates that AIC-based selection performs reasonably well over a range of 150“600 uncensored events while the strong penalty of BIC induces the selection of models too simple to recover the underlying dependency. The overfitting characterizing AIC-selected models in scenarios of simple exposure“lag“response dependencies does not seriously affect its performance a result in line with previous findings 18. However AIC-selected models also suffer from bias and undercoverage of confidence intervals to some extent. Part of this seems to be related to the limited flexibility of the functions applied in the simulation study and may be described as a smoothing problem rather that an inherent limitation of the estimators. It should also be noted that the simulation study only evaluates a limited set of exposure“response and lag“response shapes simulated under the assumption of independency. Different functions such as cubic splines and more complex exposure“lag“response surfaces will be assessed in future simulation studies. Also an extension of DLNMs with penalized splines characterized by higher flexibility can be explored as well exploiting previous research on bivariate smoothing techniques 3031. A related problem is about the inferential procedures being conditional on a posteriori selection of the best-fitting model. Previous studies on unidimensional models have proposed a correction for the inflation of type I errors in tests on a constant effect along lags 1727. However this approach is not easily extended to the bidimensional setting of exposure“lag“response associations and the definition of a hypothesis testing procedure for DLNMs is left to future developments. Although a posteriori selection may also be a source of undercoverage of confidence intervals its impact seems to be limited if compared with that associated with lack of fit at least in the simple scenarios investigated in the simulation study. Another limitation is the lack of a formal testing procedure on the hypothesis of independency. As suggested in Section 3.4 a graphical assessment of the proportionality of exposure“response and lag“response curves such as those in Figure 3 can help investigating the issue. Further research is needed to provide more consistent inferential procedures in this setting. The analysis of the temporal evolution of the risk associated with protracted time-varying exposures has straightforward applications in different research fields. For example the DLNM methodology may be used to characterize the risk of chronic exposures to occupational or environmental factors to differentiate the role of exposures sustained at different ages in life course studies or to define the temporal frame of beneficial or adverse effects of drugs in clinical trials and pharmaco-epidemiology. The development of this methodology and software implementation provide a promising analytical tool for biomedical research. 6. Software and data All the analyses presented in this paper were performed using the R software version 3.0.1 32. The DLNM modeling framework is fully implemented in the package dlnm 25 by using the expressly extended version 2.0.0. The permutational algorithm for simulating time-to-event data in the presence of time-varying exposures is implemented in the package PermAlgo 29 version 1.0. Both packages are available through R from its central repository. The data of the Colorado Plateau uranium miners cohort in the form of a comma-separated values file is included in the supporting information¡ together with the R scripts for the analysis performed in the example and the simulation study of Sections 3“4 which are entirely reproducible. In particular the script example.R provides a short illustration of the modeling framework. Versions of the scripts updated to future versions of the dlnm package will be available at http://www.ag-myresearch.com. Distributed lag non-linear models were originally conceived and developed for describing temperature“health associations in time series data by Ben Armstrong. The data from the Colorado Plateau uranium miners cohort were collected by the researchers of National Institute for Occupational Safety and Health. I am grateful to Bryan Langholz for kindly making data and documentation available. The simulation study was performed using the high-processing computing system at the London School of Hygiene and Tropical Medicine. The final version of this article has been substantially improved following the comments of an unknown reviewer. This research was supported by a Methodology Research fellowship by Medical Research Council-UK (grant ID G1002296). References 1 Goodman PG Dockery DW Clancy L Cause-specific mortality and the extended effects of particulate pollution and temperature exposure Environmental Health Perspectives 2004 112 2 179 185 14754572 2 Elliott P Shaddick G Wakefield JC de Hoogh C Briggs DJ Long-term associations of outdoor air pollution with mortality in Great Britain Thorax 2007 62 12 1088 1094 17666438 3 Collet JP Sharpe C Belzile E Boivin JF Hanley J Abenhaim L Colorectal cancer prevention by non-steroidal anti-inflammatory drugs: effects of dosage and timing British Journal of Cancer 1999 81 1 62 8 10487613 4 Abrahamowicz M Bartlett G Tamblyn R du Berger R Modeling cumulative dose and exposure duration provided insights regarding the associations between benzodiazepines and injuries Journal of Clinical Epidemiology 2006 59 4 393 403 16549262 5 Checkoway H Pearce N Hickey JL Dement JM Latency analysis in occupational epidemiology Archives of Environmental Health 1990 45 2 95 100 2334237 6 Thomas DC Models for exposure-time-response relationships with applications to cancer epidemiology Annual Review of Public Health 1988 9 451 482 7 Breslow NL Day NE Statistical Methods in Cancer Research 1987 II Lyon International Agency for Reasearch on Cancer (IARC) 232 271 The desing and analysis of cohort studies chap. 6: Modelling the relationship between risk dose and time 8 Thomas DC Brown CC Chu KC Goldsmith DF Saracci R Proceedings of a symposium on time-related factors in cancer epidemiology Journal of Chronic Diseases 1987 40 Suppl. 2 1S 211S 9 Thomas DC Statistical Methods in Environmental Epidemiology 2009 New York Oxford University Press 279 300 chap. 13: Mechanistic models 10 Thomas DC Statistical methods for analyzing effects of temporal patterns of exposure on cancer risks Scandinavian Journal of Work Environment & Health 1983 9 4 353 366 11 Vacek PM Assessing the effect of intensity when exposure varies over time Statistics in Medicine 1997 16 5 505 513 9089959 12 Langholz B Thomas D Xiang A Stram D Latency analysis in epidemiologic studies of occupational exposures: application to the Colorado Plateau uranium miners cohort American Journal of Industrial Medicine 1999 35 3 246 256 9987557 13 Richardson DB Latency models for analyses of protracted exposures Epidemiology 2009 20 3 395 399 19262389 14 Hauptmann M Wellmann J Lubin JH Rosenberg PS Kreienbrock L Analysis of exposure-time-response relationships using a spline weight function Biometrics 2000 56 4 1105 1108 11129467 15 Hauptmann M Berhane K Langholz B Lubin J Using splines to analyse latency in the Colorado Plateau uranium miners cohort Journal of Epidemiology and Biostatistics 2001 6 6 417 424 11831677 16 Hauptmann M Pohlabeln H Lubin JH Jockel KH Ahrens W Bruske-Hohlfeld I Wichmann HE The exposure-time-response relationship between occupational asbestos exposure and lung cancer in two German case-control studies American Journal of Industrial Medicine 2002 41 2 89 97 11813213 17 Sylvestre MP Abrahamowicz M Flexible modeling of the cumulative effects of time-dependent exposures on the hazard Statistics in Medicine 2009 28 27 3437 3453 19708037 18 Abrahamowicz M Beauchamp ME Sylvestre MP Comparison of alternative models for linking drug exposure with adverse effects Statistics in Medicine 2012 31 11-12 1014 1030 22095719 19 Abrahamowicz M MacKenzie TA Joint estimation of time-dependent and non-linear effects of continuous covariates on survival Statistics in Medicine 2007 26 2 392 408 16479552 20 Berhane K Hauptmann M Langholz B Using tensor product splines in modeling exposure-time-response relationships: Application to the Colorado Plateau Uranium Miners cohort Statistics in Medicine 2008 27 26 5484 5496 18613262 21 Almon S The distributed lag between capital appropriations and expenditures Econometrica 1965 33 178 196 22 Schwartz J The distributed lag between air pollution and daily deaths Epidemiology 2000 11 3 320 326 10784251 23 Armstrong B Models for the relationship between ambient temperature and daily mortality Epidemiology 2006 17 6 624 631 17028505 24 Gasparrini A Armstrong B Kenward MG Distributed lag non-linear models Statistics in Medicine 2010 29 21 2224 2234 20812303 25 Gasparrini A Distributed lag linear and non-linear models in R: the package dlnm Journal of Statistical Software 2011 43 8 1 20 22003319 26 Thomas DC Statistical Methods in Environmental Epidemiology 2009 New York Oxford University Press chap. 6: Modelling exposure-time-response relationships 27 Mahmud M Abrahamowicz M Leffondré K Chaubey Y Selecting the optimal transformation of a continuous covariate in Cox's regression: Implications for hypothesis testing Communications in Statistics: Simulation and Computation 2006 35 1 27 45 28 Breslow NL Day NE Statistical Methods in Cancer Research 1987 II Lyon International Agency for Reasearch on Cancer (IARC) 178 231 The desing and analysis of cohort studies chap. 5: Fitting models to continuous data 29 Sylvestre MP Abrahamowicz M Comparison of algorithms to generate event times conditional on time-dependent covariates Statistics in Medicine 2008 27 14 2618 2634 17918753 30 Wood SN Generalized Additive Models: an Introduction with R 2006 Chapman & Hall/CRC 31 Eilers PHC Currie ID Durban M Fast and compact smoothing on large multidimensional grids Computational Statistics and Data Analysis 2006 50 1 61 76 32 R Development Core Team R: A Language and Environment for Statistical Computing R Foundation for Statistical Computing Vienna Austria 2013. http://www.R-project.org/ Supplementary material 9005373 1697 Eur J Cancer Eur. J. Cancer European journal of cancer (Oxford England : 1990) 0959-8049 1879-0852 24246704 3991133 10.1016/j.ejca.2013.10.006 NIHMS541404 Article Dosing to Rash: A Phase II Trial of the First-Line Erlotinib for Patients with Advanced Non-Small-Cell Lung Cancer an Eastern Cooperative Oncology Group Study (E3503) Brahmer JR M.D. M.Sc. 1 Lee JW Ph.D. 2 Traynor AM M.D. 3 Hidalgo MM M.D. Ph.D. 4 Kolesar JM Pharm.D. 3 Siegfried JM Ph.D. 5 Guaglianone PP M.D. 6 Patel JD M.D. 7 Keppen MD M.D. 8 Schiller JH M.D. 9 1Sidney Kimmel Comprehensive Cancer Center at Johns Hopkins Baltimore Maryland 2Dana-Farber Cancer Institute Boston Massachusetts 3University of Wisconsin Madison Wisconsin 4Spain 5University of Pittsburgh Pittsburgh Pennsylvania 6Decatur Memorial Hospital Decatur Illinois 7Northwestern University Chicago Illinois 8Sanford Cancer Center Sioux Falls South Dakota 9University of Texas Southwestern Medical Center Dallas Texas Corresponding Author Julie R. Brahmer M.D. M.Sc. Sidney Kimmel Comprehensive Cancer Center at Johns Hopkins Bunting Blaustein Cancer Research Building Room G94 1650 Orleans Street Baltimore MD 21287-0013 Office phone: 410-502-7159; Fax 410-614-9334; brahmju@jhmi.edu 2 4 2014 15 11 2013 1 2014 01 1 2015 50 2 302 308 © 2013 Published by Elsevier Ltd. 2013 Background The development of a rash has been retrospectively associated with increased response and improved survival when treated with erlotinib at the standard dose of 150 mg per day. The objective of this trial was to evaluate the association of the activity of erlotinib in the first-line setting in patients with advanced non-small-cell lung cancer (NSCLC) with the development of a tolerable rash via dose escalation of erlotinib or tumor characteristics. Methods Patients with advanced NSCLC without prior systemic therapy were treated with erlotinib 150 mg orally per day. The dose was increased by 25 mg every two weeks until the development of grade 2/tolerable rash or other dose limiting toxicity. Tumor biopsy specimens were required for inclusion. Results The study enrolled 137 patients 135 were evaluable for safety and 124 were eligible and evaluable for response. Only 73 tumor samples were available for analysis. Erlotinib dose escalation occurred in 69/124 patients. Erlotinib was well tolerated with 70% of patients developing a grade 1/2 rash and 10% developing grade 3 rash. Response rate and disease control rate were 6.5% and 41.1% respectively. Median overall survival was 7.7 months. Toxicity and tumor markers were not associated with response. Grade 2 or greater skin rash and low pMAPK were associated with improved survival. Conclusions Overall survival was similar in this trial compared to first-line chemotherapy in this unselected patient population. Dose escalation to the development of grade 2 skin rash was associated with improved survival in this patient population. Bioinformatics Bioinformatics bioinformatics bioinfo Bioinformatics 1367-4803 1367-4811 Oxford University Press 25161229 4147902 10.1093/bioinformatics/btu449 btu449 Eccb 2014 Proceedings Papers Committee Original Papers Pathways and Molecular Networks Personalized identification of altered pathways in cancer using accumulated normal tissue data Ahn TaeJin 1 2 3 Lee Eunjin 1 2 Huh Nam 1 * Park Taesung 3 4 * 1Samsung Advanced Institute of Technology130 Suwon-si Gyeonggi-do 443-803 Korea 2Samsung Genome Institute Seoul 135-710 Korea 3Interdisciplinary Program in Bioinformatics and 4Department of Statistics Seoul National University Seoul South Korea *To whom correspondence should be addressed. 01 9 2014 22 8 2014 22 8 2014 30 17 i422 i429 © The Author 2014. Published by Oxford University Press. 2014 This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/) which permits non-commercial re-use distribution and reproduction in any medium provided the original work is properly cited. For commercial re-use please contact journals.permissions@oup.com Motivation: Identifying altered pathways in an individual is important for understanding disease mechanisms and for the future application of custom therapeutic decisions. Existing pathway analysis techniques are mainly focused on discovering altered pathways between normal and cancer groups and are not suitable for identifying the pathway aberrance that may occur in an individual sample. A simple way to identify individual™s pathway aberrance is to compare normal and tumor data from the same individual. However the matched normal data from the same individual are often unavailable in clinical situation. Therefore we suggest a new approach for the personalized identification of altered pathways making special use of accumulated normal data in cases when a patient™s matched normal data are unavailable. The philosophy behind our method is to quantify the aberrance of an individual sample's pathway by comparing it with accumulated normal samples. We propose and examine personalized extensions of pathway statistics overrepresentation analysis and functional class scoring to generate individualized pathway aberrance score. Results: Collected microarray data of normal tissue of lung and colon mucosa are served as reference to investigate a number of cancer individuals of lung adenocarcinoma (LUAD) and colon cancer respectively. Our method concurrently captures known facts of cancer survival pathways and identifies the pathway aberrances that represent cancer differentiation status and survival. It also provides more improved validation rate of survival-related pathways than when a single cancer sample is interpreted in the context of cancer-only cohort. In addition our method is useful in classifying unknown samples into cancer or normal groups. Particularly we identified ˜amino acid synthesis and interconversion™ pathway is a good indicator of LUAD (Area Under the Curve (AUC) 0.982 at independent validation). Clinical importance of the method is providing pathway interpretation of single cancer even though its matched normal data are unavailable. Availability and implementation: The method was implemented using the R software available at our Web site: http://bibs.snu.ac.kr/ipas. Contact: tspark@stat.snu.ac.kr or namhuh@samsung.com Supplementary information: Supplementary data are available at Bioinformatics online. 1 INTRODUCTIONCancer arises from normal cells and can evolve to become malignant metastatic and/or resistant to therapy. The analysis of altered pathways in an individual cancer patient may help to understand the disease status and suggest customized anticancer therapies.It is straightforward to compare the molecular profile of an individual™s tumor and normal cells to discover molecular aberrances specific to his/her cancer. However it may not be feasible in the current clinical practice environment to perform a metastatic tumor biopsy at the time of treatment resistance in patients with advanced cancer (Dancey et al. 2012). A case study of custom-tailored medicine based on an individual™s genome and transcriptome highlights this limitation (Jones et al. 2010). A patient™s tumor had metastasized to the lung after surgery at the primary site. A biopsy from his lung tumor was analyzed by mutation and transcription profiling; however the patient™s normal lung tissue was not biopsied. Because there was no matched normal tissue messenger RNA (mRNA) expression in the patient™s own blood and information collected from various normal tissues were used to identify differentially expressed genes (DEGs). The results of pathway analysis based on DEGs integrated copy number variation and mutation information led the doctor to change the patient™s drug treatment and the disease was stabilized for 3 months.Although the personalized interpretation of pathways can be demanding most current pathway analyses have been developed to investigate deregulated pathways between two phenotype groups. Khatri et al. (2012) classified these methods into three types: overrepresentation analysis (ORA) functional class scoring (FCS) and a pathway topology (PT)-based approach.ORA approaches typically apply an arbitrary threshold value (e.g. fold change >2 or P < 0.05) on gene expression to assess whether the number of genes beyond threshold are significantly over- or underrepresented in the given pathway. There are two drawbacks to ORA. First it uses only the most significant genes and discards others thus resulting in information loss for marginally significant genes (Breitling et al. 2004). Second it considers only the number of genes and does not consider the magnitude of expression changes leading to information loss regarding the importance of genes (e.g. a gene with a fold change of 2.01 and a gene with a fold change of 4 are considered equally). Unlike ORA FCS methods do not discard genes with an arbitrary threshold but use all available genes which is an improvement over ORA (Tian et al. 2005). PT methods are essentially based on FCS methods with the addition that they consider network topology information. They compensate for the common limitation of ORA and FCS in reporting false-positive gene sets due to sets of overlapping genes. In our article we focus on ORA and FCS methods extending and implementing each for personalized pathway analysis.There are two exceptional studies examining individualized pathway analysis (Drier et al. 2013; Vaske et al. 2010). PARADIGM is a tool that infers a pathway status by using known functional structures. The method models the functional structure of pathway as a set of interconnected variables where the variables are omic objects such as DNA mRNA and protein where the interaction between variables describes the functional status of a pathway. PARADIGM may perform better with multiple omics as it uses known functional relationships between a gene or inter-gene DNA and protein. Hence it might not perform well with single layer omic data such as from mRNA microarrays.Drier et al. (2013) proposed a personal pathway deregulation score (PDS) which represents the distance of a single cancer sample from the median of normal samples on the principal curve. To calculate PDS they reduced the dimensions by principal component analysis and found the best principal curve using entire cohort samples containing both normal and/or different stages of cancers. Drier™s method performs better than PARADIGM in the mRNA only datasets of brain and colon cancers. Calculating PDS requires data dependent preprocessing steps including selecting the number of principal components to be used and filtering out noisy gene data to obtain optimized principal curves. PDS fully uses whole cohort data to interpret an individual™s pathway which can be a drawback in that it requires a number of cohort data to extract principal curve to interpret a single patient data. It has a limitation to interpret a single sample such as a patient™s recurrent tumor that is not accompanied with cohort dataset to extract the principal curve.Our proposed method is based on the comparison of one cancer sample with many accumulated normal samples (we use ˜nRef™ to refer to the accumulated normal samples) that is different from the previous studies in following sense."

Lung_Cancer

"Ectopic expression of BANCR was achieved through pCDNA-BANCR transfection with an empty pCDNA3.1 vector used as a control. The expression levels of BANCR were detected by qPCR. Cell transfection Plasmid vectors (pCDNA3.1-BANCR and pCDNA3.1) for transfection were prepared using DNA Midiprep or Midiprep kits (Qiagen Hilden Germany) and transfected into SPC-A1 or A549 cells. The siRNAs si-HDAC1 si-HDAC3 si-BANCR or si-NC were transfected into SPC-A1 or A549 cells (Additional file 3: Table S2). A549 and SPC-A1 cells were grown on six-well plates to confluency and transfected using Lipofectamine 2000 (Invitrogen) according to the manufacturer™s instructions. At 48 h post-transfection cells were harvested for qPCR or western blot analysis. Cell viability assays Cell viability was monitored using a Cell Proliferation Reagent Kit I (MTT) (Roche Applied Science). The A549 cells transfected with si-BANCR (3000 cells/well) and A549 or SPC-A1 cells transfected with pCDNA-BANCR were grown in 96-well plates. Cell viability was assessed every 24 h following the manufacturer™s protocol. All experiments were performed in quadruplicate. For colony formation assays pCDNA-BANCR-transfected SPC-A1 or A549 cells (n?=?500) were placed in a 6-well plates and maintained in media containing 10% FBS. The medium was replaced every 4 days; after 14 days cells were fixed with methanol and stained with 0.1% crystal violet (Sigma-Aldrich). Visible colonies were then counted. For each treatment group wells were assessed in triplicate. Flow cytometry analysis of apoptosis SPC-A1 and A549 cells were harvested at 48 h post-transfection by trypsinization. After staining with FITC-Annexin V and propidium iodide cells were analyzed by flow cytometry (FACScan; BD Biosciences) using CellQuest software (BD Biosciences). Cells were discriminated into viable cells dead cells early apoptotic cells and apoptotic cells. The ratio of early apoptotic cells was compared to that for controls from each experiment. All samples were assayed in triplicate. Wound-healing assay For the wound-healing assay 3?—?105 cells were seeded in 6-well plates cultured overnight and transfected with pCDNA-BANCR or the control vector. Once cultures reached 85% confluency the cell layer was scratched with a sterile plastic tip and washed with culture medium then cultured for 48 h with medium containing 1% FBS. At different time points images of the plates were acquired using a microscope. The distance between the two edges of the scratch was measured using Digimizer software system. Cell migration and invasion assays For the migration assays at 48 h post-transfection 5?—?104 cells in serum-free media were placed into the upper chamber of an insert (8-?m pore size; Millipore). For the invasion assays 1?—?105 cells in serum-free medium were placed into the upper chamber of an insert coated with Matrigel (Sigma-Aldrich). Medium containing 10% FBS was added to the lower chamber. After incubation for 24 h the cells remaining on the upper membrane were removed with cotton wool. Cells that had migrated or invaded through the membrane were stained with methanol and 0.1% crystal violet imaged and counted using an IX71 inverted microscope (Olympus Tokyo Japan). Experiments were independently repeated three times. Tail vein injections into athymic mice Athymic male mice (4-weeks-old) were purchased from the Animal Center of the Chinese Academy of Science (Shanghai China) and maintained in laminar flow cabinets under specific pathogen-free conditions. SPC-A1 cells transfected with pCDNA-BANCR or the empty vector were harvested from 6-well plates washed with phosphate-buffered saline (PBS) and resuspended at 2?—?107 cells/ml. Suspended cells (0.1 ml) were injected into the tail veins of 9 mice which were sacrificed 7 weeks after injection. The lungs were removed and photographed and visible tumors on the lung surface were counted. This study was carried out in strict accordance with the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. Our protocol was approved by the Committee on the Ethics of Animal Experiments of Nanjing Medical University (Permit Number: 200933). All surgery was performed under sodium pentobarbital anesthesia and all efforts were made to minimize suffering [37]. Western blotting analysis Cells were lysed using RIPA protein extraction reagent (Beyotime Beijing China) supplemented with a protease inhibitor cocktail (Roche CA USA) and phenylmethylsulfonyl fluoride (Roche). The concentration of proteins was determined using the Bio-Rad protein assay kit. Protein extracts (50 ?g) were separated by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) then transferred to nitrocellulose membranes (Sigma) and incubated with specific antibodies. ECL chromogenic substrate was used to visualize the bands and the intensity of the bands was quantified by densitometry (Quantity One software; Bio-Rad) with GAPDH used as a control. Antibodies (1:1000 dilution) against E-cadherin and N-cadherin were purchased from BD. Antibodies against vimentin MMP-2 and MMP-9 were purchased from Cell Signaling Technology (MA USA). Fluorescence immunohistochemistry Cells were fixed in 4% paraformaldehyde following a standard protocol. Mouse anti-E-cadherin and -N-cadhherin polyclonal antibodies (1:100; BD) were used as primary antibodies with TRITC-labeled anti-Rabbit IgG (1:200; Sigma) used as a secondary antibody. Sections were mounted onto slides using Gel Mount Aqueous Mounting Medium (G0918 Sigma) and examined with an Olympus BX51 microscope (Olympus Optical Tokyo Japan). Statistical analysis Student™s t-test (2-tailed) one-way ANOVA and the Mann“Whitney U test were used to analyze data along with SPSS 16.0 (IBM IL USA). P-values of less than 0.05 were considered statistically significant. Competing interests The authors have no actual or potential conflicts of interest to declare. Authors™ contributions Conception and design: MS XHL WD. Development of the methodology: XHL EBZ FQN RK. Acquisition of data: KMW FYJ TPX. Analysis and interpretation of data: ZJL RX JFC. Writing revision of the manuscript: MS WD ZXW. Administrative technical and material support: XHL MS. Study supervision: WD ZXW. All authors read and approved the final manuscript. Supplementary Material Additional file 1: Table S1 Clinicopathological characteristics and BANCR expression of 113 patient samples of NSCLC. Click here for file Additional file 2: Figure S1 Effects of EZH2 SUZ12 and HDAC3 on BANCR expression. (A) Analysis of BANCR expression levels by qPCR following treatment of SPC-A1 and A549 cells with si-EZH2 and SUZ12.(B) Analysis of HDAC3 mRNA expression levels by qPCR in NSCLC cell lines. HDAC3 expression was upregulated more significantly in SPC-A1 H1650 and H1975 cells compared with 16HBE cells. (C) A549 and SPC-A1 cells were treated with selective HDAC3 inhibitor RGFP966 (dissolved in DMSO) at concentrations of 15?M for 24 hours. Analysis of BANCR expression levels by qPCR following treatment of SPC-A1 and A549 cells with RGFP966. *P?<?0.05 N.S. no significant. Click here for file Additional file 3: Table S2 Sequence of primers and siRNA. Click here for file Acknowledgements Xiang-Hua Liu was supported by the National Natural Scientific Foundation of China (No. 81301824). Zhao-Xia Wang was supported by the National Natural Scientific Foundation of China (No.81272601) the Medical Key Talented Person Foundation of the Jiangsu Provincial Developing Health Project (No.RC2011080) the Innovation Team Project of the Second Affiliated Hospital Nanjing Medical University the Jiangsu Provincial Personnel Department œthe Great of Six Talented Man Peak Project (No.09-B1-021) and œ333 high class Talented Man Project (No. 2011-III-2630). Ming Sun was supported by Jiangsu province ordinary university graduate student research innovation project for 2013 (CXZZ13_0562). Jin-fei Chen was supported by the National 973 Basic Research Program of China (Grant No. 2013CB911300). Jin-song Yang was supported by the Medical Science Development Subject in Science and Technology Project of Nanjing (Grant No. ZKX13017). Siegel R Naishadham D Jemal A Cancer statistics 2012 CA Cancer J Clin 2012 62 10 29 10.3322/caac.20138 22237781 Thomson CS Forman D Cancer survival in England and the influence of early diagnosis: what can we learn from recent EUROCARE results? Br J Cancer 2009 101 Suppl 2 S102 S109 19956153 Nguyen DX Bos PD Massague J Metastasis: from dissemination to organ-specific colonization Nat Rev Cancer 2009 9 274 284 10.1038/nrc2622 19308067 Sahai E Illuminating the metastatic process Nat Rev Cancer 2007 7 737 749 10.1038/nrc2229 17891189 Yilmaz M Christofori G EMT the cytoskeleton and cancer cell invasion Cancer Metastasis Rev 2009 28 15 33 10.1007/s10555-008-9169-0 19169796 Friedl P Wolf K Tumour-cell invasion and migration: diversity and escape mechanisms Nat Rev Cancer 2003 3 362 374 10.1038/nrc1075 12724734 Thiery JP Acloque H Huang RY Nieto MA Epithelial-mesenchymal transitions in development and disease Cell 2009 139 871 890 10.1016/j.cell.2009.11.007 19945376 Gao D Vahdat LT Wong S Chang JC Mittal V Microenvironmental regulation of epithelial-mesenchymal transitions in cancer Cancer Res 2012 72 4883 4889 10.1158/0008-5472.CAN-12-1223 23002209 Acloque H Adams MS Fishwick K Bronner-Fraser M Nieto MA Epithelial-mesenchymal transitions: the importance of changing cell state in development and disease J Clin Invest 2009 119 1438 1449 10.1172/JCI38019 19487820 Perl AK Wilgenbus P Dahl U Semb H Christofori G A causal role for E-cadherin in the transition from adenoma to carcinoma Nature 1998 392 190 193 10.1038/32433 9515965 Lee JM Dedhar S Kalluri R Thompson EW The epithelial-mesenchymal transition: new insights in signaling development and disease J Cell Biol 2006 172 973 981 10.1083/jcb.200601018 16567498 Cano A Nieto MA Non-coding RNAs take centre stage in epithelial-to-mesenchymal transition Trends Cell Biol 2008 18 357 359 10.1016/j.tcb.2008.05.005 18585040 Ying L Chen Q Wang Y Zhou Z Huang Y Qiu F Upregulated MALAT-1 contributes to bladder cancer cell migration by inducing epithelial-to-mesenchymal transition Mol Biosyst 2012 8 2289 2294 10.1039/c2mb25070e 22722759 Loewer S Cabili MN Guttman M Loh YH Thomas K Park IH Garber M Curran M Onder T Agarwal S Manos PD Datta S Lander ES Schlaeger TM Daley GQ Rinn JL Large intergenic non-coding RNA-RoR modulates reprogramming of human induced pluripotent stem cells Nat Genet 2010 42 1113 1117 10.1038/ng.710 21057500 Huarte M Guttman M Feldser D Garber M Koziol MJ Kenzelmann-Broz D Khalil AM Zuk O Amit I Rabani M Attardi LD Regev A Lander ES Jacks T Rinn JL A large intergenic noncoding RNA induced by p53 mediates global gene repression in the p53 response Cell 2010 142 409 419 10.1016/j.cell.2010.06.040 20673990 Mercer TR Dinger ME Mattick JS Long non-coding RNAs: insights into functions Nat Rev Genet 2009 10 155 159 10.1038/nrg2521 19188922 Tsai MC Spitale RC Chang HY Long intergenic noncoding RNAs: new links in cancer progression Cancer Res 2011 71 3 7 21199792 Wapinski O Chang HY Long noncoding RNAs and human disease Trends Cell Biol 2011 21 354 361 10.1016/j.tcb.2011.04.001 21550244 Spizzo R Almeida MI Colombatti A Calin GA Long non-coding RNAs and cancer: a new frontier of translational research? Oncogene 2012 31 4577 4587 10.1038/onc.2011.621 22266873 Flockhart RJ Webster DE Qu K Mascarenhas N Kovalski J Kretz M Khavari PA BRAFV600E remodels the melanocyte transcriptome and induces BANCR to regulate melanoma cell migration Genome Res 2012 22 1006 1014 10.1101/gr.140061.112 22581800 Sun M Liu XH Li JH Yang JS Zhang EB Yin DD Liu ZL Zhou J Ding Y Li SQ Wang ZX Cao XF De W MiR-196a Is Upregulated in Gastric Cancer and Promotes Cell Proliferation by Downregulating p27kip1 Mol Cancer Ther 2012 11 842 852 10.1158/1535-7163.MCT-11-1015 22343731 Gupta RA Shah N Wang KC Kim J Horlings HM Wong DJ Tsai MC Hung T Argani P Rinn JL Wang Y Brzoska P Kong B Li R West RB van de Vijver MJ Sukumar S Chang HY Long non-coding RNA HOTAIR reprograms chromatin state to promote cancer metastasis Nature 2010 464 1071 1076 10.1038/nature08975 20393566 Gutschner T Hammerle M Eissmann M Hsu J Kim Y Hung G Revenko AS Arun G Stentrup M Gross M Z¶rnig M MacLeod AR Spector DL Diederichs S The non-coding RNA MALAT1 is a critical regulator of the metastasis phenotype of lung cancer cells Cancer Res 2013 73 3 1180 1189 10.1158/0008-5472.CAN-12-2850 23243023 Stanbridge EJ Identifying tumor suppressor genes in human colorectal cancer Science 1990 247 12 13 10.1126/science.2403692 2403692 Kanwal R Gupta S Epigenetic modifications in cancer Clin Genet 2012 81 303 311 10.1111/j.1399-0004.2011.01809.x 22082348 Benetatos L Dasoula A Hatzimichael E Georgiou I Syrrou M Bourantas KL Promoter hypermethylation of the MEG3 (DLK1/MEG3) imprinted gene in multiple myeloma Clin Lymphoma Myeloma 2008 8 171 175 10.3816/CLM.2008.n.021 18650181 Braconi C Kogure T Valeri N Huang N Nuovo G Costinean S Negrini M Miotto E Croce CM Patel T microRNA-29 can regulate expression of the long non-coding RNA gene MEG3 in hepatocellular cancer Oncogene 2011 30 4750 4756 10.1038/onc.2011.193 21625215 Yang F Huo XS Yuan SX Zhang L Zhou WP Wang F Sun SH Repression of the long noncoding RNA-LET by histone deacetylase 3 contributes to hypoxia-mediated metastasis Mol Cell 2013 49 1083 1096 10.1016/j.molcel.2013.01.010 23395002 Katsuno Y Lamouille S Derynck R TGF-beta signaling and epithelial-mesenchymal transition in cancer progression Curr Opin Oncol 2013 25 76 84 10.1097/CCO.0b013e32835b6371 23197193 Soltermann A Epithelial-mesenchymal transition in non-small cell lung cancer Pathologe 2012 33 Suppl 2 311 317 23080026 Zhao R Wu Z Zhou Q Epithelial-mesenchymal transition and tumor metastasis Zhongguo Fei Ai Za Zhi 2011 14 620 624 21762634 Kang Y Massague J Epithelial-mesenchymal transitions: twist in development and metastasis Cell 2004 118 277 279 10.1016/j.cell.2004.07.011 15294153 Acloque H Thiery JP Nieto MA The physiology and pathology of the EMT. Meeting on the epithelial-mesenchymal transition EMBO Rep 2008 9 322 326 10.1038/embor.2008.30 18323854 Bremnes RM Veve R Gabrielson E Hirsch FR Baron A Bemis L Gemmill RM Drabkin HA Franklin WA High-throughput tissue microarray analysis used to evaluate biology and prognostic significance of the E-cadherin pathway in non-small-cell lung cancer J Clin Oncol 2002 20 2417 2428 10.1200/JCO.2002.08.159 12011119 Liu D Huang C Kameyama K Hayashi E Yamauchi A Kobayashi S Yokomise H E-cadherin expression associated with differentiation and prognosis in patients with non-small cell lung cancer Ann Thorac Surg 2001 71 949 954 discussion 954-945 10.1016/S0003-4975(00)02545-5 11269479 Cesana M Cacchiarelli D Legnini I Santini T Sthandier O Chinappi M Tramontano A Bozzoni I A long noncoding RNA controls muscle differentiation by functioning as a competing endogenous RNA Cell 2011 147 358 369 10.1016/j.cell.2011.09.028 22000014 Kilkenny C Browne W Cuthill IC Emerson M Altman DG Animal research: reporting in vivo experiments: the ARRIVE guidelines J Gene Med 2010 12 561 563 10.1002/jgm.1473 20607692 PLoS One PLoS ONE plos plosone PLoS ONE 1932-6203 Public Library of Science San Francisco USA 24586426 3930593 PONE-D-13-47163 10.1371/journal.pone.0088881 Research Article Mathematics Statistics Biostatistics Medicine Non-clinical medicine Health care policy Health statistics Health systems strengthening Health economics Cost effectiveness Socioeconomic aspects of health Public health Socioeconomic aspects of health Social and behavioral sciences Economics Health economics Health care sector Economic Outcomes of Maintenance Gefitinib for Locally Advanced/Metastatic Non-Small-Cell Lung Cancer with Unknown EGFR Mutations: A Semi-Markov Model Analysis Economic Outcomes of Maintenance Gefitinib Zeng Xiaohui 1 Li Jianhe 2 3 Peng Liubao 2 * Wang Yunhua 1 Tan Chongqing 2 3 Chen Gannong 4 Wan Xiaomin 2 3 Lu Qiong 2 Yi Lidan 2 1 PET-CT Center the Second Xiangya Hospital of Central South University Changsha Hunan People™s Republic of China 2 Department of Pharmacy the Second Xiangya Hospital of Central South University Changsha Hunan People™s Republic of China 3 School of Pharmaceutical Sciences Central South University Changsha Hunan People™s Republic of China 4 Department of Surgery the Second Xiangya Hospital of Central South University Changsha Hunan People™s Republic of China Hoheisel J¶rg D. Editor Deutsches Krebsforschungszentrum Germany * E-mail: pengliubao@126.com Competing Interests: The authors have declared that no competing interests exist. Conceived and designed the experiments: JL LP. Performed the experiments: GC QL LY. Analyzed the data: XZ CT. Contributed reagents/materials/analysis tools: YW XW. Wrote the paper: XZ CT. 2014 20 2 2014 9 2 e88881 9 11 2013 12 1 2014 2014 Zeng et al This is an open-access article distributed under the terms of the Creative Commons Attribution License which permits unrestricted use distribution and reproduction in any medium provided the original author and source are credited. Background Maintenance gefitinib significantly prolonged progression-free survival (PFS) compared with placebo in patients from eastern Asian with locally advanced/metastatic non-small-cell lung cancer (NSCLC) after four chemotherapeutic cycles (21 days per cycle) of first-line platinum-based combination chemotherapy without disease progression. The objective of the current study was to evaluate the cost-effectiveness of maintenance gefitinib therapy after four chemotherapeutic cycle™s stand first-line platinum-based chemotherapy for patients with locally advanced or metastatic NSCLC with unknown EGFR mutations from a Chinese health care system perspective. Methods and Findings A semi-Markov model was designed to evaluate cost-effectiveness of the maintenance gefitinib treatment. Two-parametric Weibull and Log-logistic distribution were fitted to PFS and overall survival curves independently. One-way and probabilistic sensitivity analyses were conducted to assess the stability of the model designed. The model base-case analysis suggested that maintenance gefitinib would increase benefits in a 13 6 or 10-year time horizon with incremental $184829 $19214 $19328 and $21308 per quality-adjusted life-year (QALY) gained respectively. The most sensitive influential variable in the cost-effectiveness analysis was utility of PFS plus rash followed by utility of PFS plus diarrhoea utility of progressed disease price of gefitinib cost of follow-up treatment in progressed survival state and utility of PFS on oral therapy. "

Lung_Cancer

"The same procedures were repeated at a distance of 1 cm creating parallel lesions in order to analyse the lung tissue in between the lesions for thermal damage. In addition two implanted capsules in the lung tissue simulating a lung nodule were resected with either the laser or the monopolar cutter. The resection surfaces were then examined by magnetic resonance imaging and histology for tissue damage. Finally we created a 2-cm wide mark on the lung surface to test the resection capacity of both instruments within 1 min. RESULTS The laser created sharply delineated lesions with a vaporization and coagulation zone without thermal damage of the surrounding lung tissue. With lowering the working speed each zone was extended. At a working speed of 10 mm/s the mean vaporization depth using the laser was 1.74 ± 0.1 mm and the mean coagulation depth was 1.55 ± 0.09 mm. At the same working speed the monopolar cutter demonstrated a greater cutting effect (mean vaporization depth 2.7 ± 0.11 mm; P < 0.001) without leaving much coagulation on the resection surface (mean coagulation depth 1.25 ± 0.1 mm; P = 0.002). In contrast to the laser the monopolar cutter caused thermal damage of the adjacent lung tissue. The adjacent tissue injury was detected in histological examination as well as in the MRI findings. Adjacent lung tissue after lung metastasectomy using the monopolar cutter was hyper-intensive in T2-weighted MR imaging indicating a severe tissue damage. No significant changes in signal intensity were observed in T2-weighted imaging of the adjacent lung tissue after using the laser for lung resection. One minute of laser applied at a 100-watt output penetrated a lung surface area of 3.8 ± 0.4 cm2 compared with 4.8 ± 0.6 cm2 of surface after application of the monopolar cutter (P = 0.001). S The monopolar cutter possesses indeed a greater cutting capacity than the laser but it also causes more adjacent tissue injury. Thus laser resection might be preferred for lung metastasectomy. Electrosurgical scalpel Laser Lung metastases Lung resection Tissue damage BMC Urol BMC Urol BMC Urology 1471-2490 BioMed Central 24612599 3975282 1471-2490-14-26 10.1186/1471-2490-14-26 Research an-specific and tumor-size-dependent responses to sunitinib in clear cell renal cell carcinoma Tsuchiya Norihiko 1 tsuchiyamed.akita-u.ac.jp Yuasa Takeshi 2 takeshi.yuasajfcr.or.jp Maita Shinya 1 yamightyyahoo.co.jp Narita Shintaro 1 narishindoc.med.akita-u.ac.jp Inoue Takamitsu 1 takamitudoc.med.akita-u.ac.jp Numakura Kazuyuki 1 numakuradoc.med.akita-u.ac.jp Saito Mitsuru 1 mitsaitomed.akita-u.ac.jp Satoh Shigeru 1 shigerusdoc.med.akita-u.ac.jp Yonese Junji 2 jyonesejfcr.or.jp Habuchi Tomonori 1 thabuchidoc.med.akita-u.ac.jp 1Department of Urology Akita University Graduate School of Medicine Akita Japan 2Department of Urology Cancer Institute Hospital Japanese Foundation for Cancer Research Tokyo Japan 2014 11 3 2014 14 26 26 20 7 2013 28 2 2014 Copyright 2014 Tsuchiya et al.; licensee BioMed Central Ltd. 2014 Tsuchiya et al.; licensee BioMed Central Ltd. This is an Open Access distributed under the terms of the Creative Commons Attribution License (http://creativecommons./licenses/by/2.0) which permits unrestricted use distribution and reproduction in any medium provided the original work is properly credited. Background Tyrosine kinase inhibitors (TKIs) have been used as standard therapy for patients with advanced renal cell carcinoma (RCC). However information on factors predicting response to treatment with TKIs is lacking. This study aimed to assess the association between initial tumor size involved ans pre-treatment C-reactive protein (CRP) levels and reduction in tumor size in patients with clear cell RCC (CCRCC) treated with sunitinib. Methods Patients with advanced CCRCC with target lesions with a maximum diameter???10 mm treated with sunitinib were evaluated. The tumor diameter representing the best overall response was designated as the post-treatment tumor diameter. Results A total of 179 lesions in 38 patients were analyzed. an-specific analysis demonstrated that pre-treatment diameter of lung metastatic lesions had a moderate inverse association with percent reduction in post-treatment tumor diameter (R?=?0.341). Lung lesions showed significantly greater percent reductions in diameter than liver and kidney lesions (P?=?0.007 and 0.002 respectively). Furthermore based on a CRP cut-off level of 2.0 mg/dl mean tumor size reduction was significantly greater in patients with low CRP levels than in patients with high CRP levels in lesions with diameters?<?20 mm (P?=?0.002). CRP level had no effect on mean size reduction in lesions with a diameter???20 mm. Conclusions Patients with CCRCC with smaller lung metastatic lesions and lower CRP levels may achieve greater percent reductions in tumor size with sunitinib therapy than patients with extra-pulmonary lesions large lung lesions and/or higher CRP levels. Advanced renal cell carcinoma Sunitinib Tumor size Tumor response C-reactive protein Background In the era of cytokine therapy tumor response to treatment in advanced or metastatic renal cell carcinoma (RCC) has been reported to vary according to the ans involved [12]. Longer overall survival and a higher response rate to therapy with interferon-? or a combination of interleukin-2 and interferon-? were observed in patients with only lung metastasis compared with those with extra-pulmonary metastasis [12]. Complete remission (CR) after treatment with tyrosine kinase inhibitors (TKIs) which mainly target vascular endothelial growth factor receptors remains a rare event but most patients who do achieve CR have either lung metastasis alone or only lymph node involvement [34]. However most cancer clinical trials evaluate tumor response using the response evaluation criteria in solid tumors (RECIST) in which the longest diameters of target lesions in multiple ans are summed. Tumor response in individual metastatic lesions in specific ans has not been delineated. A reduction in tumor size >10% calculated as the sum of the longest diameter of the target lesions was significantly associated with both time to treatment failure and overall survival suggesting that size reduction of target lesions may predict the outcome of treatment with TKIs [5]. In addition Yuasa et al. recently demonstrated that a smaller initial tumor size predicted a good response to TKIs and that the maximum response was achieved in lung lesions [6]. TKIs have shown significant clinical benefit in advanced clear cell RCC (CCRCC) in large randomized trials [7-9]. However the reported objective responses vary according to the different types of TKIs and a recent phase II trial failed to demonstrate any clinical efficacy of sunitinib in non-CCRCC [10]. Tumor size reduction may thus be affected by many factors including initial tumor size involved ans tumor histology tumor aggressiveness or type of TKI used. In this study we evaluated the association between initial tumor size of individual lesions in specific ans and reduction in tumor size in patients with CCRCC treated with sunitinib. Methods Patients and tumor measurement A total of 38 patients with advanced CCRCC who received at least two cycles of sunitinib at Akita University Hospital and at the Cancer Institute Hospital of the Japanese Foundation for Cancer Research were enrolled in this institutional review-board-approved retrospective study. Pathological diagnosis was made by radical nephrectomy in 30 patients and by percutaneous biopsy in eight patients who were not indicated for surgical treatment because of a significantly higher total volume of metastatic lesions compared with the primary lesion. The initial dose of sunitinib was 50 mg/day which was reduced to 37.5 mg/day based on the patient™s physique age and performance status. Sunitinib was initiated on a 28 days on/14 days off schedule and a dose reduction to 25 mg/day or complete cessation was considered in the event of grade 3 or higher toxicity according to the Common Terminology Criteria for Adverse Events (CTC-AE). All lesions were evaluated using a multidetector computed tomography scanner and lesions???10 mm in diameter were considered target lesions. The maximum diameter of each target lesion was measured before treatment with sunitinib (pre-treatment tumor diameter) and every 2“3 months thereafter. The tumor diameter at the point when best overall response was achieved based on the RECIST version 1.0 was adopted as the post-treatment tumor diameter. In this study the most common metastatic ans including lung liver and lymph nodes as well as the kidney were subjected to analysis. Statistical analysis The association between pre-treatment tumor diameter and percent change between pre- and post-treatment tumor diameters for each lesion was assessed by Pearson™s correlation coefficient. The Kruskal Wallis test was used to compare differences in percent change in tumor diameter between the four different ans. The Mann“Whitney U test was used to compare differences between two groups. A receiver-operator curve (ROC) was constructed to find the pre-treatment tumor diameter predicting tumor response to sunitinib treatment. A value of P?<?0.05 was considered statistically significant. Results Patients and target lesions The patients included 30 men and eight women with a median age of 62 years (range 27“81 years). The patients™ characteristics are listed in Table 1. The best response to sunitinib treatment was CR in one patient (3%) partial response (PR) in 11 (29%) stable disease (SD) in 23 (61%) and progressive disease (PD) in three (8%). The objective response rate was 32% and the clinical benefit rate (CR?+?PR?+?SD for at least 3 months) was 92%. A total of 179 lesions ranging from 10 to 106 mm were measured and analyzed in 38 patients. These lesions were localized as follows: 124 in the lung 12 in the liver 24 in the lymph nodes and 19 in the kidney. Of the 15 patients with kidney tumors seven who underwent nephrectomy had target lesions in the contralateral kidney including two patients with multiple lesions. The remaining eight patients had primary kidney tumors that were diagnosed by percutaneous needle biopsy. Table 1 Patients™ characteristics Characteristic No. of patients (%) Sex ??Male 30 (78.9) ??Female 8 (21.1) Age y ??Median [range] 62 [27“81] ECOG performance status ??0 25 (65.8) ??1 7 (18.4) ??> 1 6 (15.8) MSKCC risk category ??Favorable 8 (21.1) ??Intermediate 20 (52.6) ??Poor 10 (26.3) Target ans ??Lung 31 (81.6) ??Liver 6 (15.8) ??Lymph node 11 (28.9) ??Kidney 15 (39.5) Nephrectomy ??Yes 30 (78.9) ??No (biopsy) 8 (21.1) Prior treatments ??None 27 (71.1) ??Cytokines alone 4 (10.5) ??Sorafenib?±?cytokines 7 (18.4) Associations between pre-treatment tumor diameter and percent change in target lesion size in different ans The associations between pre-treatment tumor diameter and percent change in size of each target lesion in each of four ans were analyzed separately."

Lung_Cancer

"This represents a 160-fold preference for ?v?6. As a reference point the maximum concentration of the imaging probe in the blood of a mouse is ~5 nM; this is substantially below the Kd of the H2009.1-10mer dimeric peptide for ?v?3 and ?v?5 and no binding of the peptide to these purified integrins was detected at this concentration. In the same assay the well characterized ?v?3-binding peptide cRGDyK was determined to have a Kd of 4.9 ± 2.1 nM for ?v?3 but no detectable binding to ?v?6 was observed up to 1 µM. We further evaluated the specific ?v?3 integrin expression in H2009 and H460 tumors using our previously reported peptide-RGD based dimeric probe (64Cu-CB-TE2A-(c(RGDyK))2) ( and ). Unlike 64Cu-M10 64Cu-(M10)2 64Cu-D10 and 64Cu-AcD10 64Cu-CB-TE2A-(c(RGDyK))2 clearly visualized both tumors and showed nearly identical tumor uptake at all three time points (1 h: 1.58 ± 0.13 %ID/g in H2009 vs 1.64 ± 0.20 %ID/g in H460; 4 h: 1.07 ± 0.21 %ID/g in H2009 vs 1.09 ± 0.24 %ID/g in H460; 24 h: 0.70 ± 0.29 %ID/g in H2009 vs. 0.72 ± 0.10 %ID/g in H460). In sum our data confirms that four probes built upon the H2009.1-10mer peptide do not recognize ?v?3 but specifically bind to ?v?6 in NSCLCs. Of note 64Cu-CB-TE2A-(c(RGDyK))2 exhibited significantly lower kidney uptake in both tumor models than 64Cu-(M10)2 64Cu-D10 or 64Cu-AcD10 (p < 0.0001) which indicates that the CB-TE2A chelator scaffold has a negligible role in the high kidney accumulation. Discussion The role of molecular tumor profiling is ever-increasing in clinical practice for diagnosis treatment planning and monitoring of disease. There is an increasing demand to diagnose tumors based on prognostic biomarkers in order to select the therapy that is most likely to successfully treat an individual patient's cancer. The ?v?6-integrin is an emerging prognostic biomarker for NSCLC as well as other epithelial based cancer. Expression of ?v?6 in NSCLC patients is associated with poor survival. The up-regulation of ?v?6-integrin in early stage NSCLC as well as its association with a pro-invasive NSCLC phenotype makes it highly desirable target for diagnostic and therapeutic application 11 12. To date a few ?v?6-targeted probes have been reported. Of which most efforts are based on a 20 amino acid peptide derived from the coat protein of foot and mouth disease virus (A20FMDV2 Sequence: NAVPNLRGDLQVLAQKVART). This peptide sequence binds to ?v?6 with low nanomolar affinity. When modified and labeled with 18F the peptidic PET probe ([18F]FBA-A20FMDV2) was able to show a reasonable tumor uptake (0.66 %ID/g at 1 h) in an ?v?6+ tumor model although the tumor uptake retention needs to be further improved 37 38. Recently a ?v?6-binding cysteine knot was engineered to improve in vivo stability 39 40. This ligand displays similar affinity and specificity for ?v?6 as the A20FMDV peptide. When modified and labeled with 64Cu the cysteine knot showed good tumor uptake and retention (1.8 ± 0.50% 1 h and 1.46 ± 0.43% 24 h). However the modest tumor to lung ratio (1.89 ±0.81% 1 h and 1.25 ± 0.28% 24 h) may hamper the use of this probe for detection of NSCLC tumors. Additionally this probe requires biosynthesis and may invoke an immunological response upon repeat injections. Success of a ?v?6-specific PET imaging probe depends upon the choice of a ligand with high binding affinity and selectivity towards ?v?6-integrin. The H2009.1 peptide was selected by biopanning a phage displayed-peptide library on intact H2009 NSCLC cells. Subsequently we determined that the H2009.1 peptide binds with high binding affinity and selectivity to ?v?6+ 8 20. Not surprisingly the selected peptide sequence contains an Arginine-Glycine-Aspartate (RGD) tripeptide sequence a well-known ligand for many integrins 41 42. However the peptide is specific for ?v?6 and does not bind other RGD-binding integrins 8. Importantly this peptide does not bind cells that express other RGD binding integrins including ?v?5 ?v?3 and ?5?1 but lack ?v?6. Furthermore we have shown here that the H2009.1-10mer dimeric peptide has a >160-fold preference for purified ?v?6 for compared to ?v?5 and ?v?3. The specificity of the H2009.1 peptide for ?v?6-integrin arises from the peptide sequence LATL directly to the carboxy-terminal side of the RGD. The sequence LXXL has been shown to impart ?v?6-specificity when it flanks the RGD domain 18 43-46. Notably the binding of H2009.1 peptide showed a linear correlation with the ?v?6-integrin expression on the cell surface which enables the H2009.1 peptide as an ideal ligand for ?v?6+ tumor detection as well as quantification 8 20. However like other peptides selected from phage displayed libraries the corresponding synthetic monomer peptide was not ideal for molecular imaging especially at the later time points primarily due to suboptimal binding affinity 47. The phage-displayed library from which the H2009.1 peptide was selected presents the peptide at the N-terminus of the phage pIII coat protein. As such the peptide is displayed at one end of the filamentous phage in 3 - 5 copies. Thus target-specific binding of the phage is likely driven by both the peptide sequence and multimeric presentation of peptides. Multimeric presentation of the H2009.1-10mer peptide was sought to increase the receptor-ligand binding affinity while maintaining the specificity of the peptide for tumor detection with the aim to enhance the specific PET imaging signal 2226 29. Given that juxtaposition positioning of H2009.1-10mer peptide in the three dimensional space might play a key role in ligand-receptor interaction on the cell surface we employed two complimentary multimerization approaches to evaluate the anticipated multivalent effect. First simultaneous presentation of two monomeric peptides on a divalent BFC scaffold (CB-TE2A(tBu)2-(Mal)2) gave a scaffold-based divalent conjugate H2(M10)2. Second the isolated H2009.1-10mer peptide was dimerized and subsequently presented on a monovalent BFC scaffold (CB-TE2A(tBu)2-Mal) to provide peptide-based divalent conjugates H2D10 and H2(Ac)D10. In all cases a polyethylene glycol (PEG) linker was included in the peptide design in order to increase the solubility of the resulted peptide conjugates in aqueous solution and to act as a spacer between the chelating scaffold and the peptide moiety for optimal in vivo kinetics and high tumor uptake. Indeed it was reported that attaching a defined length 28-PEG spacer to A20FMDV2 could provide a 3-fold tumor uptake increase although higher uptake was also observed in non-target ans 37. The multivalent effect on binding affinity of isolated peptides was evaluated in a cell-based assay using H2009 human NSCLC cell line. As expected divalent conjugates of H2009.1-10mer peptide (H2-(M10)2 H2-D10 and H2-AcD10) showed a 4 - 6 fold enhancement in their binding affinity over the monovalent one (H2-M10)."

Lung_Cancer

"Product size was 203 bp. Southern blot analysis Genomic DNA from ESCs and ans was extracted with the Gentra Puregene Tissue Kit (Qiagen). Genetic chimerism in various tissues was determined by Southern blotting of EcoRV digested DNA hybridized to the Trp53 5? XbaI probe which is a 700 bp genomic XbaI fragment subcloned in pBSK and labeled by PCR (Jonkers et al 2001). Intensity of bands was quantified with ImageJ software (version 1.43u) by generating a profile plot and measuring the surface area of individual peaks. Targeting with the Col1a1-frt vector was monitored by Southern blotting of EcoRI digested DNA hybridized to the Col1a1 3? probe which is an 842 bp genomic PstI-XbaI fragment. Flp-in of frt-invCAG-Luc and frt-invEF1-Luc was monitored by Southern blotting of BglII digested DNA hybridized to the same Col1a1 3? probe. Ad5-Cre virus administration Mice were treated with cyclosporine A (Novartis) orally in the drinking water 1 week prior to adenovirus administration and 2“3 weeks following infection. Viral Ad5-CMV-Cre ps (1 — 109; Gene Transfer Vector Core University of Iowa) were injected intratracheally into KrasLSL-G12D mice and Rb1F/F ;Trp53F/F mice and intrathoracically into Nf2F/F ;Trp53F/F ;Cdkn2a*/* mice. Immunohistochemistry of tumors Mice were monitored biweekly for development of tumors and general health status. Mice were sacrificed when signs of discomfort became evident. Tissues were collected for pathological examination. Formalin fixed and paraffin embedded material was sectioned H&E stained an analyzed microscopically by a dedicated mouse pathologist (by JYC). Array comparative genome hybridization Genomic DNA from ESCs was extracted with the Gentra Puregene Tissue Kit (Qiagen). DNA (500 ng) was labeled with either Cy5 or Cy3 using the NimbleGen Dual-Color DNA Labeling Kit (NimbleGen). Labeled DNA was hybridized on the mouse array comparative genome hybridization (aCGH) 12 — 135 K whole-genome tiling array (NimbleGen) using the MAUI hybridization station. Targeted ESC clones were analyzed against the parental ESC clones and the Flp-in ESC clones against the targeted ESC clones. Data was analyzed using the NimbleScan (Roche) and Nexus 6.0 (BioDiscovery) software. Data are available at the MIAMExpress database (http://www.ebi.ac.uk/miamexpress) under accession number E-MEXP-3998. The paper explained Problem The ever-growing list of potential cancer genes and drug targets associated with specific cancers demand validation in relevant in vivo models. Genetically Engineered Mouse Models (GEMMs) have proven valuable for the distinction of driver mutations from less relevant modifiers or bystanders though the inherent complexity of these models and time spent introducing additional modifications has hampered their general use. Results We have developed an approach for fast and flexible adaption of existing mouse models. Three elements are central to this system; (i) The efficient derivation of authentic Embryonic Stem Cells (ESCs) from established GEMMs (ii) the routine introduction of transgenes of choice in these GEMM-ESCs by Flp recombinase-mediated integration and (iii) the direct use of the chimeric animals in tumor cohorts. By applying stringent quality controls the GEMM-ESC approach proofs to be a reliable and effective method to speed up cancer gene assessment and target validation as exemplified for MycL1 in a model for Small Cell Lung Cancer. Impact The GEMM-ESC approach speeds up the generation/modification of mouse models while minimizing the breeding efforts. Experimental cohorts of mice are generated on-demand and ready-to-use. This reduces the number of mice needed per experiment and is therefore in compliance with one of the 3R's of animal testing. Furthermore the establishment of an archive of ESCs from various validated mouse models will allow easy distribution and gives researchers worldwide the opportunity to evaluate their favorite genes in the most suitable model. DNA copy number analysis Genomic DNA from tumors was extracted with the Gentra Puregene Tissue Kit. Real time PCR was performed on genomic DNA using SYBRGreen in the StepOnePlus real time PCR system (Applied Biosystems) with primers specific for MycL1 (Dooley et al 2011) and related to at least two reference genes in the same sample either Actin GapdH Tfrc or Tert. Primer sequences are provided in supplementary Table S5. Some samples were analyzed by low-coverage sequencing. Nexus 6.0 software was used to process Illumina Hiseq2000 generated signal intensity. A reference samples was created by combining three ESC clones invCag-Luc;Rb1F/F ;Trp53F/F clones 1.5_1B1_6 and _ 9 and Col1a1-frt;Rb1F/F ;Trp53F/F clone 1.5_1B1_r4. The FASST2 segmentation and default Illumina setting with Gain 0.4 and Loss ?0.4 were used to identify regions of CNV for each sample. In vivo bioluminescence imaging of tumors In vivo bioluminescence imaging was performed and quantified as described by Hsieh et al (2005) on a cryogenically cooled IVIS system (Xenogen Corp. CA USA) using LivingImaging acquisition and analysis software (Xenogen). Statistical analysis Survival analysis was performed by comparing two survival curves using the Log-rank (Mantel-Cox) test within the Prism 6 software. The comparison of the incidence of MycL1 copy number gains between three groups was performed using the Fisher's Exact Test. The cut-off for MycL1 amplified tumors was more than four copy numbers present in the tumor. We are grateful to J. Nichols and A. Smith (Welcome Trust Centre for Stem Cell Research Cambridge UK) for providing training in ESC derivation and culture. We thank R. Jaenisch (Whitehead Institute for Biomedical Research Cambridge MA USA) and J. Gribnau (Erasmus University Rotterdam the Netherlands) for Flp-in plasmids. We thank F. van der Ah S. Kautschitsch B. Siteur H. van der Gulden L. Henneman for technical assistance; M. Snoek and T. Meehan for the official MGI nomenclature of ESC clones; the personnel of the animal facility for their excellent animal husbandry; and the Genomics Core Facility for their help with aCGH. This work was supported by the Dutch Cancer Society (KWF) by a National Roadmap grant for Large-Scale Research facilities provided by the Netherlands anization for Scientific Research (NWO) and by the EuroSyStem and EurocanPlatform projects as part of the European Union's seventh framework programme. Author contributions IJH conceived and designed experiments performed project coordination data analysis and wrote the paper. RBA performed ESC derivations and injections. CP designed vectors and performed embryonic stem cell manipulation. MC and NP performed health monitoring of mice viral intubations and luciferase imaging. MCK performed Mycl1 copy number analysis. JYS analyzed tumors. HdV established primary mesothelioma cultures. JB and KS provided cohorts for conventional mesothelioma and lung tumor groups respectively. EMM acquired technology. PK JJ and AB conceived and designed experiments. JJ and AB supervised the work. "

Lung_Cancer

"for use in lung cancer clinical trials Eur J Cancer Psychometric properties and responsiveness of the EORTC Quality of Life Questionnaire (QLQ-C30) in patients with breast ovarian and lung cancer Qual Life Res 1994 3 5 353 364 10.1007/BF00451727 7841968 Osoba D Aaronson N Zee B Sprangers M te Velde A Modification of the EORTC QLQ-C30 (version 2.0) based on content validity and reliability testing in large samples of patients with cancer Qual Life Res 1997 6 2 103 108 9161109 Hjermstad MJ Fossa SD Bjordal K Kaasa S Test/retest study of the European anization for Research and Treatment of Cancer Core Quality of Life Questionnaire J Clin Oncol 1995 13 1249 1254 7738629 Bergner M Bobbitt RA Carter WB Gilson BS The Sickness Impact Profile: development and final revision of a health-status measure Med Care 1981 19 8 787 805 10.1097/00005650-198108000-00001 7278416 Pot AM van Dyck R Deeg DJH Ervaren Druk door Informele Z: constructie van een schaal [Self-Perceived Pressure from Informal Care: construction of a scale] Tijdschrift voor Gerontologie en Psychiatrie 1995 26 5 214 219 Given CW Given B Stommel M Collins C King S Franklin S The Caregiver Reaction Assessment (CRA) for caregivers to persons with chronic physical and mental impairments Res Nurs Health 1992 15 4 271 283 10.1002/nur.4770150406 1386680 Nijboer C Triemstra M Tempelaar R Sanderman R van den Bos GAM Measuring both negative and positive reactions to giving care to cancer patients: psychometric qualities of the Caregiver Reaction Assessment (CRA) Soc Sci Med 1999 48 1259 1269 10.1016/S0277-9536(98)00426-2 10220024 Rusbult CE Martz JM Agnew CR The Investment Model Scale: measuring commitment level satisfaction level quality of alternatives and investment size Pers Relat 1998 5 4 357 391 10.1111/j.1475-6811.1998.tb00177.x Lewis FM Fletcher KA Cochrane BB Fann JR Predictors of depressed mood in spouses of women with breast cancer J Clin Oncol 2008 26 8 1289 1295 10.1200/JCO.2007.12.7159 18323552 de Jager-Meezenbroek E van den Berg M Tuytel G Visser A Garssen B Het meten van spiritualiteit als een universeel fenomeen: de ontwikkeling van de Spirituele Attitude en Interesse Lijst (SAIL) [Measuring spirituality as a universal human experience: the development of the Spiritual Attitude and Involvement List (SAIL)] Psychosociale Oncologie 2006 14 3 14 15 Hakkaart- van Roijen L Tan SS Bouwmans CAM Handleiding voor kostenonderzoek: methoden en standaard kostprijzen voor economische evaluaties in de gezondheidsz. [Manual for cost research: methods and unit-prices for economic evaluations in health care] 2010 Diemen: College voor Zverzekeringen [actualized version] Koopmanschap MA Rutten FFH van Ineveld BM van Roijen L The friction cost method for measuring indirect costs of disease J Health Econ 1995 14 2 171 189 10.1016/0167-6296(94)00044-5 10154656 Baer RA Smith GT Lykins E Button D Krietemeyer J Sauer S Walsh E Duggan D Williams JMG Construct validity of the Five Facet Mindfulness Questionnaire in meditating and nonmeditating samples Assessment 2008 15 3 329 342 10.1177/1073191107313003 18310597 Veehof MM ten Klooster PM Taal E Westerhof GJ Bohlmeijer ET Psychometric properties of the Dutch Five Facet Mindfulness Questionnaire (FFMQ) in patients with fibromyalgia Clin Rheumatol 2011 30 8 1045 1054 10.1007/s10067-011-1690-9 21347605 Carmody J Baer RA Relationships between mindfulness practice and levels of mindfulness medical and psychological symptoms and well-being in a Mindfulness-Based Stress Reduction program J Behav Med 2008 31 1 23 33 10.1007/s10865-007-9130-7 17899351 Neff KD The development and validation of a scale to measure self-compassion Self Identity 2003 2 3 223 250 10.1080/15298860309027 Neff KD Vonk R Self-compassion versus global self-esteem: two different ways of relating to oneself J Pers 2009 77 1 23 50 10.1111/j.1467-6494.2008.00537.x 19076996 Kuyken W Watkins E Holden E White K Taylor RS Byford S Evans A Radford S Teasdale JD Dalgleish T How does Mindfulness-Based Cognitive Therapy work? Behav Res Ther 2010 48 11 1105 1112 10.1016/j.brat.2010.08.003 20810101 Treynor W Gonzalez R Nolen-Hoeksema S Rumination reconsidered: a psychometric analysis Cogn Ther Res 2003 27 3 247 259 10.1023/A:1023910315561 Labelle LE Campbell TS Carlson LE Mindfulness-Based Stress Reduction in oncology: evaluating mindfulness and rumination as mediators of change in depressive symptoms Mindfulness 2010 1 28 40 10.1007/s12671-010-0005-6 Horowitz M Wilner N Alvarez W Impact of Event Scale: measure of subjective stress Psychosom Med 1979 41 3 209 218 472086 Brom D Kleber RJ De Schok Verwerkings Lijst [The Impact of Event Scale] Ned Tijdschr Psychol 1985 40 164 168 Sundin EC Horowitz MJ Impact of Event Scale: psychometric properties Br J Psychiatry 2002 180 205 209 10.1192/bjp.180.3.205 11872511 van Aalderen JR Donders ART Giommi F Spinhoven P Barendregt HP Speckens AEM The efficacy of Mindfulness-Based Cognitive Therapy in recurrent depressed patients with and without a current depressive episode: a randomized controlled trial Psychol Med 2012 42 05 989 1001 10.1017/S0033291711002054 22017808 Teasdale JD Segal ZV Williams JMG Ridgeway VA Soulsby JM Lau MA Prevention of relapse/recurrence in major depression by mindfulness-based cognitive therapy J Consult Clin Psychol 2000 68 4 615 623 10965637 Cohen J Statistical power analysis for the behavioral sciences 1988 2 Hillsdale: L. Erlbaum Preacher KJ Hayes AF Asymptotic and resampling strategies for assessing and comparing indirect effects in multiple mediator models Behav Res Methods 2008 40 3 879 891 10.3758/BRM.40.3.879 18697684 W¼rtzen H Dalton SO Andersen KK Elsass P Flyger H Sumbundu A Johansen C Who participates in a randomized trial of Mindfulness-Based Stress Reduction (MBSR) after breast cancer? A study of factors associated with enrollment among Danish breast cancer patients Psychooncology 2012 22 5 1180 1185 22592966 Schofield P Ugalde A Carey M Mileshkin L Duffy M Ball D Aranda SK Lung cancer: challenges and solutions for supportive care intervention research Palliat Support Care 2008 6 281 287 18662422 J Hematol Oncol J Hematol Oncol Journal of Hematology & Oncology 1756-8722 BioMed Central 24565018 3943805 1756-8722-7-15 10.1186/1756-8722-7-15 Research A novel mycobacterial Hsp70-containing fusion protein targeting mesothelin augments antitumor immunity and prolongs survival in murine models of ovarian cancer and mesothelioma Yuan Jianping 1 jyuan2partners. Kashiwagi Satoshi 1 skashiwagipartners. Reeves Patrick 1 pmreevespartners. Nezivar Jean 1 jedone1gmail.com Yang Yuan 1 amyyang1114gmail.com Arrifin Nadiah Hashim 1 Arrifinnadiah.hashim-arrifin09imperial.ac.uk Nguyen Mai 1 mai.nguyencantab.net Jean-Mary Gilberte 1 gilberte.JeanMary001umb.edu Tong Xiaoyun 1 tongxiaoyun2003gmail.com Uppal Paramjit 1 paramjit.uppal10imperial.ac.uk Korochkina Svetlana 1 sv_koroyahoo.com Forbes Ben 1 bforbespartners. Chen Tao 1 tchen5partners. Righi Elda 1 elda.righilibero.it Bronson Roderick 2 roderick_bronsonhms.harvard.edu Chen Huabiao 3 hchen13partners. Orsulic Sandra 4 sandra.Orsuliccshs. Brauns Timothy 1 tBRAUNSPARTNERS. Leblanc Pierre 1 pleblancmclean.harvard.edu Scholler Nathalie 5 nathalie.schollersri.com Dranoff Glenn 6 7 glenn_dranoffdfci.harvard.edu Gelfand Jeffrey 1 jGELFANDPARTNERS. Poznansky Mark C 1 mpoznanskypartners. 1Vaccine and Immunotherapy Center Division of Infectious Diseases Department of Medicine Massachusetts General Hospital 149 13th Street Charlestown Boston MA 02129 USA 2Department of Pathology Harvard Medical School Boston USA 3Ragon Institute of MGH MIT and Harvard University Boston USA 4Women™s Cancer Research Institute Cedars-Sinai Medical Center Los Angeles USA 5Penn Ovarian Cancer Research Center Department of Obstetrics and Gynecology University of Pennsylvania Philadelphia USA 6Department of Medical Oncology and Cancer Vaccine Center Dana-Farber Cancer Institute Boston USA 7Department of Medicine Brigham and Women™s Hospital Harvard Medical School Boston USA 2014 24 2 2014 7 15 15 29 9 2013 2 2 2014 Copyright © 2014 Yuan et al.; licensee BioMed Central Ltd. 2014 Yuan et al.; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons./licenses/by/2.0) which permits unrestricted use distribution and reproduction in any medium provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver (http://creativecommons./publicdomain/zero/1.0/) applies to the data made available in this article unless otherwise stated. Background Although dendritic cell (DC) vaccines are considered to be promising treatments for advanced cancer their production and administration is costly and labor-intensive. We developed a novel immunotherapeutic agent that links a single-chain antibody variable fragment (scFv) targeting mesothelin (MSLN) which is overexpressed on ovarian cancer and mesothelioma cells to Mycobacterium tuberculosis (MTB) heat shock protein 70 (Hsp70) which is a potent immune activator that stimulates monocytes and DCs enhances DC aggregation and maturation and improves cross-priming of T cells mediated by DCs. Methods Binding of this fusion protein with MSLN on the surface of tumor cells was measured by flow cytometry and fluorescence microscopy. The therapeutic efficacy of this fusion protein was evaluated in syngeneic and orthotopic mouse models of papillary ovarian cancer and malignant mesothelioma. Mice received 4 intraperitoneal (i.p.) treatments with experimental or control proteins post i.p. injection of tumor cells. Ascites-free and overall survival time was measured. For the investigation of anti-tumor T-cell responses a time-matched study was performed. Splenocytes were stimulated with peptides and IFN?- or Granzyme B- generating CD3+CD8+ T cells were detected by flow cytometry. To examine the role of CD8+ T cells in the antitumor effect we performed in vivo CD8+ cell depletion. We further determined if the fusion protein increases DC maturation and improves antigen presentation as well as cross-presentation by DCs. Results We demonstrated in vitro that the scFvMTBHsp70 fusion protein bound to the tumor cells used in this study through the interaction of scFv with MSLN on the surface of these cells and induced maturation of bone marrow-derived DCs. Use of this bifunctional fusion protein in both mouse models significantly enhanced survival and slowed tumor growth while augmenting tumor-specific CD8+ T-cell dependent immune responses. We also demonstrated in vitro and in vivo that the fusion protein enhanced antigen presentation and cross-presentation by targeting tumor antigens towards DCs. Conclusions This new cancer immunotherapy has the potential to be cost-effective and broadly applicable to tumors that overexpress mesothelin. Mycobacterial Hsp70 Mesothelin Single chain variable fragment Cancer immunotherapy Murine tumor model Background The goal of cancer immunotherapy is to stimulate the immune system to destroy cancer cells. Numerous strategies that involve tumor antigen-specific and non-specific activation of the immune system have been developed. These include dendritic cell (DC) vaccines adoptive T-cell therapy and immune checkpoint blockade [1-3]. Antigen-specific active immunotherapy is expected to be the most attractive strategy because of its capacity to induce both therapeutic and protective T-cell immunity. Among various approaches DC vaccine is considered to be a promising treatment for advanced cancer based on the ability of DCs to orchestrate all of the elements of the immune system. DCs capture tumor antigens process these antigens into peptides as they move to the draining secondary lymphoid ans and present the peptides to na¯ve T cells thus inducing anti-tumor cellular immune responses. DCs can also activate B cells NK cells and NKT cells [1]. In pre-clinical and clinical studies that exploited DCs as a means to improve vaccine efficiency autologous DCs are loaded ex vivo with antigens and re-administered to the patient. For example Sipuleucel-T (Provenge) that consists of ex vivo activated autologous peripheral blood mononuclear cells (PBMCs) including antigen-presenting cells (APCs) has resulted in a significant survival benefit in Phase III trials for prostate cancer [4]."

Lung_Cancer

"Statistical analysis We used Chi-square test to examine the differences in the distributions of demographic characteristics and genotype frequencies between cases and controls. The NSCLC risk associated with CR1 tag SNPs was estimated as odds ratios (OR) and 95% confidence intervals (CI) computed by logistic regression model adjusted for age gender and smoking status where it was appropriate. Smokers were considered current smokers if they smoked up to 1 year before the date of cancer diagnosis for NSCLC patients or before the date of the interview for controls. The number of pack-years smoked was determined as an indication of cumulative cigarette-dose level [pack-year?=?(cigarettes per day/20) — (years smoked)]. Light and heavy smokers were categorized by using the 50th percentile pack-year value of the controls as the cut points (i.e. ?25 and >25 pack-years). All statistical tests were 2 sided with P<?0.05 as the significant level. Statistical analyses were done using SPSS (version 16.0 SPSS Inc Chicago IL). Gene-gene and gene-smoking interactions were analyzed by open-resource GMDR software package (version 0.9) and Quanto (http://www.hydra.usc.edu/gxe) [4445]. Abbreviations CR1: Complement receptor 1; OR: Odds ratio; CI: Confidence interval; SNP: Single nucleotide polymorphism. Competing interests The authors declare no competing financial interest. Authors™ contributions XY drafted the . XY and JR conducted genotyping of CR1. JL ZZ and LC collected clinical data and analyzed the data. XZ contributed the research plan and approved the data. All authors read and approved the final manuscript. Acknowledgements This work was supported by the National Natural Sciences Foundation of China to XZ (no. 81101483) Program for New Century Excellent Talents in University to XZ (NCET-11-0933) Science Fund for Distinguished Young Scholars of Hebei Scientific Committee to XZ (H2012401022) and Foundation for the Author of National Excellent Doctoral Dissertation of PR China (FANEDD) (no. 201274). Gelderman KA Tomlinson S Ross GD Gorter A Complement function in mAb-mediated cancer immunotherapy Trends Immunol 2004 25 158 164 10.1016/j.it.2004.01.008 15036044 Rutkowski MJ Sughrue ME Kane AJ Mills SA Parsa AT Cancer and the complement cascade Mol Cancer Res 2010 8 1453 1465 10.1158/1541-7786.MCR-10-0225 20870736 Liu D Niu ZX The structure genetic polymorphisms expression and biological functions of complement receptor type 1 (CR1/CD35) Immunopharmacol Immunotoxicol 2009 31 524 535 10.3109/08923970902845768 19874218 Ahearn JM Fearon DT Structure and function of the complement receptors CR1 (CD35) and CR2 (CD21) Adv Immunol 1989 46 183 219 2551147 Tas SW Klickstein LB Barbashov SF Nicholson-Weller A C1q and C4b bind simultaneously to CR1 and additively support erythrocyte adhesion J Immunol 1999 163 5056 5063 10528211 Wagner C Ochmann C Schoels M Giese T Stegmaier S Richter R Hug F Hansch GM The complement receptor 1 CR1 (CD35) mediates inhibitory signals in human T-lymphocytes Mol Immunol 2006 43 643 651 10.1016/j.molimm.2005.04.006 16360013 Jozsi M Prechl J Bajtay Z Erdei A Complement receptor type 1 (CD35) mediates inhibitory"

Lung_Cancer

"The greater than 2-fold increase in affinity is indicative of multivalent binding of the peptide to the cell surface and not merely an increase in the number of peptide units. Attachment of the peptides to the CB-TE2A chelator does not affect the affinity of the peptide compared to the parental dimer of H2009.1-10mer. Interestingly the two divalent conjugates H2-(M10)2 and H2-D10 have the same affinity for H2009 cells. Thus displaying the peptide off a lysine core or the divalent CB-TE2A core does not significantly affect the specific cell binding. Of note CB-TE2A conjugates of the A20FMDV peptide have also been reported 48. However in the modification one of the carboxylate groups was consumed for the peptide conjugation which might compromise the stability of the Cu(II) complex moiety. In addition it adds an extra positive charge to the peptide conjugate when labeled with 64Cu which might contribute to the high kidney uptake. In contrast all our peptide conjugates maintain an intact CB-TE2A core to form the neutral Cu(II)-CB-TE2A complex with non-compromised stability. Towards the goal of utilizing the multivalent effect for ?v?6-integrin PET imaging we conducted non-invasive imaging evaluation studies in two SCID mouse models bearing H2009 (?v?6+) and H460 (?v?6-) tumors. The H2009 (?v?6+) tumor was clearly visualized by all four probes monovalent (64Cu-M10) and divalent (64Cu-(M10)2 64Cu-D10 and 64Cu-AcD10) at 1 h p.i. In contrast much lower tumor uptake was observed for all the probes in H460 (?v?6-) tumor while their distribution profiles in the other tissue were almost identical to those observed in the H2009 tumor-bearing mice. This result demonstrates the ?v?6 binding specificity of the H2009.1-10mer peptide. However though the H2009 tumor was visualized by 64Cu-M10 at 1 h p.i. its imaging contrast became barely visible at 4 and 24 h p.i. The low tumor contrast of 64Cu-M10 is likely caused by its suboptimal in vivo kinetics receptor binding and stability. These drawbacks can be potentially resolved or mitigated by multimeric presentation of the peptide on a scaffold. Indeed the divalent probes (64Cu-(M10)2 64Cu-D10 and 64Cu-AcD10) showed an approximate 3-fold tumor uptake increase as compared to 64Cu-M10 which clearly demonstrates the role of the multivalent effect in imaging signal amplification. In addition the tumor PET signal retention of the three divalent probes stayed above 0.70 %ID/g even at 24 h p.i. While the increased affinity of the dimeric probes contributes to the increased tumor accumulation increased stability and improved in vivo kinetics are likely to play a role as well. Interestingly no significant tumor uptake difference was observed for the three divalent probes out to 24 h p.i. indicating the two multivalent presentation approaches afforded virtually the same result. While this observation was somewhat to our surprise it may result from the flexible PEG spacer that has been incorporated into our probe design which provides no spatial constraints to the ligand-receptor binding. All three divalent probes showed a similar biodistribution profile in the H2009 and H460 tumor models with elevated uptake (< 3 fold) in major ans other than kidneys as compared to the monovalent one. This is likely caused by the molecular weight induced difference of in vivo kinetics. Although we observe relatively high tumor uptake compared to background accumulation in the mediastinum region we recognize the need to further increase accumulation of radiolabel in the tumor. Improved tumor uptake is anticipated to increase sensitivity of detection. One advantage of our bifunctional chelator design is that we can layer the valency moving rapidly from monomeric to octomeric peptides. As the valency increases we anticipate an increase in affinity for ?v?6 and improved in vivo kinetics 30. Additionally the design allows for facile PEGylation of both the peptide ligand and the chelator which may improve tumor uptake by increasing circulation time of the probe 49. Defined length PEG linkers are available allowing for controlled empirical testing. Rapid kidney uptake and efficient clearance is a desired feature of targeted PET imaging probes. However high kidney uptake is unwanted even for lung cancer imaging because it renders the kidneys to unnecessary radiation exposure. Given the high kidney uptake and retention observed for both 64Cu-(M10)2 and 64Cu-D10 ( ) they may not find practical applications in PET imaging of ?v?6-integrin. By immunocytochemical staining we found negligible expression of ?v?6 integrin in the kidneys of H2009 tumor bearing mice (data not shown) indicating the non-specific nature of the observed high kidney accumulation. Further as shown in the PET imaging results of 64Cu-CB-TE2A-(c(RGDyK))2 in both H2009 and H460 tumor models the CB-TE2A-based construct is not the culprit of the high kidney uptake. Therefore we reasoned that the high kidney uptake and retention resulted from the peptide itself. Two factors may play an important role - the peptide's stability and charge in vivo. As such we introduced an acetyl group to cap the N-terminus of the H2D10 conjugate which led to H2AcD10. The acetylation reduces the overall charge from +4 (H2D10) to +2 (H2AcD10) while limiting proteolysis of the peptide by N-terminal peptidases 36. As anticipated 64Cu-AcD10 showed a drastic decrease in kidney uptake and retention and the level of tumor uptake was maintained compared to its non-acetylated counterpart 64Cu-D10 (). In addition a significant uptake reduction was also observed in other non-target ans including lung and liver. The improved tumor-to-lung contrast is of great importance to the imaging detection of NSCLCs. "

Lung_Cancer

"Background A gene-based estimate of lung cancer risk in smokers has been shown to act as a smoking cessation motivator in hospital recruited subjects. The objective of this trial is to determine if this motivator is as effective in subjects recruited from an NHS primary care unit. Method/Design Subjects will be recruited by mailings using smoking entries on the GP electronic data-base (total practice population?=?32048) to identify smokers who may want to quit. Smoking cessation clinics based on medical centre premises will run for eight weeks. Clinics will be randomised to have the gene-based test for estimation of lung cancer risk or to act as controls groups. The primary endpoint will be smoking cessation at eight weeks and six months. Secondary outcomes will include ranking of the gene-based test with other smoking cessation motivators. Discussion The results will inform as to whether the gene-based test is both effective as motivator and acceptable to subjects recruited from primary care. Trial registration Registered with Clinical Trials.gov Registration number: NCT01176383. Smoking cessation Genetic test Lung cancer Background Gene testing in primary care is no longer limited by their exorbitant cost. The prices of genetic tests are dropping faster than Moore™s law for computing costs [1]. This leads the focus to shift from cost of genetic testing to the clinical value of individual gene tests. The recent development of gene-based tests that predicts the risk of lung cancer in smokers is an important example [2]. Despite the well accepted 10-15% probability of lung cancer in smokers 50% of smokers do not believe they are at significantly increased risk [3]. However over 80% of smokers would like to know their personal risk of lung cancer [4]. There is a plausible three way link between biomarkers for chronic obstructive pulmonary disease (COPD) a set of 20 single nucleotide polymorphisms (SNPs) associated with cancer risk and lung cancer [5-8] (). Research has shown a strong association between a high lung cancer susceptibility score derived from family history of cancer the 20 SNPs COPD history (Auckland formula) and the development of lung cancers whereas healthy smokers matched for age gender and lifetime smoking habits had a relatively low score (n?=?446 lung cancer subjects 484 healthy current smokers). The odds ratio for lung cancer risk varied from 0.2-3.2 depending on the genetic risk (p?<?0.001) [910]. The accuracy of the Auckland formula in estimating lung cancer risk for a score of >4 was: sensitivity 90% specificity 45% ( which also includes scores for 52 subjects who developed cancer from a six year prospective study of 1212 smokers and ex-smokers). The score for prediction of non-cancer was conducted with a follow up of just six years. It means that 45% of non-cancer subjects have a low cancer score and 55% have some degree of increased score. The 55% with increased scores have simply not been followed up long enough for lung cancers to develop yet. Notwithstanding this limitation there is now a 20 SNP gene test for prediction of lung cancer in smokers under the trade name Respiragene. Research that established the respiragene test. Distribution of the Respiragene score in a cross-sectional study of 484 control smokers (blue) and 446 with lung cancer (red) (Total?=?930) and from the prospective study of 52 lung cancer cases (green). Reference [8]. Two case-control studies showed a 5-10% increase in cessation with a single gene test of small effect [1112]. A small smoking cessation pilot study using spirometry results and explanations using the Fletcher-Peto diagram to explain risk demonstrated that patients find this is an acceptable method and the quit rate at 12 months was 27% [13]. In a randomised control trial patients were given either a full explanation of the results of spirometry testing including an estimation of lung age or just their forced expiratory volume in the first second (FEV1) without explanation (control group). The group of patients who were given the full explanation had a 7.2% higher quit rate than the control group [14]. Data from a hospital outpatient cohort in Auckland suggest a larger increase in quit rate with Respiragene test and the Auckland formula (). Subjects who were current smokers in the pre-contemplative and contemplative stage were randomised into either the test group or control group and only the test group had the Respiragene test. Counselling and follow-up was done by telephone. Using Auckland formula to incorporate the results of the Respiragene test clinical data and family history a score ranging 1-12 with associated risk level (moderate risk high risk very high risk) was calculated and explained to test subjects. Neither group were involved in any formal smoking cessation programme. Indeed of the 13 subjects that had managed to stop smoking (28% of the gene-tested group) 48% quit without any medical assistance and only 52% had nicotine replacement therapy [1516]. When compared with previous studies using telephone counselling alone [17] () there is a 20-25% improvement in smoking cessation with the Respiragene test (). The improvement in intention to quit increases from 56% before testing to 67% in smokers with an average smokers risk of lung cancer or 89% in smokers with a high risk of lung cancer [18]. Respiragene study in Auckland NZ (n?=?43) Cancer susceptibility scale (compared with normal lifetime risk) Cancer susceptibility score Estimated lifetime risk of lung cancer Initial intention to quit Proportion that stopped smoking at 2-4 weeks Proportion still not smoking at 6 months Expected result for telephone counselling () - - 15% 41% 10-20% 9-12% Telephone counselling?+?Respiragene test 1-2.3 (10-35% risk) 2.3-6.7 (35-65% risk) 6.7-8 (65%-80% risk) 27 had average risk score 15% 67% 8/27 (30%) 8 (30%) 16 had high or very high risk score 30-50% (4-10 times average risk) 89% 10/16 (63%) 6 (37.5%) Smoking cessation after Respiragene testing and estimation of lung cancer risk with telephone counselling in a small pilot study in Auckland NZ (n?=?43) compared with expected quit rate. Efficacy of the variety of smoking cessation strategies. Percent increase of success for six months over unaided attempts for each type of quitting (chart from West & Shiffman based on Cochrane review data). Totally unaided smoking cessation has a 3-6% success rate. Therefore telephone support () increases success rate by 6% = 9-12% quit rate. A large hospital trial using Respiragene for calculating lung cancer susceptibility is currently underway in the USA [19] but there are no planned UK investigations. This study fills that gap and uses the NHS framework for smoking cessation. Other studies have taken place looking at how lung functioning testing in COPD might motivate smokers to quit suggesting that it is feasible to conduct this sort of study [131420]. This protocol describes a trial to evaluate a gene-based risk test (using genetic and clinical data) as a smoking cessation motivator in smokers wishing to participate in an NHS primary care smoking cessation clinic (in the action stage of change) alongside the usual counselling and prescribing protocol. It will differ from previous studies using gene testing as a motivator however in that the NHS primary care counselling and prescribing protocol will include several other motivators (CO breath testing saliva cotinine testing and intensive counselling) whereas the Auckland trial using the same gene test had none of these. Also the method of recruitment will differ in that primary care subjects will of necessity be different from the Auckland hospital outpatient cohort [1516]. Research question Can the Respiragene test combined with an estimation of lung cancer susceptibility be used to increase the uptake adherence to and success rate in an established smoking cessation programme in subjects who want to quit in a National Health Service United Kingdom (NHS UK) setting? Hypothesis Genetic testing and estimation of lung cancer susceptibility should increase œsmoking cessation outcomes at six months to >30% (or 1.5-2 fold greater than usual care) irrespective of the risk scores assigned to subjects [11]. Method/Design This protocol has been approved by Surrey Research Ethics Committee at the Royal Surrey County Hospital Guildford Surrey UK. 1/Recruitment Focus groups A number of focus groups of different aged smokers will be held to enable them to contribute to the design of the study 2/ Recruitment Subjects will be recruited from a large general practice in Surrey (practice population=?>?30000). Smokers aged 20-70 years will be identified from the practice records and contacted by post by their GP. Patients who reply stating that they wish to stop smoking will be randomised (stratified randomisation to ensure equivalent age and gender mix) to two clinics (Figure 3) only one of which will include the gene-based test. Previous trials of genetic testing in association with smoking cessation achieved 83-100% of participants opting for the test depending on the method of recruitment [821]. There will be two mailings with SAEs for recruitment with the aim of recruiting at least 30 subjects per clinic (see Power calculations under heading œstatistics). In the first letter the patient™s GP asks the patient to give permission for the researcher to contact him/her to ask about taking part in smoking cessation research (with possible genetic risk testing) and encloses fact sheet 1 and a stamped addressed envelope (SAE) for reply. Figure 3 Consort 2010 flow diagram for GeTTS recruitment. Mailing 2. The principal investigator mails patient with Letter 2 to ask him/her if they would like to attend an 8-week smoking cessation clinic and asks if they would be willing to have a test for genetic susceptibility to development of lung cancer and encloses SAE for reply. Mailing 3. The principal investigator mails Group B subjects and Group A test-concordant subjects to confirm dates of the smoking cessation sessions and full patient information leaflet and consent form enclosed. The information sheet will be slightly different for group A and B. Non-test concordant subjects within group A will be invited to attend the practice nurse for smoking cessation. 3/Inclusion and exclusion criteria i. Inclusion criteria: Aged 20-70 years smoking more than 10 cigarettes daily. ii. Exclusion criteria: Aged under 20 years or over 70 years smoking less than 10 cigarettes daily history of major depression and other psychiatric conditions dementias and serious or terminal illness (cancers etc.). Patients on warfarin would be excluded due to interactions between warfarin and varenicline as varenicline will be used as the modern treatment of choice for smoking cessation. Patients who smoke less than 10 cigarettes/day and patients who did not wish to have a genetic test or do not wish to take part in a research study will be referred to the practice nurse for smoking cessation. 4/Smoking cessation clinics For group A subjects only subjects who have expressed an interest in having a genetic test and gene-based estimation of susceptibility to lung cancer in mailing 2 will be invited to participate (see referral for decliners above). For group B subjects all subjects willing to participate are invited to do so. Uptake into smoking cessation programme (i.e. proportion of invitees who accept invitation and attend clinic of those mailed invitation) will be recorded. All subjects who attend the first session of the research clinic will be asked by the principal investigator JN to sign a consent form and will be invited to raise any concerns about the protocol (as explained in the full information sheet). The consent form will then be countersigned by JN. Group A clinics and Group B clinics will be held on different weekdays at the same health centre premises. Test Subjects who attend Clinic A will be offered a fact sheet on the health risks of smoking (including lung cancer) and the option of the gene-based test for calculation of lung cancer susceptibility whilst subjects who attend Clinic B will be given the same fact sheet on the health risks of smoking (including lung cancer) but without any reference to the gene-based test. The principal investigator will be responsible for handing out the fact sheets and administering the gene-based test in Clinic A and for handing out and explaining the fact sheet in Clinic B. NHS Surrey™s Smoking Cessation Practitioners will lead in-house smoking cessation clinics A and B using the NHS smoking cessation guidelines [22] under the supervision of the principal investigator at the medical centre. There will be: ¢Introductory session which includes a new near patient test for salivary cotinine (nicotine metabolite) “ trade name SmokeScreen [23]. ¢At session 2 patients will be given advice on therapies for smoking cessation. We expect that most patients will opt for a course of varenicline and they will be advised to contact their GP for a prescription. ¢This is followed by seven more weekly sessions and a follow-up session at six months (Figure 4). Uptake and adherence to smoking cessation will be monitored by weekly carbon monoxide exhalation measurements (breath test). The principal investigator will be involved in clinic A administering the gene-based test and determining if subjects have COPD from practice records and history in session 1. Participants who are heavy smokers have a smokers cough and use a salbutamol inhaler can be judged to have COPD even if this is not entered in their GP records (all Group A & B subjects will have spirometry at their 6-month follow-up)."

Lung_Cancer

"MassArray analysis 1 Sequencing+pyrosequencing 1 Sequencing+pyrosequencing+high-resolution melting 2 Sequencing+restriction fragment length polymorphism 1 Sequencing+single-strand conformational analysis 1 Sequencing+Taqman+PNA clamp 1 Sequencing+Therascreen kit 5 Sequencing+Therascreen kit+CAST PCR 1 SNaPshot+single-strand conformational analysis 1 Therascreen kit+fragment length analysis+SNaPshot kit 1 Genotyping errors False positive False negative Sample no. EGFR mutation resulta Samples tested A a B a C a A a B a C a Total errors Error rate (%) Round 1 c.2369C>T p.(T790M); c.2573T>G p.(L858R) 23 0 4 4 17.4 A1 2 c.2235_2249del p.(E746_A750del) 24 0 0 0 0.0 A2 3 Wild type 24 5 0 5 20.8 A3 4 Wild type 23 5 0 5 21.7 A4 5 c.2235_2249del p.(E746_A750del) 24 0 5 5 20.8 A5 6 c.2369C>T p.(T790M); c.2573T>G p.(L858R) 24 0 5 5 20.8 A6 7 c.2235_2249del p.(E746_A750del) 24 0 1 1 4.2 A7 8 Wild type 23 0 0 0 0.0 A8 9 c.2369C>T p.(T790M); c.2573T>G p.(L858R) 23 0 0 0 0.0 A9 10 c.2369C>T p.(T790M); c.2573T>G p.(L858R) 24 0 1 1 4.2 A10 11 c.2235_2249del p.(E746_A750del) 107 1 0 1 0 2 1.9 B1 and C8 12 c.2369C>T p.(T790M); c.2573T>G p.(L858R) 107 2 0 16 1 19 17.8 B2 and C3 13 c.2235_2249del p.(E746_A750del) 100 2 0 3 4 9 9.0 B3 and C9 14 Wild type 104 0 1 0 0 1 1.0 B4 and C1 15 Wild type 103 2 0 0 0 2 1.9 B5 and C4 16 Wild type 104 2 0 0 0 2 1.9 B6 and C6 17 Wild type 103 2 0 0 0 2 1.9 B7 and C7 18 c.2155G>A p.(G719S) 104 2 0 25 10 37 35.6 B8 and C10 19 c.2369C>T p.(T790M); c.2573T>G p.(L858R) 106 0 0 7 2 9 8.5 B9 and C5 20 c.2155G>A p.(G719S) 104 0 0 9 0 9 8.7 B10 and C2 a External quality assessment scheme rounds “ first (A) second (B) and third (C). 2984705R 2786 Cancer Res Cancer Res. Cancer research 0008-5472 1538-7445 24860162 4102622 10.1158/0008-5472.CAN-13-3398 NIHMS599328 Mechanisms promoting escape from mitotic-stress induced tumor cell death Sinnott Rebecca 1 * Winters Leah 2 Larson Brittany 3 Mytsa Daniela 1 Taus Patrick 1 * Cappell Kathryn M. 4 Whitehurst Angelique W. 1 * # 1Department of Pharmacology and Lineberger Comprehensive Cancer Center University of North Carolina at Chapel Hill Chapel Hill NC 2Department of Anesthesiology University of Colorado Aurora CO 3Wake Forest University School of Medicine Winston-Salem NC 4Deparmtent of Medicine Stanford University Stanford CA * Current Institution: Simmons Comprehensive Cancer Center UT-Southwestern Medical Center Dallas TX. #Address correspondence to: Angelique Whitehurst PhD. UT-Southwestern Medical Center 6001 Forest Park Drive Dallas TX 75390-8807. Phone (214)-645-6066. 214-645-6347 angelique.whitehurstutsouthwestern.edu. 13 6 2014 23 5 2014 15 7 2014 15 7 2015 74 14 3857 3869 Non-small cell lung cancer (NSCLC) is notorious for its paltry responses to first-line therapeutic regimens. In contrast to acquired chemoresistance little is known about the molecular underpinnings of the intrinsic resistance of chemo-na¯ve NSCLC. Here we report that intrinsic resistance to paclitaxel in NSCLC occurs at a cell-autonomous level due to the uncoupling of mitotic defects from apoptosis. To identify components that permit escape from mitotic stress-induced death we employed a genome-wide RNAi-based strategy which combines a high-throughput toxicity screen with a live-cell imaging platform to measure mitotic fate. This strategy revealed that prolonging mitotic arrest with a small molecule inhibitor of the APC/Cyclosome could sensitize otherwise paclitaxel-resistant NSCLC. We also defined novel roles for CASC1 and TRIM69 in supporting resistance to spindle poisons. CASC1 which is frequently co-amplified with KRAS in lung tumors is essential for microtubule polymerization and satisfaction of the spindle assembly checkpoint. TRIM69 which associates with spindle poles and promotes centrosomal clustering is essential for formation of a bipolar spindle. Notably RNAi-mediated attenuation of CASC1 or TRIM69 was sufficient to inhibit tumor growth in vivo. On the basis of our results we hypothesize that tumor evolution selects for a permissive mitotic checkpoint which may promote survival despite chromosome segregation errors. Attacking this adaptation may restore the apoptotic consequences of mitotic damage to permit the therapeutic eradication of drug-resistant cancer cells. mitotic slippage pan-genomic RNAi screen paclitaxel CASC1 TRIM69 8811105 1399 Mol Carcinog Mol. Carcinog. Molecular carcinogenesis 0899-1987 1098-2744 23681825 4152901 10.1002/mc.22006 NIHMS619642 Heme-related gene expression signatures of meat intakes in lung cancer tissues Lam Tram Kim 1 2 * Rotunno Melissa 2 * Ryan Brid M. 3 Pesatori Angela C. 4 5 Bertazzi Pier Alberto 4 5 Spitz Margaret 6 Caporaso Neil E. 2 Landi Maria Teresa 2 § 1Cancer Prevention Fellowship Program Office of Preventive Oncology National Cancer Institute National Institutes of Health (NIH) DHHS Bethesda Maryland 2Division of Cancer Epidemiology and Genetics Genetic Epidemiology Branch National Cancer Institute National Institutes of Health (NIH) DHHS Bethesda Maryland 3Laboratory of Human Carcinogenesis Center for Cancer Research National Cancer Institute Bethesda Maryland 4EPOCA Epidemiology Research Center Universita™ degli Studi di Milano Milan 5Unit of Epidemiology Fondazione IRCCS Ospedale Maggiore Policlinico Mangiagalli e Regina Elena Milan Italy 6MD Anderson Cancer Center Houston Texas §To whom correspondence should be addressed. National Cancer Institute 6120 Executive Blvd. MSC 7114 Bethesda MD 20892-7248; landimmail.nih.gov; Fax: 301-402-4489 * The authors equally contributed to the presented work. 9 8 2014 16 5 2013 7 2014 03 9 2014 53 7 548 556 Lung cancer causes more deaths worldwide than any other cancer. In addition to cigarette smoking dietary factors may contribute to lung carcinogenesis. Epidemiologic studies including the Environment and Genetics in Lung cancer Etiology (EAGLE) have reported increased consumption of red/processed meats to be associated with higher risk of lung cancer. Heme-iron toxicity may link meat intake with cancer. We investigated this hypothesis in meat-related lung carcinogenesis using whole genome expression. We measured genome-wide expression (HG-U133A) in 49 tumor and 42 non-involved fresh frozen lung tissues of 64 adenocarcinoma EAGLE patients. We studied gene expression profiles by high-versus-low meat consumption with and without adjustment by sex age and smoking. Threshold for significance was a False Discovery Rate (FDR) ?0.15. We studied whether the identified genes played a role in heme-iron related processes by means of manually curated literature search and gene ontology-based pathway analysis. We found that gene expression of 232 annotated genes in tumor tissue significantly distinguished lung adenocarcinoma cases who consumed above/below the median intake of fresh red meats (FDR=0.12). Sixty-three (~28%) of the 232 identified genes (12 expected by chance p-value<0.001) were involved in heme binding absorption transport and Wnt signaling pathway (e.g. CYPs TPO HPX HFE SLCs WNTs). We also identified several genes involved in lipid metabolism (e.g. NCR1 TNF UCP3) and oxidative stress (e.g. TPO SGK2 MTHFR) that may be indirectly related to heme-toxicity. The study™s results provide preliminary evidence that heme-iron toxicity might be one underlying mechanism linking fresh red meat intake and lung cancer. Proc Natl Acad Sci U S A Proc. Natl. Acad. Sci. U.S.A pnas pnas PNAS Proceedings of the National Academy of Sciences of the United States of America 0027-8424 1091-6490 National Academy of Sciences 24550319 3932924 201320956 10.1073/pnas.1320956111 PNAS Plus Biological Sciences Medical Sciences PNAS Plus Mapping the molecular determinants of BRAF oncogene dependence in human lung cancer BRAF oncogene dependence in NSCLC Lin Luping a b Asthana Saurabh a b Chan Elton a b Bandyopadhyay Sourav b Martins Maria M. b Olivas Victor a b Yan Jenny Jiacheng a b Pham Luu b Wang Mingxue Michelle b Bollag Gideon c Solit David B. d Collisson Eric A. a b Rudin Charles M. e Taylor Barry S. a b f Bivona Trever G. a b 1 Departments of aMedicine and fEpidemiology and Biostatistics and bHelen Diller Family Comprehensive Cancer Center University of California San Francisco CA 94158; cPlexxikon Inc. Berkeley CA 94710; dHuman Oncology and Pathogenesis Program and eThoracic Oncology Service Memorial Sloan“Kettering Cancer Center New York NY 10065 1To whom correspondence should be addressed. E-mail: trever.bivonaucsf.edu. Edited by Arthur Weiss University of California San Francisco CA and approved January 15 2014 (received for review November 6 2013) Author contributions: L.L. G.B. D.B.S. E.A.C. C.M.R. B.S.T. and T.G.B. designed research; L.L. E.C. S.B. M.M.M. V.O. J.J.Y. L.P. and M.M.W. performed research; C.M.R. contributed new reagents/analytic tools; L.L. S.A. S.B. and B.S.T. analyzed data; and L.L. B.S.T. and T.G.B. wrote the paper. 18 2 2014 3 2 2014 111 7 E748 E757 Significance Oncogenic mutations in the BRAF kinase occur in 6“8% of nonsmall cell lung cancers (NSCLCs) but the biological and clinical relevance of these mutations is unclear. We uncovered mechanisms of resistance to BRAF inhibition in NSCLC using an integrated functional chemical genetics approach in human BRAF-mutant NSCLC cells and clinical specimens. Our results provide biological insights into the regulation of BRAF oncogene dependence and identify strategies to optimize outcomes in BRAF-mutant NSCLC patients. Oncogenic mutations in the BRAF kinase occur in 6“8% of nonsmall cell lung cancers (NSCLCs) accounting for more than 90000 deaths annually worldwide. The biological and clinical relevance of these BRAF mutations in NSCLC is incompletely understood. Here we demonstrate that human NSCLC cells with BRAFV600E but not other BRAF mutations initially are sensitive to BRAF-inhibitor treatment. However these BRAFV600E NSCLC cells rapidly acquire resistance to BRAF inhibition through at least one of two discrete molecular mechanisms: (i) loss of full-length BRAFV600E coupled with expression of an aberrant form of BRAFV600E that retains RAF pathway dependence or (ii) constitutive autocrine EGF receptor (EGFR) signaling driven by c-Jun“mediated EGFR ligand expression. BRAFV600E cells with EGFR-driven resistance are characterized by hyperphosphorylated protein kinase AKT a biomarker we validated in BRAF inhibitor-resistant NSCLC clinical specimens. These data reveal the multifaceted molecular mechanisms by which NSCLCs establish and regulate BRAF oncogene dependence provide insights into BRAF“EGFR signaling crosstalk and uncover mechanism-based strategies to optimize clinical responses to BRAF oncogene inhibition. targeted therapy combination therapy 101274235 33311 J Thorac Oncol J Thorac Oncol Journal of thoracic oncology : official publication of the International Association for the Study of Lung Cancer 1556-0864 1556-1380 24662455 4084898 10.1097/JTO.0000000000000148 NIHMS560664 Membrane carbonic anhydrase IX (CAIX) expression and relapse risk in resected stage I-II non-small cell lung cancer Stewart D.J. MD Nunez M.I. MD Behrens C. MD Liu D. MS Lin Y. H. PhD Lee J.J. PhD Roth J. MD Heymach J. MD PhD Swisher S. MD Hong W.K. MD Wistuba I.I. MD University of Ottawa (DJS) and University of Texas MD Anderson Cancer Center (MIN CB DL YHL JJL JR JH SS WKH IIW) Correspondence: David J. Stewart MD FRCPC Head Division of Medical Oncology The Ottawa Hospital/University of Ottawa Ottawa ON Canada K1H 8L6 Telephone: 613-737-7700 — 70166 dstewarttoh.on.ca 25 5 2014 5 2014 01 5 2015 9 5 675 684 Background Adjuvant chemotherapy reduces recurrences of non-small cell lung cancer (NSCLC). To determine which patients need adjuvant chemotherapy we assessed factors associated with time to relapse (TTR). Methods In 230 resected stages I-II NSCLCs we correlated immunohistochemistry (IHC) scores for factors associated with cell growth rate growth regulation hypoxia cell survival and cell death with TTR. Results With a median follow-up of 82 (1-158) months for those alive and relapse-free at last follow-up median time to recurrence was not reached. The 2- and 5-year probabilities of maintaining freedom from recurrence were 80.7% (95% confidence interval [CI]:(75.3% 86.4%)) and 74.6% (95% CI:(68.6% 81.2%)) respectively. TTR curves flattened at an apparent cure rate of 70%. In multicovariate Cox models factors correlating with shorter TTR were membranous carbonic anhydrase IX (mCAIX) staining (any vs none hazard ratio [HR]=2.083 p=0.023) and node stage (N1 vs N0 HR=2.591 p=0.002). mCAIX scores correlated positively with tumor size grade squamous histology necrosis mitoses Ki67 p53 nuclear DNMT1 and cytoplasmic SHARP2 and correlated inversely with papillary histology EGFR mutation (trend) CTR1 and cytoplasmic HIF-1? VEGF DNMT1 and ERCC1. Conclusion Nodal stage and mCAIX IHC were the strongest independent predictors of shorter TTR in resected NSCLCs. mCAIX correlated with tumor size markers of tumor proliferation and necrosis and tumor genetic characteristics and paradoxically correlated inversely with the hypoxia markers HIF-1? and VEGF. Presence of mCAIX could help determine patients with high-risk of recurrence who might require adjuvant chemotherapy. carbonic anhydrase IX non-small cell lung cancer PLoS One PLoS ONE plos plosone PLoS ONE 1932-6203 Public Library of Science San Francisco USA 24595062 3942483 PONE-D-13-41012 10.1371/journal.pone.0090818 Research Biology Biochemistry Proteins Developmental Biology Morphogenesis Cell Migration Evolutionary Biology Evolutionary Systematics Phylogenetics Genetics Cancer Genetics Gene Expression Gene Function Model Organisms Animal Models Medicine Oncology Basic Cancer Research FTSJ2 a Heat Shock-Inducible Mitochondrial Protein Suppresses Cell Invasion and Migration FTSJ2 Characteristics and Functions in Cancer Cells Lai Cheng-Wei 1 Chen Hsiao-Ling 2 Lin Ken-Yo 1 Liu Fang-Chueh 1 3 Chong Kowit-Yu 4 Cheng Winston T. K. 5 Chen Chuan-Mu 1 * 1 Department of Life Sciences Agricultural Biotechnology Center iEGG center National Chung Hsing University Taichung Taiwan 2 Department of Bioresources Da-Yeh University Changhwa Taiwan 3 Department of Animal Nutrition Livestock Research Institute Council of Agriculture Tainan Taiwan 4 Department of Medical Biotechnology and Laboratory Science Chang Gung University Tao-Yuan Taiwan 5 Department of Animal Science and Biotechnology Tunghai University Taichung Taiwan Ahmad Aamir Editor Wayne State University School of Medicine United States of America * E-mail: chchen1dragon.nchu.edu.tw Competing Interests: The authors have declared that no competing interests exist. Conceived and designed the experiments: HLC CMC. Performed the experiments: CWL KYL FCL. Analyzed the data: KYC CMC WTC. Contributed reagents/materials/analysis tools: FCL WTC. Wrote the paper: CWL CMC. 2014 4 3 2014 9 3 e90818 8 10 2013 5 2 2014 2014 Lai et al This is an open-access distributed under the terms of the Creative Commons Attribution License which permits unrestricted use distribution and reproduction in any medium provided the original author and source are credited. Ribosomal RNA large subunit methyltransferase J (RrmJ) an Escherichia coli heat shock protein is responsible for 2?-O-ribose methylation in 23S rRNA. In mammals three close homologs of RrmJ have been identified and have been designated as FTSJ1 FTSJ2 and FTSJ3; however little is known about these genes. In this study we characterized the mammalian FTSJ2 which was the most related protein to RrmJ in a phylogenetic analysis that had similar amino acid sequence features and tertiary protein structures of RrmJ. FTSJ2 was first identified in this study as a nucleus encoded mitochondrial protein that preserves the heat shock protein character in mammals in which the mRNA expressions was increased in porcine lung tissues and A549 cells after heat shock treatment. In addition a recent study in non-small cell lung cancer (NSCLC) suggested that the FTSJ2 gene is located in a novel oncogenic locus. However our results demonstrate that the expression of FTSJ2 mRNA was decreased in the more invasive subline (CL1-5) of the lung adenocarcinoma cells (CL1) compared with the less invasive subline (CL1-0) and overexpression of FTSJ2 resulted in the inhibition of cell invasion and migration in the rhabdomyosarcoma cell (TE671). In conclusion our findings indicate that mammalian FTSJ2 is a mitochondrial ortholog of E. coli RrmJ and conserves the heat shock protein properties. Moreover FTSJ2 possesses suppressive effects on the invasion and migration of cancer cells. This research was supported by grant NSC-98-2313-b-005-012 from the National Science Council and was partly supported by the Ministry of Education Taiwan Republic of China under the aiming top university plan (ATU-101-s0508). The funders had no role in study design data collection and analysis decision to publish or preparation of the manuscript. Introduction Heat shock proteins (HSPs) and their biological functions are highly conserved from Escherichia coli to mammals [1]. The following five major classes of HSPs have been defined: HSP70s HSP60s HSP90s HSP110s and small HSPs. Protein folding refolding and disaggregation are well-known functions of HSPs [1] [2]. However there are still a number of proteins involved in the heat shock response that remain uncharacterized upon heat shock stress [3]. The E. coli enzyme RrmJ a 23S rRNA 2?-O-ribose methyltransferase (MTase) that was identified as a novel heat shock protein is the first gene of the rrmJ-ftsH heat shock operon and was first discovered in 1991 [3] [4]. RrmJ is required for the 2?-O-ribose methylation of U2552 in 23S rRNA [5]. Um2552 is one of the four 2?-O-ribose methylated nucleotides in E. coli rRNA and is located in the A-loop of the peptidyl transferase center of the ribosome [5] [6]. In a previous study the E. coli rrmJ deletion strain lost its adaptive ability upon heat shock stress [7]. This loss may have resulted from a change in the A-loop conformation and ribosome dissociation [7]“[9]. The heat shock protein RrmJ is conserved in both Prokaryota and Eukaryota [10]. In Saccharomyces cerevisiae there are three homologs of RrmJ including Trm7p Mrm2p and Spb1p. Trm7p is a tRNA 2?-O-ribose MTase that catalyzes the methylation of the nucleotides at positions 32 and 34 in the anticodon loop of tRNAPheTrp [11]. Mrm2p is a mitochondrial rRNA 2?-O-ribose MTase but is encoded by the nuclear genome. Similar to RrmJ Mrm2p catalyzes the formation of Um2791 which is located in the peptidyl transferase center in mitochondrial 21S rRNA in a position equivalent to that of Um2552 in E. coli. The mrm2 deletion strain shows growth defects in a glycerol-containing medium at 37°C indicating that this protein is important for mitochondrial function and is crucial for heat shock adaptation in yeast [12]. Spb1p is a nuclear protein composed of 841 amino acids and contains two functional domains: a small N-terminal RrmJ-like domain and a large C-terminal domain that is involved in rRNA maturation. Spb1p catalyzes the methylation of U2921 and G2922 in the A-loop of 25S rRNA which are equivalent to U2552 and G2553 in E. coli 23S rRNA respectively [13]“[16]. E. coli RrmJ and its three homologs in yeast all contain the four-residue sequence K-D-K-E which composes the catalytic center of RrmJ [10] [17]. Moreover the structures of the substrates of these three homologs and the positions of the methylated rRNA residues are very similar to those of E. coli RrmJ [6] especially Mrm2p because it is located in the mitochondria which are believed to be degenerated bacteria [18]. In mammals there are also three RrmJ homologs designated as FTSJ1 FTSJ2 and FTSJ3 that correspond to Trm7p Mrm2p and Spb1p respectively. In previous studies the mutation of human FTSJ1 has been shown to cause nonsyndromic X-linked mental retardation (NSXLMR) in Japanese families [19]. A FTSJ2 locus in the genome gene amplification and mRNA over-expression were discovered in several non-small cell lung cancer (NSCLC) tissue samples [20] and FTSJ3 was revealed to function in pre-rRNA processing [21] [22]. However little is known about these three homologs in mammals. Thus in this study we used E. coli RrmJ as a starting point to construct a phylogenetic tree containing several typological species and mammals which showed that FTSJ2 is an ortholog of RrmJ. Based on the highly conserved FTSJ2 protein sequences within mammals we established the basic characteristics of FTSJ2 and its gene expression during the heat shock response in different porcine tissues and human cancer cells. Because previous studies have shown the abnormal expression of FTSJ2 in NSCLC we further investigated the functions of FTSJ2 in cell invasion and migration using human lung adenocarcinoma and rhabdomyosarcoma cell lines. Materials and Methods Phylogenetic Analysis of the E. coli RrmJ Homologs The RrmJ domain of 39 protein sequences and the three out-group proteins fibrillarin (PDB code: 1FBN) [10] [23] vaccinia VP39 (1AV6) [24] and catechol-O- methyltransferase (1VID) [25] which are structurally and functionally similar to E. coli RrmJ were used for the construction of a phylogenetic tree. The distance matrix was calculated using the JTT model. The minimum evolution (ME) method with 1000 bootstrap replicates was performed using the MEGA5 program (www.megasoftware.net/) [26]. The nodes of the tree with a bootstrapping support of >50% are shown. Database Search for RrmJ Homologs and the Multiple Sequence Alignment BLASTp was used to search the complete protein sequences in the non-redundant (nr) database at the National Center for Biotechnology Information (NCBI) website. Fourteen proteins from humans Methanococcus jannaschii and three invertebrate species were obtained using E. coli RrmJ as a query and an E-value of <3e-08 was defined as the cut-off value. Twenty-two vertebrate proteins were found using human FTSJ1 FTSJ2 and FTSJ3 as the queries and a 50% amino acid identity was defined as the cut-off value in this search. "

Lung_Cancer

"DNA whole exome sequencing (DNA-WES) is currently the most popular technology; however this yields low sensitivity in low purity tumors. RNA sequencing (RNA-seq) covers the expressed exome with depth proportional to expression. We hypothesized that integrating DNA-WES and RNA-seq would enable superior mutation detection versus DNA-WES alone. We developed a first-of-its-kind method called UNCeqR that detects somatic mutations by integrating patient-matched RNA-seq and DNA-WES. In simulation the integrated DNA and RNA model outperformed the DNA-WES only model. Validation by patient-matched whole genome sequencing demonstrated superior performance of the integrated model over DNA-WES only models including a published method and published mutation profiles. Genome-wide mutational analysis of breast and lung cancer cohorts (n = 871) revealed remarkable tumor genomics properties. Low purity tumors experienced the largest gains in mutation detection by integrating RNA-seq and DNA-WES. RNA provided greater mutation signal than DNA in expressed mutations. Compared to earlier studies on this cohort UNCeqR increased mutation rates of driver and therapeutically targeted genes (e.g. PIK3CA ERBB2 and FGFR2). In summary integrating RNA-seq with DNA-WES increases mutation detection performance especially for low purity tumors. cover-date 2014 INTRODUCTION Somatically acquired sequence mutations (nucleotide substitutions insertions and deletions) fuel the initiation and progression of cancer (1). Knowledge of mutations in patient specimens informs therapeutic management (23) and in large patient cohorts provides the basis to assess recurrently altered genes that may drive molecular pathogenesis (14“5). DNA whole exome sequencing (DNA-WES) is currently the popular technology to sequence cancer genomes and has led to an abundance of discoveries in many cancer types (46“8). However detecting somatic mutations by DNA-WES with high sensitivity and specificity remains a challenge (79“10) as evidenced by validation rates of 73% in repeated sequencing and by large inter-rater disagreement among different groups analyzing the same sequencing data (710). The biggest challenge is high quality mutation detection in low purity tumors (2911) which are prevalent in widespread cancer types such as breast and lung (12). Advances in somatic mutation detection could improve cancer genome characterization and lead to new diagnostic and therapeutic targets. Somatic mutation detection is dependent on tumor features the sequencing technology and the method of statistical modeling (8“913“17). To detect somatic mutations algorithms compare tumor and patient-matched germline sequencing based on a variety of models (46“7913“17). A tumor's degree of normal contamination and clonal heterogeneity decrease tumor purity. Low purity affects the fraction of mutated DNA observed out of all DNA at a genomic site the mutant allele fraction (MAF) (812). MAF is not often 100% can be slightly above zero in low purity tumors and varies across the genome depending on the prevalence of clones possessing a given mutation and on copy number alterations (7912). DNA-WES targets roughly 200 000 exonic regions and in practice can yield depths of 100X or greater over targeted regions (46). DNA-WES has limitations including variable capture-efficiency and incomplete exome coverage (718). In cases of high MAF mutation detection is straightforward as only a small number of reads are needed to detect the mutation with confidence. The combination of low depth and low MAF make mutation detection very difficult because of low statistical power a result of the scant sample size in which to observe and detect the low prevalence mutation. Increased mutation detection sensitivity and specificity could be achieved by statistical improvements by increasing sequencing quantity or by increasing sequencing quality. In cancer profiling projects such as The Cancer Genome Atlas (TCGA) (46) and in clinical sequencing (219) DNA-WES is utilized for mutation detection while RNA sequencing (RNA-seq) (20) is performed for gene expression fusion transcript and splicing analyses. Beyond those applications RNA-seq provides an observation of the underlying tumor DNA sequence via transcription and can be used to detect sequence variants (21). In fact we have previously used RNA-seq to confirm mutations from DNA-WES (4). A few earlier studies have used RNA-seq alone for genome-wide identification of somatic mutations (22“25) and germline variants (2627). However RNA-seq has challenges including dependency on gene expression which limits the genes that can be measured for sequence mutations and quality control requirements which when not considered result in abundant false positive variants (112128“30). For these reasons RNA-seq has not been the standard for somatic mutation detection. Herein we posed the original hypothesis that integrating patient-matched tumor RNA-seq and tumor DNA-WES would enable superior mutation detection versus DNA-WES alone. We developed a first-of-its-kind method UNCeqR that simultaneously analyzes DNA-WES and patient-matched RNA-seq to detect somatic mutations genome-wide. UNCeqR was applied to large breast and lung cancer cohorts and evaluated with respect to simulation and whole genome sequencing validation. Subsequently genome-wide analysis of UNCeqR mutations led to novel discoveries in tumor genomics. MATERIALS AND METHODS Data sources DNA-WES and RNA-seq alignments in BAM (31) format for 176 lung squamous cell carcinoma cases and for 695 breast cancer cases were acquired from TCGA at ://cghub.ucsc.edu (Supplementary Table S1). RNA-seq were paired 50 nt read from Illumina HiSeq aligned by MapSplice (432). DNA-WES were paired 76“100 nt reads from Illumina Genome Analyzer aligned by BWA (33). All lung and breast cancer cases had germline DNA-WES tumor DNA-WES and tumor RNA-seq and were referred to as the triplet cohorts. A subset of 12 lung and 91 breast tumors also had germline RNA-seq available and were referred to as the quadruplet cohorts. DNA whole genome sequencing (DNA-WGS) was acquired from TCGA for tumors in this cohort (breast: n = 43 lung: n = 17) which consisted of BWA alignments of paired 100 nt reads. Exonic coordinates were extracted from the TCGA Genome Annotation File (http://tcga-data.nci.nih.gov/docs/GAF/GAF.hg19.June2011.bundle/outputs/TCGA.hg19.June2011.gaf) and padded with 10 flanking positions for a total of 222 055 exons. Published mutations (lung: LUSC_Paper_v8.aggregated.tcga.somatic.maf breast: genome.wustl.edu_BRCA.IlluminaGA_DNASeq.Level_2.5.1.0.somatic.maf) expression subtypes DNA copy number calls and tumor purity calls (12) were obtained when available from TCGA. Numerical purity calls of 1 with an incongruent ˜Low purity™ categorical call were censored. Sequencing quality filtering The high quality data filter applies to alignments and genomic positions similar to earlier studies (914). High quality sequenced bases from tumor alignments had base quality ?20 and occurred in a parent alignment with the following properties: mapping quality ? 20 sum of reference mismatches insertions and deletions ?2 a proper pair orientation not a marked duplicate or qc-failure not within the terminal two bases and the singular best alignment. All bases from germline alignments were accepted. High quality genomic positions were those with germline depth ?10 tumor high quality depth ?5 in RNA or DNA no homopolymer > 4 on either side of the site proportion of high quality bases ?0.25 in RNA or DNA and without an insertion or deletion event at 10% allele fraction within 50 positions in germline sequencing. The high quality data filter was applied prior to detecting to tumor variant alleles. The high quality variant filter passes DNA or RNA variant alleles without significant strand bias compared to germline alleles (chi-square P < 0.01) with at least one read on both strands for indel variants with major variant allele prevalence (the proportion of major variant reads out of all variant reads) ?0.75 and a MAD of distance to the end of its aligned read sequence ?1. Somatic mutation detection The UNCeqR algorithm detected somatic mutations within exons based on input of tumor and patient-matched germline sequence alignments. The algorithm applied the following steps to each genomic site within exons: filter for high quality data;identify germline alleles from germline reads that have at least 2% allele prevalence; add population polymorphisms and mapping artifact alleles to germline alleles (see following section ˜Population polymorphisms and mapping artifacts™).Using tumor sequences: let g be the number of reads matching germline allelesdetermine most frequent allele that does not match germline alleleslet k be the number of reads with this major variant allelelet n = k + g.If major variant allele is insertion or deletion re-align nearby indel alleles: scan 20 neighboring sites to find site s with maximum k and same major variant alleleif current site is not s. Move major variant read count from current site to s by incrementing k at s and decrementing g at s by current site's major variant read count.Continue to next site.If high quality variant filter is passed apply statistical test otherwise P = 1 if k = 0 else P = NA.. A set of mutation detection models applied the algorithm with different inputs and statistical models. UNCeqRDNA takes tumor DNA-WES as input and models the corresponding read counts by a beta-binomial distribution. For a variant site with read count \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document} }{}$k_{{\rm DNA}}$\end{document} the P-value to assess whether this variant allele is a somatic mutation was calculated by \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document} }{} \begin{equation*} P_{{\rm DNA}} = 1 - \sum\limits_{i = 0}^{k - 1} {\left( {\begin{array}{*{20}c} {n_{{\rm DNA}} } \\ i \\ \end{array}} \right)} \frac{{B\left( {i + \alpha _{{\rm DNA}} n_{{\rm DNA}} - i + \beta _{{\rm DNA}} } \right)}}{{B(\alpha _{{\rm DNA}} \beta _{{\rm DNA}} )}} \end{equation*} \end{document}where B is the beta function and ?DNA and ?DNA are parameters of the null distribution where the variant allele is not a somatic mutation. Specifically ?DNA and ?DNA are estimated using randomly sampled sites until 50 000 have passed the high quality data filter in both tumor DNA-WES and tumor RNA-seq. In real data analysis these sampled sites may include real somatic mutations and thus the estimates of ? and ? are conservative which may lead to conservative P-value estimates. However based on mutation rates reported in prior studies (8 mutations per 1 000 000 sites (4)) less than one mutation is expected in these sampled sites and thus our estimates of ? and ? would be good approximations of the estimates from a set of non-somatic mutation sites. The UNCeqRRNA model is identical to UNCeqRDNA substituting tumor RNA-seq for tumor DNA-WES. The UNCeqRMETA model combines P-values from UNCeqRDNA and UNCeqRRNA if RNA and DNA have the same major variant allele irrespective of filtering; otherwise the UNCeqRMETA P-value is set to that of UNCeqRDNA. In effect this condition precludes sites with only RNA variant evidence that are suggestive of RNA-editing (3435) from being called somatic mutations. UNCeqRMETA combines P-values by the Stouffer method (36“38) with weights of the root of their sample size (read depth at the site) as follows: \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document} }{} \begin{eqnarray*} &&P_{{\rm META}} = 1 - \\ &&\varPhi\left({\frac{{\varPhi ^{ - 1} \left( {1 - P_{{\rm DNA}} } \right)\sqrt {n_{{\rm DNA}} } + \varPhi ^{ - 1} \left( {1 - P_{{\rm RNA}} } \right)\sqrt {n_{{\rm RNA}} } }}{{\sqrt {n_{{\rm DNA}}^{} + n_{{\rm RNA}}^{} } }}} \right) \end{eqnarray*}\end{document}where \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document} }{}$\varPhi$\end{document} is the standard normal cdf and \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document} }{}$\varPhi ^{ - 1}$\end{document} is the inverse of \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document} }{}$\varPhi$\end{document} i.e. the quantile function of the standard normal distribution. If the RNA major variant equals the DNA major variant and PDNA = NA PMETA is set to PRNA. DNA and RNA variant read counts among putative false positives were unassociated supporting the usage of Stouffer's method (Supplementary Figure S1). Due to possible ambiguity around insertions and deletions (˜indels™) between DNA and RNA alignments high quality variant sites with an insertion or deletion major variant allele in one alignment and with the same variant allele (insertion or deletion) occurring within 20 sites as the major variant allele in the other alignment were merged to have the same genomic position prior to statistical testing. This indel merge allowed indel variants sites between DNA and RNA that represent the same variant to be recorded at the same site and allowed UNCeqRMETA to combine this DNA and RNA evidence despite slightly different representation in the sequence alignments. UNCeqR software consisted of modified samtools (31) Perl R and VGAM (39). The total number of applied statistical tests is reported in UNCeqR output to provide interested users the possibility of multiple testing adjustment. Population polymorphisms and mapping artifacts Population-level polymorphisms were acquired from dbSNP common version 137 via the UCSC genome browser (40). Variant alleles caused by ambiguous mapping artifacts were calculated by BlackOps (41) using 2 × 50 paired-end reads aligned by MapSplice. UNCeqR was applied to 45 TCGA RNA-seq of matched normal tissue specimens (not part of the lung or breast cohorts) to detect non-reference sequence variants representing further germline polymorphic and alignment artifact alleles. "

Lung_Cancer

"The work cannot be changed in any way or used commercially. Introduction: In non“small-cell lung cancer an exon 19 deletion and an L858R point mutation in the epidermal growth factor receptor (EGFR) are predictors of a response to EGFR-tyrosine kinase inhibitors. However it is uncertain whether other uncommon EGFR mutations are associated with sensitivity to EGFR-tyrosine kinase inhibitors. Methods: A post-hoc analysis to assess prognostic factors was performed with the use of patients with EGFR mutations (exon 19 deletion L858R G719X and L861Q) who were treated with gefitinib in the NEJ002 study which compared gefitinib with carboplatin-paclitaxel as the first-line therapy. Results: In the NEJ002 study 225 patients with EGFR mutations received gefitinib at any treatment line. The Cox proportional hazards model indicated that performance status response to chemotherapy response to gefitinib and mutation types were significant prognostic factors. Overall survival (OS) was significantly shorter among patients with uncommon EGFR mutations (G719X or L861Q) compared with OS of those with common EGFR mutations (12 versus 28.4 months; p = 0.002). In the gefitinib group (n = 114) patients with uncommon EGFR mutations had a significantly shorter OS (11.9 versus 29.3 months; p < 0.001). By contrast OS was similar between patients with uncommon mutations and those with common mutations in the carboplatin-paclitaxel group (n = 111; 22.8 versus 28 months; p = 0.358). Conclusions: The post-hoc analyses clearly demonstrated shorter survival for gefitinib-treated patients with uncommon EGFR mutations compared with the survival of those with common mutations and suggest that the first-line chemotherapy may be relatively effective for non“small-cell lung cancer with uncommon EGFR mutations. Gefitinib G719X L861Q NEJ002 Uncommon epidermal growth factor receptor mutations OPEN-ACCESS TRUE The clinical efficacy of epidermal growth factor receptor-tyrosine kinase inhibitors (EGFR-TKIs) such as gefitinib and erlotinib has been demonstrated in non“small-cell lung cancer (NSCLC) patients in whom standard chemotherapy has failed.12 Further studies have revealed that the presence of activating mutations in the EGFR kinase domain is strongly associated with the therapeutic efficacy of EGFR-TKIs.34 Randomized phase 3 trials have demonstrated that EGFR-TKIs significantly improve median progression-free survival (PFS) compared with platinum-doublet therapy in EGFR-mutated patients.5“8 However not all mutations in the EGFR kinase domain are responsive to EGFR-TKI treatment. These phase 3 trials have shown that EGFR-TKIs are effective for patients with common EGFR mutations such as an exon 19 deletion or the L858R point mutation which account for more than 90% of EGFR mutations. Retrospective studies and case reports suggest that some uncommon mutations are associated with sensitivity to EGFR-TKIs.9“20 These mutations include G719X in exon 18 which accounts for approximately 3% of EGFR mutations and L861Q in exon 21 which represents approximately 2% of EGFR mutations. However these uncommon EGFR mutations have not been clearly shown to be predictive markers for the efficacy of EGFR-TKIs because of their low frequency. To investigate the efficacy of gefitinib in patients with uncommon mutations we conducted a post-hoc analysis of the NEJ002 which compared gefitinib and carboplatin-paclitaxel as first-line therapies for advanced NSCLC with activating EGFR mutations. PATIENTS AND METHODS Patient Population We retrospectively analyzed the data of 225 patients who received gefitinib treatment at any point in the NEJ002 study.6 The eligibility criteria of the NEJ002 study included the presence of advanced NSCLC harboring an EGFR mutation (exon 19 deletion or L858R G719X or L861Q point mutation) without the resistant EGFR mutation T790M (identified using the peptide nucleic acid“locked nucleic acid polymerase chain reaction clamp method) no history of chemotherapy an age of 75 years or younger a performance status of 0 to 1 and appropriate an function.2122 Patients provided a written informed consent. The study was conducted in accordance with the Helsinki Declaration of the World Medical Association. The protocol was approved by the institutional review board of each participating institution. Treatment Eligible patients were randomly assigned to receive either gefitinib (250 mg/day) or paclitaxel (200 mg/m2)/carboplatin (area under the curve 6.0) on day 1 every 3 weeks. Chemotherapy was continued for at least three cycles. Gefitinib was administered until the disease progressed intolerable toxicities developed or consent was withdrawn. The protocol recommended that the crossover regimen be used as a second-line treatment. Clinical Assessments The antitumor response to treatment was assessed using computed tomography every 2 months. Unidirectional measurements were adopted on the basis of the Response Evaluation Criteria in Solid Tumors (version 1.0).23 PFS was evaluated from the date of randomization to the date when disease progression was first observed or death occurred. The treatment response and PFS were determined by an external review of computed tomography scans by experts who were not aware of the treatment assignments. Overall survival (OS) was evaluated from the date of randomization to the date of death. Statistical Analysis To assess prognostic factors for OS we used univariate and multivariate Cox proportional hazards models. Kaplan“Meier survival curves were constructed for PFS and OS and differences between groups were identified using the log-rank test. Differences in response rates were identified using Fisher™s exact test. Each analysis was two sided with a 5% significance level and a 95% confidence interval. All analyses were performed using SAS for Windows software (release 9.1; SAS Institute Cary NC). RESULTS Patient Population A total of 230 chemonaive patients were enrolled in the NEJ002 study: 115 patients were assigned to receive gefitinib and 115 were assigned to receive carboplatin-paclitaxel (Fig. 1). To evaluate the efficacy of gefitinib in NSCLC patients with uncommon EGFR mutations we analyzed the data of 114 patients in the gefitinib group and 111 patients in the carboplatin-paclitaxel group. We identified five patients who had uncommon EGFR mutations in each group. Two patients who had common mutations and were treated with first-line chemotherapy consisting of carboplatin-paclitaxel were excluded from the PFS analysis in the NEJ002 study. However both were treated with gefitinib and were included in this post-hoc analysis. The demographic and disease characteristics of the patients with uncommon EGFR mutations were similar to those of patients with common EGFR mutations (). The characteristics of each patient with uncommon EGFR mutations are shown in supplementary Table S1 (Supplemental Digital Content 1 http://links.lww.com/JTO/A494). FIGURE 1. Enrollment randomization and follow-up of the study patients. TABLE 1. Patient Characteristics Survival Factors In the univariate analysis of 225 patients who received gefitinib at any point uncommon EGFR mutations had a significant detrimental effect on survival (). We also identified performance statuses 1 and 2 distant metastasis brain metastasis stable disease and progressive disease as significant predictors of worse prognosis for standard chemotherapy and stable disease and progressive disease as significant predictors of worse prognosis for gefitinib. When these variables were included in the Cox proportional hazards model we found that uncommon EGFR mutations performance statuses 1 and 2 stable disease and progressive disease for standard chemotherapy and stable disease and progressive disease for gefitinib had significant hazard ratios (). TABLE 2. Univariate and Multivariate Analysis by Cox Proportional Hazards Model Uncommon EGFR Mutations and Survival The Kaplan“Meier curve for OS for uncommon versus common EGFR mutations is shown in A. The OS was significantly shorter among patients with uncommon EGFR mutations compared with OS of those with common EGFR mutations in the overall population (12 versus 28.4 months; p = 0.002). A significantly shorter survival time was observed in patients with uncommon EGFR mutations compared with survival time in those with common EGFR mutations in the gefitinib group (11.9 versus 29.3 months; p < 0.001) (Fig. 2B). However a similar survival time was observed between the subgroups of uncommon and common EGFR mutations in the carboplatin-paclitaxel group (22.8 versus 28 months; p= 0.358) (Fig. 2C). FIGURE 2. The overall survival curves of patients with common mutations and uncommon mutations in the entire population (A) the gefitinib group (B) and the carboplatin-paclitaxel group (C). To examine whether the sequence of platinum doublet and gefitinib affected OS we performed a further subgroup analysis. The survival time tended to be shorter among patients receiving first-line gefitinib compared with the survival time among those receiving first-line carboplatin-paclitaxel in the uncommon EGFR mutation group (11.9 versus 22.8 months; p = 0.102). Consistent with previous publications a similar survival time was observed between patients receiving first-line gefitinib and those receiving first-line carboplatin-paclitaxel in the common EGFR mutation group (29.3 versus 28 months; p = 0.378). Uncommon EGFR Mutations PFS and Response In the gefitinib group the median PFS was significantly shorter for patients with uncommon EGFR mutations compared with median PFS of those with common EGFR mutations (2.2 versus 11.4 months; p < 0.001) (Fig. 3A). By contrast the median PFS did not differ significantly between patients with uncommon EGFR mutations and those with common EGFR mutations in the carboplatin-paclitaxel group (5.9 versus 5.4 "

Lung_Cancer

"Methylnaltrexone was developed at the University of Chicago and licensed to Progenics Pharmaceuticals subsequently sub-licensed to Salix Pharmaceuticals. Dr. Moss was a paid consultant for Progenics Pharmaceuticals and currently is a paid consultant for Salix Pharmaceuticals. He receives royalties through the University of Chicago. There are no patent(s) or patent applications relating to material pertinent to this . This does not alter the authors' adherence to all PLOS ONE policies on sharing data and materials. Conceived and designed the experiments: FEL JM RS PAS. Performed the experiments: TM BM VAP FEL. Analyzed the data: JM PAS. Contributed reagents/materials/analysis tools: PAS JM. Wrote the paper: PAS. 2014 24 3 2014 9 3 e91577 16 9 2013 13 2 2014 2014 Lennon et al This is an open-access distributed under the terms of the Creative Commons Attribution License which permits unrestricted use distribution and reproduction in any medium provided the original author and source are credited. Recent epidemiologic studies implying differences in cancer recurrence based on anesthetic regimens raise the possibility that the mu opioid receptor (MOR) can influence cancer progression. Based on our previous observations that overexpression of MOR in human non-small cell lung cancer (NSCLC) cells increased tumor growth and metastasis this study examined whether MOR regulates growth factor receptor signaling and epithelial mesenchymal transition (EMT) in human NSCLC cells. We utilized specific siRNA shRNA chemical inhibitors and overexpression vectors in human H358 NSCLC cells that were either untreated or treated with various concentrations of DAMGO morphine fentanyl EGF or IGF. Cell function assays immunoblot and immunoprecipitation assays were then performed. Our results indicate MOR regulates opioid and growth factor-induced EGF receptor signaling (Src Gab-1 PI3K Akt and STAT3 activation) which is crucial for consequent human NSCLC cell proliferation and migration. In addition human NSCLC cells treated with opioids growth factors or MOR overexpression exhibited an increase in snail slug and vimentin and decrease ZO-1 and claudin-1 protein levels results consistent with an EMT phenotype. Further these effects were reversed with silencing (shRNA) or chemical inhibition of MOR Src Gab-1 PI3K Akt and STAT3 (p<0.05). Our data suggest a possible direct effect of MOR on opioid and growth factor-signaling and consequent proliferation migration and EMT transition during lung cancer progression. Such an effect provides a plausible explanation for the epidemiologic findings. Support was provided from institutional and/or departmental sources and National Institutes of Health grant CTSA UL1 TR000430. The funders had no role in the study design data collection and analysis decision to publish or preparation of the manuscript. Introduction The role of anesthesia and analgesia in the recurrence and metastatic rate of malignancies has recently received considerable attention [1] [2] [3] [4]. Retrospective studies have demonstrated a diminished incidence of cancer recurrence following regional anesthesia with lower doses of opioids following surgery for breast prostate colon cancer and melanoma although other studies have failed to detect significant differences [5] [6] [7] [8]. Some hypotheses to explain these differences in recurrence rates include immune suppressive effects and direct effects on tumor cell growth [9] [10] [11]. Our research has focused on the mu opioid receptor (MOR) and its role in directly regulating cellular changes leading to tumor growth and metastasis [4] [12] [13]. Effective therapeutic strategies for lung cancer the leading cause of cancer-associated mortality worldwide are extremely limited exemplifying the need for early diagnosis and novel therapeutic interventions [14] [15]. We have previously reported that the MOR is upregulated in several types of human non-small cell lung cancer (NSCLC) [12]. Further we have shown that overexpression of MOR in human NSCLC increases primary tumor growth and metastasis in xenograft models [13]. However the exact cellular changes regulated by MOR in NSCLC are incompletely defined [4]. For cancer cells to grow and metastasize there needs to be a loss of cell-cell adhesion (characterized by a reduction of epithelial cell adhesion proteins including the tight junction proteins ZO-1 and claudin-1) followed by acquisition of mesenchymal characteristics including a loss of baso-apical polarization cytoskeletal remodeling and increased cell motility (characterized by increases in specific cytoskeletal proteins (i.e. vimentin) and transcription factors (i.e. Slug and Snail) [16] [17] [18] [19]. This orchestrated oncogenic process is referred to as epithelial mesenchymal transition (EMT) [16] [17] [18] [19] [20] [21] [22]. Growth factor receptors including the epidermal growth factor receptor (EGFR) are often overexpressed and/or mutated in NSCLC and regulate oncogenic processes including tumor cell proliferation migration and EMT transition [23] [24] [25] [26] [27]. Several therapies targeting the EGFR in NSCLC exist including tyrosine kinase inhibitors (gefitinib erlotinib) and monoclonal antibodies (cetuximab)[28] [29] [30] [31]. However the overall survival rate for NSCLC remains low [32] [33] [34]. Recently Fujioka et al. have demonstrated that morphine can stimulate EGFR signaling pathways including the serine/threonine kinases Akt and MAP kinase in NSCLC suggesting a role for MOR inhibition as a potential therapeutic strategy for NSCLC [35]. Based on the recent interest of the effects of anesthesia and analgesia regimens on the recurrence and metastatic potential of various cancers [1] [2] [3] [4] our previous published data indicating the MOR is upregulated in lung tissue from patients with NSCLC [12] overexpression of MOR promotes tumor growth and metastasis in human NSCLC xenograft models [13] as well as data from Fujioka et al. demonstrating MOR regulation of EGF-induced signaling events in NSCLC [35] this study investigated the functional effects of MOR in the fundamental oncogenic processes of opioid and growth factor-induced human lung cell migration proliferation and epithelial mesenchymal transition (EMT)[16] [17] [18] [19] [20]. Since there is currently very little information on opioid and/or MOR regulation of EMT and the molecular mechanisms integrating cancer cell proliferation migration and EMT this study investigated the detailed molecular mechanisms for these events which can have potential clinical utility. Methods Cell Culture and Reagents The human NSCLC cell H358 was obtained from ATCC (Walkersville MD) and cultured in Roswell Park Memorial Institute complete medium (Cambrex East Rutherford NJ) at 37°C in a humidified atmosphere of 5% CO2 95% air with passages 6“10 used for experimentation. Unless otherwise specified reagents were obtained from Sigma (St. Louis MO). Reagents for SDS-PAGE electrophoresis were purchased from Bio-Rad (Richmond CA) and Immobilon-P transfer membrane was purchased from Millipore "

Lung_Cancer

"Research has shown a strong association between a high lung cancer susceptibility score derived from family history of cancer the 20 SNPs COPD history (Auckland formula) and the development of lung cancers whereas healthy smokers matched for age gender and lifetime smoking habits had a relatively low score (n?=?446 lung cancer subjects 484 healthy current smokers). The odds ratio for lung cancer risk varied from 0.2-3.2 depending on the genetic risk (p?<?0.001) [910]. The accuracy of the Auckland formula in estimating lung cancer risk for a score of >4 was: sensitivity 90% specificity 45% ( which also includes scores for 52 subjects who developed cancer from a six year prospective study of 1212 smokers and ex-smokers). The score for prediction of non-cancer was conducted with a follow up of just six years. It means that 45% of non-cancer subjects have a low cancer score and 55% have some degree of increased score. The 55% with increased scores have simply not been followed up long enough for lung cancers to develop yet. Notwithstanding this limitation there is now a 20 SNP gene test for prediction of lung cancer in smokers under the trade name Respiragene. Research that established the respiragene test. Distribution of the Respiragene score in a cross-sectional study of 484 control smokers (blue) and 446 with lung cancer (red) (Total?=?930) and from the prospective study of 52 lung cancer cases (green). Reference [8]. Two case-control studies showed a 5-10% increase in cessation with a single gene test of small effect [1112]. A small smoking cessation pilot study using spirometry results and explanations using the Fletcher-Peto diagram to explain risk demonstrated that patients find this is an acceptable method and the quit rate at 12 months was 27% [13]. In a randomised control trial patients were given either a full explanation of the results of spirometry testing including an estimation of lung age or just their forced expiratory volume in the first second (FEV1) without explanation (control group). The group of patients who were given the full explanation had a 7.2% higher quit rate than the control group [14]. Data from a hospital outpatient cohort in Auckland suggest a larger increase in quit rate with Respiragene test and the Auckland formula (). Subjects who were current smokers in the pre-contemplative and contemplative stage were randomised into either the test group or control group and only the test group had the Respiragene test. Counselling and follow-up was done by telephone. Using Auckland formula to incorporate the results of the Respiragene test clinical data and family history a score ranging 1-12 with associated risk level (moderate risk high risk very high risk) was calculated and explained to test subjects. Neither group were involved in any formal smoking cessation programme. Indeed of the 13 subjects that had managed to stop smoking (28% of the gene-tested group) 48% quit without any medical assistance and only 52% had nicotine replacement therapy [1516]. When compared with previous studies using telephone counselling alone [17] () there is a 20-25% improvement in smoking cessation with the Respiragene test (). The improvement in intention to quit increases from 56% before testing to 67% in smokers with an average smokers risk of lung cancer or 89% in smokers with a high risk of lung cancer [18]. Respiragene study in Auckland NZ (n?=?43) Cancer susceptibility scale (compared with normal lifetime risk) Cancer susceptibility score Estimated lifetime risk of lung cancer Initial intention to quit Proportion that stopped smoking at 2-4 weeks Proportion still not smoking at 6 months Expected result for telephone counselling () - - 15% 41% 10-20% 9-12% Telephone counselling?+?Respiragene test 1-2.3 (10-35% risk) 2.3-6.7 (35-65% risk) 6.7-8 (65%-80% risk) 27 had average risk score 15% 67% 8/27 (30%) 8 (30%) 16 had high or very high risk score 30-50% (4-10 times average risk) 89% 10/16 (63%) 6 (37.5%) Smoking cessation after Respiragene testing and estimation of lung cancer risk with telephone counselling in a small pilot study in Auckland NZ (n?=?43) compared with expected quit rate. Efficacy of the variety of smoking cessation strategies. Percent increase of success for six months over unaided attempts for each type of quitting (chart from West & Shiffman based on Cochrane review data). Totally unaided smoking cessation has a 3-6% success rate. Therefore telephone support () increases success rate by 6% = 9-12% quit rate. A large hospital trial using Respiragene for calculating lung cancer susceptibility is currently underway in the USA [19] but there are no planned UK investigations. This study fills that gap and uses the NHS framework for smoking cessation. Other studies have taken place looking at how lung functioning testing in COPD might motivate smokers to quit suggesting that it is feasible to conduct this sort of study [131420]. This protocol describes a trial to evaluate a gene-based risk test (using genetic and clinical data) as a smoking cessation motivator in smokers wishing to participate in an NHS primary care smoking cessation clinic (in the action stage of change) alongside the usual counselling and prescribing protocol. It will differ from previous studies using gene testing as a motivator however in that the NHS primary care counselling and prescribing protocol will include several other motivators (CO breath testing saliva cotinine testing and intensive counselling) whereas the Auckland trial using the same gene test had none of these. Also the method of recruitment will differ in that primary care subjects will of necessity be different from the Auckland hospital outpatient cohort [1516]. Research question Can the Respiragene test combined with an estimation of lung cancer susceptibility be used to increase the uptake adherence to and success rate in an established smoking cessation programme in subjects who want to quit in a National Health Service United Kingdom (NHS UK) setting? Hypothesis Genetic testing and estimation of lung cancer susceptibility should increase œsmoking cessation outcomes at six months to >30% (or 1.5-2 fold greater than usual care) irrespective of the risk scores assigned to subjects [11]. Method/Design This protocol has been approved by Surrey Research Ethics Committee at the Royal Surrey County Hospital Guildford Surrey UK. 1/Recruitment Focus groups A number of focus groups of different aged smokers will be held to enable them to contribute to the design of the study 2/ Recruitment Subjects will be recruited from a large general practice in Surrey (practice population=?>?30000). Smokers aged 20-70 years will be identified from the practice records and contacted by post by their GP. Patients who reply stating that they wish to stop smoking will be randomised (stratified randomisation to ensure equivalent age and gender mix) to two clinics () only one of which will include the gene-based test. Previous trials of genetic testing in association with smoking cessation achieved 83-100% of participants opting for the test depending on the method of recruitment [821]. There will be two mailings with SAEs for recruitment with the aim of recruiting at least 30 subjects per clinic (see Power calculations under heading œstatistics). In the first letter the patient™s GP asks the patient to give permission for the researcher to contact him/her to ask about taking part in smoking cessation research (with possible genetic risk testing) and encloses fact sheet 1 and a stamped addressed envelope (SAE) for reply. Consort 2010 flow diagram for GeTTS recruitment. Mailing 2. The principal investigator mails patient with Letter 2 to ask him/her if they would like to attend an 8-week smoking cessation clinic and asks if they would be willing to have a test for genetic susceptibility to development of lung cancer and encloses SAE for reply. Mailing 3. The principal investigator mails Group B subjects and Group A test-concordant subjects to confirm dates of the smoking cessation sessions and full patient information leaflet and consent form enclosed. The information sheet will be slightly different for group A and B. Non-test concordant subjects within group A will be invited to attend the practice nurse for smoking cessation. 3/Inclusion and exclusion criteria i. Inclusion criteria: Aged 20-70 years smoking more than 10 cigarettes daily. ii. Exclusion criteria: Aged under 20 years or over 70 years smoking less than 10 cigarettes daily history of major depression and other psychiatric conditions dementias and serious or terminal illness (cancers etc.). Patients on warfarin would be excluded due to interactions between warfarin and varenicline as varenicline will be used as the modern treatment of choice for smoking cessation. Patients who smoke less than 10 cigarettes/day and patients who did not wish to have a genetic test or do not wish to take part in a research study will be referred to the practice nurse for smoking cessation. 4/Smoking cessation clinics For group A subjects only subjects who have expressed an interest in having a genetic test and gene-based estimation of susceptibility to lung cancer in mailing 2 will be invited to participate (see referral for decliners above). For group B subjects all subjects willing to participate are invited to do so. Uptake into smoking cessation programme (i.e. proportion of invitees who accept invitation and attend clinic of those mailed invitation) will be recorded. All subjects who attend the first session of the research clinic will be asked by the principal investigator JN to sign a consent form and will be invited to raise any concerns about the protocol (as explained in the full information sheet). The consent form will then be countersigned by JN. Group A clinics and Group B clinics will be held on different weekdays at the same health centre premises. Test Subjects who attend Clinic A will be offered a fact sheet on the health risks of smoking (including lung cancer) and the option of the gene-based test for calculation of lung cancer susceptibility whilst subjects who attend Clinic B will be given the same fact sheet on the health risks of smoking (including lung cancer) but without any reference to the gene-based test. The principal investigator will be responsible for handing out the fact sheets and administering the gene-based test in Clinic A and for handing out and explaining the fact sheet in Clinic B. NHS Surrey™s Smoking Cessation Practitioners will lead in-house smoking cessation clinics A and B using the NHS smoking cessation guidelines [22] under the supervision of the principal investigator at the medical centre. There will be: ¢Introductory session which includes a new near patient test for salivary cotinine (nicotine metabolite) “ trade name SmokeScreen [23]. ¢At session 2 patients will be given advice on therapies for smoking cessation. We expect that most patients will opt for a course of varenicline and they will be advised to contact their GP for a prescription. ¢This is followed by seven more weekly sessions and a follow-up session at six months (Figure 4). Uptake and adherence to smoking cessation will be monitored by weekly carbon monoxide exhalation measurements (breath test). The principal investigator will be involved in clinic A administering the gene-based test and determining if subjects have COPD from practice records and history in session 1. Participants who are heavy smokers have a smokers cough and use a salbutamol inhaler can be judged to have COPD even if this is not entered in their GP records (all Group A & B subjects will have spirometry at their 6-month follow-up). Subsequently the principal investigator will report back to clinic A patients with estimated lung cancer risks (session 3). To ensure balance in the control clinic the principal investigator will also attend Clinic B sessions 2 and 3 (see Figure 5 flow charts). ¢At the eight week clinic and the 6-month follow-up clinic smoking cessation status and carbon monoxide breath test score will be recorded and a feedback questionnaire used to assess efficacy of various components will be administered. Mailing 4. Telephone calls followed by letters to patients with invitation to 6-month follow-up session with NHS Smoking Cessation Practitioners and the principal investigator when cessation rate will be assessed and verified by repeating the carbon monoxide breath and salivary cotinine tests. “ for further details see Figure 5: flow charts Figure 4 Timeline of project. Figure 5 Flow chart for the duration of the trial. a. Flow chart of project from start to week 12. b. Flow chart of project to week 36. We anticipate good attendance at the eight week free smoking cessation clinic as would be expected if it were a regular NHS smoking cessation clinic but the attendance at the 6-month follow-up clinic may be more challenging. We consider this attendance essential and as attendance will take up an evening of their time study participants should be paid for their travel expenses (£20) and will receive up to three reminders. Group B subjects attending at the 6-month follow up who have been unable to quit will be offered the gene-based test at this stage. Technique for taking the respiragene test The test requires a Buccal swab and the subjects should not eat or drink within 15 minutes prior to supplying a sample (if has eaten or taken a drink within 15 minutes then rinse mouth with tap water). The nurse taking the sample should wear latex or plastic gloves and take care to avoid contact with the buccal swab collection tip to avoid DNA (deoxyribonucleic acid) contamination. Then: 1. Open buccal swab package at the handle end and carefully remove the swab. 2. Holding handle end of swab stick scrape the collection tip firmly against the inside of the cheek 5-6 times (about 10 seconds) being careful not to press the plunger that ejects the tip. 3. After taking the sample eject the swab tip into a labelled 2 ml microcentrifuge tube by firmly pressing the plunger at the end of the handle. 4. Complete and affix the sample tube label onto the microtube. The sample label requires the anonymised trial code for the subject. Storage of the respiragene test After sample collection tips can be kept at room temperature if they are posted immediately. If storage is necessary freeze the tubes containing the tips at -20°C. Packaging instructions for return of samples to Lab21 Ltd 1. Place absorbent material around the tube and then place tube in the plastic bag provided with the kit. Seal the plastic back as per the instructions on the bag 2. Place the plastic bag containing the sample tube into the shipping box. 3. Seal the box with the security seal supplied. 4. Using the Freepost service provided send the samples to: Lab 21 184 Cambridge Science Park Cambridge CB4 0GA. Patients will be asked to sign a disclaimer form that explains clearly that this test can only give an estimation of cancer risk and is a test that is still under development (one copy of form for investigators and one for patient). Interpretation of result of respiragene test Lung cancer susceptibility is calculated using the Respiragene test Auckland formula [7]: Lung cancer score?=?(number of susceptible genotypes) - (number of protective genotypes)?+?3 (for positive family history)?+?4 (for past history of COPD)?+?4 (for age?>?60 years old). The laboratory reports include the scores with an explanation of how the scores relate to a risk category (see ). When the subject is aged <60 years the report will also include the score and risk category that would apply if the subject is still a smoker at age 60 years or over. Follow-up questionnaires The questionnaires will be slightly different for groups A (questionnaire 2a) and B (questionnaire 2b) as only 2a will contain a direct reference to the gene-based test. Patients who fail to attend at eight weeks and six months will be contacted by telephone to remind them to complete their questionnaires and hand them in to the practice manager. They are designed to determine which subjects have quit smoking or cut down and which subjects who have failed to quit still plan to do so. There is a section that asks about general motivators and components of the smoking cessation programme. The subjects will be asked to score these motivators and smoking cessation aids for their efficacy in helping them to quit. The questions in this section are almost identical to a validated questionnaire [24]. There are also further questions on whether the subject would recommend the Respiragene test to a relative or friend and an open ended question for subjects to add their own comments about the concept of a test that predicts susceptibility to lung cancer in a smoker. Data quality assurance The study has been designed and will be reported in accordance with CONSORT (Consolidated Statement of Reporting Trials) [25]. Data will be controlled in accordance with data protection legislation institutional protocols of Sussex NHS Research Consortium and NHS policies for research and information governance for ensuring patient confidentiality [26]. Data will be analysed in SPSS (Statistical Package for Social Sciences) version 15 using an intention to treat approach. Outcome measures Primary endpoint Comparison of smoking cessation rates (7 day point abstinence and continuous abstinence) in Clinic A and Clinic B at 8 weeks and six months. Secondary endpoints A. Personal data: 1. Number of smokers still smoking who state that they still plan to stop. 2. Daily cigarette consumption of those still smoking. 3. Mean scores for ranking of smoking cessation aids (gene-based test - Clinic A only salivary cotinine lung cancer facts - controls in Clinic B only and general counselling from NHS smoking counsellors). B. Analyse questions about whether subjects would recommend the test to a member of family or a friend. C. Analyse last (open ended) question using qualitative research methodology. Statistics Primary end point The difference between smoking cessation between Clinic A and Clinic B will be estimated from the four week and six month follow up for the primary endpoint (smoking status confirmed by carbon monoxide breathalyser and salivary cotinine tests). If there is the expected higher rate of smoking cessation for Clinic A compared with Clinic B statistical significance will be demonstrated by the ?2 test. Since there are as yet no case-control studies that compare quit rate following the gene-based test versus quit rate without the test the expected difference in quit rate between Clinic A and Clinic B is difficult to estimate. Two case-control studies showing only a 5-10% increase in smoking cessation involved just a single gene of small effect [1112]. In a randomised control trial patients were given either a full explanation of the results of spirometry testing including an estimation of lung age or just the FEV1 without explanation (control group). The group of patients who were given the full explanation had a 7.2% higher quit rate than the control group. However data from Auckland suggest a larger uplift of quit rate with Respiragene. This can be explained by the superior predictive power of a 20-gene test combined with clinical history (personal history of COPD and family history of lung cancer) to give a rather more impressive estimate of cancer risk than anything previously available. The adequacy of sample size was tested using data from smoking cessation trials that showed: ¢30-40% smoking cessation at 6-months with similar protocols [2728]. ¢A 48% quit rate at 2-4 weeks in subjects with high and very high lung cancer risk scores but this difference shrinks to 27% at 6 months. ¢Data from Young et al [1518] (independently verified by McBride et al [11]) that even being given an average score for lung cancer susceptibility increases smoking cessation by approximately 10%. Therefore with a minimum sample sizes of 30 per group the following calculations based on these estimated quit rates apply (Table 2). Statistical power of 87.1% is generally acceptable for publication (for alpha error of 5% - i.e. 5% probability of incorrectly rejecting the null hypothesis that there is no difference in the percentage values). For further detailed statistical analysis refer to Additional file 1. Table 2 Summary of values from which the power of the study are estimated Control group expected quit rate as %ge Respiragene group expected quit rate as %ge ? 2 calculated from four-some table P value based on ? 2 Power calculations* 8 weeks Sample size 30/30* 70% 94% 5.9 <0.05 79.3% Sample size 60/60* 11.7 <0.01 96.9% 6 months Sample size 30/30** 35% 52% 1.7 NS 36.5% Sample size 60/60** 6.2 <0.05 87.1% *Telephone (alone) quit rate (see ) assumed to be 20%. **Telephone (alone) quit rate (see ) assumed to be 10-15%. Secondary outcome measures Similarly the significance of secondary endpoints on intention to stop smoking cigarette consumption uptake of invitation to cessation adherence to cessation course and self-reported smoking cessation will be calculated by the ?2 test but the p value for the ranking scores for information on lung cancer risk and other smoking cessation aids and motivators will be estimated from the unpaired student t-test. The open ended question: œHow do you feel now about having had a genetic test that estimates the probability that you will develop lung cancer at some future date? will have to be analysed by qualitative analysis to determine the main recurrent themes in responses. Discussion Overview Smoking cessation is one of the most cost effective interventions that can be achieved in primary care [29]. However many smokers are very reluctant to commit to a smoking cessation programme (precontemplative and contemplative) and about half of those that attend for smoking cessation intervention (action stage of change) are likely to drop out or give up trying. Therefore any methodology that increases motivation in both unmotivated and motivated smokers could be very valuable. The gene-based test we are offering has shown promise as a smoking cessation motivator in precontemplative-contemplative smokers in a hospital outpatient setting [1518] and now needs to be tested out as a motivator for improving adherence in a primary care smoking cessation clinic using a randomised controlled study. Strengths The main strengths of this study are that it is being carried out on subjects from a large primary care population and should therefore be more representative of the general population than previous studies recruited from hospital patients and other special groups. We also have the advantage of being able to carry out this research within the established framework of the local stop smoking service. Limitations and assumptions Although we have estimated based on previous smoking cessation work using this gene-based test that the primary endpoint will show that having the test improves quit rate by 20-25% this was based on a cohort of hospital outpatients in Auckland New Zealand and subjects recruited from primary care may respond differently. Although we plan to recruit a minimum of 60 subjects this may not be enough to balance unexpected and unknown confounding factors. What we might find We aim to recruit a minimum of 60 subjects to randomise 30 into group A (test group) and 30 into Group B (control group). The normal experience in NHS smoking cessation clinics is a drop-out rate of 40-50% [30-32]. We need therefore to attempt to recruit about 120 subjects in order to get a statistically significant result based on the assumptions in our power calculations. We may however have underestimated the 6-month quit rate using the NHS local stop smoking guidelines [22] which typically involves a multi-interventional programme which includes combinations of varenicline prescriptions breath carbon monoxide monitoring and intensive counselling giving a quit rate of 70-80% at 6-weeks.There are however no Surrey data for 6-month quit rate which we assume on the basis of similar smoking cessation data to be about half the 6-week figure [33] ? 35%. An unknown and unpredictable factor that could skew results significantly is the possibility that our multi-interventional approach could help to reinforce the health risk message equally for subjects in both groups. Also the Auckland study design involved recruitment of precontemplative-contemplative smokers from a hospital outpatient setting compared to this study that will involve primary care subjects who have volunteered to participate in a smoking cessation programme (ie smokers in the action stage of quitting)."

Lung_Cancer

"A decrease of 50% or more from baseline urinary prostaglandin E2 metabolite after a 5-day open-label run-in period was used to select eligible patients. One hundred twenty patients (median age 64 years) were randomized (78 to AP/E and 42 to P/E). Overall median TTP was 1.8 months in the AP/E group and 2.1 months in the P/E group with a 12% objective response rate in both groups (intent-to-treat analysis). A subgroup analysis in patients aged 65 years or younger demonstrated a statistically significant TTP benefit for AP/E (hazard ratio 0.5 [95% confidence interval: not applicable“0.9]; p=0.018) and overall survival advantage at minimum 1-year follow-up (median 12.2 versus 4.0 months; hazard ratio=0.5; p=0.021). The most common adverse events were rash diarrhea fatigue and nausea. Toxicity contributed to early discontinuations in patients aged more than 65 years treated with AP/E. This is the first randomized placebo-controlled study of a COX-2 inhibitor in NSCLC to use a prospective patient-selection strategy. Although AP/E seemed to improve TTP and overall survival in a subset of patients aged 65 years or younger the primary endpoint of the trial was not met. Non“small-cell lung cancer Apricoxib Erlotinib Cyclooxygenase-2 inhibitor Prostaglandin E2 metabolite 0413066 2830 Cell Cell Cell 0092-8674 1097-4172 24630729 4040459 10.1016/j.cell.2014.02.031 NIHMS573682 Genetic and Clonal Dissection of Murine Small Cell Lung Carcinoma Progression by Genome Sequencing McFadden David G. 1 5 Papagiannakopoulos Thales 1 5 Taylor-Weiner Amaro 3 5 Stewart Chip 3 5 Carter Scott L. 3 5 Cibulskis Kristian 3 Bhutkar Arjun 1 McKenna Aaron 3 Dooley Alison 1 Vernon Amanda 1 Sougnez Carrie 3 Malstrom Scott 1 Heimann Megan 1 Park Jennifer 1 Chen Frances 1 Farago Anna F. 1 Dayton Talya 1 Shefler Erica 3 Gabriel Stacey 3 Getz Gad 3 4 * Jacks Tyler 1 2 * 1Koch Institute for Integrative Cancer Research and Department of Biology Massachusetts Institute of Technology Cambridge MA 02142 USA 2Howard Hughes Medical Institute Massachusetts Institute of Technology Cambridge MA 02142 USA 3Cancer Program Broad Institute of MIT and Harvard Cambridge MA 02142 USA 4Cancer Center and Department of Pathology Massachusetts General Hospital Boston MA 02114 USA *Correspondence: gadgetzbroadinstitute. (G.G.) tjacksmit.edu (T.J.) 5 Co-first author 6 5 2014 13 3 2014 13 3 2015 156 6 1298 1311 2014 Elsevier Inc. 2014 Summary Small cell lung carcinoma (SCLC) is a highly lethal smoking-associated cancer with few known targetable genetic alterations. Using genome sequencing we characterized the somatic evolution of a genetically engineered mouse model (GEMM) of SCLC initiated by loss of Trp53 and Rb1. We identified alterations in DNA copy number and complex genomic rearrangements and demonstrated a low somatic point mutation frequency in the absence of tobacco mutagens. Alterations targeting the tumor suppressor Pten occurred in the majority of murine SCLC studied and engineered Pten deletion accelerated murine SCLC and abrogated loss of Chr19 in Trp53; Rb1; Pten compound mutant tumors. Finally we found evidence for polyclonal and sequential metastatic spread of murine SCLC by comparative sequencing of families of related primary tumors and metastases. We propose a temporal model of SCLC tumorigenesis with implications for human SCLC therapeutics and the nature of cancer-genome evolution in GEMMs. J Natl Cancer Inst J. Natl. Cancer Inst jnci jnci.j JNCI Journal of the National Cancer Institute 0027-8874 1460-2105 Oxford University Press US 24317180 3906987 10.1093/jnci/djt338 Brief Communication Novel Germline Mutation in the Transmembrane Domain of HER2 in Familial Lung Adenocarcinomas Yamamoto Hiromasa Higasa Koichiro Sakaguchi Masakiyo Shien Kazuhiko Soh Junichi Ichimura Koichi Furukawa Masashi Hashida Shinsuke Tsukuda Kazunori Takigawa Nagio Matsuo Keitaro Kiura Katsuyuki Miyoshi Shinichiro Matsuda Fumihiko Toyooka Shinichi Affiliations of authors:Department of Thoracic Breast and Endocrinological Surgery (HY KS JS MF SH KT SM ST) Department of Clinical Genomic Medicine (KS ST) Department of Cell Biology (MS) Department of Pathology (KI) and Department of Hematology Oncology and Respiratory Medicine (KK) Okayama University Graduate School of Medicine Dentistry and Pharmaceutical Sciences Okayama Japan; Center for Genomic Medicine Kyoto University School of Medicine Kyoto Japan (KH FM); Department of General Internal Medicine 4 Kawasaki Medical School Okayama Japan (NT); Department of Preventive Medicine Kyushu University Faculty of Medical Sciences Fukuoka Japan (KM). Correspondence to: Shinichi Toyooka MD PhD Okayama University Graduate School of Medicine Dentistry and Pharmaceutical Sciences Clinical Genomic Medicine/Thoracic Breast and Endocrinological Surgery 2-5-1 Shikata-cho Kita-ku Okayama Okayama 700“8558 Japan (e-mail: toyookamd.okayama-u.ac.jp). 1 2014 7 12 2013 7 12 2013 106 1 djt338 7 7 2013 14 10 2013 16 10 2013 The Author 2013. Published by Oxford University Press. 2013 This is an Open Access distributed under the terms of the Creative Commons Attribution-NonCommercial-NoDerivs licence (http://creativecommons./licenses/by-nc-nd/3.0/) which permits non-commercial reproduction and distribution of the work in any medium provided the original work is not altered or transformed in any way and that the work is properly cited. For commercial re-use please contact journals.permissionsoup.com We encountered a family of Japanese descent in which multiple members developed lung cancer. Using whole-exome sequencing we identified a novel germline mutation in the transmembrane domain of the human epidermal growth factor receptor 2 (HER2) gene (G660D). A novel somatic mutation (V659E) was also detected in the transmembrane domain of HER2 in one of 253 sporadic lung adenocarcinomas. Because the transmembrane domain of HER2 is considered to be responsible for the dimerization and subsequent activation of the HER family and downstream signaling pathways we performed functional analyses of these HER2 mutants. Mutant HER2 G660D and V659E proteins were more stable than wild-type protein. Both the G660D and V659E mutants activated Akt. In addition they activated p38 which is thought to promote cell proliferation in lung adenocarcinoma. Our findings strongly suggest that mutations in the transmembrane domain of HER2 may be oncogenic causing hereditary and sporadic lung adenocarcinomas. Familial lung cancers are rare among human malignancies. Recent studies have reported that germline mutations in the epidermal growth factor receptor (EGFR) gene predispose the development of lung cancer. Reported familial lung adenocarcinomas with a germline EGFR mutation such as T790M carry secondary somatic EGFR mutations including exon 19 deletion and exon 21 L858R mutation (1“4). We encountered a family of Japanese descent in which multiple members developed lung cancer (). The proband (III-4) was a 53-year-old woman with multiple lung adenocarcinomas in bilateral lungs. She was a light smoker with a 1.2-pack-year history of smoking. She had undergone a left lower lobectomy for multiple lung adenocarcinomas at the age of 44 years. Her mother (II-4) a never smoker also had multiple lung adenocarcinomas. Partial pulmonary resections of two tumors were performed for II-4 for the purpose of diagnosis after pleural dissemination was found during surgery and multiple lesions were removed in a lobectomy or partial resections in III-4. A histological examination of the resected tumors in II-4 revealed nonmucinous adenocarcinoma in situ and nonmucinous minimally invasive adenocarcinoma whereas the histological findings of pleural dissemination indicated mucus-containing adenocarcinoma. Those of III-4 contained various subtypes of adenocarcinoma including nonmucinous and mucinous adenocarcinoma in situ and invasive mucinous adenocarcinoma. In addition normal-appearing lung parenchyma obtained from a lobectomy in III-4 revealed innumerable small preinvasive lesions implying the presence of precancerous changes throughout the lung (Supplementary available online). Sequencing analyses of EGFR exons 18 to 21 and KRAS as well as an immunohistochemical staining for ALK protein in the resected tumors indicated no genetic alterations in these genes. The pedigree chart suggested that lung cancer was inherited in an autosomal dominant manner. . Pedigree chart of a Japanese family in which multiple members developed lung cancer. The boxes and circles indicate men and women respectively. The numbers at the bottom of each member indicate the age at the time of death or the time of the analysis. An oblique line shows deceased family members. The proband (III-4) had multiple lung adenocarcinomas (arrow). "

Lung_Cancer

"rs10494885 C/T ACGTTGGATGGTGTAATGCCACAGACATGC ACGTTGGATGCCAGCCAACTGACCTTTATG CTTCTGATTTTCTTTCCTGTTAC rs7542544 C/A ACGTTGGATGGCTAAGAGCCATTAGTGTGC ACGTTGGATGAACGTGGTGGTGCCCAAACA CCATGACCCCAAAGC rs6691117 A/G ACGTTGGATGAGAGTACCAGGAAACAGGAG ACGTTGGATGACCCTACCATGACAAACCCG CCGGGCTGACATCTAAATCTGA rs6656401 G/A ACGTTGGATGAAAGGACACACACAGAGGAG ACGTTGGATGCGTTGATGTTCCTTGGCTTG CTCTGTCTCCATCTTCTC rs2296160 C/T ACGTTGGATGCCAGAATTCCTCAGCAAAAC ACGTTGGATGCCAGAGTGATGTTTTGTGAC CGTGCCTTTTGTCTTCCTTTTAGGT rs9429942 T/C ACGTTGGATGTACATGTGCACAACGTGCAG ACGTTGGATGAAGGACGAGTTAATGGGTGC GGGAACGTCGCACATGTAT rs4844600 G/A ACGTTGGATGGAATGGCTTCCATTTGCCAG ACGTTGGATGGGGCGGCATTCATAGTTCAG CCCAATGGGAAACTCAAA rs3818361 C/T ACGTTGGATGTGGAAAGGACAGTTCCAGAG ACGTTGGATGTTTTAAGCCCTCTGGTAAGC TAATCCCTCTGGTAAGCATAAGATATA rs17048010 T/C ACGTTGGATGTTTCAAGGCTGCTCCTTGTT ACGTTGGATGCCCAGTCTATGGAGTTTCTG AGACTGAGACAGTTGGT Statistical analysis We used Chi-square test to examine the differences in the distributions of demographic characteristics and genotype frequencies between cases and controls. The NSCLC risk associated with CR1 tag SNPs was estimated as odds ratios (OR) and 95% confidence intervals (CI) computed by logistic regression model adjusted for age gender and smoking status where it was appropriate. Smokers were considered current smokers if they smoked up to 1 year before the date of cancer diagnosis for NSCLC patients or before the date of the interview for controls. The number of pack-years smoked was determined as an indication of cumulative cigarette-dose level [pack-year?=?(cigarettes per day/20) — (years smoked)]. Light and heavy smokers were categorized by using the 50th percentile pack-year value of the controls as the cut points (i.e. ?25 and >25 pack-years). All statistical tests were 2 sided with P<?0.05 as the significant level. Statistical analyses were done using SPSS (version 16.0 SPSS Inc Chicago IL). Gene-gene and gene-smoking interactions were analyzed by open-resource GMDR software package (version 0.9) and Quanto (http://www.hydra.usc.edu/gxe) [4445]. Abbreviations CR1: Complement receptor 1; OR: Odds ratio; CI: Confidence interval; SNP: Single nucleotide polymorphism. Competing interests The authors declare no competing financial interest. Authors™ contributions XY drafted the . XY and JR conducted genotyping of CR1. JL ZZ and LC collected clinical data and analyzed the data. XZ contributed the research plan and approved the data. All authors read and approved the final manuscript. Acknowledgements This work was supported by the National Natural Sciences Foundation of China to XZ (no. 81101483) Program for New Century Excellent Talents in University to XZ (NCET-11-0933) Science Fund for Distinguished Young Scholars of Hebei Scientific Committee to XZ (H2012401022) and Foundation for the Author of National Excellent Doctoral Dissertation of PR China (FANEDD) (no. 201274). Gelderman KA Tomlinson S Ross GD Gorter A Complement function in mAb-mediated cancer immunotherapy Trends Immunol 2004 25 158 164 10.1016/j.it.2004.01.008 15036044 Rutkowski MJ Sughrue ME Kane AJ Mills SA Parsa AT Cancer and the complement cascade Mol Cancer Res 2010 8 1453 1465 10.1158/1541-7786.MCR-10-0225 20870736 Liu D Niu ZX The structure genetic polymorphisms expression and biological functions of complement receptor type 1 (CR1/CD35) Immunopharmacol Immunotoxicol 2009 31 524 535 10.3109/08923970902845768 19874218 Ahearn JM Fearon DT Structure and function of the complement receptors CR1 (CD35) and CR2 (CD21) Adv Immunol 1989 46 183 219 2551147 Tas SW Klickstein LB Barbashov SF Nicholson-Weller A C1q and C4b bind simultaneously to CR1 and additively support erythrocyte adhesion J Immunol 1999 163 5056 5063 10528211 Wagner C Ochmann C Schoels M Giese T Stegmaier S Richter R Hug F Hansch GM The complement receptor 1 CR1 (CD35) mediates inhibitory signals in human T-lymphocytes Mol Immunol 2006 43 643 651 10.1016/j.molimm.2005.04.006 16360013 Jozsi M Prechl J Bajtay Z Erdei A Complement receptor type 1 (CD35) mediates inhibitory"

Lung_Cancer

"The price of gefitinib is the most significant parameter that could reduce the incremental cost per QALY. Probabilistic sensitivity analysis indicated that the cost-effective probability of maintenance gefitinib was zero under the willingness-to-pay (WTP) threshold of $16349 (3—per-capita gross domestic product of China). The sensitivity analyses all suggested that the model was robust. Conclusions Maintenance gefitinib following first-line platinum-based chemotherapy for patients with locally advanced/metastatic NSCLC with unknown EGFR mutations is not cost-effective. Decreasing the price of gefitinib may be a preferential choice for meeting widely treatment demands in China. This study was funded by National Natural Science Foundation of China (No.81173028) (URL: http://www.nsfc.gov.cn/Portal0/default152.htm). The funders had no role in study design data collection and analysis decision to publish or preparation of the manuscript. Introduction Lung cancer the most commonly diagnosed form of cancer is also the leading mortality cause of cancer in males [1]. Non-small-cell lung cancer (NSCLC) accounts for approximately 80% of all lung cancer cases and the majority of patients with NSCLC have locally advanced/metastatic disease when they are diagnosed with carcinoma [2] [3]. Platinum-based combination therapies are recommended as first-line chemotherapy for unselected patients with locally advanced/metastatic NSCLC [4] [5]. However the duration of them (4“6 chemotherapeutic cycles 21 days per cycle) are limited by cumulative toxicities and response rates (20%“35%) and median overall survival (7“12 months) are modest [6] [7]. On the basis of previous investigations efforts to improve treatment outcome have focused on the specific goal of prolonging tumour response progression-free survival (PFS) and overall survival (OS) with well tolerated maintenance treatment in patients who have attained tumor control during first-line treatment [8]“[12]. Because of these trials and other findings both erlotinib and pemetrexed (for patients with histologies other than squamous cell carcinoma) have been approved by clinical guidelines as a category 2A recommendation for switch maintenance therapy and also been approved by FDA in patients without disease progression after 4“6 chemotherapeutic cycles of first-line therapy [4] [13] [14]. In The Lancet Oncology recently Li Zhang et al based on a double-blind randomised phase 3 trial reported that maintenance gefitinib significantly prolonged PFS compared with placebo in patients from 27 centres across China with locally/metastatic NSCLC which indicates that gefitinib should be considered as a maintenance treatment choice in eastern Asian patients [15]. Several economic studies were conducted of maintenance therapy [16]“[23]. Two analyses concluded that maintenance erlotinib is cost-effective versus best supportive care for locally advanced/metastatic NSCLC [16] [17]. Except for the study by Greenhalgh et al [18] the 4 other studies of maintenance pemetrexed indicated that the new therapy was not cost-effective [19]“[22]. The evaluation from Zhu J et al on the basis of the clinical trial suggested that the maintenance gefitinib therapy was cost-effective for locally advanced/metastatic NSCLC patients with activating EGFR mutations [23]. However it is unclear whether the new therapy is cost-effective in patients with unknown EGFR mutations after first-line platinum-based combination chemotherapy without disease progression. The objective of the current study was to evaluate the long-term cost-effectiveness (10 year time horizon) of maintenance gefitinib therapy after four chemotherapeutic cycles of stand first-line platinum-based chemotherapy for locally advanced/metastatic NSCLC patients with unknown EGFR mutations from a Chinese health care system perspective. Materials and Methods A previously constructed semi-Markov model was used to compare the long-tern impact of maintenance gefitinib treatment versus placebo after 4 chemotherapeutic cycles of first-line platinum-based chemotherapy for patients with locally advanced/metastatic NSCLC [22] on the basis of the double-blind randomised phase III trial from China by Li Zhang et al [15]. The model along with two-parametric Weibull and Log-logistic distribution were used for calculating the direct medical costs life-years gained (LYGs) and quality-adjusted life-years (QALYs) gained of the practice presented in the trial [15]. Due to the perspective of the Chinese health care system only direct medical costs related to the practice were estimated including maintenance gefitinib therapy treatment of major adverse events routine follow-up treatment for patients without progression follow-up treatment for progressive disease and terminal-phase cost. Costs in this study were estimated in US dollars (USD) corresponding to the 2011 consumer price index and assuming an average exchange rate of 1 USD to 6.45 Chinese Yuan (RMB). Utilities for the model were derived from the literature. The future costs and outcomes were discounted at 3% annually in compliance with the request of China Guidelines for Pharmacoeconomic Evaluations (version 8) [24]. Effectiveness data were stemmed from the multicentre double-blind randomised clinical trial [15] which is the only phase III trial compared maintenance gefitinib treatment in patients with locally advanced/metastatic NSCLC according to our literature search. In brief 296 patients with histological or cytological NSCLC in stage IIIb or IV between September 28 2008 and August 112009 who were 18 years or older and had a WHO performance status of 0“2 and more than 12 weeks life expectancy after completion of four chemotherapeutic cycle™s first-line platinum-based chemotherapy without disease progression were eligible for the maintenance gefitinib or placebo treatment (1?1 randomization ratio). Eligible patients continued to take either gefitinib (250 mg per day) or placebo orally until disease progression intolerable toxicity withdrawal of consent serious non-compliance with protocol or dose delay or interruption >14 days. In this report there were 40 and 39 patients were deemed know EGFR mutation status in gefitinib group and placebo group respectively. Therefore there were 108 patients and 109 patients with unknown EGFR mutation received maintenance gefitinib and placebo treatment separately. The primary endpoint of the trial was progression-free survival and the survival analysis revealed that median PFS for patients with unknown EGFR mutation was 6.0 months in gefitinib group and 2.7 months in placebo group (HR 0.40 [95% CI 0.29“0.54]; p<0.0001). Median OS was not significantly different between the two groups (HR 0.84 [95% CI 0.62“1.14]; p?=?0.26; median OS 18.7 months vs 16.9 months). The incidence of adverse events in gefitinib group was more frequent than that in placebo group (80% vs. 53%). The cumulative probabilities of serious adverse events were 7% and 3% in the maintenance gefitinib and placebo groups respectively. The model outcomes were presented as costs LYGs and QALYs from the perspective of the Chinese health care system. Sensitivity analyses of input parameters with the high/low values and various distributions were conducted to assess the stability of the model at a value of recommended willingness-to-pay (WTP) threshold of $16349 (3—per-capita gross domestic product GDP) based on the cost-effectiveness guidelines of Word Health anization (WHO) [25]. Model Structure The simplified model structure was shown in which comprised 3 mutually exclusive health states: PFS (entry state); progressed survival (PS state) and death. Patients move from one state to another during each Markov cycle length of 3 weeks (short enough to detect all clinically relevant events) until time horizon termination of 10-year (>95% patients died). Two-parametric Weibull survival and Log-logistic distribution analyses using R for Statistical Computing version 2.15.2 (R Foundation Wien Austria) were fitted to the PFS and OS curves respectively on the basis of survival data extracted from the published Kaplan-Meier curves [15] by using GetData Graph Digitizer software (version 2.24). Table 1 shows the Weibull and Log-logistic distribution parameters of model estimated. The estimated Weibull parameters are used to measure the time-dependency transition probabilities from PFS to PS state according to the following formula:where the ? defines the scale of the distribution the ? gives the shape the u is the Markov cycle and tu indicates that t is calculated as integer multiples of the cycle length of the model. The transition probabilities of death at current t due to the following formula:where the ? and ? are the theta and kappa from the estimated Log-logistic parameters indications of the u and the tu are the same as above. 10.1371/journal.pone.0088881.g001 Markov model of locally advanced/metastatic non-small-cell lung cancer. 10.1371/journal.pone.0088881.t001 Table 1 Weibull and Log-logistic parameters of model estimated for progression-free and overall survival curves respectively. Progression-free survivala Scale Mean (Range) Shape Mean (Range) Adjusted R2 Correlation Coefficient Placebo arm 0.10443 (0.04509/0.16377) 1.29221 (0.99662/1.58780) 0.9729 ?0.995165 Gefitinib arm 0.10231 (0.06622/0.13840) 0.83852 (0.71474/0.96230) 0.9782 ?0.998386 Overall survival b Theta Mean (Range) Kappa Mean (Range) Adjusted R2 Correlation Coefficient Placebo arm ?6.54311 (?7.16112/?5.92510) 2.09373 (1.89823/2.28923) 0.9855 ?0.999986 Gefitinib arm ?5.04069 (?5.53622/?4.54516) 1.54139 (1.38359/1.69919) 0.9801 ?0.999852 a R output for Weibull regression fitted to progression-free curves of locally advanced/metastatic non-small-cell lung cancer patients derived from the Phase III trial [15]. b R output for Log-logistic regression fitted to overall curves of locally advanced/metastatic non-small-cell lung cancer patients derived from the Phase III trial [15]. Medical Costs and Utilities Medical costs for each strategy (Table 2) from the perspective of Chinese health care system were based on outlining current practice [15] which reflected the effectiveness of maintenance gefitinib treatment in Chinese patients with locally advanced/metastatic NSCLC. Direct medical costs related to the practice were estimated including maintenance gefitinib therapy treatment of major adverse events routine follow-up treatment for patients without progression follow-up treatment in PS state and terminal-phase cost. Prices of gefitinib follow-up treatment cost in PS state and terminal-phase cost were obtained from our previous study in which we have calculated healthcare costs associated with the time- and health status-related treatment resources that advanced NSCLC may anticipate based on health expenditure data for 253 cases of advanced NSCLC registered at the Second Xiangya Hospital of Central South University in China between 2006 and 2010 [26]. The aggregate annual medical costs for patients in either PFS or PS state and monthly healthcare costs accumulated during the terminal 3 months were estimated and evaluated using 95% confidence intervals through bootstrapping with the R software (version 2.14.0; R Foundation Vienna Austria) [26]. According to Gefitinib Patients Assistance Program of the pharmaceutical producer in China NSCLC patients receive donations of gefitinib after six months treatment [23]. Therefore six months was applied to calculate the total cost of the maintenance drug. Routine follow-up treatment cost for patients without progression including computed tomography scan physician visit and other examinations and drugs was derived from the literature by Wu B et al [27]. Based on expert opinion only diarrhoea and other grade 3/4 adverse events were considered to estimate the costs of treatment-associated toxicity. Therefore the unit costs of diarrhoea treated and liver protected were multiplied by published rates of corresponding events to populate the model analysis (we assumed patients with grade 3/4 alanine aminotransferase aspartate aminotransferase or aminotransferases increased should receive treatment of liver protected). The unit costs of diarrhoea and liver protected were estimated according to local charges in China. 10.1371/journal.pone.0088881.t002 Table 2 Base cases ranges and distributional assumptions of parameters. Variables Base case Range Distribution Costs ($) Treatment costs Gefitinib per 250 mg [26] 81.0 64.8/81.0a Fixed in PSA ?Routine follow-up of patients per unit [27] 51.5 45.0/58.4 Lognormal ?Follow-up treatment in PS state each year [26] 14519 12011/16871 Lognormal ?Terminal phase cost in last month [26] 3754 3274/4238 Lognormal Adverse events ?Liver protected per unitb 57.78 32.07/96.22 Lognormal ?Diarrhoea per unitb 1.48 0.89/2.08 Lognormal Utility values Progression-free survival on oral therapy [28] 0.67 0.27/0.80 Beta Progression-free survival plus rash [28] 0.62 0.25/0.74 Beta Progression-free survival plus diarrhoea [28] 0.61 0.24/0.73 Beta Progressed disease survival [28] 0.47 0.19/0.56 Beta Discount rate (%) [24] 3 0/8 Fixed in PSA Risk for adverse events Rash in gefitinib arm [15] 0.50 0.35/0.65c Beta Rash in placebo arm [15] 0.095 0.067/0.124c Beta Diarrhoea in gefitinib arm [15] 0.25 0.18/0.32c Beta Diarrhoea in placebo arm [15] 0.088 0.062/0.114c Beta ALT increased in gefitinib arm (grade 34) [15] 0.020 0.014/0.026c Beta AST increased in gefitinib arm (grade 34) [15] 0.007 0.0049/0.0091c Beta ATR increased in gefitinib arm (grade 34) [15] 0.014 0.0098/0.0182c Beta PSA?=?Probabilistic sensitivity analysis; ALT?=?Alanine aminotransferase; AST?=?Aspartate aminotransferase; ATR?=?Aminotransferases. a Price of gefitinib was reduced 20% and was fixed in probabilistic sensitivity analysis because it is a brand name drug. b Estimated according to local charges in China. c Varied by ±30%. Health state utility values of the PFS and PS states presented in Table 2 were derived from the published literature by Nafees et al who assessed quality of life using the visual analogue scale and standard gamble interview in 100 participants on the basis of the health state descriptions which were developed after rounds of in-depth interviews with oncologists oncology specialist nurses and psychometric experts [28]. According to the literature diarrhoea and rash reported in the trial were significantly associated with the utility values of PFS [15] [28]. Therefore we calculated the utility value in PFS based on the published proportion of the adverse events (diarrhoea and rash) [15] and utility values of PFS on oral therapy (0.67) PFS plus rash (0.62) and PFS plus diarrhoea (0.61) [28]. The utility of PS state was 0.47 (range 0.19“0.56) and was used in both arms. Sensitivity Analysis Each key parameter was fitted high/low values and specific pattern of distribution in our model (Table 2) to reflect substantial uncertainty of the input parameters using one-way and probabilistic sensitivity analyses (PSA). Many ranges were derived from published reports [26]“[28]; price of gefitinib was reduced 20% and fixed in PSA because it is a brand name drug; costs of adverse events were estimated by local charges in China; probabilities of adverse events were varied by ±30%. Lognormal distributions were chosen for all input costs except gefitinib (fixed in PSA); beta distributions were chosen for utility values and probabilities of adverse events; bivariate normal distributions were adopted for the Weibull and Log-logistic parameters; discount rate with high/low values was fixed in PSA in compliance with the request of China Guidelines for Pharmacoeconomic Evaluations (Version 8) [24]. The WTP threshold of 3—per-capita GDP ($16349/QALY) was used. A tornado diagram and an incremental cost-effectiveness scatter plot were developed to depict the results of one-way sensitivity analyses (OSA) and PSA. Results Base Case Model Analysis The Log-logistic and two parameters Weibull model matched the survival curves of the clinical trial by Zhang L et al [15] satisfactorily (Figure 2). The validity of the simulated survival curves tail beyond the observed time horizon of clinical trial was conducted by comparing the 5 years overall survival rate calculated from the current distribution models for placebo arm (5.7%) to the data from the Surveillance Epidemiology and End Results (SEER) Program which shows that 5-year survival rate of distant lung cancer patients is 3.9% [29] and the site of http://lungcancer.about.com/ which shows that 5-year survival rate of metastatic NSCLC is sadly less than 10%. Base case model analyses in different time horizon are displayed in Table 3 which suggested that maintenance gefitinib therapy after four chemotherapeutic cycles of stand first-line platinum-based chemotherapy for patients with locally advanced/metastatic NSCLC patients would increase the effectiveness in a 1- 3- 6- or 10-year time horizon with incremental QALYs gained of 0.02330.1462 0.2699 and 0.3496. Incremental costs per QALY for the new therapy compared with placebo were $184828 $19214 $19328 and $21308 respectively at 136 and 10 years. 10.1371/journal.pone.0088881.g002 Figure 2 Survival curves in patients with maintenance gefitinib group or placebo group after first-line platinum-based combination chemotherapy of four cycles in locally advanced/metastatic non-small-cell lung cancer. The original curves from the clinical trial are shown together with the Weibull and Log-logistic model estimated for progression-free survival and overall survival separately. 10.1371/journal.pone.0088881.t003 Table 3 Base-case model analyses of life-years gained (LYGs) quality-adjusted life-years (QALYs) costs and incremental cost per LYG/QALY of maintenance gefitinib therapy arm and placebo arm after four cycles of stand first-line platinum-based chemotherapy for patients with locally advanced/metastatic NSCLC on the basis of 1000 simulation cases. Arm LYGs Gained QALYs Gained Cost ($) Incremental cost ($) Per LYG Per QALY 1-year Placebo arm 0.865 0.465 9082 “ “ Gefitinib arm 0.845 0.488 13396 Dominated 184829 3-year Placebo arm 1.516 0.772 18866 “ “ Gefitinib arm 1.658 0.918 21675 19788 19214 6-year Placebo arm 1.735 0.875 22129 “ “ Gefitinib arm 2.112 1.144 27345 13816 19328 10-year Placebo arm 1.814 0.912 23302 “ “ Gefitinib arm 2.357 1.262 30751 13734 21308 One-way Sensitivity Analysis The results of one-way sensitivity analyses of key populated variables (displayed in Table 2) were depicted in a tornado diagram (Figure 3) to show the influence with regard to the incremental cost-effectiveness ratio (ICER) which means incremental cost per QALY gained in current study. The utility of PFS plus rash impacted utmost on the ICER. The other sensitive variables included utility of PFS plus diarrhoea utility of progressed disease price of gefitinib cost of follow-up treatment in PS state and utility of PFS on oral therapy. All of these variables did not led to an ICER entrancing the WTP threshold of $16349 per QALY (3—per-capita GDP of China). None of the other parameters significantly altered the ICER. 10.1371/journal.pone.0088881.g003 Figure 3 Tornado diagram for one-way sensitivity analysis revealing variables™ influence on the incremental cost-effectiveness ratio. PFS?=?progression-free survival; GE?=?gefitinib; PL?=?placebo; QALY?=?quality-adjusted life-years. Probabilistic Sensitivity Analysis Incremental cost-effectiveness scatter plot of 1000 simulations (Figure 4) showed a zero probability meeting the WTP threshold of $16349/QALY. If the WTP was >$21323 (per-capita GDP: $7108) more 50% of locally advanced/metastatic NSCLC with maintenance gefitinib therapy after four cycles of first-line platinum-based combination chemotherapy without disease progression could achieve cost-effectiveness. Acceptability curves (Figure 5) suggested that the cost-effectiveness likelihood of maintenance gefitinib therapy increased with increasing thresholds of WTP and about $17700 to $26300 was the sensitivity range. At WTPs >$26300 almost all cases could achieve cost-effectiveness. 10.1371/journal.pone.0088881.g004 Figure 4 Probabilistic sensitivity analysis of 1000 cases study comparing maintenance gefitinib strategy and placebo strategy. WTP?=?willingness to pay; QALY?=?quality-adjusted life-years. 10.1371/journal.pone.0088881.g005 Figure 5 Acceptability curves of maintenance gefitinib arm and placebo arm. QALY?=?quality-adjusted life-years. Discussion Maintenance gefitinib therapy has been proven to prolong PFS significantly than placebo for patients with locally advanced/metastatic NSCLC after 4 chemotherapeutic cycles of first-line platinum-based combination chemotherapy without disease progression based on a Chinese phase III trial across 27 centres [15]. However its economic impact is necessary to be considered before it is widely used for the appropriate patients especially for China where the population is >1.3 billion and the health care resources are in serious shortage [30]. Resource allocation decisions in health care are rife based on results from economic assessments. However from Clinical trials it is of difficulty to collect enough financial data for economic evaluation [27]. Thus mathematical models that can estimate long-term cost-effectiveness of alternative strategies is a helpful technique to support economic analyses of health care resource ulitization [26] [27]. "

Lung_Cancer

"The presence of 3R/3R polymorphism seemed to predict a higher ORR (100%) compared to the rest of the genotypes with a trend toward statistical significance (p =?0.055). In the subgroup analysis a significantly higher ORR to pemetrexed for wild-type EGFR patients showing a 3R/3R genotype (100%) compared to the 2R/2R (77.8%) 2R/3R (33.3%) and 3R/4R (0%) was observed (p =?0.017). Overall response rate to the treatment and polymorphisms observed Global distribution of polymorphisms (Pol) Response N (%) Stabilization or progression N (%) p value VNTR 2R/2R 7 (77.8) 2 (22.2) 0.055 3R/3R 7 (100) 0 (0) 2R/3R 4 (50) 4 (50) 3R/4R 0 (0) 1 (100) Pol VNTR (Subanalysis by EGFR status; group of native EGFR-patients) 2R/2R 7 (77.8) 2 (22.2) 0.017 3R/3R 7 (100) 0 (0) 2R/3R 2 (33.3) 4 (66.7) 3R/4R 0 (0) 1 (100) Global distribution of SNP Absence 6 (85.7) 1 (14.3) 0.626 Presence 12 (66.7) 6 (33.3) Global distribution of polymorphisms in 3?-UTR +6/+6 10 (83.3) 2 (16.7) 0.234 +6/-6 6 (54.5) 5 (45.5) -6/-6 2 (100) 0 (0) Pol 3?-UTR (Subanalysis by smoking habit stratification; group of active and former smokers) +6/+6 8 (100) 0 (0) 0.085 +6/-6 4 (50) 4 (50) -6/-6 2 (100) 0 (0) No statistically significant differences were observed comparing the presence and the absence of a SNP G >?C as shown in . Overall a non-significant correlation between the different 3?-UTR polymorphisms and the ORR was observed. However the genotype +6/+6 seemed to predict a higher ORR among active/former smokers (A/FS) compared to +6/-6 (100% vs. 50%; p =?0.085). Correlation between PFS and polymorphisms Regarding TSER polymorphisms we found a trend toward statistical significance (p =?0.089) in the differences in PFS observed among the different genotypes in favor of the 3R/3R genotype (A). Kaplan-Meier curves for progression-free survival (PFS) in months (mo) associated with the different TS polymorphisms. A: TSER genotypes. B: Presence or absence of SNP. C: 3´UTR genotypes. In the case of the absence or presence of a SNP at the third repetition (3R allele) we observed a non-significant increased PFS in the subgroup of patients showing an absence of SNP (B). Finally no significant correlations regarding the 3?UTR genotypes and PFS were observed (C). Correlation between OS and polymorphisms In this cohort we found a significant correlation between TSER polymorphisms and OS (A). The median OS was not reached for 3R/3R genotype patients whereas 2R/3R genotype subjects showed a 70 m OS followed by 3R/4R and 2R/2R genotypes with a median OS of 15 m and 13 m respectively (p =?0.019) (A). Kaplan-Meier curves for overall survival (OS) in months (mo) associated with the different TS polymorphisms. A: TSER genotypes. B: Presence or absence of SNP. C: 3´UTR genotypes. No significant differences in OS were observed with regards to the presence/absence of SNP (B) or regarding the 3?-UTR polymorphisms (C). Correlation between toxicity and polymorphisms The most frequent toxicity was grade (G)1 anemia (28%) and nausea (20%) and G2 leucopenia (40%). The most commom G3-4 toxicities were leucopenia (16%) asthenia (8%) anemia (4%) neutropenia (4%) and dyspnea (4%). Overall we found no significant correlations between the toxicity profiles experienced by the patients and the different TS genotypes (). Correlation between grades of toxicity and different genotypes Global distribution polymorphisms (Pol) No toxicity Grade 1-2 Grade 3-4 p value VNTR polymorphisms 2R/2R 2 (22.2) 4 (44.2) 3 (33.4) 0.545 3R/3R 2 (25) 5 (75) 0 (0) 2R/3R 2 (25) 4 (50) 2 (25) 3R/4R 1 (100) 0 (0) 0 (0) SNP polymorphisms Absence 3 (42.9) 4 (57.1) 0 (0) 0.3 Presence 4 (22.2) 9 (50) 5 (27.8) 3?-UTR polymorphisms +6/+6 3 (25) 6 (50) 3 (25) > 0.05 +6/-6 3 (27.3) 6 (54.5) 2 (18.2) -6/-6 1 (50) 1 (50) 0 (0) Discussion Pemetrexed a multitargeted antifolate drug is essential for the first and second-line as well as maintenance treatment of NSCLC patients with non-squamous histology [6]. TS is the main biological target of pemetrexed. Some studies have suggested that TS expression could be a predictive factor of response in NSCLC [19]. Moreover some VNTR genotypes have been associated with TS expression and activity in other tumor types such as colorectal cancer [17]. In NSCLC patients a correlation between different genotypes and the TS protein expression has been shown [20]. Shintani et al. [20] also confirmed that the TS mRNA levels were significantly higher in lung cancer tissues with the 3R/3R genotype as compared to those with the 2R/2R genotype. Nonetheless definitive studies addressing the correlation of the different genotypes of TS in circulating genomic DNA with response to the treatment PFS or OS in pemetrexed-treated NSCLC European patients are lacking. The potential influence of the EGFR status on those polymorphisms and their correlation with clinical outcome after pemetrexed-based treatment is also unexplored. A recent study by Hu et al. [21] investigated the different TS polymorphisms in genomic DNA of 90 Asian NSCLC patients. In contrast with our findings no specific genotype regarding the TSER or 3?-UTR polymorphisms studied seemed to correlate with a significant difference in ORR PFS or OS. This could be explained by substantial clinical differences between both populations. Our cohort was constituted by Caucasian patients compared to the Asian population studied by Hu et al. In addition our patients were mostly current or former smokers (72%) compared to the Asian population that showed 62% of never smokers. Also in our cohort the subjects mainly received pemetrexed-based chemotherapy as a first line regimen (92%) whereas the cohort studied by Hu et al. [21] was treated with pemetrexed as a second or further line in 62.2% of the cases. These remarkable differences in basic clinical characteristics and in particular the ethnicity between both cohorts are probably also explaining the differences observed in the 3?-UTR genotype frequency between our population and the one studied by Hu et al. In our cohort +6 bp/+6 bp +6 bp/-6 bp and -6 bp/-6 bp genotypes were found in 48% 44% and 8% of the cases respectively. In contrast0.078 47.8% and 44.4% were respectively found in the population studied by Hu et al. [21]. In a previous analysis performed on another Caucasian NSCLC population evaluated at the M.D. Anderson Cancer Center [22] a similar proportion of 3?-UTR genotypes according to our findings was observed (49.2% of +6 bp/+6 bp 42.4% of +6 bp/-6 bp and 8.4% of -6 bp/-6 bp). Additionally the low prevalence of the +6 bp/+6 bp genotype in an Asian population compared to our cohort may be confirmed by a recent study in which from 106 Asian NSCLC patients investigated none of them showed a +6 bp/+6 bp genotype in genomic circulating DNA [23]. Nontheless in this latter study [23] a significantly higher ORR was observed among patients showing a -6 bp/-6 bp 3?-UTR genotype compared to the ORR reported for patients presenting a -6 bp/+6 bp polymorphism (32.2% vs 12.7%; p =?0.008). Accordingly in our cohort a higher ORR in patients showing a -6 bp/-6 bp genotype compared to those presenting a -6 bp/+6 bp polymorphism was also observed (100% vs. 54.5%). However the statistical significance was not reached probably due to the relatively low number of patients included in our analysis. Interestingly enough in the subgroup analysis of our data the +6 bp/+6 bp genotype seemed to predict a higher ORR only among active/former smokers compared to +6 bp/-6 bp (100% vs. 50%; p =?0.085). This novel observation if validated in future studies could be relevant for selecting specific drugs for each patient in a second or third line setting. With regards to the TSER polymorphisms the presence of a 3R/3R polymorphism seemed to predict a higher ORR with a clear trend toward statistical significance (p =?0.055). Moreover that difference was even greater and statistically significant benefiting the subpopulation of wild-type EGFR patients. To our knowledge this is the first time that such observation has been made. An interesting preclinical study by Giovannetti et al. [24] investigated the activity profile of a combination therapy against NSCLC cell lines with different genotypes with erlotinib and pemetrexed. Remarkably pemetrexed increased EGFR phosphorylation and reduced Akt phosphorylation. Additionally erlotinib significantly reduced TS expression and activity. Thus when erlotinib and pemetrexed were combined a strong synergism in all NSCLC cells regardless of their genetic signature was observed. This potential crosstalk between the EGFR signaling pathway and the TS expression and activity could in part explain our novel findings showing a significantly higher ORR to pemetrexed in those wild-type EGFR patients harboring a 3R/3R polymorphism."

Lung_Cancer

"They are designed to determine which subjects have quit smoking or cut down and which subjects who have failed to quit still plan to do so. There is a section that asks about general motivators and components of the smoking cessation programme. The subjects will be asked to score these motivators and smoking cessation aids for their efficacy in helping them to quit. The questions in this section are almost identical to a validated questionnaire [24]. There are also further questions on whether the subject would recommend the Respiragene test to a relative or friend and an open ended question for subjects to add their own comments about the concept of a test that predicts susceptibility to lung cancer in a smoker. Data quality assurance The study has been designed and will be reported in accordance with CONSORT (Consolidated Statement of Reporting Trials) [25]. Data will be controlled in accordance with data protection legislation institutional protocols of Sussex NHS Research Consortium and NHS policies for research and information governance for ensuring patient confidentiality [26]. Data will be analysed in SPSS (Statistical Package for Social Sciences) version 15 using an intention to treat approach. Outcome measures Primary endpoint Comparison of smoking cessation rates (7 day point abstinence and continuous abstinence) in Clinic A and Clinic B at 8 weeks and six months. Secondary endpoints A. Personal data: 1. Number of smokers still smoking who state that they still plan to stop. 2. Daily cigarette consumption of those still smoking. 3. Mean scores for ranking of smoking cessation aids (gene-based test - Clinic A only salivary cotinine lung cancer facts - controls in Clinic B only and general counselling from NHS smoking counsellors). B. Analyse questions about whether subjects would recommend the test to a member of family or a friend. C. Analyse last (open ended) question using qualitative research methodology. Statistics Primary end point The difference between smoking cessation between Clinic A and Clinic B will be estimated from the four week and six month follow up for the primary endpoint (smoking status confirmed by carbon monoxide breathalyser and salivary cotinine tests). If there is the expected higher rate of smoking cessation for Clinic A compared with Clinic B statistical significance will be demonstrated by the ?2 test. Since there are as yet no case-control studies that compare quit rate following the gene-based test versus quit rate without the test the expected difference in quit rate between Clinic A and Clinic B is difficult to estimate. Two case-control studies showing only a 5-10% increase in smoking cessation involved just a single gene of small effect [1112]. In a randomised control trial patients were given either a full explanation of the results of spirometry testing including an estimation of lung age or just the FEV1 without explanation (control group). The group of patients who were given the full explanation had a 7.2% higher quit rate than the control group. However data from Auckland suggest a larger uplift of quit rate with Respiragene. This can be explained by the superior predictive power of a 20-gene test combined with clinical history (personal history of COPD and family history of lung cancer) to give a rather more impressive estimate of cancer risk than anything previously available. The adequacy of sample size was tested using data from smoking cessation trials that showed: ¢30-40% smoking cessation at 6-months with similar protocols [2728]. ¢A 48% quit rate at 2-4 weeks in subjects with high and very high lung cancer risk scores but this difference shrinks to 27% at 6 months. ¢Data from Young et al [1518] (independently verified by McBride et al [11]) that even being given an average score for lung cancer susceptibility increases smoking cessation by approximately 10%. Therefore with a minimum sample sizes of 30 per group the following calculations based on these estimated quit rates apply (). Statistical power of 87.1% is generally acceptable for publication (for alpha error of 5% - i.e. 5% probability of incorrectly rejecting the null hypothesis that there is no difference in the percentage values). For further detailed statistical analysis refer to Additional file 1. Summary of values from which the power of the study are estimated Control group expected quit rate as %ge Respiragene group expected quit rate as %ge ? 2 calculated from four-some table P value based on ? 2 Power calculations* 8 weeks Sample size 30/30* 70% 94% 5.9 <0.05 79.3% Sample size 60/60* 11.7 <0.01 96.9% 6 months Sample size 30/30** 35% 52% 1.7 NS 36.5% Sample size 60/60** 6.2 <0.05 87.1% *Telephone (alone) quit rate (see ) assumed to be 20%. **Telephone (alone) quit rate (see ) assumed to be 10-15%. Secondary outcome measures Similarly the significance of secondary endpoints on intention to stop smoking cigarette consumption uptake of invitation to cessation adherence to cessation course and self-reported smoking cessation will be calculated by the ?2 test but the p value for the ranking scores for information on lung cancer risk and other smoking cessation aids and motivators will be estimated from the unpaired student t-test. The open ended question: œHow do you feel now about having had a genetic test that estimates the probability that you will develop lung cancer at some future date? will have to be analysed by qualitative analysis to determine the main recurrent themes in responses. Discussion Overview Smoking cessation is one of the most cost effective interventions that can be achieved in primary care [29]. However many smokers are very reluctant to commit to a smoking cessation programme (precontemplative and contemplative) and about half of those that attend for smoking cessation intervention (action stage of change) are likely to drop out or give up trying. Therefore any methodology that increases motivation in both unmotivated and motivated smokers could be very valuable. The gene-based test we are offering has shown promise as a smoking cessation motivator in precontemplative-contemplative smokers in a hospital outpatient setting [1518] and now needs to be tested out as a motivator for improving adherence in a primary care smoking cessation clinic using a randomised controlled study. Strengths The main strengths of this study are that it is being carried out on subjects from a large primary care population and should therefore be more representative of the general population than previous studies recruited from hospital patients and other special groups. We also have the advantage of being able to carry out this research within the established framework of the local stop smoking service. Limitations and assumptions Although we have estimated based on previous smoking cessation work using this gene-based test that the primary endpoint will show that having the test improves quit rate by 20-25% this was based on a cohort of hospital outpatients in Auckland New Zealand and subjects recruited from primary care may respond differently. Although we plan to recruit a minimum of 60 subjects this may not be enough to balance unexpected and unknown confounding factors. What we might find We aim to recruit a minimum of 60 subjects to randomise 30 into group A (test group) and 30 into Group B (control group). The normal experience in NHS smoking cessation clinics is a drop-out rate of 40-50% [30-32]. We need therefore to attempt to recruit about 120 subjects in order to get a statistically significant result based on the assumptions in our power calculations. We may however have underestimated the 6-month quit rate using the NHS local stop smoking guidelines [22] which typically involves a multi-interventional programme which includes combinations of varenicline prescriptions Lung_Cancer breath carbon monoxide monitoring and intensive counselling giving a quit rate of 70-80% at 6-weeks.There are however no Surrey data for 6-month quit rate which we assume on the basis of similar smoking cessation data to be about half the 6-week figure [33] ? 35%. An unknown and unpredictable factor that could skew results significantly is the possibility that our multi-interventional approach could help to reinforce the health risk message equally for subjects in both groups. Also the Auckland study design involved recruitment of precontemplative-contemplative smokers from a hospital outpatient setting compared to this study that will involve primary care subjects who have volunteered to participate in a smoking cessation programme (ie smokers in the action stage of quitting). This population therefore could be sufficiently different to give unexpected results. However the results of this trial will inform as to the acceptability of this approach as well as its effectiveness. Abbreviations CONSORT: Consolidated statement of reporting trials; COPD: Chronic obstructive pulmonary disease; DNA: Deoxyribonucleic acid; NHS: National health service UK; SNP: Single nucleotide polymorphism; SAE: Stamped addresses envelope. Competing interests JN and PG are in receipt of research grants from Lab 21 Cambridge who are marketing the Respiragene test in the UK and Synergenz Bioscience Ltd. who financed the development of the test from its origins in New Zealand. We initially purchased SmokeScreen kits (for salivary cotinine estimation) from GFC Diagnostics Ltd. But they subsequently supplied 30 kits free of charge. Authors™ contributions JN and PG developed the idea of a control trial of the Respiragene test after discussions with Aino Telaranta-Keerie of Lab 21 Cambridge. WK was involved in helping to write the protocol and her experience in running smoking cessation clinics was very helpful. PW was our statistical adviser and SdeL helped us to write the protocol in accordance with CONSORT principles and in development of trial methodology. All authors read and approved the final manuscript. Authors™ information PG is a Visiting Professor of Primary Care at The University of Surrey. SdeL is Professor of Health Care and Clinical Informatics at The University of Surrey. JN is a primary care physician and visiting research fellow at The University of Surrey. WK is a visiting research fellow at The University of Surrey and an experienced smoking cessation nurse. PW is a Statistics Consultant in the Department of Mathematics at The University of Surrey. Pre-publication history The pre-publication history for this paper can be accessed here: http://www.biomedcentral.com/1471-2466/14/77/prepub Supplementary Material Additional file 1 Detailed statistical analysis. Click here for file Acknowledgements We are grateful for the help of Aino Telaranta-Keerie and the staff of Lab 21 for their support and for carrying out the Respiragene tests. We are also indebted to Kevin Murphy of Synergenz for his encouragement and support. Professor Robert Young and his team of Auckland New Zealand developed the Respiragene test and the risk score formula. His advice and guidance has been invaluable. Wetterstrand KA DNA Sequencing Costs Data from the NHGRI Large-Scale Genome Sequencing Program http://en.wikipedia.org/wiki/Personal_genomics#cite_note-18 Smerecnik C Grispen JEJ Quaak M Effectiveness of testing for genetic susceptibility to smoking-related diseases on smoking cessation outcomes: a systematic review and meta-analysis Tob Control 2012 21 3 347 354 10.1136/tc.2011.042739 21948804 Smith SM Campbell MC Macleod U Factors contributing to the time taken to consult with symptoms of lung cancer: a cross sectional study Thorax 2009 64 1953 531 Sanderson SC O™Neill SC White DB Bepler G Bastian L Lipkus IM McBride CM Responses to online GSTM1 genetic test results among smokers related to patients with lung cancer: a pilot study Cancer Epidemiol Biomarkers Prev 2009 18 7 1953 1961 10.1158/1055-9965.EPI-08-0620 19567511 Young RP Hopkins R Black PN Eddy C Wu L Gamble GD Mills GD Garrett JE Eaton TE Rees MI Functional variants of antioxidant genes in smokers with COPD and in those with normal lung function Thorax 2006 61 5 394 399 10.1136/thx.2005.048512 16467073 Young RP Hopkins RJ Christmas T Black PN Metcalf P Gamble GD COPD prevalence is increased in lung cancer independent of age sex and smoking history Eur Respir J 2009 34 2 380 386 10.1183/09031936.00144208 19196816 Young RP Hopkins RJ Hay BA Epton MJ Mills GD Black PN Gardner HD Sullivan R Gamble GD Lung cancer susceptibility model based on age family history and genetic variants PLoS ONE [Electronic Resource] 2009 4 4 e5302 10.1371/journal.pone.0005302 Young RP Hopkins RJ Hay BA Gamble GD GWAS And Candidate SNPs For COPD And Lung Cancer Combine To Identify Lung Cancer Susceptibility: Validation In A Prospective Study Am J Respir Crit Care Med 2010 181 A3738 Young RP Hopkins RJ Hay BA Epton MJ Mills GD Black PN Gardner HD Sullivan R Gamble GD A gene-based risk score for lung cancer susceptibility in smokers and ex-smokers Postgrad Med J 2009 85 515 524 10.1136/pgmj.2008.077107 19789190 Young RP Hopkins RJ Hay BA Epton MJ Black PN Gamble GD Lung cancer gene associated with COPD: triple whammy or possible confounding effect? Eur Respir J 2008 32 5 1158 1164 10.1183/09031936.00093908 18978134 McBride CM Bepler G Lipkus IM Lyna P Samsa G Albright J Datta S Rimer BK Incorporating genetic susceptibility feedback into a smoking cessation program for African-American smokers with low income Cancer Epidemiol Biomarkers Prev 2002 11 6 521 528 12050092 Sanderson SC Humphries SE Hubbart C Hughes E Jarvis MJ Wardle J Psychological and Behavioural Impact of Genetic Testing Smokers for Lung Cancer Risk: A Phase II Exploratory Trial J Health Psychol 2008 13 481 494 10.1177/1359105308088519 18420756 Wells S de Lusignan S Does screening for loss of lung function help smokers give up? Br J Nurs 2003 12 12 744 750 12829957 Parkes G Greenhalgh T Griffin M Dent R Effect on smoking quit rate of telling patients their lung age: The Step2quit randomised control trial BMJ 2008 336 598 600 10.1136/bmj.39503.582396.25 18326503 Hopkins RJ Young RP Hay B Gamble GD Lung cancer risk testing enhances NRT uptake and quit rates in randomly recruited smokers offered a gene based risk test Am J Respir Crit Care Med 2012 185 A2590 Hopkins RJ Young RP Hay B Gamble GD Gene-based lung cancer risk score triggers smoking cessation in randomly recruited smokers Am J Respir Crit Care Med 2011 183 A5441 West R Shiffman S McLean D Fast Facts: Smoking Cessation (Fast Facts series) “ Paperback 2007 London: Health Press Young RP Hopkins RJ Smith M Hogarth DK Smoking cessation: the potential role of risk assessment tools as motivational triggers [Review] Postgrad Med J 2010 86 1011 26 33 10.1136/pgmj.2009.084947 20065338 Cabebe E Recruitment details: REACT Clinical Trial Lung Cancer Detection Study http://www.elcaminohospital.org/Cancer_Center/Clinical_Trials/Lung_Cancer_Detection_Study McClure JB Ludman EJ Grothaus L Pabiniak C Richards J Impact of spirometry feedback and brief motivational counseling on long-term smoking outcomes: a comparison of smokers with and without lung impairment Patient Education & Counseling 2010 80 2 280 283 10.1016/j.pec.2009.11.002 20434863 Sanderson SK Humphries SE Hubbart C Psychological and behavioural impact of genetic testing smokers for lung cancer risk J Health Psychol 2010 13 4 481 494 18420756 Croghan E NHS Local stop smoking services services delivery and monitoring guidance 2011/12"

Lung_Cancer

"The VATS approach is a safe and feasible treatment in terms of the survival rate for metastatic lung cancer compared with the thoracotomy. The 3-year disease-free survival rate in the VATS group is inferior to that of open thoracotomy. The VATS approach could not completely replace open thoracotomy. The authors have no support or funding to report. Introduction Metastasectomy is considered a beneficial treatment for a patient with metastatic lung cancer whose primary tumor has been well controlled[1].After surgery 5-year survival rates of 30% to 50% could be achieved depending on the underlying primary cancer[2]“[4].In practice the surgical approaches to pulmonary metastases are variable. Video-assisted thoracoscopic surgery (VATS) is an emerging technique; many procedures that had previously required a thoracotomy have been performed with the minimally invasive VATS. VATS has been used for the treatment of pulmonary metastases. The routine use of VATS for the treatment of respectable metastatic lung cancer remains controversial. Critics of the VATS approach have argued that it might not be an equivalent oncological operation[5] [6]. A prospective study by Cerfolio[7]found that 22% of the nodules that could be detected by thoracotomy were missing by VATS.Whether the VATS approach can provide a satisfactory outcome is unknown. An evidenced-based investigation of the VATS approach is needed we undertook this meta-analysis to achieve a more objective assessment of the published studies and to provide a more accurate comparison between VATS and thoracotomy for metastatic lung cancer. Methods Search Strategy Electronic searches were of the MEDLINECochrane Controlled Trial Register (CENTRAL) Ovid MEDILINE PubMed and Embase databases were performed until July 2013.The following MeSH search headings were used: œmetastatic lung cancer œpulmonary metastases œvideo-assisted thoracic surgery œthoracotomy and œcomparative study.We searched the reference lists of relevant studies reviews editorials lettersand meeting s. We used the Science Citation Index to cross-reference for further studies that met our criteria. Study Selection The studies included in this meta-analysis were based on our predetermined criteria as follows: (1) clinical trials that include the full text of the paper published in peer-reviewed English journals or reports of presentations at major thoracic surgery meetings; (2) comparison of the efficacy of VATS to that of thoracotomy in patients with metastatic lung cancer; and (3) similarity in the patients' baseline characteristics. Data extraction and quality assessment Two independent reviewers (Siyuan and Wenya) assessed the quality and the risk of bias of the included trials as follows: (1) the studies that did not include a comparative group with surgery as a form of intervention were excluded; (2) the trials focusing on patients undergoing surgery for primary lung cancer were excluded; (3) the studies on robotic video-assisted thoracic surgery were excluded; (4) if there was an overlap between authors centers or patient cohorts evaluated in the published literature only the most recent report was included; (5) studies published more than 20 years ago were excluded because of the significant technological changes that has occurred. The s were evaluated with the Downs and Black quality assessment method[8]. Discrepancies between the two investigators were resolved by discussion and consensus with a senior investigator. The final results were reviewed by two senior investigators (Lin and Jiang).The disease-free survival was defined as the date of the initial metastasectomy until the date of a recurrence. Statistical and sensitivity analyses The meta-analysis was performed using the RevMan 5.1.0. software package. The odds ratio (OR) or the mean difference with 95% confidence intervals (95% CI) was calculated for the dichotomous outcomes and the continuous outcomes respectively. A P value<0.05 was considered a significant difference in the value between the two groups. We used the I2 statistic to investigate the heterogeneity among the studies.The heterogeneity was explored by X2 and I2; I2<25% and I2>50% reflect a small and large inconsistency respectively. P<0.05 was considered significant. If there were a statistical difference in terms of the heterogeneity (P?0.05) a random-effect model was selected to pool the data. Otherwise a fixed-effect model was used. Taking into account the presence of different sample sizes of the included studies a sensitivity analysis was performed to compare the of 1-year survival rate and the 3-year disease free survival rate between VATS and open thoracotomy. Publication bias A funnel plot was used to explore bias. Asymmetry in the funnel plot of trial size against treatment effect was used to assess the risk of bias. Results Description of the studies Six retrospective cohort studies the met our criteria were included in this meta-analysis. A total of 546 patients were included in the six studies;235 patients were allocated to the VATS group whereas 311 were allocated to the open thoracotomy group to evaluate their survival rate.The search algorithm results of the search strategies and selection criteria are shown in Fig 1. The patient characteristics and evaluation index are shown in . .0085329.g001 Identification of studies for inclusion. .0085329.t001 Study Design Country NO(V/O) Gender (M/F) Mean age (years) Assessment score Nakajima2001[28] OC Japan 45/55 V59/41 O34/21 V55±15 O55±14 13 Mutsaerts2002[29] OC Netherlands 8/12 NR NR 19 Nakas2009[30] OC UK 25/27 V16/9 O 19/8 V69 O66 16 Carballo2009[31] OC USA 36/135 V18/18 O82/53 V58.5 O49 15 Gossot2009[32] OC France 31/29 V21/10 O13/16 V43 O40 18 Chao2012[33] OC Taiwan 90/53 V49/41 O35/18 NR 13 V VATS; O Open thoracotomy; NR Not reported; OC observational cohort. Assessment of Recurrence and Survival Six studies documented the 1-year survival rateand there was no significant heterogeneity among the six studies (x2?=?3.79 P?=?0.58I2?=?0%).A fixed effect model was used.The combined result is shown in Fig 2(OR?=?1.15; 95%CI 0.72“1.84; p?=?0.58). Because of the heterogeneity in sample size the sensitivity analyses were conducted using larger sample sizes. There was no difference between the two surgical methods with an OR of 1.00(95%CI 0.55“1.79) and with heterogeneity(?2?=?3.23P?=?0.07 I2?=?69%). Five studies reported the 3-year survival rate and heterogeneity was identified through the five studies (x2?=?11.32P?=?0.02I2?=?65%); and a random effect model was adopted (OR?=?1.07; 95%CI 0.50“2.27; p?=?0.86) (Fig 3). Three studies compared the 5-year survival rate (OR?=?0.96; 95%CI 0.34“2.71; p?=?0.93) with certain heterogeneity(x2?=?8.86P?=?0.01I2?=?77%) (Fig 4). .0085329.g002 1-year survival rate. Forest plot of the Odds Ratio(OR) of the 1-year survival rate following VATS versus open thoracotomy for metastatic lung cancer.The estimate of the OR of each individual trial corresponds to the middle of the squares and horizontal line gives the 95% CI.On each linethe numbers of events as a fraction of the total number randomized are shown for both treatment groups.For each subgroupthe sum of the statistics along with the summary OR is represented by the middle of the solid diamonds.A test of heterogeneity between the trials within a subgroup is given below the summary statistics. .0085329.g003 3-year survival rate. Forest plot of the Odds Ratio(OR) of the 3-year survival rate following VATS versus open thoracotomy for metastatic lung cancer.The estimate of the OR of each individual trial corresponds to the middle of the squares and horizontal line gives the 95% CI.On each linethe numbers of events as a fraction of the total number randomized are shown for both treatment groups.For each subgroupthe sum of the statistics along with the summary OR is represented by the middle of the solid diamonds.A test of heterogeneity between the trials within a subgroup is given below the summary statistics. .0085329.g004 5-year survival rate. Forest plot of the Odds Ratio(OR) of the 5-year survival rate following VATS versus open thoracotomy for metastatic lung cancer.The estimate of the OR of each individual trial corresponds to the middle of the squares and horizontal line gives the 95% CI.On each linethe numbers of events as a fraction of the total number randomized are shown for both treatment groups.For each subgroupthe sum of the statistics along with the summary OR is represented by the middle of the solid diamonds.A test of heterogeneity between the trials within a subgroup is given below the summary statistics. Four studies compared the 1-year disease free survival rate (OR?=?1.31; 95% CI 0.79“2.19; p?=?0.30)finding no significant heterogeneity among these studies (x2?=?1.82P?=?0.61I2?=?0%) (Fig 5) and four studies compared the 3-year disease free survival rate (OR?=?0.59; 95% CI0.38“0.91; p?=?0.02) finding no significant heterogeneity (x2?=?1.82P?=?0.61I2?=?0%) between the patients who underwent VATS and those who underwent open thoracotomy (Fig 6). Because of the heterogeneity in the sample size sensitivity analyses were conducted using larger sample size studies; however there was no difference between the two surgical methods with an OR of 1.71 (95% CI1.02“2.89) and with heterogeneity (?2?=? 3.07P ?=?0.22 I2?=?35%). There were significant 3-year disease free survival rate benefits with open thoracotomy. We attempted to evaluate the 5-year disease free survival rate.Only two studies reported these ratesand the published data were not sufficient for the combined analysis. .0085329.g005 Figure 5 1-year disease-free survival rate. Forest plot of the Odds Ratio(OR) of the 1-year disease free survival rate following VATS versus open thoracotomy for metastatic lung cancer.The estimate of the OR of each individual trial corresponds to the middle of the squares and horizontal line gives the 95% CI.On each linethe numbers of events as a fraction of the total number randomized are shown for both treatment groups.For each subgroupthe sum of the statistics along with the summary OR is represented by the middle of the solid diamonds.A test of heterogeneity between the trials within a subgroup is given below the summary statistics. .0085329.g006 Figure 6 3-year disease-free survival rate. Forest plot of the Odds Ratio(OR) of the 3-year survival rate following VATS versus open thoracotomy for metastatic lung cancer.The estimate of the OR of each individual trial corresponds to the middle of the squares and horizontal line gives the 95% CI.On each linethe numbers of events as a fraction of the total number randomized are shown for both treatment groups.For each subgroupthe sum of the statistics along with the summary OR is represented by the middle of the solid diamonds.A test of heterogeneity between the trials within a subgroup is given below the summary statistics. Publication bias Publication bias might exist when nonsignificant findings remain unpublishedthus artificially inflating the apparent magnitude of an effect.The funnel plots of the study are shown in Figure 7.The funnel plots of the 1-year survival rate following VATS and thoracotomy for the treatment of metastatic lung cancer showed asymmetry which suggested that there was some publication bias. .0085329.g007 Figure 7 Funnel plot of the outcome of 1-year survival rate. Discussion Many tumors can metastasize to the lungand colorectal and breast tumors are the most common primary tumors[9].Pulmonary resection has been shown to be beneficial for patients with resectable and isolated pulmonary metastases[10]. Traditional open thoracotomy and VATS are two principally different surgical methods for pulmonary metastasectomy.The selection of an approach depends more on the theoretical knowledge and personal experience of the surgeon than on the evidence. Over the past two decades several studies have demonstrated the benefits of VATS that included less postoperative pain shorter hospital stays a smaller degree of immunosuppression and enhanced recovery and the ability to tolerate adjuvant therapy[11]“[13]. Whether the long-term advantages are comparable to those of open thoracotomy is not well documented. The major deficiency of the VATS approach is that nodules might be undetected by VATS that might be detected by manual palpation during thoracotomy; such missing nodules are not imaged on a preoperative CT scan. The VATS approach has long been controversial because VATS does not consistently detect all the metastases and it is recognized that complete resection remains a major determining factor of survival [14].The detection rate of HRCT for pulmonary metastases is 78“84%[15]“[17].Kayton[18]found that 35% of the pathologically verified metastases were missed by CT. In the International Registry of Lung Metastases study of 5206 patients the 5-year survival rate was 36% for complete resection compared with 13% incomplete resectoin[19]. It is not certain whether the nodule imaged on a CT scan and resected by VATS is the correct one [14]. Those who disagree with the use of VATS hypothesize that VATS-related recurrence is commonly observed including port-site recurrence and resection stump recurrence[20]. Johnstone reported 23 cases of port-site chest wall recurrence related to VATS[21]. They hypothesized that the thoracoscopic approach should only be used in patients with a solitary lesion and when resection is requried for diagnostic purposes. The surgeons who favor the VATS approach advocate that VATS minimizes pain and trauma to the patients and that the VATS group might have an improved tolerance of chemotherapy which would likely ensure delivery of planned post-resection adjuvant therapy without a reduction in dosage or delay. The standard surgical procedure for pulmonary metastases is wedge resection that usually does not require manipulation of the pulmonary hilum which is appropriate for the VATS approach.They hypothesiezd that a lesion overlooked by CT but detected by palpation might not result in a survival gain[22] [23] and may be partially compensated for by carefully follow-up.Flores[24] hypothesized that the VATS group might demonstrate a great number of metachronous tumors over time;however the metachronous lesions in each group was similar. Our work suggests that thoracoscopic resection of metastatic lung cancer is a safe and curative procedure with 13 and 5-year survival rates comparable to those of thoracotomy. Patients with metastatic lung cancer are likely to relapse in the lung and after lung metastasectomy by VATS patients might benefit from a second metastasectomy. We hypothesize that earlier chemotherapy and radiation are essential to maximizing survival. Our study might be subject to pretreatment selection bias because most of the patients selected for open thoracotomy had multiple lesions and high risk and were not suitable for treatment with VATS.The missing lesions perhaps skewed the data more toward VATS as an equivalent procedure. We were also interested in the recurrence of cancerand the disease-free survival rates were evaluated. This study demonstrates a similar 1-year disease-free survival rate;however the 3-year disease-free survival rate is inferior for three reasons. First unrelated cancer deaths were included in our analysis of the 13 and 5-year overall survival which might account for VATS having a comparable overall survival rate but an inferior disease-free survival rate. Secondthe patients in the VATS group might have lesions that are missed and there are more likely to relapse in the lung leading to the inferior 3-year disease-free survival rate.Third some of our included studies were in the early period of VATS development when the technology was immature and some of the complications can now be prevented with more experience. Schaeff[25] reported 23 cases of port-site recurrence associated with VATS that occurred before 1998.The number of cases studied was small and the observation period was limitied. Spiral computed tomography has a far higher detection rate today than it did 20 years ago;so small lesions can be accurately localized before surgery[26] which ensures the success of VATS. With advances in imaging technology palpaiton during open thoracotomy is becoming less important.The latest VATS technology has a high-definition resolution and the flexible-tip thoracoscope enables complete inspection of the pleural cavity.These advancements ensure that VATS is an ideal method for patients with a solitary and relatively small peripheral lesions.Tamas[27] hypothesizes that palpation is necessary in a therapeutic metastasectomy as opposed to a diagnostic procedure.Whether patients with multiple lesions should be treated with open thoracotomy or VATS is controversial. This study is the first meta-analysis of the oncological outcome of thoracoscopic surgery for the treatment of metastatic lung cancer. In our work we observed that VATS might be a promising treatment for metastatic lung cancer. No randomized trials existing to guide doctors in the field of metastatic lung cancer currently. A prospective randomized study of the different surgical strategies is needed. Limitation No randomized controlled trials existing to comparing VATS with thoracotomy have been conducted. Heterogeneity was observed between the sample size and the years covered. Most studies are limited to small observational studies and single-institution case series. For these reasonsthere are only a total of 546 patients were included in the two groups for a study period spans more than a decade. Two of the studies comprise almost 65% of the patients and one study has only 20 patients; there are potential sources of bias in our work.Additional randomized controlled trials in the studies we accessed would have increased the strength of our results.There is a bias for the English language. Conclusion In our meta-analysis we found that for patients with metastatic lung cancer comparing VATS with thoracotomy showed almost equivalent survival rates. The VATS can not replace open thoracotomy completely. Further study is neededand a large multicenter randomized trial comparing VATS and thoracotomy would be ideal. Supporting Information Checklist S1 PRISMA Checklist. (DOC) Click here for additional data file. References 1 RuschVW (2010) Pulmonary metastasectomy: a moving target. J Thorac Oncol5: S130“13120502246 2 CassonAG PutnamJB NatarajanG JohnstonDA MountainC et al (1992) Five-year survival after pulmonary metastasectomy for adult soft tissue sarcoma. Cancer69: 662“6681730117 3 van HalterenHK van GeelAN HartAA ZoetmulderFA (1995) Pulmonary resection for metastases of colorectal origin. Chest107: 1526“15317781341 4 KandiolerD KromerE TuchlerH EndA MullerMR et al (1998) Long-term results after repeated surgical removal of pulmonary metastases. Ann Thorac Surg65: 909“9129564899 5 McCormackPM BainsMS BeggCB BurtME DowneyRJ et al (1996) Role of video-assisted thoracic surgery in the treatment of pulmonary metastases: results of a prospective trial. Ann Thorac Surg62: 213“216 discussion 216“217.8678645 6 SaishoS NakataM SawadaS YamashitaM SaekiH et al (2009) Evaluation of video-assisted thoracoscopic surgery for pulmonary metastases: 11-years of experience. Surg Endosc23: 55“6118437482 7 CerfolioRJ BryantAS McCartyTP MinnichDJ (2011) A prospective study to determine the incidence of non-imaged malignant pulmonary nodules in patients who undergo metastasectomy by thoracotomy with lung palpation. Ann Thorac Surg91: 1696“1700 discussion 1700“1691.21619965 8 DownsSH BlackN (1998) The feasibility of creating a checklist for the assessment of the methodological quality both of randomised and non-randomised studies of health care interventions. J Epidemiol Community Health52: 377“3849764259 9 KondoH OkumuraT OhdeY NakagawaK (2005) Surgical treatment for metastatic malignancies. Pulmonary metastasis: indications and outcomes. Int J Clin Oncol10: 81“8515864692 10 PorterGA CantorSB WalshGL RuschVW LeungDH et al (2004) Cost-effectiveness of pulmonary resection and systemic chemotherapy in the management of metastatic soft tissue sarcoma: a combined analysis from the University of Texas M. D. Anderson and Memorial Sloan-Kettering Cancer Centers. J Thorac Cardiovasc Surg127: 1366“137215115994 11 PetersenRP PhamD BurfeindWR HanishSI TolozaEM et al (2007) Thoracoscopic lobectomy facilitates the delivery of chemotherapy after resection for lung cancer. Ann Thorac Surg83: 1245“1249 discussion 1250.17383320 12 PaulS AltorkiNK ShengS LeePC HarpoleDH et al (2010) Thoracoscopic lobectomy is associated with lower morbidity than open lobectomy: a propensity-matched analysis from the STS database. J Thorac Cardiovasc Surg139: 366“37820106398 13 WhitsonBA GrothSS DuvalSJ SwansonSJ MaddausMA (2008) Surgery for early-stage non-small cell lung cancer: a systematic review of the video-assisted thoracoscopic surgery versus thoracotomy approaches to lobectomy. Ann Thorac Surg86: 2008“2016 discussion 2016“2008.19022040 14 EckardtJ LichtPB (2012) Thoracoscopic versus open pulmonary metastasectomy: a prospective sequentially controlled study. Chest142: 1598“160222677347 15 AmbrogiV PaciM PompeoE MineoTC (2000) Transxiphoid video-assisted pulmonary metastasectomy: relevance of helical computed tomography occult lesions. Ann Thorac Surg70: 1847“185211156082 16 MargaritoraS PorziellaV D'AndrilliA CesarioA GalettaD et al (2002) Pulmonary metastases: can accurate radiological evaluation avoid thoracotomic approach? Eur J Cardiothorac Surg21: 1111“111412048094 17 ParsonsAM DetterbeckFC ParkerLA (2004) Accuracy of helical CT in the detection of pulmonary metastases: is intraoperative palpation still necessary? Ann Thorac Surg78: 1910“1916 discussion 1916“1918.15561000 18 KaytonML HuvosAG CasherJ AbramsonSJ RosenNS et al (2006) Computed tomographic scan of the chest underestimates the number of metastatic lesions in osteosarcoma. J Pediatr Surg41: 200“206 discussion 200“206.16410133 19 Long-term results of lung metastasectomy: prognostic analyses based on 5206 cases. The International Registry of Lung Metastases. J Thorac Cardiovasc Surg113: 37“499011700 20 MutsaertsEL ZoetmulderFA RutgersEJ (2001) Port site metastasis as a complication of thoracoscopic metastatectomy. Eur J Surg Oncol27: 327“32811373113 21 JohnstonePA RohdeDC SwartzSE FetterJE WexnerSD (1996) Port site recurrences after laparoscopic and thoracoscopic procedures in malignancy. J Clin Oncol14: 1950“19568656265 22 TreasureT (2007) Pulmonary metastasectomy: a common practice based on weak evidence. Ann R Coll Surg Engl89: 744“74817999813 23 RothJA PassHI WesleyMN WhiteD PutnamJB et al (1986) Comparison of median sternotomy and thoracotomy for resection of pulmonary metastases in patients with adult soft-tissue sarcomas. Ann Thorac Surg42: 134“1383741009 24 FloresRM IhekweazuUN RizkN DycocoJ BainsMS et al (2011) Patterns of recurrence and incidence of second primary tumors after lobectomy by means of video-assisted thoracoscopic surgery (VATS) versus thoracotomy for lung cancer. J Thorac Cardiovasc Surg141: 59“6421055770 25 SchaeffB PaolucciV ThomopoulosJ (1998) Port site recurrences after laparoscopic surgery. A review. Dig Surg15: 124“1349845574 26 ChenYR YeowKM LeeJY SuIH ChuSY et al (2007) CT-guided hook wire localization of subpleural lung lesions for video-assisted thoracoscopic surgery (VATS). J Formos Med Assoc106: 911“91818063512 27 MolnarTF GebitekinC TurnaA (2010) What are the considerations in the surgical approach in pulmonary metastasectomy? J Thorac Oncol5: S140“14420502249 28 NakajimaJ TakamotoS TanakaM TakeuchiE MurakawaT et al (2001) Thoracoscopic surgery and conventional open thoracotomy in metastatic lung cancer. Surg Endosc15: 849“85311443456 29 MutsaertsEL ZoetmulderFA MeijerS BaasP HartAA et al (2002) Long term survival of thoracoscopic metastasectomy vs metastasectomy by thoracotomy in patients with a solitary pulmonary lesion. Eur J Surg Oncol28: 864“86812477479 30 NakasA KlimatsidasMN EntwisleJ Martin-UcarAE WallerDA (2009) Video-assisted versus open pulmonary metastasectomy: the surgeon's finger or the radiologist's eye? Eur J Cardiothorac Surg36: 469“47419464921 31 CarballoM MaishMS JaroszewskiDE HolmesCE (2009) Video-assisted thoracic surgery (VATS) as a safe alternative for the resection of pulmonary metastases: a retrospective cohort study. J Cardiothorac Surg4: 1319239710 32 GossotD RaduC GirardP Le CesneA BonvalotS et al (2009) Resection of pulmonary metastases from sarcoma: can some patients benefit from a less invasive approach? Ann Thorac Surg87: 238“24319101304 33 ChaoYK ChangHC WuYC LiuYH HsiehMJ et al (2012) Management of lung metastases from colorectal cancer: video-assisted thoracoscopic surgery versus thoracotomy”a case-matched study. Thorac Cardiovasc Surg60: 398“40422228090 101150042 30118 Mol Cancer Res Mol. Cancer Res. Molecular cancer research : MCR 1541-7786 1557-3125 24202705 3946989 10.1158/1541-7786.MCR-13-0300 NIHMS538386 œNEDD9 Depletion Leads to MMP14 Inactivation by TIMP2 and Prevents Invasion and Metastasis. McLaughlin Sarah L. 5 * Ice Ryan J. 5 * Rajulapati Anuradha 5 Kozyulina Polina Y. 1 Livengood Ryan H. 4 Kozyreva Varvara K. 5 Loskutov Yuriy V. 5 Culp Mark V. 3 Weed Scott A. 2 5 Ivanov Alexey V. 1 5 Pugacheva Elena N. 1 5 # 1Department of Biochemistry West Virginia University School of Medicine Morgantown WV 26506 2Department of Neurobiology and Anatomy West Virginia University School of Medicine Morgantown WV 26506 3Department of Statistics West Virginia University School of Medicine Morgantown WV 26506 4Department of Pathology West Virginia University School of Medicine Morgantown WV 26506 5Mary Babb Randolph Cancer Center West Virginia University School of Medicine Morgantown WV 26506 #Corresponding author: Elena N. Pugacheva Mailing address: Department of Biochemistry and Mary Babb Randolph Cancer Center PO Box 9142 1 Medical Center Drive West Virginia University School of Medicine Morgantown WV 26506. Phone: (304) 293-5295; Fax: (304) 293-4667; epugacheva@hsc.wvu.edu S.L. McLaughlin* and R. J. Ice* contributed equally to this work. 17 12 2013 07 11 2013 1 2014 01 1 2015 12 1 69 81 The scaffolding protein NEDD9 is an established pro-metastatic marker in several cancers. Nevertheless the molecular mechanisms of NEDD9 driven metastasis in cancers remain ill defined. Here using a comprehensive breast cancer (BCa) tissue microarray it was show that increased levels of NEDD9 protein significantly correlated with the transition from carcinoma in situ to invasive carcinoma. Similarly it was shown that NEDD9 overexpression is a hallmark of highly invasive BCa cells. Moreover NEDD9 expression is crucial for the protease-dependent mesenchymal invasion of cancer cells at the primary site but not at the metastatic site. Depletion of NEDD9 is sufficient to suppress invasion of tumor cells in vitro and in vivo leading to decreased circulating tumor cells (CTCs) and lung metastases in xenograft models. Mechanistically NEDD9 localized to invasive pseudopods and was required for local matrix degradation. Depletion of NEDD9 impaired invasion of cancer cells through inactivation of membrane-bound matrix metalloproteinase MMP14 by excess TIMP2 on the cell surface. Inactivation of MMP14 is accompanied by reduced collagenolytic activity of soluble metalloproteinases MMP2 and MMP9. Re-expression of NEDD9 is sufficient to restore the activity of MMP14 and the invasive properties of BCa cells in vitro and in vivo. Collectively these findings uncover critical steps in NEDD9-dependent invasion of BCa cells."

Lung_Cancer

"316 chips were used for sequencing on the Ion Torrent PGM for 65 cycles and the samples were barcoded. Ion PGM 200 Sequencing Kit was used for sequencing reactions as per the recommended protocol (Part # 4474004 Rev. B). The dataset has been deposited to the NIH Sequence Read Archive and the accession number is SRP028756 (http://www.ncbi.nlm.nih.gov/Traces/sra/?study=SRP028756). Variant calling Data from the PGM runs were processed initially using the Ion Torrent platform-specific pipeline software Torrent Suite to generate sequence reads trim adapter sequences filter and remove poor signal-profile reads. Initial variant calling from the Ion AmpliSeq sequencing data was generated using Torrent Suite Software v3.0 with a plug-in œvariant caller program. In order to eliminate erroneous base calling three filtering steps were used to generate final variant calling. The first filter was set at an average total coverage depth >100 each variant coverage >20 a variant frequency of each sample >5 and P-value<0.01. In order to eliminate error base calling several filtering steps were used to generate final variant calling (Fig. S1.). The first filter was set at an average depth of total coverage of >100 an each variant coverage of >20 a variant frequency of each sample >5 and P-value <0.01. The second filter was employed by visually examining mutations using Integrative Genomics Viewer (IGV) software (http//www.broadinstitute./igv) or Samtools software SAMtools software (http://samtools.sourcefe.net) as well as by filtering out possible strand-specific errors ie. a mutation was only detected in either œ+ or œ- strand but not in both strands of DNA. The third filtering step was set as variants within 727 hotspots according to the manufacturer' instructions. The last filter step was eliminate variants in amplicon AMPL339432 (PIK3CA exon13 chr3:178938822-178938906) which is not unique matched in human genome. From our sequencing runs using the Ion Ampliseq Cancer Panel false deletion data were generated from the JAK2 gene locus and thus the sequencing data from this locus were excluded from further analysis. Somatic mutations Detected mutations were compared to variants in the 1000 Genomes Project [35] and 6500 exomes of the National Heart Lung and Blood Institute Exome Sequencing Project [36] to distinguish somatic mutations and germline mutations. Bioinformatical and experimental validation applied We used the COSMIC[37] (version 64) MyCancerGenome database (http://www.mycancergenome./) and some publications to assess reappearance mutations in lung cancer (Table S1). Additionally some detected missense mutations were confirmed by Sanger's sequencing (Fig. S2). Statistical analysis We select reappearance somatic missense/in-del mutations of lung cancer to do the statistical analysis. Supporting Information Figure S1 Filter process of variants. Note: (a) Strand-biased variants were eliminated using Integrative Genomics Viewer (IGV) software (http//www.broadinstitute./igv); (b) Variants in AMPL339432 should be eliminated because this amplicon is not unique matched to PIK3CA in human genome; (c) All of our statistical analysis was based on the data in blue box. (DOCX) Click here for additional data file. Figure S2 Sanger validations of 15 variants. (DOC) Click here for additional data file. Table S1 Frequencies of point mutations insertion and deletion mutations in 737 loci of 76 human lung cancers. (DOCX) Click here for additional data file. We would like to thank Rong Shi at the Wu Jieping Foundation Dr. Haibo Wang Zhi Yu Ying Li and other members of San Valley Biotechnology Inc. Beijing for their assistance in sample and data collection. We would also like to thank the staff at the Beijing Military Hospital for their generous support for DNA sequencing and data collection. References 1 FerlayJ ShinHR BrayF FormanD MathersC et al (2010) Estimates of worldwide burden of cancer in 2008: GLOBOCAN 2008. Int J Cancer127: 2893“291721351269 2 BrayF RenJS MasuyerE FerlayJ (2013) Global estimates of cancer prevalence for 27 sites in the adult population in 2008. Int J Cancer132: 1133“114522752881 3 HerbstRS HeymachJV LippmanSM (2008) Lung Cancer. New England Journal of Medicine359: 1367“138018815398 4 HechtSS (2003) Tobacco carcinogens their biomarkers and tobacco-induced cancer. Nat Rev Cancer3: 733“74414570033 5 ThunMJ HannanLM Adams-CampbellLL BoffettaP BuringJE et al (2008) Lung Cancer Occurrence in Never-Smokers: An Analysis of 13 Cohorts and 22 Cancer Registry Studies. PLoS Med5: e18518788891 6 SunS SchillerJH GazdarAF (2007) Lung cancer in never smokers"

Lung_Cancer

"Adenocarcinoma including cases with bronchioloalveolar carcinoma. Expression of miR-182 and correlations miR-182 was homogenously expressed mainly in the cytoplasm of tumor cells. There was also some unspecific nuclear staining (). The scoring was based on cytoplasmic staining. There was no staining of stromal cells except for weak nuclear staining of some fibroblasts. We tested correlations between miR-182 and angiogenic and hypoxia molecular markers. We found significant correlations between miR-182 and FGF2 (r?=??0.147; P?=?0.010) HIF2? (r?=?0.115; P?=?0.047) and MMP-7 (r?=?0.172; P?=?0.003). Univariate analysis As shown in the clinicopathological variables performance status (P?=?0.016) histology (P?=?0.028) tumor differentiation (P?<?0.001) surgical procedure (P?=?0.007) pathological stage (P?<?0.001) tumor status (P?<?0.001) nodal status (P?<?0.001) and vascular infiltration (P?=?0.001) were significant prognostic indicators for DSS. The results from the univariate analyses on miR-182 are presented in and Figures 2 and 3. In the whole cohort there was a tendency towards a better prognosis for those with tumors overexpressing miR-182 (P?=?0.062 ). In subgroup analyses patients with stage II disease had a significantly improved prognosis if they overexpressed miR-182 (P?=?0.003 E). In the histological subgroup SCC high tumor cell miR-182 expression was associated with superior prognosis when compared to low expression (P?=?0.042 A) while for large cell carcinomas the trend was opposite (C). miR-182 in tumor cells and stroma as predictors for disease-specific survival in NSCLC patients (univariate analysis; log-rank test) and results of Cox regression analysis summarizing significant independent prognostic factors Characteristics Pts (n) Pts (%) Median survival (months) 5-year survival (%) Univariate (P) Multi-variate (P) HR (95% CI) Total (n?=?335) 0.062 0.098 0.73 ??Low 190 57 98 55 (0.50-1.06) ??High 115 34 NR 62 ??Missing 30 9 Pathological stage Stage I (n?=?143) 0.97 NE NE ??Low 87 61 190 73 ??High 56 39 NR 73 Stage II (n?=?127) 0.003 0.020 0.50 ??Low 80 63 33 39 0.28-0.90 ??High 47 37 NR 63 Stage III (n?=?35) 0.69 NE NE ??Low 23 66 23 39 ??High 12 34 15 17 Histology ??SCC (n?=?172) 0.042 0.048 0.57 ??Low 104 60 NR 58 0.33-0.99 ??High 68 40 NR 74 AC (n?=?106) 0.316 NE NE ??Low 69 65 47 45 ??High 37 35 57 50 LCC (n?=?27) 0.285 NE NE ??Low 17 63 NR 80 ??High 10 37 58 39 Statistically significant results in bold font. Abbreviations:NR not reached PS performance status SCC squamous cell carcinoma AC adenocarcinoma LCC large-cell carcinoma NE not entered due to insignificance. Adenocarcinoma including cases with bronchioloalveolar carcinoma. Disease-specific survival curves according to tumor cell expression of miR-182 in the whole cohort of patients. Disease-specific survival curves according to tumor cell expression of A) miR-182 in SCC B) miR-182 in AC C) miR-182 in LCC D) miR-182 in stage I patients E) miR-182 in stage II patients F) miR-182 in stage III patients. Multivariate analysis In the total cohort performance status (P?=?0.008) histology (P?=?0.001) tumor differentiation (P?=?0.007) tumor status (P?=?0.007) nodal status (P?=?0.022) and vascular infiltration (P?=?0.004) all were independent prognostic factors. Results of the multivariate analysis for miR-182 expression are presented in . Examining the total material high miR-182 expression tended towards an independent association with a better prognosis (HR 0.73 CI 95% 0.50-1.06 P?=?0.098). Among stage II patients however high tumor cell expression of miR-182 was an independent positive prognostic factor (HR 0.50 CI 95% 0.28-0.90 P?=?0.020). Also in SCC patients with a high miR-182 expression had an independent favorable outcome (HR 0.57 CI 95% 0.33-0.99 P?=?0.048). Co-expression of miR-182 with FGF2 and MMP-7 Among markers examined for correlations with miR-182 FGF2 and MMP-7 showed the strongest correlations. We assessed the co-expression combinations between miR-182 and FGF2 and MMP-7 respectively. The co-expression of low miR-182/high FGF2 was associated with poor survival (P?=?0.017) as shown in A. The combination showed an independently significant adverse prognosis compared to high miR-182/low FGF2 (HR 1.92 P?=?0.015 ). Patients expressing high miR-182/high MMP-7 had a better survival than other combinations (P?=?0.036 B). In the multivariate analyses high miR-182/high MMP-7 showed an independently better prognosis than low miR-182/low MMP-7 (HR 0.49 P?=?0.015 ). In the SCC subgroup we found an even bigger difference between these groups both in univariate and multivariate analyses (C ). Disease-specific survival curves according to tumor cell co-expression of miR-182 and A) FGF2 in the whole cohort of patients B) MMP-7 in the whole cohort of patients C) MMP-7 in SCC and D) MMP-7 in AC. Results of Cox regression analysis summarizing co-expressions of miR-182 with FGF2 and MMP-7 respectively Hazard ratio 95% CI P Co-expression of miR-182/FGF2 0.021 ??High miR-182/low FGF2 1.00 ??High miR-182/high FGF2 and low miR-182/low FGF2 1.26 0.74-2.13 0.39 ??Low miR-182/high FGF2 1.92 1.14-3.24 0.015 Co-expression of miR-182/MMP-7 0.032 ??Low miR-182/low MMP-7 1.00 ??Low miR-182/high MMP-7 and high miR-182/low MMP-7 0.71 0.48-1.05 0.086 ??High miR-182/high MMP-7 0.49 0.27-0.87 0.015 Co-expression of miR-182/MMP-7 squamous cell carcinoma 0.040 ??Low miR-182/low MMP-7 1.00"

Lung_Cancer

" Successful examples of this include the co-development (and co-approval) of the BRAF inhibitor vemurafenib and its companion diagnostic BRAF V600E mutation assay for BRAF-mutant metastatic melanoma[1] and the ALK inhibitor crizotinib and its companion diagnostic ALK fusion gene test in advanced ALK-fusion positive non-small cell lung cancer (NSCLC) patients.[2] [3] [4] However in some cases predictive biomarkers for a targeted therapy are not recognized until after the drug is first approved. As an example the anti-EGFR antibody cetuximab was first approved in the US for the treatment of metastatic colorectal cancer in 2004. Numerous retrospective and prospective trials subsequently revealed that tumors harboring KRAS mutations were very unlikely to respond to cetuximab. In July 2009 FDA required labeling changes for cetuximab and another anti-EGFR antibody panitumumab requiring that the indications and usage state there was no treatment benefit with the drugs for patients whose tumors had KRAS mutations in codon 12 or 13 at a time when there were no FDA-approved diagnostic assays for KRAS mutations.[5] Only later in July 2012 did a KRAS mutation assay receive FDA approval based on the results of a prospective randomized trial highlighting the challenges of retrospectively validating a companion diagnostic assay after the pivotal drug trials have been completed.[6] The anti-EGFR TKI erlotinib was initially approved for all patients with advanced NSCLC who had progressed on first-line chemotherapy. A number of subsequent studies determined that patients with EGFR-mutant NSCLC had a high likelihood of responding to these TKI leading to trials in the first-line setting for EGFR-mutant cancer.[7] [8] [9] [10] [11] [12] [13] Four prospective randomized clinical trials studied in Asian populations demonstrated that erlotinib and gefitinib resulted in improved progression-free survival compared to chemotherapy for first line therapy in NSCLC patients with EGFR mutations.[7] [8] [9] [13] Other clinical studies in mixed ethnicity cohorts have concluded with similar results.[10][12] The EURTAC trial was a randomized phase 3 trial to assess the safety and efficacy of erlotinib compared with standard platinum-based chemotherapy for first-line treatment of a patient population with advanced EGFR-mutation detected NSCLC in a largely Caucasian population of European patients. Erlotinib-treated patients experienced significant improvements in median PFS (9.7 months vs. 5.2 months) compared to chemotherapy. Patients on the erlotinib arm also had a considerably higher percentage of responses (58% vs. 15%) in the intent-to-treat population.[11] This trial has been submitted for first line indication of erlotinib in EGFR mutated NSCLC patients. The majority of activating EGFR mutations are located in exons 19 (45%) and 21 (40“45%).[14] [15] [16] [17] [18] [19] [20] Guidelines from anizations such as ASCO CAP/AMP and NCCN recommend the use of anti-EGFR TKIs as first-line therapy in patients with EGFR-mutant advanced NSCLC based on the results of these pivotal clinical trials. [21] [22] [23] Recent recommendations by CAP/IASLC/AMP advise the identification of EGFR mutations present at >1% of which exon 19 deletions and an exon 21 mutation (L858R) account for greater than 90% of all mutations.[24] None of the guidelines specify the testing method to be used however the cobas EGFR Mutation test is CE-IVD approved and is recently FDA approved.[25] Here we present the retrospective analysis of a clinical validation study of the EGFR PCR test on a subset of lung cancer specimens from patients screened for the EURTAC trial. The EGFR PCR test demonstrated improved sample workflow relative to the LDTs used in the EURTAC trial enabling EGFR mutation screening in a single assay with a one-day turn-around time. The EGFR PCR test showed superior sensitivity and specificity compared with conventional Sanger sequencing. Methods The major study objectives were 1) to correlate the clinical outcomes (PFS BORR) from the subgroup of available samples tested by the EGFR PCR test to the results from the entire EURTAC population and 2) to compare the analytic performance of the EGFR PCR test to that of the original LDT and Sanger sequencing using massively parallel pyrosequencing (MPP) to resolve discrepancies observed between the other 3 testing methods. In the EURTAC trial1044 patients from hospitals in France Italy and Spain were screened using the LDT. For this study all samples were retrospectively analyzed under IRB approval from Copernicus IRB (00001313). Site specific IRB approval from each clinical site and written consent from all patients was obtained prior to the study conduct phase of NCT00446225.[11] [26] In 487 cases residual specimens were available for retesting with the EGFR PCR test (). A single 5 µm section with at least 10% tumor content from each of the 487 specimens was used for the EGFR PCR test. Genomic DNA from existing eluate or extracted from additional sections was tested on Sanger sequencing and MPP. lists the demographics of the patients screened for the EURTAC trial by the LDT sub-categorized by patients tested or not tested by the EGFR PCR test. Patients enrolled in the EURTAC trial were selected using a laboratory-developed test validated by the Laboratory of Oncology (ICO-Hospital Germans Trias i Pujol Badalona Spain) consisting of three methodologies.[26] In this study a single PCR-based assay for detecting EGFR mutations was used. Details of the analytical performance of this assay have been described previously.[27] .0089518.g001 Flow of samples through the study. E1 samples: tumor block not available for analysis. E2 samples: tumor material insufficient for analysis. LDT ?=? laboratory-developed test. .0089518.t001 Demographics of the patient cohort screened for EURTAC trial. SLCG LDT MD SLCG LDT MND EGFR PCR tested EGFR PCRnot tested EGFR PCR tested EGFR PCR not tested Total 172 53 303 489 Age (years) mean ± SD 64.1±10.4 62.9±10.4 61.7±10.6 61.7±10.6 Sex n (%) Male 41 (23.8) 14 (26.4) 179 (59.1) 281 (57.5) Female 131 (76.2) 39 (73.6) 124 (40.9) 208 (42.5) Race/ethnicity n (%) Caucasian 168 (97.7) 52 (98.1) 296 (97.7) 481 (98.4) Other* 4 (2.3) 1 (1.9) 7 (2.3) 8 (1.6) Smoking status n (%) Never smoked 124 (72.1) 31 (58.5) 74 (24.4) 133 (27.2) Past/currentsmoker 47 (27.3) 22 (41.5) 219 (72.3) 339 (69.3) Unknown 1 (0.6) 0 (0.0) 10 (3.3) 17 (3.5) Stage IIIB 13 (7.6) 2 (3.8) 17 (5.6) 40 (8.2) Stage IV 157 (91.3) 50 (94.3) 277 (91.4) 432 (88.3) Other* 2 (1.2) 1 (1.9) 9 (3.0) 17 (3.5) Histology n (%) Adenocarcinoma 156 (90.7) 47 (88.7) 266 (87.8) 407 (83.2) BronchioalveolarCarcinoma 1 (0.6) 2 (3.8) 5 (1.7) 16 (3.3) Other* 15 (8.7) 4 (7.5) 32 (10.6) 66 (13.5) *Other includes subjects with no information available. LDT ?=? laboratory-developed test; MD ?=? mutation detected; MND ?=? mutation not detected. SLCG inconclusive (n?=?27) data not shown. Statistical considerations Mutation Detected (MD) was defined as the presence of either an exon 19 deletion or L858R mutation. Mutation Not Detected (MND) was defined as the absence of both exon 19 deletions and the L858R mutation. SAS/STAT® software was used for all data analysis. Clinical outcome study statistics Kaplan-Meier survival curves were used to assess the PFS by treatment method (chemotherapy or erlotinib) among patients who were enrolled in the EURTAC trial and screened with the LDT as well as the subset of patients who were determined to be mutation-positive by the EGFR PCR test. Nonparametric log-rank test was performed to assess PFS between patients who were randomized to chemotherapy or erlotinib. The hazard ratio (chemotherapy vs. erlotinib) relative to PFS was also calculated. Best overall response was the best response recorded from the start of treatment until disease progression and BORR (Best overall response rate) was summarized with 95% confidence limits according to Pearson-Clopper methods based on investigators assessment for each treatment arm. Analytical performance statistics For analytical performance an agreement analysis was performed between the EGFR PCR test result and the LDT test. Mutation detection of exon 19 deletions and L858R mutations were analyzed in aggregate. Separately the EGFR PCR test was also compared to Sanger sequencing and MPP by a CLIA-certified laboratory. For the agreement analyses the positive percent agreement (PPA) negative percent agreement (NPA) and overall percent agreement (OPA) with their corresponding 95% confidence intervals (CIs) were calculated. In addition 3-way analyses using MPP as a second reference method was performed to resolve the discrepancy results. Mutation testing methods EGFR PCR Test The EGFR PCR test (cobas EGFR Mutation Test Roche Molecular Systems Inc Branchburg NJ USA) is a CE-IVD marked multiplex allele-specific PCR-based assay designed to detect 41 mutations in exons 181920 and 21 in FFPET specimens of human NSCLC.[28] DNA is isolated using the cobas DNA Sample Preparation Kit (Roche Molecular Systems Branchburg NJ). [29] A minimum of 150 ng of genomic DNA is required for PCR amplification which can typically be isolated from a single 5 µm FFPET section. The EGFR PCR test software version used in this study was designed to detect 29 deletions in exon 19 and 2 L858R variants in exon 21. Macrodissection is only recommended if tumor content is less than 10%; laser capture microdissection is not required. The EGFR PCR test was performed per manufacturer's package insert and results were automatically analyzed and reported. The limit of detection has been validated to 5% mutant alleles. The workflow from DNA isolation to results reporting can be performed in one 8 hour period.[27] LDT Patients in the EURTAC study were screened using a combination of methods developed by Laboratory of Oncology ICO-Hospital Germans Trias i Pujol Barcelona Spain.[11] In short EGFR activating mutations in exons 19 and 21 were initially identified by Sanger sequencing and confirmed by fragment length analysis for exon 19 deletions (FAM-labelled primer in an ABI prism 3130 DNA analyser (Applied Biosystems Foster City CA USA) and by Taqman assay for exon 21 (L858R) mutation. All tumor specimens were from the original biopsy taken prior to any treatment and before randomization. Testing was performed on ? 2mm2 of tissue obtained from one to three slides of 4-micron tissue sections which were subjected to laser capture microdissection to enrich for the presence of tumor cells. DNA was extracted using a standard laboratory protocol and tested at a single site in Spain in Laboratory of Oncology for EGFR activating mutations in exon 19 and 21 using a previously described method. The average turnaround time was approximately 5 days.[26] Bi-directional Sanger sequencing All samples tested by the EGFR PCR test were also tested by Sanger sequencing using DNA from FFPET specimens prepared by the cobas DNA Sample Preparation Kit and sequenced with 2× bidirectional Sanger sequencing by a CLIA-certified laboratory (SeqWright Houston TX USA) using a validated protocol. Repeat Sanger sequencing was performed to compare the detection of EGFR mutations from adjacent sections of tissue to minimize any impact of tissue heterogeneity used for the EGFR PCR test relative to the original LDT results. Also sequencing protocols vary by laboratory in terms of the percent tumor content/sample that requires macrodissection. DNA isolated with the cobas DNA Sample Preparation Kit and used for sequencing required ?10% tumor content. Average turnaround time to results was 7 days. The estimated limit of detection is approximately 20% mutant alleles.[30] Massively parallel pyrosequencing (MPP) Samples with valid EGFR PCR test results with adequate DNA remaining from the initial extraction were tested by a MPP method (454 GS Titanium 454 Life Sciences Branford CT USA) by a CLIA-certified laboratory (SeqWright Houston TX USA) using a validated protocol.[31] This method is a 5“7 day process that involves amplicon generation pooling ligation emulsion PCR amplification and massively parallel pyrosequencing with manual data analysis. The estimated limit of detection for the assay is 1.25% mutant alleles. [27] The MPP method was used to demonstrate performance of the EGFR PCR test to a more sensitive method and as an arbiter for discrepant cases observed between the LDT or the repeat Sanger sequencing. In order to preserve patient privacy associated with tested clinical samples raw MPP sequencing results were anonymized and presented in Table S1. Results Specimen demographics 487 (47%) of 1044 specimens screened for the EURTAC trial using LDTs were available for testing using the EGFR PCR test. The flow of samples through the study is shown in . Patient demographics and baseline tumor characteristics for all patients by LDT status are shown in . There were no significant differences between subsets of patients tested and patients not tested by the EGFR PCR test (p>0.05) for each LDT status (mutation detected mutation not detected) with the exception of country of the screening clinic. Clinical outcomes for patients based on the EGFR PCR test results Of the 174 patients enrolled in EURTAC trial specimens from 134 (77%) patients were available for testing using the EGFR PCR test. Excluding 11 patients with invalid EGFR PCR test results and 7 patients with a result of EGFR mutation not detected a total of 116 (67%) patients were mutation detected by the EGFR PCR test and evaluable for clinical outcome analysis (57 patients in the chemotherapy arm and 59 in the erlotinib arm). Clinical outcomes (PFS BORR and OS) are presented in Table 2. Among EGFR PCR test positive patients those treated with erlotinib had a significantly prolonged PFS when compared to patients treated with chemotherapy (p-value <0.0001 log-rank test); the median PFS was 10.4 months (95% CI: 8.0 to 13.8 months) and 5.4 months (95% CI: 4.4 to 6.8 months) for patients treated with erlotinib or chemotherapy respectively (Figure 2). The HR based on the Cox proportional hazards model was reduced by 66% (HR 0.34; [95% CI: 0.21 to 0.54]) for patients in the erlotinib versus chemotherapy arm. One year after randomization a higher percentage of patients in the erlotinib compared with the chemotherapy arm were event-free (45% [95% CI: 32% to 59% versus 6% [95% CI: 0% to 15%] respectively). .0089518.g002 Figure 2 Kaplan-Meier curves of progression-free survival (PFS) for different treatments in treatment-naïve patients with non“small-cell lung cancer and EGFR mutation detected by the EGFR PCR test and LDT. .0089518.t002 Table 2 Summary of Clinical Outcome Analysis among EGFR PCR test positive patients in the EURTAC trial. Chemotherapy (N?=?57) Erlotinib (N?=?59) PFS (Investigator) Patients with event 37 (64.9%) 47 (79.7%) Patients without eventa 20 (35.1%) 12 (20.3%) ?Time to event (months) ?Medianb (95%CI) 5.4 [4.4; 6.8] 10.4 [8.0; 13.8] ?p-Value (Log-Rank Test) <0.0001 ?Hazard Ratio (95% CI) 0.34 [0.21; 0.54] ?1 year estimate ?Patients remaining at risk 2 24 ?Event-free Rateb (95%CI) 6% [0%; 15%] 45% [32%; 59%] Best Overall Analysis Response rates (95% CI) 14.0% [ 6.3%; 25.8%] 59.3%[ 45.7%; 71.9%] Difference in Response Rates (%) 45.29% [ 28.8%; 61.7%] ?p-Value (Chi-squared Test) <.0001 Odds Ratio (95% CI) 8.93 [3.59; 22.19] OS Patients with event 35 (61.4%) 36 (61.0%) Patients without eventa 22 (38.6%) 23 (39.0%) ?Time to event (months) ?Medianb (95%CI) 20.8 [17.3; 29.4] 25.8 [16.1; 30.0] ?p-Value (Log-Rank Test) 0.5381 ?Hazard Ratio (95% CI) 0.86 [0.54; 1.38] ?2 - year estimate ?Patients remaining at risk 16 23 ?Event-free Rateb (95% CI) 43% [29%; 57%] 51% [38%; 64%] Note: All eligible patients enrolled in study ML20650 were determined as EGFR mutation detected by the LDT. Among those patients with EGFR mutation confirmed by the EGFR PCR test were included in this table. Event ?=? Death or progression free whichever comes first for PFS analysis and event?=?death for OS analysis. a censored. b Kaplan-Meier estimates. C including censored observations. BORR were higher in patients in the erlotinib arm (59.3% [95% CI: 45.7% to 71.9%]) compared to the chemotherapy arm (14.0% [95% CI: 6.3% to 25.8%]). Patients in the erlotinib arm were much more likely to respond to therapy than patients in the chemotherapy arm (odds ratio of 8.93 [95% CI: 3.59 to 22.19]). There was no significant difference in OS between the treatment arms (25.8 months in the erlotinib arm (95% CI: 16.1 to 30.0) and 20.8 months in the chemotherapy arm (95% CI: 17.3 to 29.4) (log-rank test p-value ?=?0.5381)). PFS BORR and OS results for EGFR PCR test positive patients did not differ significantly from those obtained in all patients enrolled in the EURTAC trial which suggests that the EGFR PCR test positive patients are representative of all EURTAC enrolled patients. For the 7 cases where the EGFR PCR test result was mutation not detected and discrepant with the LDT two cases resolved in favor of the LDT by MPP three cases resolved in favor of the EGFR PCR test and one sample was invalid for both Sanger and MPP and the other was in agreement between the EGFR PCR test and Sanger but not MPP (Table S2). Anecdotally 6 of the 7 patients were treated with erlotinib and only one patient achieved greater than or equal to median PFS based on the LDT or the EGFR PCR test. Comparison of EGFR PCR test and LDT results Among 432 specimens with valid results from both the EGFR PCR test and LDT the PPA NPA and OPA were 94.2% (146/155 CI: 89.3% 96.9%) 97.5% (270/277 CI: 94.9% 98.8%) and 96.3% (416/432 CI: 94.1% 97.7%) respectively (Table 3). Thus there was a high concordance between the original LDT and EGFR PCR test results. Among sixteen specimens with discordant results the EGFR PCR test result was confirmed by MPP in 68.8% (11/16) cases (Table S3). .0089518.t003 Table 3 Agreement analysis between EGFR PCR test and LDT. SLCG LDT Total N?=?432 Mutation detected Mutation not detected EGFR PCR test Mutation detected 146 7 153 Mutation not detected 9 270 279 Total 155 277 432* ¢12 samples with inconclusive LDT results and 43 samples with invalid EGFR PCR test results were excluded. Positive percent agreement ?=?94.2% (95% CI [89.3“96.9%]). Negative percent agreement ?=?97.5% (95% CI [94.9“98.8%]). Overall percent agreement ?=?96.3% (95% CI [94.1“97.7%]). Comparison of the EGFR PCR test results with Sanger Sequencing Of 487 specimens tested using the EGFR PCR test and Sanger sequencing 406 gave valid results by both methods (38 were invalid by both methods five were invalid by EGFR PCR test and 38 were invalid by Sanger sequencing). The PPA NPA and OPA for EGFR PCR test compared with Sanger sequencing were 96.6% (112/116 CI: 91.7% 98.7%) 88.3% (256/290 CI: 84.1% 91.5%) and 90.6% (368/406 CI: 87.4% 93.1%; Table 4) respectively. Among 38 discordant results between the EGFR PCR test and Sanger sequencing MPP agreed with the EGFR PCR test result in 30 (78.9%) cases (Table S4). Sanger sequencing detected one L858R not detected by MPP and failed to detect 22 exon 19 deletions and 7 L858R mutations confirmed by MPP. Four MPP results were invalid and the remaining four results agreed with Sanger. The range of percent mutant alleles of the cases missed by Sanger was 3% to 60% with several specimens (n?=?16) under the estimated limit of detection for Sanger. .0089518.t004 Table 4 Agreement analysis between EGFR PCR test and Sanger sequencing. Sanger sequencing Total N?=?406 Mutation detected Mutation not detected EGFR PCR test Mutation detected 112 34 146 Mutation not detected 4 256 260 Total 116 290 406 *81 samples with invalid EGFR PCR test or Sanger sequencing results were excluded. Positive percent agreement ?=?96.6% (95% CI [91.5“98.7%]). Negative percent agreement ?=?88.3% (95% CI [84.1“91.5%]). Overall percent agreement ?=?90.6% (95% CI [87.4“93.1%]). Discussion This study supports the feasibility of performing a retrospective clinical validation of a companion diagnostic from prospective therapeutic clinical trials. The EGFR PCR test results were highly concordant (>96%) with the LDT results used to select patients for the EURTAC trial. As a consequence PFS and BORR of the subset of patients with EGFR mutations detected with the EGFR PCR test were comparable to the full cohort of patients enrolled in the EURTAC trial thus validating the use of the EGFR PCR test to select patients for treatment with anti-EGFR TKIs such as erlotinib. Median PFS survival was 9.7 versus 10.4 months for the erlotinib group and 5.2 versus 5.4 months for the LDTs and EGFR PCR test respectively. The BORR was 58% versus 59.3% months for the erlotinib group and 15% versus 14.0% for the LDTs and EGFR PCR test respectively. Among the 16 discordant specimens between the EGFR PCR test and LDTs a third mutation testing method agreed with the EGFR PCR test result in 11 cases. Of seven cases that were mutation detected by the EGFR PCR test and mutation not detected by the LDT 5 were confirmed by MPP. These patients could have potentially benefited from anti-EGFR TKI therapy. The EGFR PCR test had a number of technical advantages over the LDT used in the EURTAC trial. The LDT required laser capture microdissection of multiple tissue sections and involved 3 separate assays with a median turnaround time of 4.5 days. By comparison the EGFR PCR test required macrodissection only if the tumor content was <10% and can be performed in one day using a single 5 µm section. Furthermore the EGFR PCR test is a commercially available kit-based assay that provides an automated result rather than a manual process subject to interpretation and which can be performed by any qualified clinical laboratory. "

Lung_Cancer

"630±60?nm band pass filter) and green (?excitation: 470±40?nm band pass filter ?detection: 535±50?nm band pass filter) fluorescence channels. Flow cytometric analysis was assayed with the JC-1 Mitochondrial Membrane Potential Kit (AAT Bioquest Sunnyvale CA USA) according to the manufacturer's directions using a FACSCalibur and the results were analyzed by CellQuest software. In vitro casapse-9 activity determination Caspase-9 activity was measured by a fluorometric assay in whole-cell lysates using Ac-Leu-Glu-His-Asp-MCA substrate (Peptide International Inc. Louisville KY USA). A549 cell extracts were mixed with Ac-LEHD-MCA in ICE standard buffer (100?mM HEPES pH 7.5 10% sucrose 0.1% CHAPS 10?mM DTT 1?mM PMSF) and cleavage of the fluorogenic peptide substrate was monitored at 37?°C for 30?min by a SPECTRA max GEMINI EM (Molecular Device Sunnyvale CA USA) fluorometer with excitation at 370?nm and emission at 460?nm. This work was supported in part by a Grant-in-Aid (23591477) from the Ministry of Education Culture Sports Science and Technology of Japan. Apaf-1 apoptotic protease-activating factor 1 COX cyclooxygenase HSF-1 heat shock factor 1 MTT 3-(45-dimethylthiazol-2-yl)-25-diphenyltetrazolium bromide NSAID nonsteroidal anti-inflammatory drug NSCLC non-small cell lung cancer PCR polymerase chain reaction RNAi RNA interference RT reverse transcriptase TUNEL terminal deoxynucleotidyl transferase-mediated dUTP nick and labelling Edited by G Raschell  The authors declare no conflict of interest. Tavaria M Gabriele T Kola I Anderson RL A hitchhiker's guide to the human Hsp70 family Cell Stress Chaperones 1996 1 23 28 9222585 Jaattela M Escaping cell death: survival proteins in cancer Exp Cell Res 1999 248 30 43 10094811 Aghdassi A Phillips P Dudeja V Dhaulakhandi D Sharif R Dawra R Heat shock protein 70 increases tumorigenicity and inhibits apoptosis in pancreas adenocarcinoma Cancer Res 2007 67 616 625 17234771 Ciocca DR Clark GM Tandon AK Fuqua SA Welch WJ McGuire WL Heat shock protein hsp70 in patients with axillary lymph node-negative breast cancer J Natl Cancer Inst 1993 85 570 574 8455204 Cornford PA Dodson AR Parsons KF Desmond AD Woolfenden A Fordham M Heat shock protein expression independently predicts clinical outcome in prostate cancer Cancer Res 2000 60 7099 7105 11156417 Vargas-Roig LM Gago FE Tello O Aznar JC Ciocca DR Heat shock protein expression and drug resistance in breast cancer patients treated with induction chemotherapy Int J Cancer 1998 79 468 475 9761114 Igney FH Krammer PH Death and anti-death: tumor resistance to apoptosis"

Lung_Cancer

"These results suggest that there may be lifelong differences in how BMI affects health in blacks versus whites. Several lines of evidence suggest that underlying physiological distinctions among different race and sex groups may contribute to the observed differences in the BMI-mortality association. The association between BMI and the total level and distribution of body fat may be race- or sex-specific 25“26. For instance some studies have reported that the slope of the association between BMI and visceral adipose tissue (VAT) is less steep in blacks compared to whites 27“28. Therefore the same increments in BMI may lead to smaller increments in VAT in the black population. Similar differences have also been observed for associations between BMI and adipokine levels with several studies reporting a more clearly linear association between BMI and leptin or adiponectin in white women than in black women 29“30. Such racial differences may have important health implications. VAT has been proposed to be a better marker than BMI for certain chronic conditions such as the metabolic syndrome31 and leptin and adiponectin are critically involved in a variety of physiological or pathogenic pathways including energy regulation insulin sensitivity inflammatory response and tumorigenesis 32“34. Stronger relationships between BMI and these biomarkers in whites may translate into stronger effects of BMI on general health and mortality. On the other hand BMI may not be an accurate indicator of risk of obesity-related diseases among blacks and other measures of adiposity may be more appropriate in directly comparing health risks associated with obesity across racial/ethnic groups. The BMI-mortality association may be modified by socioeconomic factors as well. Both the Black Women™s Health Study and the Cancer Prevention Study-I found that the BMI-mortality association was attenuated in women with lower education levels (less than 12 years of education in the Black Women™s Health Study and less than high school education in the Cancer Prevention Study-I) 8 11. It was suggested that among people with low socioeconomic status factors other than BMI such as chronic psychological stress and limited access to care are major determinants of health and may mask the effect of BMI on mortality. However we did not find the association to differ according to education levels in blacks. Instead we saw a significant interaction between BMI and education level in white men whereby the BMI-mortality relation was weaker among those who had a less-than-college education. Interestingly we found that among black men marital status appeared to be a strong effect modifier for the BMI-mortality association with a significant and positive association found only in the married men. These findings support that socioeconomic status may modify the BMI-mortality association but the modifying factor may be population-specific. Our study™s strengths include the inclusion of both black and white male and female participants which allowed us to investigate and directly compare the relation between BMI and mortality across these different groups. To reduce the potential for confounding we examined the effect of excluding subjects whose BMI might have been affected by a previous diagnosis of cancer or cardiovascular disease as well as current and recent smokers. We found no difference in the results after excluding participants who died within the first year of follow-up further reducing of the potential for bias due to reverse causality. There are however several limitations of our study. The sample size among blacks in this study was modest and the numbers of deaths were small compared to previous studies on this topic in this and other racial/ethnic groups and limited our ability to detect possible associations particularly in sub-group analyses. Self-reported weight and height especially recalled weights are prone to error. Although validation studies have generally found strong correlations between measured and recalled past weight 35“36 previous studies reported that women and whites are more likely to underreport their weight compared to men and non-whites 37. However the shapes of the BMI and mortality associations were similar after correcting for reporting error in BMI using race- and sex-specific equations for adjustment. We also lacked more direct measures of central adiposity and visceral fat which may be independent 36 or even more important 1838 risk factors for certain health outcomes compared with general obesity. Lastly although we controlled for multiple factors we could not rule out the possibility of residual confounding from other lifestyle factors such as diet. In we found differences in the shape of the BMI-mortality associations between blacks and whites. BMI at baseline and at age 20 as well as the change in BMI during this period appeared to have a stronger positive association with all-cause mortality in whites than in blacks. We have also identified socioeconomic factors such as education in white men and marital status in black men which may be important effect modifiers for the BMI-mortality relationship. Such differences may be rooted in both the distinct biology and socioeconomic environment across populations defined by race/ethnicity and sex. For future studies utilizing more valid measures of adiposity particularly more direct measures of abdominal adiposity and visceral fat may better address the health risks associated with overweight and obesity in the black population. Supplementary Material This research was supported by the Intramural Research Program of the National Institutes of Health National Cancer Institute National Institutes of Health Department of Health and Human Services. The authors would like to thank Dr Alan Flint (School of Public Health Harvard University) for his help with the analysis using NHANES data. Disclosure: The authors declared no conflict of interest. 1 Flegal KM Carroll MD Kit BK Ogden CL Prevalence of obesity and trends in the distribution of body mass index among US adults 1999“2010 JAMA 2012 307 5 491 7 22253363 2 Beydoun MA Wang Y Gender-ethnic disparity in BMI and waist circumference distribution shifts in US adults Obesity (Silver Spring) 2009 17 1 169 76 19107129 3 Flegal KM Carroll MD Ogden CL Curtin LR Prevalence and trends in obesity among US adults 1999“2008 JAMA 2010 303 3 235 41 20071471 4 Robinson WR Keyes KM Utz RL Martin CL Yang Y Birth cohort effects among US-born adults born in the 1980s: foreshadowing future trends in US obesity prevalence Int J Obes (Lond) 2012 5 Whitlock G Lewington S Sherliker P Body-mass index and cause-specific mortality in 900 000 adults: collaborative analyses of 57 prospective studies Lancet 2009 373 9669 1083 96 19299006 6 Berrington de Gonzalez A Hartge P Cerhan JR Body-mass index and mortality among 1. 46 million white adults N Engl J Med 2010 363 23 2211 9 21121834 7 Stevens J Keil JE Rust PF Tyroler HA Davis CE Gazes PC Body mass index and body girths as predictors of mortality in black and white women Arch Intern Med 1992 152 6 1257 62 1599355 8 Stevens J Plankey MW Williamson DF The body mass index-mortality relationship in white and African American women Obes Res 1998 6 4 268 77 9688103 9 Calle EE Thun MJ Petrelli JM Rodriguez C Heath CW Jr Body-mass index and mortality in a prospective cohort of U.S. adults N Engl J Med 1999 341 15 1097 105 10511607 10 Adams KF Schatzkin A Harris TB Overweight obesity and mortality in a large prospective cohort of persons 50 to 71 years old N Engl J Med 2006 355 8 763 78 16926275 11 Boggs DA Rosenberg L Cozier YC General and abdominal obesity and risk of death among black women N Engl J Med 2011 365 10 901 8 21899451 12 Hoffmans MD Kromhout D de Lezenne Coulander C The impact of body mass index of 78612 18-year old Dutch men on 32-year mortality from all causes J Clin Epidemiol 1988 41 8 749 56 3418364 13 Jeffreys M McCarron P Gunnell D McEwen J Smith GD Body mass index in early and midadulthood and subsequent mortality: a historical cohort study Int J Obes Relat Metab Disord 2003 27 11 1391 7 14574351 14 Corrada MM Kawas CH Mozaffar F Paganini-Hill A Association of body mass index and weight change with all-cause mortality in the elderly Am J Epidemiol 2006 163 10 938 49 16641311 15 Stevens J Truesdale KP Wang CH Cai J Erber E Body mass index at age 25 and all-cause mortality in whites and African Americans: the Atherosclerosis Risk in Communities study J Adolesc Health 2012 50 3 221 7 22325126 16 Gohagan JK Prorok PC Hayes RB Kramer BS The Prostate Lung Colorectal and Ovarian (PLCO) Cancer Screening Trial of the National Cancer Institute: history organization and status Control Clin Trials 2000 21 6 Suppl 251S 272S 11189683 17 Prorok PC Andriole GL Bresalier RS Design of the Prostate Lung Colorectal and Ovarian (PLCO) Cancer Screening Trial Control Clin Trials 2000 21 6 Suppl 273S 309S 11189684 18 National Health and Nutrition Examination Survey data Department of Health and Human Services Hyattsville MD 2006 19 Cohen SS Signorello LB Cope EL Obesity and All-Cause Mortality Among Black Adults and White Adults Am J Epidemiol 2012 20 Lakoski SG Le AH Muntner P Adiposity inflammation and risk for death in black and white men and women in the United States: the Reasons for Geographic and Racial Differences in Stroke (REGARDS) study J Clin Endocrinol Metab 2011 96 6 1805 14 21430022 21 Park SY Wilkens LR Murphy SP Monroe KR Henderson BE Kolonel LN Body mass index and mortality in an ethnically diverse population: the Multiethnic Cohort Study Eur J Epidemiol 2012 22 Renehan AG Tyson M Egger M Heller RF Zwahlen M Body-mass index and incidence of cancer: a systematic review and meta-analysis of prospective observational studies Lancet 2008 371 9612 569 78 18280327 23 Reeves GK Pirie K Beral V Green J Spencer E Bull D Cancer incidence and mortality in relation to body mass index in the Million Women Study: cohort study BMJ 2007 335 7630 1134 17986716 24 Parr CL Batty GD Lam TH Body-mass index and cancer mortality in the Asia-Pacific Cohort Studies Collaboration: pooled analyses of 424519 participants Lancet Oncol 2010 11 8 741 52 20594911 25 Jackson AS Stanforth PR Gagnon J The effect of sex age and race on estimating percentage body fat from body mass index: The Heritage Family Study Int J Obes Relat Metab Disord 2002 26 6 789 96 12037649 26 Katzmarzyk PT Bray GA Greenway FL Racial differences in abdominal depot-specific adiposity in white and African American adults Am J Clin Nutr 2010 91 1 7 15 19828714 27 Carroll JF Chiapa AL Rodriquez M Visceral fat waist circumference and BMI: impact of race/ethnicity Obesity (Silver Spring) 2008 16 3 600 7 18239557 28 Camhi SM Bray GA Bouchard C The relationship of waist circumference and BMI to visceral subcutaneous and total body fat: sex and race differences Obesity (Silver Spring) 2011 19 2 402 8 20948514 29 Cohen SS Gammon MD Signorello LB Serum adiponectin in relation to body mass index and other correlates in black and white women Ann Epidemiol 2011 21 2 86 94 21109453 30 Cohen SS Fowke JH Cai Q Differences in the association between serum leptin levels and body mass index in black and white women: a report from the Southern Community Cohort Study Ann Nutr Metab 2012 60 2 90 7 22353927 31 Despres JP Lemieux I Abdominal obesity and metabolic syndrome Nature 2006 444 7121 881 7 17167477 32 Stofkova A Leptin and adiponectin: from energy and metabolic dysbalance to inflammation and autoimmunity Endocr Regul 2009 43 4 157 68 19908934 33 van Kruijsdijk RC van der Wall E Visseren FL Obesity and cancer: the role of dysfunctional adipose tissue Cancer Epidemiol Biomarkers Prev 2009 18 10 2569 78 19755644 34 Prieto-Hontoria PL Perez-Matute P Fernandez-Galilea M Bustos M Martinez JA Moreno-Aliaga MJ Role of obesity-associated dysfunctional adipose tissue in cancer: a molecular nutrition approach Biochim Biophys Acta 2011 1807 6 664 78 21111705 35 Stevens J Keil JE Waid LR Gazes PC Accuracy of current 4-year and 28-year self-reported body weight in an elderly population Am J Epidemiol 1990 132 6 1156 63 2260547 36 Perry GS Byers TE Mokdad AH Serdula MK Williamson DF The validity of self-reports of past body weights by U.S. adults Epidemiology 1995 6 1 61 6 7888448 37 Wen M Kowaleski-Jones L Sex and ethnic differences in validity of self-reported adult height weight and body mass index Ethn Dis 2012 22 1 72 8 22774312 38 Dobbelsteyn CJ Joffres MR MacLean DR Flowerdew G A comparative evaluation of waist circumference waist-to-hip ratio and body mass index as indicators of cardiovascular risk factors. The Canadian Heart Health Surveys Int J Obes Relat Metab Disord 2001 25 5 652 61 11360147 Figure 1 Hazard ratios (HRs) and 95% confidence intervals (CIs) for death from any cause according to body mass index (BMI) among healthy a subjects who were not current cigarette smokers or recent quitters by race and sex. Light colored lines represent whites and dark colored lines represent blacks. Solid lines represent results with self-reported BMI and dotted lines represent results with adjusted b BMI. Squares and circles represent the HR corresponding to the median values in each BMI category. "

Lung_Cancer

"METHODS These experiments were conducted on left lungs (n = 6) taken from freshly slaughtered pigs. The laser and the monopolar cutter were fixed in a hydraulic mover. The laser was focused at a distance of 3 cm to the lung tissue and the monopolar cutter was fixed in pressure-free contact with the lung surface. Both instruments were manoeuvred at a speed of 5 10 and 20 mm/s in a straight line at an output of 100 watts over the lung surface. The lung lesions that ensued were then examined macro- and microscopically. The same procedures were repeated at a distance of 1 cm creating parallel lesions in order to analyse the lung tissue in between the lesions for thermal damage. In addition two implanted capsules in the lung tissue simulating a lung nodule were resected with either the laser or the monopolar cutter. The resection surfaces were then examined by magnetic resonance imaging and histology for tissue damage. Finally we created a 2-cm wide mark on the lung surface to test the resection capacity of both instruments within 1 min. RESULTS The laser created sharply delineated lesions with a vaporization and coagulation zone without thermal damage of the surrounding lung tissue. With lowering the working speed each zone was extended. At a working speed of 10 mm/s the mean vaporization depth using the laser was 1.74 ± 0.1 mm and the mean coagulation depth was 1.55 ± 0.09 mm. At the same working speed the monopolar cutter demonstrated a greater cutting effect (mean vaporization depth 2.7 ± 0.11 mm; P < 0.001) without leaving much coagulation on the resection surface (mean coagulation depth 1.25 ± 0.1 mm; P = 0.002). In contrast to the laser the monopolar cutter caused thermal damage of the adjacent lung tissue. The adjacent tissue injury was detected in histological examination as well as in the MRI findings. Adjacent lung tissue after lung metastasectomy using the monopolar cutter was hyper-intensive in T2-weighted MR imaging indicating a severe tissue damage. No significant changes in signal intensity were observed in T2-weighted imaging of the adjacent lung tissue after using the laser for lung resection. One minute of laser applied at a 100-watt output penetrated a lung surface area of 3.8 ± 0.4 cm2 compared with 4.8 ± 0.6 cm2 of surface after application of the monopolar cutter (P = 0.001). S The monopolar cutter possesses indeed a greater cutting capacity than the laser but it also causes more adjacent tissue injury. Thus laser resection might be preferred for lung metastasectomy. Electrosurgical scalpel Laser Lung metastases Lung resection Tissue damage BMC Urol BMC Urol BMC Urology 1471-2490 BioMed Central 24612599 3975282 1471-2490-14-26 10.1186/1471-2490-14-26 Research an-specific and tumor-size-dependent responses to sunitinib in clear cell renal cell carcinoma Tsuchiya Norihiko 1 tsuchiyamed.akita-u.ac.jp Yuasa Takeshi 2 takeshi.yuasajfcr.or.jp Maita Shinya 1 yamightyyahoo.co.jp Narita Shintaro 1 narishindoc.med.akita-u.ac.jp Inoue Takamitsu 1 takamitudoc.med.akita-u.ac.jp Numakura Kazuyuki 1 numakuradoc.med.akita-u.ac.jp Saito Mitsuru 1 mitsaitomed.akita-u.ac.jp Satoh Shigeru 1 shigerusdoc.med.akita-u.ac.jp Yonese Junji 2 jyonesejfcr.or.jp Habuchi Tomonori 1 thabuchidoc.med.akita-u.ac.jp 1Department of Urology Akita University Graduate School of Medicine Akita Japan 2Department of Urology Cancer Institute Hospital Japanese Foundation for Cancer Research Tokyo Japan 2014 11 3 2014 14 26 26 20 7 2013 28 2 2014 Copyright 2014 Tsuchiya et al.; licensee BioMed Central Ltd. 2014 Tsuchiya et al.; licensee BioMed Central Ltd. This is an Open Access distributed under the terms of the Creative Commons Attribution License (http://creativecommons./licenses/by/2.0) which permits unrestricted use distribution and reproduction in any medium provided the original work is properly credited. Background Tyrosine kinase inhibitors (TKIs) have been used as standard therapy for patients with advanced renal cell carcinoma (RCC). However information on factors predicting response to treatment with TKIs is lacking. This study aimed to assess the association between initial tumor size involved ans pre-treatment C-reactive protein (CRP) levels and reduction in tumor size in patients with clear cell RCC (CCRCC) treated with sunitinib. Methods Patients with advanced CCRCC with target lesions with a maximum diameter???10 mm treated with sunitinib were evaluated. The tumor diameter representing the best overall response was designated as the post-treatment tumor diameter. Results A total of 179 lesions in 38 patients were analyzed. an-specific analysis demonstrated that pre-treatment diameter of lung metastatic lesions had a moderate inverse association with percent reduction in post-treatment tumor diameter (R?=?0.341). Lung lesions showed significantly greater percent reductions in diameter than liver and kidney lesions (P?=?0.007 and 0.002 respectively). Furthermore based on a CRP cut-off level of 2.0 mg/dl mean tumor size reduction was significantly greater in patients with low CRP levels than in patients with high CRP levels in lesions with diameters?<?20 mm (P?=?0.002). CRP level had no effect on mean size reduction in lesions with a diameter???20 mm. Conclusions Patients with CCRCC with smaller lung metastatic lesions and lower CRP levels may achieve greater percent reductions in tumor size with sunitinib therapy than patients with extra-pulmonary lesions large lung lesions and/or higher CRP levels. Advanced renal cell carcinoma Sunitinib Tumor size Tumor response C-reactive protein Background In the era of cytokine therapy tumor response to treatment in advanced or metastatic renal cell carcinoma (RCC) has been reported to vary according to the ans involved [12]. Longer overall survival and a higher response rate to therapy with interferon-? or a combination of interleukin-2 and interferon-? were observed in patients with only lung metastasis compared with those with extra-pulmonary metastasis [12]. Complete remission (CR) after treatment with tyrosine kinase inhibitors (TKIs) which mainly target vascular endothelial growth factor receptors remains a rare event but most patients who do achieve CR have either lung metastasis alone or only lymph node involvement [34]. However most cancer clinical trials evaluate tumor response using the response evaluation criteria in solid tumors (RECIST) in which the longest diameters of target lesions in multiple ans are summed. Tumor response in individual metastatic lesions in specific ans has not been delineated. A reduction in tumor size >10% calculated as the sum of the longest diameter of the target lesions was significantly associated with both time to treatment failure and overall survival suggesting that size reduction of target lesions may predict the outcome of treatment with TKIs [5]. In addition Yuasa et al. recently demonstrated that a smaller initial tumor size predicted a good response to TKIs and that the maximum response was achieved in lung lesions [6]. TKIs have shown significant clinical benefit in advanced clear cell RCC (CCRCC) in large randomized trials [7-9]. However the reported objective responses vary according to the different types of TKIs and a recent phase II trial failed to demonstrate any clinical efficacy of sunitinib in non-CCRCC [10]. Tumor size reduction may thus be affected by many factors including initial tumor size involved ans tumor histology tumor aggressiveness or type of TKI used. In this study we evaluated the association between initial tumor size of individual lesions in specific ans and reduction in tumor size in patients with CCRCC treated with sunitinib. Methods Patients and tumor measurement A total of 38 patients with advanced CCRCC who received at least two cycles of sunitinib at Akita University Hospital and at the Cancer Institute Hospital of the Japanese Foundation for Cancer Research were enrolled in this institutional review-board-approved retrospective study. Pathological diagnosis was made by radical nephrectomy in 30 patients and by percutaneous biopsy in eight patients who were not indicated for surgical treatment because of a significantly higher total volume of metastatic lesions compared with the primary lesion. The initial dose of sunitinib was 50 mg/day which was reduced to 37.5 mg/day based on the patient€™s physique age and performance status. Sunitinib was initiated on a 28 days on/14 days off schedule and a dose reduction to 25 mg/day or complete cessation was considered in the event of grade 3 or higher toxicity according to the Common Terminology Criteria for Adverse Events (CTC-AE). All lesions were evaluated using a multidetector computed tomography scanner and lesions???10 mm in diameter were considered target lesions. The maximum diameter of each target lesion was measured before treatment with sunitinib (pre-treatment tumor diameter) and every 2€“3 months thereafter. The tumor diameter at the point when best overall response was achieved based on the RECIST version 1.0 was adopted as the post-treatment tumor diameter. In this study the most common metastatic ans including lung liver and lymph nodes as well as the kidney were subjected to analysis. Statistical analysis The association between pre-treatment tumor diameter and percent change between pre- and post-treatment tumor diameters for each lesion was assessed by Pearson€™s correlation coefficient. The Kruskal Wallis test was used to compare differences in percent change in tumor diameter between the four different ans. The Mann€“Whitney U test was used to compare differences between two groups. A receiver-operator curve (ROC) was constructed to find the pre-treatment tumor diameter predicting tumor response to sunitinib treatment. A value of P?<?0.05 was considered statistically significant. Results Patients and target lesions The patients included 30 men and eight women with a median age of 62 years (range 27€“81 years). The patients€™ characteristics are listed in Table 1. The best response to sunitinib treatment was CR in one patient (3%) partial response (PR) in 11 (29%) stable disease (SD) in 23 (61%) and progressive disease (PD) in three (8%). The objective response rate was 32% and the clinical benefit rate (CR?+?PR?+?SD for at least 3 months) was 92%. A total of 179 lesions ranging from 10 to 106 mm were measured and analyzed in 38 patients. These lesions were localized as follows: 124 in the lung 12 in the liver 24 in the lymph nodes and 19 in the kidney. Of the 15 patients with kidney tumors seven who underwent nephrectomy had target lesions in the contralateral kidney including two patients with multiple lesions. The remaining eight patients had primary kidney tumors that were diagnosed by percutaneous needle biopsy. Table 1 Patients€™ characteristics Characteristic No. of patients (%) Sex ??Male 30 (78.9) ??Female 8 (21.1) Age y ??Median [range] 62 [27€“81] ECOG performance status ??0 25 (65.8) ??1 7 (18.4) ??> 1 6 (15.8) MSKCC risk category ??Favorable 8 (21.1) ??Intermediate 20 (52.6) ??Poor 10 (26.3) Target ans ??Lung 31 (81.6) ??Liver 6 (15.8) ??Lymph node 11 (28.9) ??Kidney 15 (39.5) Nephrectomy ??Yes 30 (78.9) ??No (biopsy) 8 (21.1) Prior treatments ??None 27 (71.1) ??Cytokines alone 4 (10.5) ??Sorafenib?±?cytokines 7 (18.4) Associations between pre-treatment tumor diameter and percent change in target lesion size in different ans The associations between pre-treatment tumor diameter and percent change in size of each target lesion in each of four ans were analyzed separately. an-specific analysis demonstrated that pre-treatment diameter of lung metastatic lesions had a moderately positive association with percent change in post-treatment tumor diameter (R?=?0.341 Figure 1). There were fewer target lesions in the other three ans than in the lung and there was no association between liver lymph node or kidney lesion size and percent change in post-treatment tumor diameter (Figure 1). The percent changes in target lesion size differed significantly between the four individual ans (P?=?0.0007 by the Kruskal Wallis test). The mean (± SD) percent changes in target lesion size in the lung liver lymph nodes and kidney were ?27.1?±?33.5 0.5?±?29.4 ?16.7?±?19.6 and ?2.7?±?21.7 respectively. Target lesions in the lung showed the greatest change in size which was significantly greater than in the liver and kidney (P?=?0.007 and 0.002 respectively). There was no difference in the percent change in target lesion size between the lung and lymph nodes (P?=?0.114) (Figure 2). Figure 1 Association between pre-treatment tumor size and percent change in lesion size after sunitinib treatment. Association between pre-treatment tumor size and percent change in size was analyzed for lesions in the lung (a) liver (b) lymph nodes (c) and kidney (d). The pre-treatment size of lung lesions showed a moderately positive association with percent size change after treatment with sunitinib while no association was observed in the liver lymph nodes and kidney. Figure 2 Percent change in target lesion size in different ans. The reduction in lesion size was significantly greater in lung lesions compared with liver and kidney lesions. Lung lesions with an initial diameter?<?17.3 mm (median) showed a significant percent reduction in size compared with lesions???17.3 mm. No significant differences in relation to initial lesion size were observed in the liver lymph nodes and kidney. Lesions in each an were divided into two groups according to the median pre-treatment diameter and percent changes in tumor diameter were compared between the two groups. Lung lesions with a pre-treatment diameter less than the median value of 17.3 mm showed a significant percent reduction in diameter compared with tumors???17.3 mm (P?=?0.002). There were no differences in the percent change in relation to size above or below the median value in other ans (Figure 2). Cut-off value for pre-treatment tumor diameter predicting response to sunitinib in lung metastasis ROC curves were drawn to determine cut-off values predicting 30% and 50% reductions in the diameter of lung metastatic lesions (Figure 3). The cut-off predicting a 30% reduction in diameter was 16.5 mm with a sensitivity of 69.6% specificity of 58.2% and an area under the curve (AUC) of 0.662. The cut-off predicting a 50% reduction in diameter was also 16.5 mm with a sensitivity of 67.0% specificity of 77.8% and an AUC of 0.752. Using this cut-off value the percent change in lesion size for lesions?<?16.5 mm was ?41.7?±?35.5% while that for lesions???16.5 mm was ?16.2?±?26.9% (P?=?0.0005). Figure 3 Cut-off values of initial lung tumor size for predicting 30% and 50% reductions in diameter after sunitinib treatment. Based on ROC analysis the cut-off values of initial lung lesion size for predicting reductions in diameter of both 30% and 50% were 16.5 mm. Influence of pre-treatment CRP value cytoreductive nephrectomy and treatment line on percent change in target lesion size in the lung Metastatic lung lesions were categorized into two groups based on pre-treatment C-reactive protein (CRP) levels. The mean diameter and percent change in lesion size in patients with CRP?<?2.0 mg/ml were 19.0?±?9.3 mm and ?38.3?±?30.5% respectively while those in patients with CRP???2.0 mg/ml were 28.3?±?20.6 mm and ?9.6?±?33.9% respectively. The lesions were further divided into three subgroups according to pre-treatment diameter?<?20 mm ? 20 to?<?40 mm and???40 mm. Percent changes were compared between lesions in patients with CRP?<?2.0 mg/dl (low CRP) and those with CRP???2.0 mg/dl (high CRP) in each subgroup. For lesions?<?20 mm patients with low CRP had significantly greater reductions in tumor diameter than patients with high CRP (?43.8?±?33.4% vs. ?15.3?±?37.7% P?=?0.0019). In patients with lesions ?20 to?<?40 mm there was a tendency towards a greater reduction in patients with low CRP compared with high CRP though the difference was not significant (?29.0?±?17.3% vs. ?12.4?±?30.2% P?=?0.054) and similarly there was no significant association between tumor reduction and CRP level in patients with lesions???40 mm (?13.3?±?20.6 vs. 6.8?±?17.4 P?=?0.151) (Figure 4). Figure 4 Influence of CRP on percent change in lung lesion size. In patients with lung lesions?<?20 mm the percent reduction in size was significantly greater in patients with low compared with high CRP levels. Meanwhile CRP level had a marginal effect on size reduction in lesions???20 to?<?40 mm and no effect in lesions???40 mm. Percent changes in size were compared between lung lesions in patients in each diameter subgroup who did and did not undergo cytoreductive nephrectomy. There were no lung lesions???40 mm in patients who did not undergo cytoreductive nephrectomy. There was no significant difference between mean percent change in lesion size in patients with and without cytoreductive nephrectomy (?36.1?±?32.6 vs. ?28.2?±?41.9 P?=?0.421 and ?20.4?±?25.1 vs. ?32.0?±?21.9 P?=?0.307 in lesions?<?20 mm and???20 mm respectively). Similarly there was no significant difference in percent change in lesion size between lung lesions in patients treated as first-line therapy and those treated as second-line or later therapy in any diameter subgroup (?38.1?±?37.7 vs. ?32.1?±?33.9 P?=?0.280; ?23.5?±?21.6 vs. ?17.5?±?23.3 P?=?0.803; and 3.5?±?2.6 vs. 1.9?±?22.9 P?>?0.9 in lesions?<?20 mm ? 20 to?<?40 mm and???40 mm respectively). Discussion A previous study on metastatic RCC by Yuasa et al. demonstrated that: 1) smaller initial tumor size predicted a good response to TKIs; 2) the greatest response was achieved in patients with lung lesions; and 3) there was no difference in tumor response between patients treated with sorafenib and sunitinib [6]. However these results raised several specific questions. First tumor histology and progression risk may affect the response to TKIs. TKIs are associated with a good response in patients with CCRCC but are less effective against non-CCRCC [10]. Similarly patients with favorable risk factors have a greater chance of a good tumor response than those with poorer risk factors. Second there is the possibility of bias in terms of the types of TKI selected; given that sunitinib showed a higher response rate than sorafenib [78] patients with larger or more rapidly-growing tumors may be allocated sunitinib rather than sorafenib in clinical practice. Third efficacy based on initial tumor size may differ between different ans; although the previous study compared mean lesion-size reductions between different ans they did not compare the effect of initial tumor size in individual ans. It is therefore unclear if the association between initial lesion size and tumor response was observed in each an or if the association could be attributed to the fact that most of the small lesions were lung metastases which showed a good response to TKIs. The current study only included CCRCC patients treated with sunitinib. We found that lung lesions showed the greatest response to sunitinib and detected a modest correlation between initial tumor diameter and reduction in lesion size while even small lesions in other ans failed to respond. However the number of extra-pulmonary tumors assessed was too small to determine statistical significance and further studies with larger numbers of tumors are needed to obtain conclusive results. Only lesions with an initial diameter?<?20 mm achieved a CR in this study indicating that a lung-tumor reduction of?>?50% might be limited to smaller lesions. The cut-off value of 16.5 mm for a?>?50% reduction in diameter was calculated using ROC analysis with a sensitivity of 67.0% and a specificity of 77.8%. Some physicians may prefer conservative therapies without TKIs or a watchful waiting strategy in CCRCC patients with only small lung metastatic lesions [11]. Furthermore cytokine therapies are still employed in CCRCC patients especially in Japan because of their low toxicity and ability to achieve long-term stable disease [12]. However the present results suggest that smaller lung lesions are associated with a greater chance of response to TKIs and it is therefore important not to miss the opportunity for early initiation of TKI treatment in patients with PD during watchful waiting periods or cytokine therapy. Several studies have investigated the response of primary kidney lesions to TKIs [13-15]. Kroon et al. reported that smaller primary lesions were more responsive to treatment and that tumors of 5€“7 cm may benefit from neoadjuvant treatment followed by nephron-sparing surgery. In contrast our results showed that the response of kidney lesions to sunitinib was independent of initial tumor size and many smaller lesions exhibited no response. A possible explanation for this difference may be the selection of patients; most of the kidney lesions were investigated in the neoadjuvant setting in Kroon et al.€™s study while all the patients with kidney lesions in the current study had an extensive metastatic tumor burden. The different patient backgrounds may have led to different responses to TKIs particularly in small kidney lesions. CRP is an acute phase protein produced by the liver in response to various conditions such as inflammation infection and malignancy [16]. In the cytokine era elevated serum CRP level has been suggested as a biomarker for predicting poor survival in RCC patients [17-19]. Yasuda et al. recently demonstrated that CRP was a significant predictive marker for prognosis in metastatic RCC patients treated with TKIs [20]. In the current study the size reduction of lung lesions in patients with high serum CRP levels was lower than that in patients with low CRP levels irrespective of the initial size. This lower response to sunitinib in patients with higher serum CRP levels may be attributed to an aggressive disease status reflected by higher CRP levels the acquisition of resistance to therapeutic agents through an increase in inflammatory mediators in the cancer-cell microenvironment or compromised drug metabolism induced by such mediators associated with CRP [21]. Tumor response to treatment is currently assessed by imaging based on RECIST criteria [22]. However although marked central necrosis is often detected in lesions with a small size reduction after treatment with TKIs RECIST only considers one-dimensional lesional size changes suggesting that it may substantially underestimate the actual tumor response. Several studies recently reported novel criteria which may improve response assessment by evaluating changes in tumor attenuation and morphology on contrast-enhanced computed tomography scans in addition to size changes [522-26]. The results of this study therefore need to be interpreted carefully because lesions in different ans may exhibit distinct response patterns in imaging. Moreover the current study did not demonstrate an association between tumor response and patient survival and it is possible that percent change in tumor size might not correlate directly with survival. Further studies are needed to determine the influence of an-specific response patterns to TKI treatment on survival. Conclusions The results suggest that tumor-size reduction depends on initial tumor size and the ans involved as well as systemic reaction to the lung tumor as indicated by CRP levels. CCRCC patients with lung metastatic lesions?<?20 mm in diameter and lower CRP levels may achieve greater reductions in tumor size with sunitinib therapy than those with extra-pulmonary lesions lung lesions???20 mm in diameter"

Lung_Cancer

"Rabbit anti-MOR antibody was purchased from GeneTex (San Antonio TX). Rabbit anti-EGFR rabbit anti-phosphotyrosine-EGFR (pY845 pY992 pY1045 pY1068) rabbit anti-Grb-2 rabbit anti-Gab-1 rabbit anti-phosphotyrosine-Gab-1 (pY307 pY627) rabbit anti-Src rabbit anti-phosphotyrosine-Src (pY416) rabbit anti-p85 PI3 kinase rabbit anti-p55 PI3 kinase rabbit anti-phosphotyrosine-p85/p55 PI3 kinase (pY458 pY199) rabbit anti-STAT3 rabbit anti-phosphotyrosine-STAT3 (pY705) rabbit anti-vimentin rabbit anti-ZO-1 rabbit anti-claudin-1 rabbit anti-Snail and rabbit anti-Slug antibodies were purchased from Cell Signaling Technologies (Danvers MA). Mouse anti-?-actin antibody was purchased from Sigma (St. Louis MO). Secondary horseradish peroxidase-labeled antibodies were purchased from Amersham Biosciences (Piscataway NJ). N-methylnaltrexone bromide or methylnaltrexone was purchased from Mallinckrodt Specialty Chemicals (Phillipsburg NJ). The PI3 kinase inhibitor LY294002 Akt Inhibitor X the Src family kinase inhibitor PP2 and the STAT3 inhibitor Stattic were purchased from EMD Biosciences (Billerica MA). Immunoblotting Immunoblotting was performed as we have previously described. Cellular materials from treated or untreated human NSCLC cells were incubated with lysis buffer (50 mM HEPES (pH 7.5) 150 mM NaCl 20 mM MgCl2 1% Triton X-100 0.1% SDS 0.4 mM Na3VO4 40 mM NaF 50 µM okadaic acid 0.2 mM phenylmethylsulfonyl fluoride 1?250 dilution of Calbiochem protease inhibitor mixture 3). The samples were then run on SDS-PAGE in 4“15% polyacrylamide gels transferred onto Immobilon„¢ membranes and developed with specific primary and secondary antibodies. Visualization of immunoreactive bands was achieved using enhanced chemiluminescence (Amersham Biosciences Piscataway NJ). In some instances immunoreactive bands were quantitated using computer-assisted densitometry. Small Interfering RNA Transfection in Human NSCLC Cells Stable Control and either MOR Gab-1 or Src siRNA (Santa Cruz Biotechnology Santa Cruz CA) were transfected into H358 cells as we have previously described [12]. Cells (?40% confluent) were serum-starved for 1 hour followed by incubated with siRNA for 6 hours in serum-free media. Serum-containing media was then added (10% serum final concentration) for 42 hours. Inhibition of protein expression was confirmed by immunoblot analysis with specific antibodies. Stable Control and MOR Small Hairpin RNA Transfection in Human NSCLC Cells Stable Control and MOR shRNA (Santa Cruz Biotechnology Santa Cruz CA) were stably transfected into H358 cells as we have previously described [12]. Cells (?40% confluent) were serum-starved for 1 hour followed by incubated with shRNA for 6 hours in serum-free media. Serum-containing media was then added (10% serum final concentration) for 42 hours and puromycin selection reagent was added. Inhibition of protein expression was confirmed by immunoblot analysis with anti-MOR antibody (GeneTex San Antonio TX). Stable Vector Control and MOR1 Overexpression in Human NSCLC Cells Myc-DDK-tagged ORF clone of Homo sapiens opioid receptor mu 1 (OPRM1) transcript variant MOR-1 (OriGene Technologies Inc MD) was amplified using Platinum Taq DNA polymerase high fidelity enzyme (Invitrogen CA) and subsequently cloned into a pCR8/GW/Topo entry vector (Invitrogen CA) according to manufacturer's instructions. Plasmid DNA was extracted from selected clones by QIAquick Plasmid Mini kit (Qiagen CA). ORF integrity and fragment orientation were confirmed by sequencing. The MOR1-Myc fusion product was then transferred to pcDNA3.2/v5 DEST vector (Invitrogen CA) by LR reaction. The resulting construct (pcDNA3.2-MOR1-Myc) was transfected into H358 cells using FuGENE HD„¢ as the transfection reagent (Roche Applied Sciences) according to the protocol provided by Roche as we have previously described. Cells (?40% confluent) were serum-starved for 1 hour followed by incubation with pcDNA3.2-MOR1-Myc for 6 hours in serum-free media. Serum-containing media was then added (10% serum final concentration) for 42 hours and neomycin selection reagent was added. Overexpression was confirmed by immunoblot analysis with anti-MOR antibody (GeneTex San Antonio TX). Human NSCLC Cell Proliferation Assay Measurement of in vitro NSCLC cell growth was performed as we have previously described. Control or siRNA pretreated H358 cells (5—103 cells/well) were incubated with 0.2 ml of serum-free media containing either vehicle (control) methylnaltrexone (MNTX 100 nM) the PI3 kinase inhibitor LY294002 (10 uM) Akt Inhibitor X (5 uM) the Src family kinase inhibitor PP2 (100 nM) or the STAT3 inhibitor Stattic (10 uM) for 72 h at 37°C in 5%CO2/95% air in 96-well culture plates. The in vitro cell proliferation assay was analyzed by measuring increases in cell number using the CellTiter96„¢ MTS assay (Promega Madison WI) and read at 492 nm. Each assay was set up in triplicate and repeated at least five times. Human NSCLC Cell Migration Assay Measurement of in vitro NSCLC cell migration was performed as we have previously described. Twenty-four transwell units with 8 µM pore size (Millipore Billerica MA) were used for monitoring in vitro cell migration as we have previously described [12]. Control or siRNA pretreated H358 cells (5—103 cells/well) were incubated with 0.2 ml of serum-free media containing either vehicle (control) methylnaltrexone (MNTX 100 nM) the PI3 kinase inhibitor LY294002 (10 uM) Akt Inhibitor X (5 uM) the Src family kinase inhibitor PP2 (100 nM) or the STAT3 inhibitor Stattic (10 uM) were plated on the upper chamber and media with serum was added to the lower chamber. Cells were allowed to migrate through the pores for 18 hours. Cells from the upper and lower chamber were quantitated using the CellTiter96„¢ MTS assay (Promega San Luis Obispo CA) and read at 492 nm. % migration was defined as the # of cells in the lower chamber divided by the number of cells in both the upper and lower chamber. Each assay was set up in triplicate and repeated at least five times. Statistical Analysis Results are expressed as mean ± standard deviation of three independent experiments. For data analysis experimental samples were compared to controls by unpaired Student's t-test. For multiple-group comparisons a one-way variance analysis (ANOVA) and post hoc multiple comparisons tests were used. Differences between groups were considered statistically significant when P value was less than 0.05. All statistical analyses were performed using the GraphPad Prism program (GraphPad Software Inc. USA). Results Our results in indicate that inhibiting MOR with the peripheral MOR antagonist MNTX attenuates EGF-induced proliferation (-A) and migration (-B) of human H358 NSCLC cells in a dose-dependent manner. These data suggest a link between MOR and the EGFR in H358 cells. To mechanistically evaluate the role of MOR on EGF-induced EGFR dynamics we treated H358 cells with EGF at various times and immunoprecipitated the EGFR to determine potential MOR association. -A demonstrates that EGF induces a complex formation between the EGFR and MOR which peaks at 5 to 15 minutes after EFG challenge. Based on our results that a MOR/EGFR complex can occur with EGF stimulation of H358 cells we next examined whether MOR can regulate EGFR phosphorylation. Utilizing a panel of anti-phospho-EGFR antibodies -B demonstrates that pretreatment of H358 human NSCLC cells with the peripheral MOR antagonist MNTX failed to attenuate EGF-induced EGFR tyrosine phosphorylation. .0091577.g001 The peripheral mu opioid receptor antagonist methylnaltrexone (MNTX) inhibits epidermal growth factor (EGF)-induced proliferation and migration of human lung cancer cells in a dose-dependent manner. Panel A: Human H358 non-small cell lung cancer (NSCLC) cells were analyzed for methylnaltrexone (MNTX) inhibition of EGF-mediated proliferation using a MTS proliferation assay. Cells were growth in the presence of 100 ng/ml EGF and/or 0“250 nM MNTX for 72 hours. MNTX There is a statistically significant difference (p<0.05 indicated by an asterisks) between control and MNTX (1050100 250 nM) treatment with n?=?3 per condition and error bars?=?standard deviation. See the Methods section for experimental details. Panel B: Human H358 non-small cell lung cancer (NSCLC) cells were analyzed for methylnaltrexone (MNTX) inhibition of EGF-mediated migration using a transwell assay (8 uM pore size). Cells were allowed to migrate in the presence of 100 ng/ml EGF and/or 0“250 nM MNTX for 18 hours. There is a statistically significant difference (p<0.05 indicated by an asterisks) between control and MNTX (50100 250 nM) treatment with n?=?3 per condition and error bars?=?standard deviation. See the Methods section for experimental details. .0091577.g002 The mu opioid receptor (MOR) is recruited to the EGF receptor with EGF stimulation but does not regulate EGF receptor phosphorylation. Panel A: Human H358 non-small cell lung cancer (NSCLC) cells were treated with no (control) or 100 ng/ml EGF for 515 or 30 minutes. Cell lysates were obtained and immunoprecipitated with anti-EGFR antibody. Immunoblots were performed on total cell lysates (left) and immunoprecipitated material (right) using anti-MOR (a) and anti-EGFR (b) antibodies. The mu opioid receptor is recruited to the EGFR with EGF stimulation. Panel B: Human H358 non-small cell lung cancer (NSCLC) cells were either untreated (control) or treated with 100 nM MNTX alone 10 ng/ml EGF for 5 15 or 30 minutes or 100 nM MNTX and 10 ng/ml EGF for 515 or 30 minutes. Cell lysates were obtained and immunoblotted using anti-pY845 EGFR (a) anti-pY992 EGFR (b) anti-pY1045 EGFR (c) anti-pY1068 EGFR (d) anti-EGFR (e) and anti-actin (e) antibodies. MNTX does not inhibit EGF-induced EGFR tyrosine phosphorylation. We next examined whether MOR can regulate EGFR downstream signaling molecules. We first examined the adaptor protein Growth factor receptor-bound protein 2 (Grb-2)"

Lung_Cancer

"The estimate of the OR of each individual trial corresponds to the middle of the squares and horizontal line gives the 95% CI.On each linethe numbers of events as a fraction of the total number randomized are shown for both treatment groups.For each subgroupthe sum of the statistics along with the summary OR is represented by the middle of the solid diamonds.A test of heterogeneity between the trials within a subgroup is given below the summary statistics. .0085329.g004 5-year survival rate. Forest plot of the Odds Ratio(OR) of the 5-year survival rate following VATS versus open thoracotomy for metastatic lung cancer.The estimate of the OR of each individual trial corresponds to the middle of the squares and horizontal line gives the 95% CI.On each linethe numbers of events as a fraction of the total number randomized are shown for both treatment groups.For each subgroupthe sum of the statistics along with the summary OR is represented by the middle of the solid diamonds.A test of heterogeneity between the trials within a subgroup is given below the summary statistics. Four studies compared the 1-year disease free survival rate (OR?=?1.31; 95% CI 0.79“2.19; p?=?0.30)finding no significant heterogeneity among these studies (x2?=?1.82P?=?0.61I2?=?0%) (Fig 5) and four studies compared the 3-year disease free survival rate (OR?=?0.59; 95% CI0.38“0.91; p?=?0.02) finding no significant heterogeneity (x2?=?1.82P?=?0.61I2?=?0%) between the patients who underwent VATS and those who underwent open thoracotomy (Fig 6). Because of the heterogeneity in the sample size sensitivity analyses were conducted using larger sample size studies; however there was no difference between the two surgical methods with an OR of 1.71 (95% CI1.02“2.89) and with heterogeneity (?2?=? 3.07P ?=?0.22 I2?=?35%). There were significant 3-year disease free survival rate benefits with open thoracotomy. We attempted to evaluate the 5-year disease free survival rate.Only two studies reported these ratesand the published data were not sufficient for the combined analysis. .0085329.g005 1-year disease-free survival rate. Forest plot of the Odds Ratio(OR) of the 1-year disease free survival rate following VATS versus open thoracotomy for metastatic lung cancer.The estimate of the OR of each individual trial corresponds to the middle of the squares and horizontal line gives the 95% CI.On each linethe numbers of events as a fraction of the total number randomized are shown for both treatment groups.For each subgroupthe sum of the statistics along with the summary OR is represented by the middle of the solid diamonds.A test of heterogeneity between the trials within a subgroup is given below the summary statistics. .0085329.g006 3-year disease-free survival rate. Forest plot of the Odds Ratio(OR) of the 3-year survival rate following VATS versus open thoracotomy for metastatic lung cancer.The estimate of the OR of each individual trial corresponds to the middle of the squares and horizontal line gives the 95% CI.On each linethe numbers of events as a fraction of the total number randomized are shown for both treatment groups.For each subgroupthe sum of the statistics along with the summary OR is represented by the middle of the solid diamonds.A test of heterogeneity between the trials within a subgroup is given below the summary statistics. Publication bias Publication bias might exist when nonsignificant findings remain unpublishedthus artificially inflating the apparent magnitude of an effect.The funnel plots of the study are shown in .The funnel plots of the 1-year survival rate following VATS and thoracotomy for the treatment of metastatic lung cancer showed asymmetry which suggested that there was some publication bias. .0085329.g007 Funnel plot of the outcome of 1-year survival rate. Discussion Many tumors can metastasize to the lungand colorectal and breast tumors are the most common primary tumors[9].Pulmonary resection has been shown to be beneficial for patients with resectable and isolated pulmonary metastases[10]. Traditional open thoracotomy and VATS are two principally different surgical methods for pulmonary metastasectomy.The selection of an approach depends more on the theoretical knowledge and personal experience of the surgeon than on the evidence. Over the past two decades several studies have demonstrated the benefits of VATS that included less postoperative pain shorter hospital stays a smaller degree of immunosuppression and enhanced recovery and the ability to tolerate adjuvant therapy[11]“[13]. Whether the long-term advantages are comparable to those of open thoracotomy is not well documented. The major deficiency of the VATS approach is that nodules might be undetected by VATS that might be detected by manual palpation during thoracotomy; such missing nodules are not imaged on a preoperative CT scan. The VATS approach has long been controversial because VATS does not consistently detect all the metastases and it is recognized that complete resection remains a major determining factor of survival [14].The detection rate of HRCT for pulmonary metastases is 78“84%[15]“[17].Kayton[18]found that 35% of the pathologically verified metastases were missed by CT. In the International Registry of Lung Metastases study of 5206 patients the 5-year survival rate was 36% for complete resection compared with 13% incomplete resectoin[19]. It is not certain whether the nodule imaged on a CT scan and resected by VATS is the correct one [14]. Those who disagree with the use of VATS hypothesize that VATS-related recurrence is commonly observed including port-site recurrence and resection stump recurrence[20]. Johnstone reported 23 cases of port-site chest wall recurrence related to VATS[21]. They hypothesized that the thoracoscopic approach should only be used in patients with a solitary lesion and when resection is requried for diagnostic purposes. The surgeons who favor the VATS approach advocate that VATS minimizes pain and trauma to the patients and that the VATS group might have an improved tolerance of chemotherapy which would likely ensure delivery of planned post-resection adjuvant therapy without a reduction in dosage or delay. The standard surgical procedure for pulmonary metastases is wedge resection that usually does not require manipulation of the pulmonary hilum which is appropriate for the VATS approach.They hypothesiezd that a lesion overlooked by CT but detected by palpation might not result in a survival gain[22] [23] and may be partially compensated for by carefully follow-up.Flores[24] hypothesized that the VATS group might demonstrate a great number of metachronous tumors over time;however the metachronous lesions in each group was similar. Our work suggests that thoracoscopic resection of metastatic lung cancer is a safe and curative procedure with 13 and 5-year survival rates comparable to those of thoracotomy. Patients with metastatic lung cancer are likely to relapse in the lung and after lung metastasectomy by VATS patients might benefit from a second metastasectomy. We hypothesize that earlier chemotherapy and radiation are essential to maximizing survival. Our study might be subject to pretreatment selection bias because most of the patients selected for open thoracotomy had multiple lesions and high risk and were not suitable for treatment with VATS.The missing lesions perhaps skewed the data more toward VATS as an equivalent procedure. We were also interested in the recurrence of cancerand the disease-free survival rates were evaluated. This study demonstrates a similar 1-year disease-free survival rate;however the 3-year disease-free survival rate is inferior for three reasons. First unrelated cancer deaths were included in our analysis of the 13 and 5-year overall survival which might account for VATS having a comparable overall survival rate but an inferior disease-free survival rate. Secondthe patients in the VATS group might have lesions that are missed and there are more likely to relapse in the lung leading to the inferior 3-year disease-free survival rate.Third some of our included studies were in the early period of VATS development when the technology was immature and some of the complications can now be prevented with more experience. Schaeff[25] reported 23 cases of port-site recurrence associated with VATS that occurred before 1998.The number of cases studied was small and the observation period was limitied. Spiral computed tomography has a far higher detection rate today than it did 20 years ago;so small lesions can be accurately localized before surgery[26] which ensures the success of VATS. With advances in imaging technology palpaiton during open thoracotomy is becoming less important.The latest VATS technology has a high-definition resolution and the flexible-tip thoracoscope enables complete inspection of the pleural cavity.These advancements ensure that VATS is an ideal method for patients with a solitary and relatively small peripheral lesions.Tamas[27] hypothesizes that palpation is necessary in a therapeutic metastasectomy as opposed to a diagnostic procedure.Whether patients with multiple lesions should be treated with open thoracotomy or VATS is controversial. This study is the first meta-analysis of the oncological outcome of thoracoscopic surgery for the treatment of metastatic lung cancer. In our work we observed that VATS might be a promising treatment for metastatic lung cancer. No randomized trials existing to guide doctors in the field of metastatic lung cancer currently. A prospective randomized study of the different surgical strategies is needed. Limitation No randomized controlled trials existing to comparing VATS with thoracotomy have been conducted. Heterogeneity was observed between the sample size and the years covered. Most studies are limited to small observational studies and single-institution case series. For these reasonsthere are only a total of 546 patients were included in the two groups for a study period spans more than a decade. Two of the studies comprise almost 65% of the patients and one study has only 20 patients; there are potential sources of bias in our work.Additional randomized controlled trials in the studies we accessed would have increased the strength of our results.There is a bias for the English language. Conclusion In our meta-analysis we found that for patients with metastatic lung cancer comparing VATS with thoracotomy showed almost equivalent survival rates. The VATS can not replace open thoracotomy completely. Further study is neededand a large multicenter randomized trial comparing VATS and thoracotomy would be ideal. Supporting Information Checklist S1 PRISMA Checklist. (DOC) Click here for additional data file. References 1 RuschVW (2010) Pulmonary metastasectomy: a moving target. J Thorac Oncol5: S130“13120502246 2 CassonAG PutnamJB NatarajanG JohnstonDA MountainC et al (1992) Five-year survival after pulmonary metastasectomy for adult soft tissue sarcoma. Cancer69: 662“6681730117 3 van HalterenHK van GeelAN HartAA ZoetmulderFA (1995) Pulmonary resection for metastases of colorectal origin. Chest107: 1526“15317781341 4 KandiolerD KromerE TuchlerH EndA MullerMR et al (1998) Long-term results after repeated surgical removal of pulmonary metastases. Ann Thorac Surg65: 909“9129564899 5 McCormackPM BainsMS BeggCB BurtME DowneyRJ et al (1996) Role of video-assisted thoracic surgery in the treatment of pulmonary metastases: results of a prospective trial. Ann Thorac Surg62: 213“216 discussion 216“217.8678645 6 SaishoS NakataM SawadaS YamashitaM SaekiH et al (2009) Evaluation of video-assisted thoracoscopic surgery for pulmonary metastases: 11-years of experience. Surg Endosc23: 55“6118437482 7 CerfolioRJ BryantAS McCartyTP MinnichDJ (2011) A prospective study to determine the incidence of non-imaged malignant pulmonary nodules in patients who undergo metastasectomy by thoracotomy with lung palpation. Ann Thorac Surg91: 1696“1700 discussion 1700“1691.21619965 8 DownsSH BlackN (1998) The feasibility of creating a checklist for the assessment of the methodological quality both of randomised and non-randomised studies of health care interventions. J Epidemiol Community Health52: 377“3849764259 9 KondoH OkumuraT OhdeY NakagawaK (2005) Surgical treatment for metastatic malignancies. Pulmonary metastasis: indications and outcomes. Int J Clin Oncol10: 81“8515864692 10 PorterGA CantorSB WalshGL RuschVW LeungDH et al (2004) Cost-effectiveness of pulmonary resection and systemic chemotherapy in the management of metastatic soft tissue sarcoma: a combined analysis from the University of Texas M. D. Anderson and Memorial Sloan-Kettering Cancer Centers. J Thorac Cardiovasc Surg127: 1366“137215115994 11 PetersenRP PhamD BurfeindWR HanishSI TolozaEM et al (2007) Thoracoscopic lobectomy facilitates the delivery of chemotherapy after resection for lung cancer. Ann Thorac Surg83: 1245“1249 discussion 1250.17383320 12 PaulS AltorkiNK ShengS LeePC HarpoleDH et al (2010) Thoracoscopic lobectomy is associated with lower morbidity than open lobectomy: a propensity-matched analysis from the STS database. J Thorac Cardiovasc Surg139: 366“37820106398 13 WhitsonBA GrothSS DuvalSJ SwansonSJ MaddausMA (2008) Surgery for early-stage non-small cell lung cancer: a systematic review of the video-assisted thoracoscopic surgery versus thoracotomy approaches to lobectomy. Ann Thorac Surg86: 2008“2016 discussion 2016“2008.19022040 14 EckardtJ LichtPB (2012) Thoracoscopic versus open pulmonary metastasectomy: a prospective sequentially controlled study. Chest142: 1598“160222677347 15 AmbrogiV PaciM PompeoE MineoTC (2000) Transxiphoid video-assisted pulmonary metastasectomy: relevance of helical computed tomography occult lesions. Ann Thorac Surg70: 1847“185211156082 16 MargaritoraS PorziellaV D'AndrilliA CesarioA GalettaD et al (2002) Pulmonary metastases: can accurate radiological evaluation avoid thoracotomic approach? Eur J Cardiothorac Surg21: 1111“111412048094 17 ParsonsAM DetterbeckFC ParkerLA (2004) Accuracy of helical CT in the detection of pulmonary metastases: is intraoperative palpation still necessary? Ann Thorac Surg78: 1910“1916 discussion 1916“1918.15561000 18 KaytonML HuvosAG CasherJ AbramsonSJ RosenNS et al (2006) Computed tomographic scan of the chest underestimates the number of metastatic lesions in osteosarcoma. J Pediatr Surg41: 200“206 discussion 200“206.16410133 19 Long-term results of lung metastasectomy: prognostic analyses based on 5206 cases. The International Registry of Lung Metastases. J Thorac Cardiovasc Surg113: 37“499011700 20 MutsaertsEL ZoetmulderFA RutgersEJ (2001) Port site metastasis as a complication of thoracoscopic metastatectomy. Eur J Surg Oncol27: 327“32811373113 21 JohnstonePA RohdeDC SwartzSE FetterJE WexnerSD (1996) Port site recurrences after laparoscopic and thoracoscopic procedures in malignancy. J Clin Oncol14: 1950“19568656265 22 TreasureT (2007) Pulmonary metastasectomy: a common practice based on weak evidence. Ann R Coll Surg Engl89: 744“74817999813 23 RothJA PassHI WesleyMN WhiteD PutnamJB et al (1986) Comparison of median sternotomy and thoracotomy for resection of pulmonary metastases in patients with adult soft-tissue sarcomas. Ann Thorac Surg42: 134“1383741009 24 FloresRM IhekweazuUN RizkN DycocoJ BainsMS et al (2011) Patterns of recurrence and incidence of second primary tumors after lobectomy by means of video-assisted thoracoscopic surgery (VATS) versus thoracotomy for lung cancer. J Thorac Cardiovasc Surg141: 59“6421055770 25 SchaeffB PaolucciV ThomopoulosJ (1998) Port site recurrences after laparoscopic surgery. A review. Dig Surg15: 124“1349845574 26 ChenYR YeowKM LeeJY SuIH ChuSY et al (2007) CT-guided hook wire localization of subpleural lung lesions for video-assisted thoracoscopic surgery (VATS). J Formos Med Assoc106: 911“91818063512 27 MolnarTF GebitekinC TurnaA (2010) What are the considerations in the surgical approach in pulmonary metastasectomy? J Thorac Oncol5: S140“14420502249 28 NakajimaJ TakamotoS TanakaM TakeuchiE MurakawaT et al (2001) Thoracoscopic surgery and conventional open thoracotomy in metastatic lung cancer. Surg Endosc15: 849“85311443456 29 MutsaertsEL ZoetmulderFA MeijerS BaasP HartAA et al (2002) Long term survival of thoracoscopic metastasectomy vs metastasectomy by thoracotomy in patients with a solitary pulmonary lesion. Eur J Surg Oncol28: 864“86812477479 30 NakasA KlimatsidasMN EntwisleJ Martin-UcarAE WallerDA (2009) Video-assisted versus open pulmonary metastasectomy: the surgeon's finger or the radiologist's eye? Eur J Cardiothorac Surg36: 469“47419464921 31 CarballoM MaishMS JaroszewskiDE HolmesCE (2009) Video-assisted thoracic surgery (VATS) as a safe alternative for the resection of pulmonary metastases: a retrospective cohort study. J Cardiothorac Surg4: 1319239710 32 GossotD RaduC GirardP Le CesneA BonvalotS et al (2009) Resection of pulmonary metastases from sarcoma: can some patients benefit from a less invasive approach? Ann Thorac Surg87: 238“24319101304 33 ChaoYK ChangHC WuYC LiuYH HsiehMJ et al (2012) Management of lung metastases from colorectal cancer: video-assisted thoracoscopic surgery versus thoracotomy”a case-matched study. Thorac Cardiovasc Surg60: 398“40422228090 101150042 30118 Mol Cancer Res Mol. Cancer Res. Molecular cancer research : MCR 1541-7786 1557-3125 24202705 3946989 10.1158/1541-7786.MCR-13-0300 NIHMS538386 Article œNEDD9 Depletion Leads to MMP14 Inactivation by TIMP2 and Prevents Invasion and Metastasis. McLaughlin Sarah L. 5 * Ice Ryan J. 5 * Rajulapati Anuradha 5 Kozyulina Polina Y. 1 Livengood Ryan H. 4 Kozyreva Varvara K. 5 Loskutov Yuriy V. 5 Culp Mark V. 3 Weed Scott A. 2 5 Ivanov Alexey V. 1 5 Pugacheva Elena N. 1 5 # 1Department of Biochemistry West Virginia University School of Medicine Morgantown WV 26506 2Department of Neurobiology and Anatomy West Virginia University School of Medicine Morgantown WV 26506 3Department of Statistics West Virginia University School of Medicine Morgantown WV 26506 4Department of Pathology West Virginia University School of Medicine Morgantown WV 26506 5Mary Babb Randolph Cancer Center West Virginia University School of Medicine Morgantown WV 26506 #Corresponding author: Elena N. Pugacheva Mailing address: Department of Biochemistry and Mary Babb Randolph Cancer Center PO Box 9142 1 Medical Center Drive West Virginia University School of Medicine Morgantown WV 26506. Phone: (304) 293-5295; Fax: (304) 293-4667; epugacheva@hsc.wvu.edu S.L. McLaughlin* and R. J. Ice* contributed equally to this work. 17 12 2013 07 11 2013 1 2014 01 1 2015 12 1 69 81 The scaffolding protein NEDD9 is an established pro-metastatic marker in several cancers. Nevertheless the molecular mechanisms of NEDD9 driven metastasis in cancers remain ill defined. Here using a comprehensive breast cancer (BCa) tissue microarray it was show that increased levels of NEDD9 protein significantly correlated with the transition from carcinoma in situ to invasive carcinoma. Similarly it was shown that NEDD9 overexpression is a hallmark of highly invasive BCa cells. Moreover NEDD9 expression is crucial for the protease-dependent mesenchymal invasion of cancer cells at the primary site but not at the metastatic site. Depletion of NEDD9 is sufficient to suppress invasion of tumor cells in vitro and in vivo leading to decreased circulating tumor cells (CTCs) and lung metastases in xenograft models. Mechanistically NEDD9 localized to invasive pseudopods and was required for local matrix degradation. Depletion of NEDD9 impaired invasion of cancer cells through inactivation of membrane-bound matrix metalloproteinase MMP14 by excess TIMP2 on the cell surface. Inactivation of MMP14 is accompanied by reduced collagenolytic activity of soluble metalloproteinases MMP2 and MMP9. Re-expression of NEDD9 is sufficient to restore the activity of MMP14 and the invasive properties of BCa cells in vitro and in vivo. Collectively these findings uncover critical steps in NEDD9-dependent invasion of BCa cells. Implications This study provides a mechanistic basis for potential therapeutic interventions to prevent metastasis. NEDD9 invasion metastasis breast cancer MMP14 Int J Occup Environ Health Int J Occup Environ Health OEH International Journal of Occupational and Environmental health 1077-3525 2049-3967 Maney Publishing Suite 1C Joseph's Well Hanover Walk Leeds LS3 1AB UK 24999846 4090870 2014_1 10.1179/1077352514Z.000000000104 Original Article Dust diseases and the legacy of corporate manipulation of science and law Dust diseases Egilman David 1 Bird Tess 2 Lee Caroline 2 1 Department of Community Health Brown University Attleboro MA USA 2 Never Again Consulting Attleboro MA USA Correspondence to: David Egilman 8 North Main Street Suite 404 Attleboro MA 02703 USA. Email: degilman@egilman.com 4 2014 20 2 115 125 © W. S. Maney & Son Ltd 2014 2014 Background"

Lung_Cancer

"The mean Ct values for these five miRNAs were calculated excluding outliers (i.e. replicates with Ct values differing by more than one cycle from the median). In addition if CtU6ave and CtU48ave each did not occur within 32 cycles the assay was repeated. Samples with low U6 or U48 snRNA levels were not excluded from data analyses. Statistical analysis All statistical analyses were performed using GraphPad Prism 5.0 software (GraphPad Software Inc. San Diego CA USA). The data were analyzed using homogeneity of variance. One-way ANOVA or Wilcoxon two-sample tests were used to test for associations between miRNA expression levels and clinicopathological features of the patients. A paired sample t-test was used to compare differences in miRNA expression between lung tissue and serum samples. Receiver operating characteristic (ROC) curves were generated to assess the diagnostic accuracy of each parameter. Patient survival was estimated by the Kaplan-Meier method and the log-rank test was used to compare the survival between groups. The Cox hazard regression model was used to analyze the risk factors for NSCLC. All statistical tests were two-sided and a P value of 0.05 was considered statistically significant. Results Differential expression of three miRNAs in NSCLC tissue and patient sera Based on our miRNA array (Agilent) and validation data we selected three miRNAs (miR-29c miR-93 and miR-429) for further study in NSCLC samples. We performed qRT-PCR analysis for these three miRNAs in 70 pairs of NSCLC and corresponding noncancerous lung tissues. Our data showed that levels of miR-29c and miR-93 expression were upregulated in NSCLC tissues compared to the corresponding noncancerous lung tissues (P?=?0.0408 and P?=?0.0444 respectively) whereas miR-429 levels were not significantly different between NSCLC and noncancerous lung tissues (P?=?0.3903 A). .0087780.g001 Differential expression of miRNAs in NSCLC. A qRT-PCR detection of three miRNAs in 70 NSCLC tumors and the corresponding normal lung tissues. P-values for miR-29c miR-93 and miR-429 were 0.04080.0444 and 0.3903 respectively using a paired sample t-test. B qRT-PCR analysis of serum miRNA levels in serum samples of 70 NSCLC patients vs. 48 healthy controls. P-values of serum miR-29c miR-93 and miR-429 were 0.00120.9291 and 0.0001 respectively using an unpaired sample t-test. C D E Association of these miRNA levels between NSCLC tissue and serum samples. Pearson correlation test showed that miR-429 expression in serum was significantly associated with that in NSCLC tissues (r?=?0.3578 P?=?0.0024) whereas serum levels of miR-29c and miR-93 were not associated with those in NSCLC tissues (r?=??0.07877 P?=?0.5169 and r?=?0.1515 P?=?0.2105 respectively). *P<0.05 between groups. We then investigated whether these differences in miRNA expression were present in serum samples from these patients. We found that serum miR-93 expression did not differ between NSCLC patients and healthy controls (P?=?0.3530). However miR-29c expression was significantly increased serum from NSCLC patients (P?=?0.0012) and miR-429 expression was significantly decreased (P?=?0.0001 B). The serum level of miR-429 expression was significantly correlated with that in NSCLC tissues (r?=?0.3578 P?=?0.0024 E) whereas serum levels of miR-29c and miR-93 expression were not associated with those in NSCLC tissues (r?=??0.07877 P?=?0.5169 and r?=?0.1515 P?=?0.2105 respectively C and D). Associations between altered miRNA expression and clinical characteristics of NSCLC We next investigated associations between the altered miRNA expression levels (miR-29c and miR-93 in NSCLC and miR-29c and miR-429 in serum) with the clinicopathological characteristics of the NSCLC patients. We found that increased miR-93 expression was strongly associated with NSCLC histology (P?=?0.031 ) whereas serum miR-29c expression was associated with abnormal CEA levels (P?=?0.030 ). In contrast no other associations were detected between the expression levels of these miRNAs. Furthermore we plotted expression data for miR-29c and miR-429 using ROC curves to identify a cut-off value that could distinguish lung cancer patients from healthy controls. ROC curve analysis showed that at the optimal cut-off serum levels of miR-29c had a sensitivity of 65.7% and a specificity of 74.1% for distinguishing NSCLC patients from healthy controls with an area under the curve (AUC) of 0.676 (P?=?0.0004 95% confidence interval [CI]: 0.584“0.759 A). In addition serum levels of miR-429 had a sensitivity of 54.3% and a specificity of 81.2% for distinguishing NSCLC patients from healthy controls with an AUC of 0.713 (P<0.0001 95% CI: 0.623“0.793 B)."

Lung_Cancer

"Since activation of the adaptive T cell response previously has been demonstrated to peak around day 10“14 post vaccination with Ad-Ii-GP or Ad-GP it was somewhat unexpected to find that previous vaccination did not cause any difference in gene expression under these conditions [12] [21]. However this probably reflects that it takes some time for the vaccine-induced antigen-specific T cells to accumulate in sufficient numbers in the lungs even at the height of the immune response. Thus if the lungs were isolated from similarly treated mice 11 days after tumor inoculation a clear-cut difference in the gene expression was found when comparing vaccinated and non-vaccinated mice. This capacity to control tumor gene expression was maintained for at least a month and probably longer after vaccination. Finally we found that if mice were challenged at the peak of the primary CD8 T cell response no more than 4 days were required to demonstrate a distinct difference between vaccinated and unvaccinated mice. Taken together these results imply that prophylactic vaccination with Ad-GP or Ad-Ii-GP in particular can protect against melanoma metastasis to the lungs. Direct comparison of our Q-PCR method to conventional analysis involving counting of metastatic foci under a dissection microscope revealed that tumor control could be detected earlier by our new method. Thus metastatic foci could not be counted with certainty until day 5“6 after challenge while a reduction in tumor gene expression may already be observed by day 4. More importantly as it could be argued that reduction of tumor gene expression might not reflect reduced tumor growth we would like to stress that parallel results were obtained when tumor metastasis was evaluated under the same conditions using the two different methodologies. Perhaps the most important difference between the two assays lies in the fact that while visual inspection only considers numbers of metastatic foci regardless of size the Q-PCR approach takes into account not only numbers of foci but also numbers of cells per metastatic focus thus delivering a more quantitative representation of tumor cell growth. This difference may be of particular relevance in situations where the antitumor effect under investigation is predominantly exerted at a late stage after metastasis rather than targeting the metastatic tumor cell itself. In clinical settings surgical removal of primary tumors has been demonstrated to increase the risk of tumor metastasis since it can result in the release of tumor cells into the circulation [26]“[29]. It has also been found that surgery may promote metastasis indirectly by inducing growth of pre-established micrometastasis through the reduction of anti-angiogenic factors through the increase of released growth factors as well as by the induction of immunosuppression caused by the medical procedure or perioperative stress and anxiety [26]. Trying to mimic the situation of vaccination simultaneously with surgically induced metastasis mice were vaccinated and tumor challenged on the same day and lungs were isolated 11 days later. Interestingly we found a clear difference in melanoma gene expression between vaccinated and non-vaccinated mice. In addition Ad-Ii-GP vaccinated mice showed improved protection against metastasis compared to Ad-GP. These results suggest that in a clinical setting vaccination with a vector such as Ad-Ii-GP concurrent with surgical removal of the primary tumor may substantially reduce the likelihood of metastatic spread caused by the surgery. Finally previous studies have shown that the Ad-Ii-GP-induced control of solid s.c. B16.F10gp tumors is dependent on CD8 T cells and IFN? acting predominantly in a direct fashion on the tumor cells [13]."

Lung_Cancer

"involvement to disclose. 1 Nakashima S Watanabe A Obama T Yamada G Takahashi H Higami T Need for preoperative computed tomography-guided localization in video-assisted thoracoscopic surgery pulmonary resections of metastatic pulmonary nodules Ann Thorac Surg 2010 89 212 218 20103238 2 Chen S Zhou J Zhang J Hu H Luo X Zhang Y Chen H Video-assisted thoracoscopic solitary pulmonary nodule resection after CT-guided hookwire localization: 43 cases report and literature review Surg Endosc 2011 25 1723 1729 21181200 3 Ciriaco P Negri G Puglisi A Nicoletti R Del Maschio A Zannini P Video-assisted thoracoscopic surgery for pulmonary nodules: rationale for preoperative computed tomography-guided hookwire localization Eur J Cardiothorac Surg 2004 25 429 433 15019673 4 Suzuki K Nagai K Yoshida J Ohmatsu H Takahashi K Nishimura M Nishiwaki Y Video-assisted thoracoscopic surgery for small indeterminate pulmonary nodules: indications for preoperative marking Chest 1999 115 563 568 10027460 5 Seo JM Lee HY Kim HK Choi YS Kim J Shim YM Lee KS Factors determining successful computed tomography-guided localization of lung nodules J Thorac Cardiovasc Surg 2012 143 809 814 22104686 6 Gossot D Miaux Y Guermazi A Celerier M Friga J The hook-wire technique for localization of pulmonary nodules during thoracoscopic resection Chest 1994 105 1467 1469 8181339 7 Pittet O Christodoulou M Pezzetta E Schmidt S Schnyder P Ris HB Video-assisted thoracoscopic resection of a small pulmonary nodule after computed tomography-guided localization with a hook-wire system: experience in 45 consecutive patients World J Surg 2007 31 575 578 17318707 8 Chen W Chen L Yang S Chen Z Qian G Zhang S Jing J A novel technique for localization of small pulmonary nodules Chest 2007 131 1526 1531 17494801 9 Bernard A Resection of pulmonary nodules using video-assisted thoracic surgery: the Thorax Group Ann Thorac Surg 1996 61 202 204 8561553 10 Martin AE Chen JY Muratore CS Mayo-Smith WW Luks FI Dual localization technique for thoracoscopic resection of lung lesions in children J Laparoendosc Adv Surg Tech A 2009 19 S161 S164 18999984 11 Kawanaka K Nomori H Mori T Ikeda K Ikeda O Tomiguchi S Yamashita Y Marking of small pulmonary nodules before thoracoscopic resection: injection of lipiodol under CT-fluoroscopic guidance Acad Radiol 2009 16 39 45 19064210 12 Yamagami T Miura H Yoshimatsu R Tanaka O Ono S Iehara T Hosoi H Nishimura T Experience of fluoroscopy-aided thoracoscopic resection of pulmonary nodule localised with Lipiodol in a child J Med Imaging Radiat Oncol 2011 55 401 403 21843175 13 Iwasaki Y Nagata K Yuba T Hosogi S Kohno K Ohsugi S Kuwahara H Takemura Y Yokomura I Fluoroscopy-guided barium marking for localizing small pulmonary lesions before video-assisted thoracic surgery Respir Med 2005 99 285 289 15733503 14 Yoshida J Nagai K Nishimura M Takahashi K Computed tomography-fluoroscopy guided injection of cyanoacrylate to mark a pulmonary nodule for thoracoscopic resection Jpn J Thorac Cardiovasc Surg 1999 47 210 213 10402768 15 Nomori H Horio H Colored collagen is a long-lasting point marker for small pulmonary nodules in thoracoscopic operations Ann Thorac Surg 1996 61 1070 1073 8607658 16 McConnell PI Feola GP Meyers RL Methylene blue-stained autologous blood for needle localization and thoracoscopic resection of deep pulmonary nodules J Pediatr Surg 2002 37 1729 1731 12483642 17 Hu J Zhang C Sun L Localization of small pulmonary nodules for videothoracoscopic surgery ANZ J Surg 2006 76 649 651 16813634 18 Wicky S Mayor B Cuttat JF Schnyder P CT-guided localizations of pulmonary nodules with methylene blue injections for thoracoscopic resections Chest 1994 106 1326 1328 7956378 19 Vandoni RE Cuttat JF Wicky S Suter M CT-guided methylene-blue labelling before thoracoscopic resection of pulmonary nodules Eur J Cardiothorac Surg 1998 14 265 270 9761435 20 Lenglinger FX Schwarz CD Artmann W Localization of pulmonary nodules before thoracoscopic surgery: value of percutaneous staining with methylene blue AJR Am J Roentgenol 1994 163 297 300 7518642 21 Ikeda K Nomori H Mori T Kobayashi H Iwatani K Yoshimoto K Kawanaka K Impalpable pulmonary nodules with ground-glass opacity: success for making pathologic sections with preoperative marking by lipiodol Chest 2007 131 502 506 17296654 22 Nomori H Horio H Naruke T Suemasu K Fluoroscopy-assisted thoracoscopic resection of lung nodules marked with lipiodol Ann Thorac Surg 2002 74 170 173 12118752 23 Watanabe K Nomori H Ohtsuka T Kaji M Naruke T Suemasu K Usefulness and complications of computed tomography-guided lipiodol marking for fluoroscopy-assisted thoracoscopic resection of small pulmonary nodules: experience with 174 nodules J Thorac Cardiovasc Surg 2006 132 320 324 16872957 24 Kim YD Jeong YJ I H Cho JS Lee JW Kim HJ Lee SH Kim DH Localization of pulmonary nodules with lipiodol prior to thoracoscopic surgery Acta Radiol 2011 52 64 69 21498328 25 Mayo JR Clifton JC Powell TI English JC Evans KG Yee J McWilliams AM Lam SC Finley RJ Lung nodules: CT-guided placement of microcoils to direct video-assisted thoracoscopic surgical resection Radiology 2009 250 576 585 19188326 26 Lee NK Park CM Kang CH Jeon YK Choo JY Lee HJ Goo JM CT-guided percutaneous transthoracic localization of pulmonary nodules prior to video-assisted thoracoscopic surgery using barium suspension Korean J Radiol 2012 13 694 701 23118567 27 Kamiyoshihara M Ishikawa S Morishita Y Pulmonary cryptococcosis diagnosed by video-assisted thoracoscopic surgery with CT-guided localization: report of a case Kyobu Geka 2000 53 795 797 10935411 28 Kwon WJ Kim HJ Jeong YJ Lee CH Kim KI Kim YD Lee JH Direct lipiodol injection used for a radio-opaque lung marker: stability and histopathologic effects Exp Lung Res 2011 37 310 317 21574876 29 Jang HS Effect of drugs for preoperative localization of thoracoscopy to histopathologic change in rabbit lung Seoul the Catholic University of Korea 2000 27 Dissertation 30 Okumura T Kondo H Suzuki K Asamura H Kobayashi T Kaneko M Tsuchiya R Fluoroscopy-assisted thoracoscopic surgery after computed tomography-guided bronchoscopic barium marking Ann Thorac Surg 2001 71 439 442 11235684 Fig. 1 Overview of the experimental design. Animals were randomly divided into two groups: Group A (n = 12) was sacrificed 6 hr after percutaneous injection and Group B (n = 12) was sacrificed 24 hr after a CT guided percutaneous injection of MLM and methylene blue. Fig. 2 Examples of evaluation of staining on the lung surface. Photographs show (A) the extensive staining (score 1) (B) localized dispersion of staining (score 2) and (C) minimal dispersion of staining (score 3). The white lines on the bottom of the figure are markings of the ruler. The distance between two lines is one centimeter. Fig. 3 Examples of assessment of radio-opacity on the fluoroscopic examinations. The fluoroscopic images show (A) a minimally increased opacity (arrow) (score 1) (B) a low density of increased opacity (arrow) (score 2) and (C) a compact nodular increased opacity (arrow) (score 3). Fig. 4 CT and corresponding photomicrograph of lung specimen. MLM in Group B (A-D); (A) discrete and compact nodular opacity (arrowheads) (B) focal neutrophil infiltration necrosis and hemorrhage (arrowheads) (H&E —12.5) (C) scattered small nodular opacities of lipiodol (long arrows) and faint nodular opacity (arrowheads) (D) focal hemorrhage and necrosis (arrowheads) with diffuse neutrophil infiltration (short arrows) (H&E —12.5). MLM in Group A (E F); (E) faint nodular lipiodol opacity (arrows) (F) focal hemorrhage (arrows) with diffuse neutrophil infiltration (arrowheads) (H&E —12.5). Methylene blue in Group A (G H); (G) faint nodular opacity (arrowheads) and (H) focal extent of neutrophil infiltration necrosis and hemorrhage (arrowheads) (H&E —12.5). Staining extent and localization ability of MLM versus methylene blue Data are mean±standard deviation. Numbers in parentheses are ranges. N/A indicates not available. *Non-parametric Mann-Whitney test was performed to compare the average score of MLM and methylene blue. MLM mixture of lipiodol and methylene blue. Localization ability score of staining and radio-opacity for MLM as well as methylene blue Data are numbers of subjects. Numbers in parentheses are percentages. MLM mixture of lipiodol and methylene blue. Table 3 Comparison of localization ability between MLM and methylene blue in total subjects (n = 42) We considered a score of 2 or 3 as appropriate and 3 as excellent for localization respectively. Numbers in parentheses are percentages. *Fisher's exact test compared the proportion of appropriate or excellent staining between the mixture and methylene blue. MLM mixture of lipiodol and methylene blue. Table 4 Localization ability of MLM: Evaluation of radio-opacity and staining score Data are given as numbers of subjects. Numbers in parentheses are percentages. MLM mixture of lipiodol and methylene blue. Table 5 Histopathologic findings of lung specimens after percutaneous injections Data are numbers of subjects. Numbers in parentheses are percentages. N/A indicates not available. *Linear by linear association was performed between material and the extent of the histopathologic findings. € Linear by linear association was performed between groups and the extent of the histopathologic findings. MLM mixture of lipiodol and methylene blue. PLoS One PLoS ONE plos plosone PLoS ONE 1932-6203 Public Library of Science San Francisco USA 24819391 4018408 PONE-D-13-46027 10.1371/journal.pone.0096911 Research Article Biology and Life Sciences Biochemistry Biomarkers Genetics Heredity Medicine and Health Sciences Diagnostic Medicine Epidemiology Biomarker Epidemiology Cancer Epidemiology Health Care Environmental Health Oncology Cancer Risk Factors Environmental Causes of Cancer Pathology and Laboratory Medicine Public and Occupational Health Pulmonology Environmental and Occupational Lung Diseases Single Nucleotide Polymorphism in ATM Gene Cooking Oil Fumes and Lung Adenocarcinoma Susceptibility in Chinese Female Non-Smokers: A Case-Control Study ATM Polymorphism and Risk of Lung Adenocarcinoma Shen Li 1 2 Yin Zhihua 1 2 Wu Wei 1 2 Ren Yangwu 1 2 Li Xuelian 1 2 Zhou Baosen 1 2 * 1 Department of Epidemiology School of Public Health China Medical University Heping District Shenyang Liaoning Province China 2 Key Laboratory of Cancer Etiology and Intervention University of Liaoning Province China Chang Jeffrey S. Editor National Health Research Institutes Taiwan * E-mail: bszhou@mail.cmu.edu.cn Competing Interests: The authors have declared that no competing interests exist. Conceived and designed the experiments: LS. Performed the experiments: LS YR XL. Analyzed the data: LS WW ZY. Contributed reagents/materials/analysis tools: LS ZY XL BZ. Wrote the paper: LS. Obtained informed consent from subjects: Baosen Zhou. 2014 12 5 2014 9 5 e96911 3 11 2013 12 4 2014 2014 Shen et al This is an open-access article distributed under the terms of the Creative Commons Attribution License which permits unrestricted use distribution and reproduction in any medium provided the original author and source are credited. Background The ataxia-telangiectasia mutated (ATM) gene plays an important role in the DNA double-strand breaks repair pathway. Single nucleotide polymorphisms (SNPs) of DNA repair genes are suspected to influence the risk of lung cancer. This study aimed to investigate the association between the ATM -111G>A (rs189037) polymorphism environmental risk factors and the risk of lung adenocarcinoma in Chinese female non-smokers. Methods A hospital-based case-control study of 487 lung cancer patients and 516 matched cancer-free controls was conducted. Information concerning demographic and environmental risk factors was obtained for each case and control by a trained interviewer. After informed consent was obtained 10 ml venous blood was collected from each subject for biomarker testing. Single nucleotide polymorphism was determined by using TaqMan method. Results This study showed that the individuals with ATM rs189037 AA genotype were at an increased risk for lung adenocarcinoma compared with those carrying the GA or GG genotype (adjusted odds ratios (OR) 1.44 95% confidence interval (CI) 1.02€“2.02 P?=?0.039). The stratified analysis suggested that increased risk associated with ATM rs189037 AA genotype in individuals who never or seldom were exposed to cooking oil fumes (adjusted OR 1.89 95%CI 1.03€“3.49 P?=?0.040). Conclusions ATM rs189037 might be associated with the risk of lung adenocarcinoma in Chinese non-smoking females. Furthermore ATM rs189037 AA genotype might be a risk factor of lung adenocarcinoma among female non-smokers without cooking oil fume exposure. This study was supported by grant no. 81272293 from National Natural Science Foundation of China grant no. 81102194 from National Natural Science Foundation of China and grant no. 00726 from China Medical Board. The funders had no role in study design data collection and analysis decision to publish or preparation of the manuscript. Introduction Lung cancer is the leading cause of cancer-related deaths both worldwide and in China. Although cigarette smoke is the major risk factor for lung cancer only a fraction of smokers develop this disease [1] suggesting that host genetic susceptibility may play an important role in the development of lung cancer. Recent genetic susceptibility studies of lung cancer have focused on single nucleotide polymorphisms (SNPs) in candidate genes among which DNA repair genes are increasingly studied because of their critical role in maintain genome integrity. Genetic variations in DNA repair genes are thought to affect DNA repair capacity and deficits in DNA repair capacity may lead to genetic instability and carcinogenesis [2] [3]. As one of the DNA repair genes ataxia-telangiectasia mutated (ATM) gene which is responsible for the multisystem autoxomal recessive disorder ataxia-telangiectasia (A€“T) plays a crucial role in the recognition signaling and repair of DNA damage especially DNA double-strand breaks (DSBs) [4] [5]. The ATM "

Lung_Cancer

"and Cys-K-(PEG11-10mer-COCH3)2) peptide (3.0 mg 0.68 ?mol). Protected (tBu)2-AcD10 was obtained as a white solid (2.5 mg; yield: 73%). MALDI-TOF/MS: 5048.15 [M+H]+. Calc'd MS: 5047.49. After deprotection H2-AcD10 was obtained in quantitative yield. MALDI-TOF/MS: 4935.46 [M+H]+. Calc'd MS: 4934.85 Synthesis of H2(M10)2: To the mixture of CB-TE2A(tBu)2-(Mal)2(0.2 mg 0.23 ?mol) and Cys-PEG11-10mer peptide (1.3 mg 0.7 ?mol) was added 10 mM PBS solution containing 10 mM EDTA (500 ?L pH 7.0). The reaction mixture was stirred for 12 h under N2. The reaction mixture was purified by semi-preparative reverse-phase HPLC. The collected fractions from multiple runs were pooled and lyophilized to give protected (tBu)2-(M10)2 (0.67 mg; yield: 63%). MALDI-TOF/MS: 4529.62 [M+H]+. Calc'd MS: 4528.53. The protected conjugate (tBu)2-D10 was dissolved in 95% of TFA and stirred at room temperature for 12 h. Solvent was evaporated and the residue was purified by semi-preparative reverse-phase HPLC. Lyophilization afforded H2-(M10)2 as white solid in quantitative yield. MALDI-TOF/MS: 4414.57 [M+H]+. Calc'd MS: 4413.37 Radiolabeling of H2M10 H2D10 H2AcD10 and H2(M10)2 with 64Cu: To a 100 ?L vial containing 5-10 ?g of a respective conjugate in 50 ?L of 0.4 M NH4OAc buffer (pH = 6.5) 1-2 mCi of 64CuCl2 was added. The reaction mixture was shaken at 75ºC for 30 min. Then 2 ?L of 5 mM EDTA was added to the reaction mixture which was allowed to incubate for 5 min. Purification of 64Cu-labeled conjugate was carried out on a Sep-Pak C-18 light cartridge preconditioned with 10 mL EtOH followed by 10 mL H2O. After thorough rinsing (3 — 3 mL water) of the cartridge the 64Cu-labeled conjugate was eluted by an ethanol-PBS (10 mmol) mixture (70:30). The product was analyzed on instant thin-layer chromatography (ITLC-SG) plates (Pall Life Sciences East Hills NY) read by a Rita Star Radioisotope TLC Analyzer (Straubenhardt Germany). The radiochemical purity of the 64Cu-labeled conjugates after cartridge purification was > 97% as determined by radio-HPLC. The overall radiochemical procedure including the synthesis and purification steps took less than 45 min and gave a decay-corrected radiochemical yield of > 70%. The specific activity of the purified 64Cu-labeled conjugates was in the range of 15-30 GBq/?mol. Small Animal PET/CT Imaging: Imaging studies were performed on a Siemens Inveon Multimodality PET/CT system. One hour prior to imaging each mouse bearing a H2009 or H460 tumor was injected with 100 - 125 µCi of a 64Cu labeled conjugate in 100 µL of saline via the tail vein (n=3 for each experiment). Ten minutes prior to imaging the animals were anesthetized using 3% isofluorane in O2 at room temperature until vital signs stabilized. The animal was placed onto the imaging bed under 2% Isofluorane anesthesia for the duration of the imaging. At each time point (1 h 4 h and 24 h) post-injection (pi.) a CT scan was performed (6 min) immediately followed by a static PET scan (15 min). The CT imaging was acquired at 80kV and 500 ?A with a focal spot of 58 ?m. Total rotation of the gantry was 360o with 360 rotation steps obtained at an exposure time of approximately 180 ms/frame. The images were attained using CCD readout of 4096 — 3098 with a binning factor of 4 and an average frame of 1. Under low magnification the effective pixel size was 103.03 ?m. The CT images were reconstructed with a down sample factor of 2 using Cobra Reconstruction Software. PET images were reconstructed using Fourier Rebinning and Ordered Subsets Expectation Maximization 3D (OSEM3D) algorithm. Reconstructed CT and PET images were fused and analyzed using Inveon Research Workplace (IRW) software. For quantification regions of interest were placed in the areas expressing the highest 64Cu-labeled conjugate activity as determined by PET and guided by visual inspection of CT images. The resulting quantitative data were expressed in % injected dose/g (%ID/g). Serum stability test: In vitro stability test was performed in rat serum. Briefly 64Cu labeled conjugate (0.74 MBq 5 ?L) was added into 100 ?L of rat serum and incubated at 37 °C (n = 3). After 1 h 4 h and 24 h incubation 50 ?L of the sample was taken out and mixed with 250 ?L of ethanol. The solution was vortexed and centrifuged for 5 min at 21000 g. Both the pellet and the supernatant were counted and the supernatant was further analyzed by radio-HPLC. Peptide Competition Assay: Binding affinity of the peptide-conjugates (H2-M10 H2-D10 H2-AcD10 and H2-(M10)2) to H2009 cells was determined as previously described by varying the peptide concentration by factors of 10 ranging from 0.1 to 1000 nM 34. Peptide stock solutions were prepared in phosphate buffered saline (pH 7.4) and concentrations were determined by 3-(4-carboxybenzoyl)quinoline-2-carboxaldehyde assay (CBCQA assay Invitrogen). Peptide stock solutions were diluted in PBS/BSA containing 108 ps of the H2009.1 phage clone which displays the parental H2009.1 peptide. Chloroquine (0.1 mM) and 1 — protease inhibitor (Roche) were included to minimize phage degradation. The peptide-phage solution was incubated on 90% confluent H2009 cells in a 12-well tissue culture dish for 10 minutes. Cells were then washed 4 times with PBS/BSA and 2 times with 0.1 M HCl-Glycine in 0.9% saline (pH 2.2). Cells were lysed in 30 mM Tris-HCl (pH 8.0) by freeze-thaw. Cell-associated fractions were diluted mixed with K91 E. coli and colony forming units were determined. Peptide blocking is defined as the output phage to input phage ratio in the presence of the peptide compared to the same ratio without added peptide. Binding Assays on Purified Integrins: The dimeric H2009.1-10-mer and scrambled H2009.1-10-mer peptides were synthesized in house with a biotinylated lysine incorporated into the dimeric core. cRGDfK-PEG-PEG-biotin and RADfK-PEG-PEG-biotin were purchased from Peptides International. Purified integrins (R & D systems) were resuspended from lyophilized powder in PBS+ at 1 µg/ml and absorbed onto Nunc MaxiSorp flat bottom polystyrene plates (96 well) overnight at 4oC.Peptide solutions at 02001005020105210.50.2 and 0.1 nM were added to the wells containing the integrin proteins. After 30 minute incubation at room temperature the wells were washed 3-times with PBS. Peptide capture was measured with Avidin-HRP and developed with TMB. Specific binding was determined using scramble H2009.1 dimeric peptide or cRADfY as controls. Dissociation constants were determined using nonlinear regression in GraphPad Prism using assuming a one-site binding model. Flow Cytometry on Intact Cells: Peptide binding to cells by flow cytometry was performed as previously described 29. Cells were plated in 12 well tissue culture plates and cultured 24 to 48 hours prior to each experiment. Steptavidin-phycoerythrin (BDBiosciences San Jose CA) was incubated with H2009.1-dimeric peptide containing 1 biotin at 20 nM peptide concentration in PBS for 30 minutes at room temperature. Excess biotin binding sites on streptavidin were then quenched by the addition of an equal volume of RPMI. Culture medium was removed from each well and the indicated concentration of the peptide added and incubated with cells for 1 hour at 37°C. Peptide-SAPE was removed and the cells were washed 3 times in PBS 2 times in acid wash pH 2.2 and removed from the well in PBS containing 10 mM EDTA. Peptide-mediated SAPE uptake in cells was determined by flow cytometry on a Beckman Coulter Cell Lab Quanta (Beckman Coulter Inc. Indianapolis IN). Collected data was evaluated using WinMDI v2.9 flow analysis software. The arbitrary binding units reflect the mean fluorescence intensity. Statistical analysis: Quantitative data were expressed as the mean ± SD. Unpaired t test (two-tailed confidence intervals: 95%) was performed using GraphPad Prism. P values of <0.05 were considered statistically significant. Results Synthesis The chelator 411-bis(carboxymethyl)-14811-tetraazabicyclo[6.6.2]hexadecane (CB-TE2A) forms a thermodynamically and kinetically stable complex with Cu(II). In our design the peptide attachment is through the peripheral carboxylate groups (Scheme 1). As such the unique feature of CB-TE2A is preserved: the two inner carboxylates to form an octahedral complex with Cu(II) along with the four nitrogen atoms of the macrocycle. This results in a stable and neutral copper complex to which multiple ligands can be attached. Synthetic routes to the monovalent (H2-M10) and divalent conjugates (H2-(M10)2 H2-D10 and H2-AcD10) (Scheme 1) consist of three parts i) synthesis of BFC scaffolds 1 and 225 ii) formation of maleimide derivatives: CB-TE2A(tBu)2-Mal and CB-TE2A(tBu)2-(Mal)2 and iii) conjugation of the H2009.1-10mer peptide to the BFCS CB-TE2A(tBu)2-Mal or CB-TE2A(tBu)2-(Mal)2 followed by deprotection of the ?-carboxylate groups to provide H2-M10 H2-(M10)2 H2-D10 and H2-AcD10 as final products. Scaffolds 1 and 2 were synthesized in quantitative yield by reaction of CB-cyclam with ?-bromoglutaric acid-1-tertbutylester-4-benzyl ester 25. They were further functionalized with one or two maleimide groups to yield CB-TE2A(tBu)2-Mal and CB-TE2A(tBu)2-(Mal)2 in 34 and 45% yields respectively. The maleimide moiety reacts selectively with thiols thus minimizing issues with chemical regiospecificity upon conjugation. Also this imparts flexibility in the design of peptides as cysteine is not a common amino acid and can be conveniently incorporated into a peptide sequence as handle for further modification. In addition this chemistry keeps the peptide sequence intact which allows the multivalent presentation of the peptide to be conserved on the BFCS as in the original phage clone. The maleimide intermediate CB-TE2A(tBu)2-Mal was conjugated with one equivalent of Cys-PEG11-10mer to provide (tBu)2-M10. Similarly the peptide dimers (Cys-K-(PEG11-10mer)2 and Cys-K-(PEG11-10mer-COCH3)2) were conjugated to CB-TE2A(tBu)2-Mal to afford the protected divalent conjugates (tBu)2-D10 and (tBu)2-AcD10 respectively. The BFCS based dimer (tBu)2-(M10)2 was synthesized by conjugation of CB-TE2A(tBu)2-(Mal)2 with two equivalents of Cys-PEG11-10mer peptide. Finally deprotection of t-butyl group afforded the monovalent and divalent peptide conjugates in quantitative yield. All four conjugates (H2-M10 H2-(M10)2 H2-D10 and H2-AcD10) were successfully labeled with 64Cu to give 64Cu-M10 64Cu-(M10)2 64Cu-D10 and 64Cu-(Ac)D10. The overall radiochemical procedure including synthesis and purification was completed in less than 1 h with the specific radioactivity of 64Cu-labeled conjugates in the range of 15-30 GBq/µmol. Binding Assays The in vitro ?v?6 binding affinities of H2-M10 H2-(M10)2 H2-D10 and H2-AcD10 were determined by our previously described method using ?v?6 integrin-positive H2009 human NSCLC cells 20 34. All the conjugates inhibited the binding of H2009.1 peptide phage to the ?v?6 integrin-positive H2009 cells in a dose-dependent manner (Figure 1). The IC50 values of the parental H2009.1 peptides which represent their concentrations required to inhibit 50% of the H2009.1 peptide phage binding were 9.2 nM (monomeric 10mer) and 0.56 nM ((10mer)-PEG11)2-K-Cys) respectively. The IC50 values of the synthesized peptide conjugates were 4.5 (H2-M10) 0.89 nM (H2-(M10)2 0.85 nM (H2-D10) and 1.3 nM (H2-AcD10)) indicating that the conjugation of the H2009.1-10mer peptides to the CB-TE2A scaffolds has minimal effect on the peptide's binding ability. The improved affinity of H2-M10 compared to the parental monomeric 10mer may be due to the addition of the PEG linker. All three dimers showed the anticipated multivalent effect as measured by the multivalent enhancement ratio (MVE) - the fold of IC50 value decrease of the dimers as compared to H2-M10: 5.1 for H2-(M10)2 5.3 for H2-D10 and 3.5 for H2-AcD10. Surprisingly H2-(M10)2 and H2-D10 displayed virtually the same binding affinity. This indicates that the peptide's multivalent presentation format is not as critical as we expected in our ?v?6 imaging probe design. Serum stability The serum stability of 64Cu labeled conjugates was evaluated by incubating the 64Cu labeled conjugate in rat serum at 37°C. After 1 4 and 24 h an aliquot was removed and the serum proteins were precipitated in ethanol. The supernatants were analyzed by radio- HPLC. At 1 h post incubation serum stability of all four conjugates was in the range of 60-73%. A significant fraction of the multivalent conjugates remains intact (64Cu-D10 (35%)"

Lung_Cancer

"Then we need to calculate a tail probability for a heterogeneous Bernoulli process. For the calculation for gene sets with coordinate down-regulated differential expression we need to focus on the combination of different components with (j1 = 2 j2 = 2 . . . jK = 2). Then we need to change the formulas for uSi and CESS as follows: False discovery rate The concordant enrichment score given in Equation (2) is an estimated conditional probability of concordant enrichment which can be considered as the true positive probability for the gene set S. This conditional probability is closely related to the concept of false discovery rate (FDR). FDR has been widely used to evaluate the proportion of false positives among the claimed positives [6 23]. According to the discussion by McLachlan et al. [14] among the J top gene sets {S1 S2 . . . SJ} claimed significantly concordantly enriched the false discovery rate can be estimated as:3 Computational approximation Although we have derived the formula for concordant enrichment score (CES) it is usually difficult to compute it in practice: the number of possible component combinations from different genes in a given gene set is usually huge. Based on our observation most gene sets contain more than 20 genes. Since different genes have different probabilities of being concordantly up-regulated and/or down-regulated differentially expressed we cannot further simplify the formula (we need to calculate a tail probability for a heterogeneous Bernoulli process). However we can consider a simulation based approach to the approximation of CES given in Equation (2). Monte Carlo approximation Recall that the probability of event of interest uSi can be calculated for a gene XSi in a given gene set S = {XSi i = 12 . . . mS}. The simulation scheme is based on a heterogeneous Bernoulli process: For each XSi simulate a Bernoulli random variable with probability of event uSi; For the gene set S count the number R of events from different genes; Repeat the above two steps B times and report the approximated enrichment score as {number of . One related question is how large B should be set in the simulation. As we have discussed above the concordant enrichment score (CES) is closely related to the false discovery rate (FDR). Then it is reasonable to require its accuracy around the 1% level for the 95% CES level (e.g. a 95% normally approximated binomial confidence interval 0.95 ± 0.01) and B = 2000 is adequate. Therefore the Monte Carlo approximation is a feasible approach in practice. (In general if we do not have a specific CES level we can simply use an upper bound B = 10000 calculated based on the 95% normally approximated binomial confidence interval. Then the related computing burden is still practically feasible.) Results and discussion Application #1: an integrative analysis of two data sets To illustrate our method we first considered two microarray gene expression data sets collected for lung cancer studies [24 25]. The first one was collected by a research group in Boston (referred to as Boston data) and the second one was collected by a research group in Michigan (referred to as Michigan data). For an application of their Gene Set Enrichment Analysis (GSEA) method Subramanian Tamayo et al. [8] reanized these two data sets which were made freely available at http://www.broadinstitute./gsea. There were 62 and 86 patients for the Boston and Michigan data sets respectively. These patients were classified as either ""good"" or ""poor"" outcomes. Expression profiles were available for 5216 genes that were common for both data sets. To compare our analysis results with the results reported by Subramanian Tamayo et al. [8] we used an early version of gene set collection that was used by them [8]. "

Lung_Cancer

"Single agent and combination treatment protocols were well tolerated by mice with no weight loss or other signs of acute or delayed toxicity (A-C). Antitumor activity of AZD6244 and/or BEZ235 in mouse xenograft models of human tumors. Nude mice-bearing NCI-H1993 (A) NCI-H1975 (B) and NCI-H460 (C) tumors were administered 25 mg/kg AZD6244 twice daily and/or 20 mg/kg BEZ235 once daily up to 21 days. Tumors were resected from nude mice on day 21 (D). Tumor volume was measured using calipers on the indicated days. Mean?±?SD n?=?10. * P?<?0.05 vs control group. ** P?<?0.01 vs control group. Changes in body weight of mice treated with control group or AZD6244 and/or BEZ235. Nude mice-bearing NCI-H1993 (A) NCI-H1975 (B) and NCI-H460 (C) tumors were administered 25 mg/kg AZD6244 twice daily and/or 20 mg/kg BEZ235 once daily up to 21 days. Body weight was measured on the indicated days. Mean?±?SD n?=?10. Effect of MEK and PIK3/mTOR inhibitors on signaling transduction pathways in gefitinib-resistant NSCLC tumor models To assess the impact of both compounds on downstream molecules of the MEK and PI3K pathways we used Western blot analysis to observe phosphorylation status and total protein expression in tumor tissues. The results showed that p-MEK1/2 p-ERK1/2 p-AKT p-S6 and p-4E-BP1 appeared to be inhibited by AZD6244 and BEZ235 combination treatment whereas the total protein levels of MEK1/2 ERK1/2 AKT S6 and 4E-BP1 remained unchanged in each tumor model (). Western blot analysis of downstream signals also showed treatment with AZD6244 or BEZ235 inhibited the phosphorylation of ERK1/2 or AKT in all three tumor models respectively. In addition combined treatment with AZD6244 and BEZ235 showed greater inhibition of p-ERK1/2 and p-AKT than observed in control group or mice treated with each compound alone in vivo (). Interestingly the impact from both inhibitors on p-S6 and p-4E-BP1 levels was alternatively tumor model specific. For example AZD6244 and BEZ235 alone and in combination markedly inhibited p-S6 and p-4E-BP1 expression levels in NCI-H1993 tumor models compared with the minimal suppression observed in NCI-H460 tumor model (). Neither AZD6244 nor BEZ235 alone suppressed p-S6 and p-4E-BP1 in NCI-H1975 tumor model. We also found that the expression of MMP-9 was significantly inhibited by AZD6244 and BEZ235 combination treatment whereas the expression of MMP-2 was not affected by the treatment. Effects of AZD6244-BEZ235 combination therapy on PI3K/AKT and MEK/ERK pathways. All three gefitinib-resistant tumor xenograft models were treated with the AZD6244 and/or BEZ235 for 2 h on Day 21 of the efficacy study tumor tissues were then harvested to detect p-AKT (S473)/AKT p-ERK (T202/Y204)/ERK p-S6 (S240/244)/S6 and p-4E-BP1 (S65)/4E-BP1. Effect of MEK and PIK3/mTOR inhibitors on the expressions of Ki-67 and CD31 in gefitinib-resistant NSCLC tumor models To characterize the mechanism of tumor growth inhibition observed in our gefitinib-resistant NSCLC tumor models by AZD6244 and BEZ235 lung tumor tissues were assessed by evaluating Ki-67 expression using immunohistochemical analyses. We observed active cell proliferation in NCI-H1993 tumor model with a 56% proliferation index (A). Monotherapy with AZD6244 or BEZ235 slightly decreased the percentage of Ki-67-positive proliferating tumor tissues with proliferation indices of 42% and 39% respectively (A). Combined treatment with AZD6244 and BEZ235 markedly decreased the percentage of Ki-67-positive proliferating tumor tissues to 10% consistent with the marked inhibition of ERK1/2 and AKT phosphorylation. We also found the similar results in NCI-H1975 and NCI-H460 tumor models (A).To evaluate the potential antiangiogenic mechanism of AZD6244 and BEZ235 gefitinib-resistant NSCLC tumor tissues were analyzed by immunostaining for CD31 (platelet endothelial cell adhesion molecule 1). The results showed BEZ235 significantly decreased the vascular density of all three gefitinib-resistant NSCLC tumors whereas AZD6244 monotherapy had only a mildly effect upon lung tumor angiogenesis. The antiangiogenic effects AZD6244 and BEZ235 were markedly increased when they were combined (B). Effects of AZD6244 and/or BEZ235 on the expressions of Ki-67 (A) and CD31 (B) in NCI-1993 NCI-1975 and NCI-H460 xenograft models. All three gefitinib-resistant tumor xenograft models were treated with the AZD6244 and/or BEZ235 for 2 h on Day 21 of the efficacy study tumor tissues in each group were resected and immunostained with anti-Ki67 and anti-CD31 antibodies. N?=?10 * P?<?0.05 vs vehicle group. ** P?<?0.01 vs vehicle group. MEK and PIK3/mTOR inhibitors had no effect on caspase-3 8 and 9 activities in gefitinib-resistant NSCLC tumor models In order to investigate whether AZD6244 and/or BEZ235 would induce apoptosis in gefitinib-resistant NSCLC tumor models activity of caspase-3 8 and 9 were measured by the colorimetric assay. The results showed that AZD6244 and/or BEZ235 had no effect on caspase-3 8 and 9 activities in all three gefitinib-resistant NSCLC tumor models (). Effects of AZD6244 and/or BEZ235 on the activities of caspase-3 8 and 9 in NCI-1993 NCI-1975 and NCI-H460 xenograft models. All three gefitinib-resistant tumor xenograft models were treated with the AZD6244 and/or BEZ235 for 2 h on Day 21 of the efficacy study tumor tissues in each group were resected and measured by caspase colorimetric protease kits. N?=?10. Discussion Although advances have been made in cancer treatment with the development of selective molecular targeted therapies several relevant issues for their optimal and effective use remain unsolved. Recent studies have demonstrated that the EGFR-TKI gefitinib and erlotinib are associated with a high response rate and prolong progression-free survival in patients with EGFR mutant lung cancer [22]. Responders to these agents however later relapse after acquiring EGFR-TKI resistance making it urgent to develop novel therapeutic agents that can overcome acquired resistance to EGFR-TKI. Current clinical approaches to combat resistance in lung adenocarcinoma include irreversible and mutant-selective inhibitors of EGFR combination of cetuximab and afatinib [23] and combination of an EGFR inhibitor with a drug targeting a resistance pathway such as the combination of gefitinib and a MET inhibitor [24]. However alternative RTK pathways that are activated following EGFR inhibition are another area for investigation. These alternative pathways may bypass or evade inhibition of EGFR signaling thereby enabling combinations of agents to simultaneously attack multiple molecular targets for cancer growth inhibition. One potential solution to overcome multiple mechanisms of resistance is to target downstream pathways. In this study we show that the combination of a selective MEK inhibitor and a PI3K/mTOR inhibitor is effective against tumor cell lines refractory to gefitinib by three different mechanisms: an EGFR gatekeeper T790M mutation MET amplification and KRAS/PIK3CA mutation. To our knowledge this is the first report of the effects of MEK TKI with PI3K/mTOR TKI therapy in gefitinib-resistant models of NSCLC. MEK is a potentially relevant molecular therapeutic target since it is the activated downstream of the axis RAS/RAF proteins and in turn activates ERK to induce cell proliferation. Therefore several selective MEK inhibitors have been developed [25] and more than ten MEK inhibitors have entered early clinical trial evaluation [26]. Unfortunately clinical activity as single agent has been rarely observed with MEK inhibitors in gefitinib-resistant NSCLC patients [27]. The benefit of blocking an individual pathway has been largely limited by the presence of a compensatory feedback loop between PI3K and MEK. For example inhibition of the MEK pathway results in activation of the PI3K pathway [28] and PI3K activation mediates resistance to MEK inhibition [29]. In our study in order to circumvent this compensatory feedback concurrent blockade of the two pathways has been tested and synergy in antitumor effects was detected providing the rationale for phase I clinical trials. Moreover early signs of clinical benefit have been reported in advanced cancer by a retrospective analysis on patients receiving agents that target both pathways [30]. Gatekeeper mutations the T790M mutation in EGFR associated with resistance to gefitinib [31] are common mechanisms by which tumor cells acquire resistance to molecularly targeted drugs. Although irreversible EGFR-TKIs including BIBW2992 have been developed to overcome T790M-mediated resistance to gefitinib [32] recent clinical trials have failed to show that monotherapy with irreversible EGFR-TKIs has benefits in patients with NSCLC refractory to gefitinib [33]. This may be due at least in part to the low selectivity of this class of compounds to wild-type and mutant EGFR. In addition because HGF overexpression was frequently observed in tumors with the gatekeeper T790M mutation [34] monotherapy with a mutant-selective EGFR-TKI may not be sufficient to inhibit the growth of tumors with acquired resistance to gefitinib. Our findings suggest that the combination of a MEK-TKI and a PIK3/mTOR-TKI may be effective in controlling these resistant tumors. Many KRAS-mutant cancer cells have been shown to be sensitive to MEK inhibitors [35] and KRAS mutations can be detected in up to 30% of lung cancers dependent upon histology and ethnicity [36-38] suggesting that a subset of lung cancers would likely be highly sensitive to AZD6244. Our finding that AZD6244 was effective in one distinct KRAS mutant human lung cancer NCI-H460 models supports and validates this hypothesis. Although monotherapy with AZD6244 resulted in antitumor and some antiangiogenic effects in all of our lung cancer models the antitumor effects were more apparent in the NCI-H1993 lung adenocarcinoma model. The increased antitumor efficacy observed in this model is associated with differences in the inhibitory effect of p-AKT signaling pathway in NCI-H1975 and NCI-H460 lung tumors. However additional studies are needed to elucidate this phenomenon. In this study we evaluated therapy directed against MEK and PI3K/mTOR in distinct gefitinib-resistant NSCLC xenograft models. MEK or PI3K/mTOR inhibition resulted in antitumor effects for these gefitinib-resistance NSCLC models by blocking key intracellular pathways controlling cell proliferation and survival as demonstrated both in vitro and in vivo. Surprisingly PI3K/mTOR inhibition by BEZ235 also suppressed lung tumor angiogenesis and targeted both MEK and PI3K/mTOR activation in lung tumors resulting in substantial antiangiogenic effects which may due to the significantly reduced expression of MMP-9 in tumors. "

Lung_Cancer

" PAX6 expression was recently found in tumors suggesting an oncogenic role [9]. PAX6 is frequently expressed in retinoblastoma pancreatic tumors and intestinal tumors [6] [10] [11]. PAX6 is also highly expressed in brain and breast cancer cell lines [9]. In pancreatic carcinoma cell lines the inhibition of PAX6 expression leads to a decrease in cell growth and survival [12]. PAX6 is also a regulator of MET tyrosine kinase receptor expression in pancreatic carcinoma cell lines [12]. MET is a potential biomarker and therapeutic target for tumors which confirms the oncogenic role of PAX6 in tumorigenesis [13]. It was previously reported that PAX8 and PAX5 are highly expressed in non-small cell lung cancer (NSCLC) and small cell lung cancer cell lines respectively [14]; but little is known regarding PAX6 expression and function in lung cancer. In this study we investigated whether PAX6 regulated cell proliferation of NSCLC. Our findings show that PAX6 promotes G1-S progression by activating the MAPK signal pathway. PAX6 mRNA was frequently expressed in lung cancer tissue as compared to corresponding adjacent non-neoplastic tissue. This suggests that PAX6 is a new potential target in lung cancer. Materials and Methods RPMI 1640 fetal bovine serum (FBS) and Trizol Reagent were purchased from Invitrogen (Carlsbad CA); M-MLV reverse transcription CellTiter 96® aqueous non-radioactive cell proliferation assay oligo-dT and dNTP were obtained from Promega (Madison WI); SYBR® Green PCR Master Mixture was from Applied Biosystems (Carlsbad CA); anti-PAX6 antibodies were purchased from Abnova (Taibei Taiwan) anti-pRB -ERK1/2 p38 -pERK -pp38 -cyclin D1 and -pRB (S780 phosphorylation) antibodies were obtained from Abcam (Cambridge England UK); and enhanced chemiluminescence (ECL) reagent was obtained from Pierce (Rockford IL). Propidium iodide (PI) RNase A and protease inhibitor cocktail were purchased from Sigma (St. Louis MO). Samples Fifty-two NSCLC specimens were obtained from patients undergoing surgical resection at Beijing Chest Hospital. Primary lung cancer samples and matched adjacent normal tissues were used. The study and use of specimens was reviewed and approved by Research Ethic Committee in Beijing Chest Hospital Capital Medical University (Beijing China). Written informed consent was obtained from all patients. The clinical characteristics of the patients are listed in . .0085738.t001 Patients and Clinical Characteristics. Characteristics Number of Patients Patient Age Years 0 “ 60 27 >60 25 Gender Male 40 Female 12 Smoke Status Nonsmoker 21 Smoker 31 Histologic Type SCC* 31 Adenocarcinoma 21 Histological Grade III 21 II 31 Tumor Size 0 “ 3 cm 14 >3 cm 38 Lymph Node Status Negative 27 Positive 25 Distant Metastasis Negative 44 Positive 8 TNM Stage Stage I 17 Stage II 10 Stage III 19 Stage IV 6 : Squamous Cell Carcinoma. Cell culture Human lung adenocarcinoma cell lines A549 and NCI-H1299 human large cell lung carcinoma cell lines NCI-H460 small cell lung cancer cell line NCI-H446 human embryo lung fibroblasts (MRC-5) were obtained from the National Platform of Experimental Cell Resources Sci-Tech. Human large cell lung carcinoma cell lines 95C 95D and 801D were obtained from the tumor center of Chinese Academy of Medical Sciences. Human lung adenocarcinoma cell line A2 and squamous cell carcinoma cell line L were isolated and established by our lab. The lung cancer cell lines were cultured in RPMI 1640 medium (Invitrogen Carlsbad CA USA) supplemented with 10% fetal bovine serum (FBS; Gibco Los Angeles CA USA). MRC-5 were maintained in MEM-EBSS supplemented with 10% FBS. Construction of a PAX6 shRNA lentiviral vector and infection into cells Four RNA interference (RNAi) candidate target sequences were designed based on the human pax6 mRNA sequence and cloned into the pGCSIL-GFP vector (GeneChem Shanghai China). The RNAi sequence GAGTAGCGACTCCAGAAGT was the most effective at suppressing PAX6 mRNA in H1299 and A549 cells and was used in subsequent experiments to knock down endogenous PAX6. Nonsilencing (NS)-small interfering RNA (shRNA) (TTCTCCGAACGTGTCACGT) was also cloned into the pGCSIL-GFP vector and used as a control (GeneChem). The recombinant virus was packaged in 293T cells using a Lentivector Expression System (GeneChem). For cellular infection H1299 and A549 cells were subcultured at 5000 cells/well in 96-well culture plates and infected with lentivirus-mediated pax6-shRNA or NS-shRNA. The GFP expression level was detected via fluorescence microscopy (Nikon Tokyo Japan) to determine the infection efficiency. RNA isolation and real-time PCR Total RNA from tissue and cells was isolated with Trizol Reagent according to the manufacturer™s protocol. The total RNA concentration was calculated by measuring the OD260 and the samples were stored at “80°C. Total RNA (2 µg) was reverse-transcribed using an M-MLV Reverse Transcriptase Kit according to the manufacturer™s protocol. The cDNA (20 ng) was mixed with SYBR® Green Master Mix and genes were amplified with appropriate primers using a real-time PCR detection system (ABI7500; Life Technologies Carlsbad CA). The relative expression levels of PAX6 mRNA were calculated by normalization to the ?-actin mRNA level. The PCR primers used were as follows: PAX6 forward 5'-TTCAGCACCAGTGTCTACCA-3'; PAX6 reverse 5'-GCTGTAGGTGTTTGTGAGGG-3'; ?-actin forward 5'-TTAGTTGCGTTACACCCTTTC-3'; and ?-actin reverse 5'-GCTGTCACCTTCACCGTTC - 3'. Cell proliferation assay A proliferation assay was carried out using Non-Radioactive Cell Proliferation Assay according to the manufacturer™s protocol. Briefly5000 cells/well were seeded into 96-well culture plates in RPMI 1640 containing 10% FBS. The cells were cultured for 5 days then 20 µL of 3-(45-dimethyl-thiazol-2yl)-5-(3-carboxymethoxyphenyl)-2- (4-sulfophenyl)-2H-tetrazolium (MTS) was added to each well and the cells were incubated at 37°C for 3 h every 24 h. The absorbance was recorded at 490 nm with a universal microplate reader (Bio-Rad Hercules CA). "

Lung_Cancer

"oup A (n = 12) was sacrificed 6 hr after percutaneous injection and Group B (n = 12) was sacrificed 24 hr after a CT guided percutaneous injection of MLM and methylene blue. Fig. 2 Examples of evaluation of staining on the lung surface. Photographs show (A) the extensive staining (score 1) (B) localized dispersion of staining (score 2) and (C) minimal dispersion of staining (score 3). The white lines on the bottom of the figure are markings of the ruler. The distance between two lines is one centimeter. Fig. 3 Examples of assessment of radio-opacity on the fluoroscopic examinations. The fluoroscopic images show (A) a minimally increased opacity (arrow) (score 1) (B) a low density of increased opacity (arrow) (score 2) and (C) a compact nodular increased opacity (arrow) (score 3). Fig. 4 CT and corresponding photomicrograph of lung specimen. MLM in Group B (A-D); (A) discrete and compact nodular opacity (arrowheads) (B) focal neutrophil infiltration necrosis and hemorrhage (arrowheads) (H&E —12.5) (C) scattered small nodular opacities of lipiodol (long arrows) and faint nodular opacity (arrowheads) (D) focal hemorrhage and necrosis (arrowheads) with diffuse neutrophil infiltration (short arrows) (H&E —12.5). MLM in Group A (E F); (E) faint nodular lipiodol opacity (arrows) (F) focal hemorrhage (arrows) with diffuse neutrophil infiltration (arrowheads) (H&E —12.5). Methylene blue in Group A (G H); (G) faint nodular opacity (arrowheads) and (H) focal extent of neutrophil infiltration necrosis and hemorrhage (arrowheads) (H&E —12.5). Staining extent and localization ability of MLM versus methylene blue Data are mean±standard deviation. Numbers in parentheses are ranges. N/A indicates not available. *Non-parametric Mann-Whitney test was performed to compare the average score of MLM and methylene blue. MLM mixture of lipiodol and methylene blue. Localization ability score of staining and radio-opacity for MLM as well as methylene blue Data are numbers of subjects. Numbers in parentheses are percentages. MLM mixture of lipiodol and methylene blue. Comparison of localization ability between MLM and methylene blue in total subjects (n = 42) We considered a score of 2 or 3 as appropriate and 3 as excellent for localization respectively. Numbers in parentheses are percentages. *Fisher's exact test compared the proportion of appropriate or excellent staining between the mixture and methylene blue. MLM mixture of lipiodol and methylene blue. Localization ability of MLM: Evaluation of radio-opacity and staining score Data are given as numbers of subjects. Numbers in parentheses are percentages. MLM mixture of lipiodol and methylene blue. Histopathologic findings of lung specimens after percutaneous injections Data are numbers of subjects. Numbers in parentheses are percentages. N/A indicates not available. *Linear by linear association was performed between material and the extent of the histopathologic findings.  Linear by linear association was performed between groups and the extent of the histopathologic findings. MLM mixture of lipiodol and methylene blue. PLoS One one 1932-6203 Public Library of Science San Francisco USA 24819391 4018408 PONE-D-13-46027 .0096911 Research Biology and Life Sciences Biochemistry Biomarkers Genetics Heredity Medicine and Health Sciences Diagnostic Medicine Epidemiology Biomarker Epidemiology Cancer Epidemiology Health Care Environmental Health Oncology Cancer Risk Factors Environmental Causes of Cancer Pathology and Laboratory Medicine Public and Occupational Health Pulmonology Environmental and Occupational Lung Diseases Single Nucleotide Polymorphism in ATM Gene Cooking Oil Fumes and Lung Adenocarcinoma Susceptibility in Chinese Female Non-Smokers: A Case-Control Study ATM Polymorphism and Risk of Lung Adenocarcinoma Shen Li 1 2 Yin Zhihua 1 2 Wu Wei 1 2 Ren Yangwu 1 2 Li Xuelian 1 2 Zhou Baosen 1 2 * 1 Department of Epidemiology School of Public Health China Medical University Heping District Shenyang Liaoning Province China 2 Key Laboratory of Cancer Etiology and Intervention University of Liaoning Province China Chang Jeffrey S. Editor National Health Research Institutes Taiwan * E-mail: bszhoumail.cmu.edu.cn Competing Interests: The authors have declared that no competing interests exist. Conceived and designed the experiments: LS. Performed the experiments: LS YR XL. Analyzed the data: LS WW ZY. Contributed reagents/materials/analysis tools: LS ZY XL BZ. Wrote the paper: LS. Obtained informed consent from subjects: Baosen Zhou. 2014 12 5 2014 9 5 e96911 3 11 2013 12 4 2014 2014 Shen et al This is an open-access distributed under the terms of the Creative Commons Attribution License which permits unrestricted use distribution and reproduction in any medium provided the original author and source are credited. Background The ataxia-telangiectasia mutated (ATM) gene plays an important role in the DNA double-strand breaks repair pathway. Single nucleotide polymorphisms (SNPs) of DNA repair genes are suspected to influence the risk of lung cancer. This study aimed to investigate the association between the ATM -111G>A (rs189037) polymorphism environmental risk factors and the risk of lung adenocarcinoma in Chinese female non-smokers. Methods A hospital-based case-control study of 487 lung cancer patients and 516 matched cancer-free controls was conducted. Information concerning demographic and environmental risk factors was obtained for each case and control by a trained interviewer. After informed consent was obtained 10 ml venous blood was collected from each subject for biomarker testing. Single nucleotide polymorphism was determined by using TaqMan method. Results This study showed that the individuals with ATM rs189037 AA genotype were at an increased risk for lung adenocarcinoma compared with those carrying the GA or GG genotype (adjusted odds ratios (OR) 1.44 95% confidence interval (CI) 1.02“2.02 P?=?0.039). The stratified analysis suggested that increased risk associated with ATM rs189037 AA genotype in individuals who never or seldom were exposed to cooking oil fumes (adjusted OR 1.89 95%CI 1.03“3.49 P?=?0.040). Conclusions ATM rs189037 might be associated with the risk of lung adenocarcinoma in Chinese non-smoking females. Furthermore ATM rs189037 AA genotype might be a risk factor of lung adenocarcinoma among female non-smokers without cooking oil fume exposure. This study was supported by grant no. 81272293 from National Natural Science Foundation of China grant no. 81102194 from National Natural Science Foundation of China and grant no. 00726 from China Medical Board. The funders had no role in study design data collection and analysis decision to publish or preparation of the manuscript. Introduction Lung cancer is the leading cause of cancer-related deaths both worldwide and in China. Although cigarette smoke is the major risk factor for lung cancer only a fraction of smokers develop this disease [1] suggesting that host genetic susceptibility may play an important role in the development of lung cancer. Recent genetic susceptibility studies of lung cancer have focused on single nucleotide polymorphisms (SNPs) in candidate genes among which DNA repair genes are increasingly studied because of their critical role in maintain genome integrity. Genetic variations in DNA repair genes are thought to affect DNA repair capacity and deficits in DNA repair capacity may lead to genetic instability and carcinogenesis [2] [3]. As one of the DNA repair genes ataxia-telangiectasia mutated (ATM) gene which is responsible for the multisystem autoxomal recessive disorder ataxia-telangiectasia (A“T) plays a crucial role in the recognition signaling and repair of DNA damage especially DNA double-strand breaks (DSBs) [4] [5]. The ATM protein is a member of phosphoinositide 3-kinase (PI-3 kinases) and can be activated by DSBs caused by ionizing radiation or reactive oxygen intermediates [6] [7]. Once activated ATM can phosphorylate various downstream substates that function in cell cycle arrest apoptosis and DNA repair such as p53 NBS1 BRCA1 and Chk2 [8] [9]. Therefore genetic variants in ATM gene may lead to the structure and function change of the protein and act as important factors indicating individual susceptibility to cancer. ATM -111G>A (rs189037) resides in the promoter of ATM gene. Increasing studies have shown that variations in the DNA promoter sequence may potentially alter the affinities of multiple regulatory proteins-DNA interactions or the specificity of the transcriptional process [10]“[13]. Although this polymorphism makes no amino acid change the alleles may have different binding affinity to the transcription factor and exhibit different levels of mRNA expression [14] [15]. Zhang et al. [16]declared that ATM rs189037 AA genotype was associated with a lower ATM mRNA levels than GG genotype in lung tissue samples. Their results showed that the G-to-A change might create a transcriptional inhibitor-binding site for ATM rs189037 A allele promoter and subsequently reduce the ATM mRNA expression. Consequently lower expression of ATM might cause elevated sensitivity to ionizing radiation defects in the activation of cell cycle checkpoints a reduced capacity for DNA repair and abnormal apoptosis. All of these features would contribute to increased individual cancer susceptibility. In recent years a number of studies have evaluated the association between this polymorphism and cancer risk such as thyroid carcinoma [17] oral cancer [18] breast cancer [19] leukemia [20] nasopharyngeal carcinoma [21] glioma [22] and lung caner [23]“[25]. Previous studies of ATM rs189037 have included cigarette smokers as cases and controls that made it difficult to judge whether this polymorphism were associated with lung cancer or tobacco use. Considering the facts in China the incidence and death rate of lung cancer in women continues to increase and this phenomenon is frequently occurring in those who have never smoked. In order to have a better control of confounding of gender or smoking we performed a case-control study to identify the association between the polymorphism of ATM rs189037 and the risk of lung cancer in the non-smoking females in Chinese Han population. We also investigated the interaction between genetic polymorphism and environmental exposure in lung cancer. Methods Subjects This hospital-based case-control study included 487 lung cancer patients and 516 cancer-free hospital controls. All subjects were female non-smokers and they were from unrelated ethic Han Chinese. The cases were recruited during January 2002 to November 2012 at Liaoning Cancer Hospital & Institute. All patients were histologically confirmed to have lung cancer before any radiotherapy and chemotherapy. During the same time controls were selected from patients with other lung diseases but free of cancer history and symptom. Controls suffered mainly from bronchitis pneumonias fibrosis sarcoidosis chronic obstructive pulmonary disease and emphysema. Controls were all non-smoking females and frequency-matched to case subjects for age (±5 years). This study was approved by the institutional review board of China Medical University and written informed consent was obtained from each participant or each participant's representatives if direct consent could not be obtained. Data Collection A total of 10 ml of venous blood was collected from each patient. Patients were interviewed to collect information for demographics and environmental exposure at the time they were admitted to hospital. Information concerning demographic characteristics passive smoking cooking oil fume exposure fuel smoke exposure family history of cancer occupational exposure and dietary habit was obtained for each case and control by trained interviewers. An individual was defined as a smoker if she had consumed a total of 100 cigarettes in her lifetime; otherwise she was considered as a non-smoker. About fuel smoke exposure participants who used coal-fuel-burning stoves without chimneys were regarded as fuel smoke exposure. For exposure to cooking oil fumes participants were mainly asked about the method of cooking and eyes or throat irritation. For cooking methods participants were asked whether they cooked food in a stir-frying way and how many times a week; for eyes or throat irritation participants were asked how often they felt eyes or throat irritated by the oily smoke. There were four possible responses ranging from œnever œseldom œsometimes and œfrequently. Subjects were considered as cooking oil fume exposure if they met criteria as follows: (1) have cooked for over 15 years; (2) cooked food in a stir-frying way for more than twice a week; (3) felt eyes or throat irritated by oily smoke. Exposure for cooking oil fume was categorized as an indicator variable equal to 1 if participants reported frequently or sometimes and equal to 0 otherwise. Genotype Analysis Genomic DNA was extracted from peripheral blood samples by the conventional phenol-chloroform extraction method. SNP was genotyped by investigators blinded to case-control status in order to avoid any genotyping bias using TaqMan methodology and read with the Sequence Detection Software on an Applied Biosystems 7500 FAST Real-Time PCR System according to the manufacturer's instructions (Applied Biosystems Foster City CA). Amplification was done under the following conditions: 95°C for 10 min followed by 47 cycles of 92°C for 30 s and 60°C for 1 min. In this study 487 lung cancer patients and 516 controls were all genotyped successfully and 5% duplicated samples were randomly selected to assess the reproducibility for quality control with a concordance rate of 100%. Statistical Analysis The x2 test and t test were applied to estimate differences in demographic variables and distributions of genotypes between cases and controls. The association of genotypes of ATM rs189037 with risk of lung cancer was estimated by computing the odds ratios (ORs) and 95% confidence intervals (CIs) in unconditional logistic regression analysis. The Hardy-Weinberg equilibrium (HWE) was tested using goodness-fit x2 test to compare the genotype frequencies in the control subjects from those expected. A logistic regression model was used to evaluate gene-environment interactions. All data were analyzed with Statistical Product and Service Solutions (SPSS) v13.0 for Windows if not otherwise specified. All statistical analysis were two-sided and the significance level was set at P<0.05. Results Population characteristics A total of 487 lung cancer and 516 age-matched cancer-free controls were enrolled in this study. As shown in the mean ages of cases and controls (mean ±S.D.) were almost identical (56.5±11.7 and 56.3±12.5 respectively). All cases were female non-smoking lung cancer patients. No statistically significant difference was found between cases and controls in terms of age (P?=?0.248) and monthly income (P?=?0.084). Cases included 434 non-small cell lung cancer (NSCLC) patients and 53 small cell carcinoma patients. In the NSCLC cases there were 320 adenocarcinomas 73 squamous cell carcinomas and 41 other tumors with a variety of different pathologies (such as large cell carcinomas mixed cell carcinomas or undifferentiated carcinomas). .0096911.t001 Characteristics of lung cancer cases and controls. Variables Cases(%) Controls(%) P value Female 487 516 Mean age (years) 56.5±11.7 56.3±12.5 0.248a Income (yuan/month) 628.9±419.3 563.5±387.6 0.084a Never smoker 487 516 Histological type NSCLC 434(89.1) Adenocarcinoma 320(65.7) Squamous cell carcinoma 73(15.0) Small cell carcinoma 53(10.9) Other 41(8.4) a Student's t-test was used to compare the frequency distributions of demographic variables between the cases and controls. Association analysis The observed genotype frequencies among the control subjects was in agreement with that expected under the Hardy-Weinberg equilibrium (P?=?0.119). The distribution of ATM rs189037 genotypes among subjects were displayed in . Using subjects with the ATM rs189037 GG genotype as the reference group we calculated the ORs and 95%CIs for heterozygous carriers of GA genotype and homozygous carriers of AA genotype. No significant difference was observed between lung cancer cases and controls in each test (P>0.05). In order to increase the statistical power we combined the GA genotype with the AA genotype to compare with GG genotype as a dominant model and combined the GA genotype with the GG genotype to compare with AA genotype as a recessive model. The results indicated that individuals with AA genotype had a significantly elevated risk of lung adenocarcinoma compared with those carrying the GG or GA genotype (OR?=?1.44 95%CI 1.02“2.02 P?=?0.039). .0096911.t002 Distribution of ATM rs189037 genotypes and ORs for lung cancer cases and controls. Genotype Cases(%) Controls(%) ORc 95%CI P overall (n?=?487) GG 148(30.4) 152(29.5) ref GA 240(49.3) 272(52.7) 0.91 0.68“1.20 0.494 AA 99(20.3) 92(17.8) 1.11 0.77“1.59 0.590 dominant modela 0.96 0.73“1.25 0.742 recessive modelb 1.18 0.86“1.61 0.313 NSCLC (n?=?434) GG 129(29.7) 152(29.5) ref GA 213(49.1) 272(52.7) 0.92 0.68“1.24 0.573 AA 92(21.2) 92(17.8) 1.18 0.81“1.71 0.397 dominant model 0.98 0.74“1.30 0.906 recessive model 1.24 0.90“1.71 0.192 Adenocarcinoma (n?=?320) GG 94(29.4) 152(29.5) ref GA 150(46.9) 272(52.7) 0.89 0.64“1.23 0.485 AA 76(23.7) 92(17.8) 1.33 0.90“1.99 0.156 dominant model 1.00 0.74“1.36 0.987 recessive model 1.44 1.02“2.02 0.039* Squamous cell carcinoma (n?=?73) GG 24(32.9) 152(29.5) ref GA 39(53.4) 272(52.7) 0.90 0.52“1.56 0.706 AA 10(13.7) 92(17.8) 0.69 0.32“1.51 0.355 dominant model 0.85 0.50“1.43 0.537 recessive model 0.74 0.37“1.50 0.400 *P<0.05. a GA+AA vs GG. b AA vs GA+GG. c adjusted for age and data were calculated by unconditional logistic regression. According to the results above we assumed that ATM rs189037 AA genotype might affect lung adenocarcinoma risk among non-smoking Chinese females. To test this hypothesis and explore the gene-environment interaction we adopted all the lung adenocarcinoma patients and cancer-free controls whose information about environmental risk factors were completely obtained such as fuel smoke exposure cooking oil fume exposure passive smoking and family history of cancer. Cases and controls were not included in the association analysis if any item of their environmental risk factors data was incomplete. After screening we had 242 lung adenocarcinoma cases and 277 cancer-free controls that were eligible. Selected demographic variables and environmental risk factors for the cases and controls were listed in . .0096911.t003 Basic demographic data and environmental risk factor in lung adenocarcinoma cases and controls. Variable Cases(%) Controls(%) P value Female 242 277 Mean age (±S.D.) 55.7±11.6 56.6±11.0 0.346a Income(yuan/month) 626.5±384.0 558.1±391.4 0.066a Education Never 26(10.7) 26(9.4) 0.305 Elementary school 111(45.9) 141(50.9) Junior school 76(31.4) 69(24.9) Senior school and upwards 29(12.0) 41(14.8) Fuel smoke exposure 66(27.3) 76(27.4) 0.967b Cooking oil fume exposure 86(35.5) 70(25.3) 0.011b* Family history of cancer 26(10.7) 30(10.8) 0.975b Passive smoking exposure 141(58.3) 158(57.0) 0.778b *P<0.05. a Student's t-test was used to compare the frequency distribution of demographic variables between the cases and controls. b Peason's chi square was used to compare the frequency distribution of demographic variables fuel smoke exposure cooking oil fume exposure family history of cancer passive smoking between the cases and controls. As shown in the mean ages of lung adenocarcinoma cases and controls (mean±S.D.) were similar (P>0.05). All cases were female non-smokers. There was no significant difference in the distribution of education fuel smoke exposure family history of cancer and passive smoking status between cases and controls. However the cases were more likely than the controls to report cooking oil fume exposure (P?=?0.011). summarized the relationship between ATM rs189037 genotypes and lung adenocarcinoma risk with the stratification analysis of cooking oil fume exposure. The results indicated that in the recessive model (AA vs GA/GG) individuals carrying AA genotype had a 1.69-fold risk of lung adenocarcinoma compared with those carrying GA or AA genotype (95%CI 1.09“2.61 P?=?0.019). Considering the difference in the distribution of cooking oil fume exposure between cases and controls we conducted the stratification analysis. Our data revealed that AA homozygous carriers had an increased risk of lung adenocarcinoma among women who were never or seldom exposed to cooking oil fume (OR?=?1.89 95%CI 1.03“3.49 P?=?0.040). To well-understood the possible interaction between rs189037 polymorphism and cooking oil fumes exposure next we conducted a combined analysis. But there was no significant correlation found between this SNP and cooking oil fumes exposure. .0096911.t004 Overall association stratification analysis and combined analysis between ATM rs189037 polymorphism and lung adenocarcinoma risk. Comparison model Genotype ORc 95%CI P value Overall GG ref GA 0.89 0.59“1.35 0.592 AA 1.57 0.93“2.62 0.089 dominant modela 1.05 0.70“1.55 0.825 recessive modelb 1.69 1.09“2.61 0.019* Stratified by cooking oil fuel exposure Yes GG ref GA 0.72 0.34“1.54 0.395 AA 1.19 0.43“3.24 0.740 dominant modela 0.81 0.39“1.68 0.573 recessive modelb 1.48 0.62“3.52 0.381 No GG ref GA 0.94 0.57“1.56 0.811 AA 1.89 1.03“3.49 0.040* dominant modela 1.16 0.72“1.87 0.542 recessive modelb 1.97 1.18“3.29 0.009* Cooking oil fumes exposure-genotype combined analysis non-exposed GG ref non-exposed GA 0.91 0.55“1.50 0.714 non-exposed AA 1.71 0.94“3.09 0.078 exposed GG 1.99 0.96“4.12 0.063 exposed GA 1.58 0.88“2.82 0.127 exposed AA 2.07 0.87“4.93 0.099 *P<0.05. a GA+AA vs GG. b AA vs GA+GG. c the overall test was adjusted for age fuel smoke exposure cooking oil fume exposure family history of cancer and passive smoking and the stratified analysis was adjusted for age fuel smoke exposure family history of cancer and passive smoking. Discussion It is well known that smoking is the most important risk factor for lung cancer but in the past 30years the incidence and death rate of lung cancer continues to increase in women who have a low rate of smoking [26]“[28]. Adenocarcinoma accounts for about 40% of all lung cancer with a higher incidence in women especially in those who have never smoked. Undoubtedly female non-smokers are the ideal subjects to examine unknown yet important environmental and genetic factors of lung adenocarcinoma. Exposure to cooking oil fume fuel smoke passive smoking and occupational exposures have been implicated as possible risk factors among Chinese women mainly based on Chinese people's traditional diet habits lifestyle and social environment [29] [30]. So we designed this study to evaluate the association between genetic variant and environmental risk factors and lung adenocarcinoma in female non-smokers. To date the association between ATM rs189037 and host susceptibility to lung adenocarcinoma in Chinese female non-smokers has not been well addressed. ATM rs189037 was a common polymorphism in the promoter of ATM gene. Studies have shown that this site possibly may regulate ATM protein activity due to regulation function of promoter as shown in most genes. And specific genotypes or haplotypes of ATM may play an important role in carcinogenesis through expression regulation or alternative splicing of the ATM gene [31]. We searched through NCBI (National Center for Biotechnology Information) dbSNP database to get the allele frequency of this polymorphism. The data indicated that the frequency of wild-type allele G was 61.1% and the frequency of variant allele A was 38.9% in Chinese Han population (http://www.ncbi.nlm.nih.gov/SNP/snp_ref.cgi?rs=rs189037). In this study our results was in accordance with the data from NCBI. In 2006 Kim et al.[25] evaluated the role of ATM rs189037 in lung cancer development In Korean population for the first time. No significant association was found between this polymorphism and lung cancer risk (P>0.05). They recruited 616 lung cancer patients in which 78.4% were male and 79.6% were cigarette smokers. As cigarette smoking might modulate the risk of lung cancer in turn it could be a confounder in the association between ATM rs189037 and lung cancer risk. Besides there was no gene-environment interactions be considered in their research. In 2010 Lo et al.[23] suggested that ATM rs189037 was associated with lung cancer risk among never smokers (AA vs GG: OR?=?1.61 95%CI 1.10“2.35) and this association might be modified by passive smoking. Although they have eliminated the cofounding effect of cigarette smoking by conducting their study in non-smokers the risk of lung cancer among different histological types still needed to be clarified. Recently Hsia et al.[24] put their attention on the association of ATM rs189037 with lung cancer susceptibility among ever smokers. No genotype frequency difference was found between lung cancer cases and controls among ever smokers (P>0.05). After summing up the omissions of their studies and combining with the current situation that Chinese non-smoking female lung adenocarcinoma incidence and fatality rate was increasingly rising up we performed this case-control study to elucidate the association between ATM rs189037 and lung adenocarcinoma risk. To the best of our knowledge this is the first study that has investigated whether ATM rs189037 was associated with lung adenocarcinoma risk in non-smoking Han-Chinese females. Our results have shown that individuals with exposure to cooking oil fume had a 1.63-fold increased risk of developing lung adenocarcinoma (P?=?0.011). Similar significant associations were observed in our previous studies of Chinese non-smoking females. Experimental studies have presented that fumes from cooking oils could be genotoxic because of the potential carcinogenic components such as polycyclic aromatic hydrocarbons (PAHs) and benzo[a]pyr"

Lung_Cancer

"Implications This study provides a mechanistic basis for potential therapeutic interventions to prevent metastasis. NEDD9 invasion metastasis breast cancer MMP14 Int J Occup Environ Health Int J Occup Environ Health OEH International Journal of Occupational and Environmental health 1077-3525 2049-3967 Maney Publishing Suite 1C Joseph's Well Hanover Walk Leeds LS3 1AB UK 24999846 4090870 2014_1 10.1179/1077352514Z.000000000104 Original Dust diseases and the legacy of corporate manipulation of science and law Dust diseases Egilman David 1 Bird Tess 2 Lee Caroline 2 1 Department of Community Health Brown University Attleboro MA USA 2 Never Again Consulting Attleboro MA USA Correspondence to: David Egilman 8 North Main Street Suite 404 Attleboro MA 02703 USA. Email: degilmanegilman.com 4 2014 20 2 115 125 W. S. Maney & Son Ltd 2014 2014 Background: The dust diseases silicosis and asbestosis were the first occupational diseases to have widespread impact on workers. Knowledge that asbestos and silica were hazardous to health became public several decades after the industry knew of the health concerns. This delay was largely influenced by the interests of Metropolitan Life Insurance Company (MetLife) and other asbestos mining and product manufacturing companies. Objectives: To understand the ongoing corporate influence on the science and politics of asbestos and silica exposure including litigation defense strategies related to historical manipulation of science. Methods: We examined previously secret corporate documents depositions and trial testimony produced in litigation; as well as published literature. Results: Our analysis indicates that companies that used and produced asbestos have continued and intensified their efforts to alter the asbestos“cancer literature and utilize dust-exposure standards to avoid liability and regulation. anizations of asbestos product manufacturers delayed the reduction of permissible asbestos exposures by covering up the link between asbestos and cancer. Once the decline of the asbestos industry in the US became inevitable the companies and their lawyers designed the state of the art (SOA) defense to protect themselves in litigation and to maintain sales to developing countries. Conclusions: Asbestos product companies would like the public to believe that there was a legitimate debate surrounding the dangers of asbestos during the twentieth century particularly regarding the link to cancer which delayed adequate regulation. The asbestos“cancer link was not a legitimate contestation of science; rather the companies directly manipulated the scientific literature. There is evidence that industry manipulation of scientific literature remains a continuing problem today resulting in inadequate regulation and compensation and perpetuating otherwise preventable worker and consumer injuries and deaths. asbestos mesothelioma state-of-the-art corporate corruption MetLife industry knowledge 9421547 4136 Hum Pathol Hum. Pathol. Human pathology 0046-8177 1532-8392 24746212 4271837 10.1016/j.humpath.2014.01.003 NIHMS648391 Y-chromosome status identification suggests a recipient origin of posttransplant non“small cell lung carcinomas: chromogenic in situ hybridization analysis??? Chen Wei MD PhD a Brodsky Sergey V. MD PhD a Zhao Weiqiang MD PhD a Otterson Gregory A. MD b Villalona-Calero Miguel MD b Satoskar Anjali A. MD a Hasan Ayesha MD b Pelletier Ronald MD c Ivanov Iouri MD PhD a Ross Patrick MD PhD c Nadasdy Tibor MD a Shilo Konstantin MD a * aDepartment of Pathology The Ohio State University Wexner Medical Center Columbus OH 43210 bDepartment of Medicine The Ohio State University Wexner Medical Center Columbus OH 43210 cDepartment of Surgery The Ohio State University Wexner Medical Center Columbus OH 43210 *Corresponding author. Department of Pathology The Ohio State University Wexner Medical Center E412 Doan Hall 450 West 10th Ave Columbus OH 43210. Konstantin.ShiloOSUMC.edu (K. Shilo) 13 12 2014 23 1 2014 5 2014 19 12 2014 45 5 1065 1070 2014 Elsevier Inc. All rights reserved. 2014 Summary Owing to the need of lifelong immunosuppression solid-an transplant recipients are known to have an increased risk of posttransplant malignancies including lung cancer. Posttransplant neoplastic transformation of donor-derived cells giving rise to hematopoietic malignancies Kaposi sarcoma and basal cell carcinoma in nongraft tissues has been reported. The goal of this study was to assess the cell origin (donor versus recipient derived) of posttransplant non“small cell lung carcinomas (NSCLCs) in kidney and heart transplant recipients. An institutional database search identified 2557 kidney and heart transplant recipients in 8 consecutive years. Among this cohort 20 (0.8%) renal and 18 (0.7%) heart transplant recipients developed NSCLC. The study cohort comprised 6 of 38 NSCLCs arising in donor-recipient sex-mismatched transplant patients. The tumor cell origin was evaluated by chromogenic in situ hybridization with Y-chromosome probe on formalin-fixed paraffin-embedded tissues. Y-chromosome was identified in 97% ± 1% (range from 92% to 99%) of all types of nucleated cells in male control tissues. In all 5 NSCLCs from male recipients of female donor an Y-chromosome was identified in 97% ± 2% (range from 92% to 100%) of tumor cells statistically equivalent to normal control (P < .001). No Y-chromosome was identified in NSCLC cells from a female recipient of male kidney. These findings suggest a recipient derivation of NSCLC arising in kidney and heart transplant recipients. A combination of histologic evaluation and chromogenic in situ hybridization with Y-chromosome analysis allows reliable determination of tissue origin in sex-mismatched solid-an transplant recipients and may aid in management of posttransplant malignancy in such cases. Post“solid-an transplantation lung cancer Chromogenic in situ hybridization for Y-chromosome 15030100R 648 Ann Thorac Surg Ann. Thorac. Surg. The Annals of thoracic surgery 0003-4975 1552-6259 24576597 4008142 10.1016/j.athoracsur.2013.12.043 NIHMS571118 Accuracy of FDG-PET within the clinical practice of the ACOSOG Z4031 trial to diagnose clinical stage I NSCLC Grogan Eric L. MD MPH a b c Deppen Stephen A. MA MS PhD b c * Ballman Karla V. f Andrade Gabriela M. b Verdial Francys C. b Aldrich Melinda C. b d Chen Chiu L. e Decker Paul A. f Harpole David H. MD g Cerfolio Rrobert J. MD h Keenan Robert J. MD i Jones David R. MD j D™Amico Thomas A. MD g Shrager Joseph B. MD k Meyers Bryan F. MD l Putnam Joe B. Jr. MD a b aVeterans Affairs Medical Center Nashville TN bDepartment of Thoracic Surgery; Department of Medicine Vanderbilt University Medical Center Nashville TN cInstitute for Medicine and Public Health Vanderbilt University Medical Center Nashville TN dDivision of Epidemiology Vanderbilt University Medical Center Nashville TN eCenter for Quantitative Sciences Vanderbilt University Medical Center Nashville TN fDivision of Biomedical Statistics and Informatics Mayo Clinic Rochester MN gDepartment of Surgery Duke University Durham NC hDepartment of Surgery University of Alabama Birmingham AL iDepartment of Surgery Allegheny General Hospital Pittsburgh PA jDepartment of Surgery University of Virginia Charlottesville VA kDepartment of Surgery Stanford University Stanford CA lDepartment of Surgery Washington University St. Louis MO Corresponding Author/Request for Reprints: Eric Grogan M.D. M.P.H. Department of Thoracic Surgery 609 Oxford House 1313 21st Ave. South Nashville TN 37232 Phone: 615-322-0064 Fax: 615-343-9194 eric.groganvanderbilt.edu * Equal shared co-first author 23 4 2014 25 2 2014 4 2014 01 4 2015 97 4 1142 1148 2014 The Society of Thoracic Surgeons. Published by Elsevier Inc. All rights reserved. 2014 Background Fluoro-deoxyglucose positron emission tomography (FDG-PET) is recommended for diagnosis and staging of NSCLC. Meta-analyses of FDG-PET diagnostic accuracy demonstrated sensitivity and specificity of 96% and 78% respectively but were performed in select centers introducing potential bias. This study evaluates the accuracy of FDG-PET to diagnose NSCLC and examines differences across enrolling sites in the national ACOSOG Z4031 trial. Methods 959 eligible patients with clinical stage I (cT1-2N0M0) known or suspected NSCLC were enrolled between 2004 and 2006 in the Z4031 trial and 682 had a baseline FDG-PET. Final diagnosis was determined by pathological examination. FDG-PET avidity was categorized into four levels based on radiologist description or reported maximum standard uptake value (SUV). FDG-PET diagnostic accuracy was calculated for the entire cohort. Accuracy differences based on preoperative size and by enrolling site were examined. Results Preoperative FDG-PET results were available for 682 participants enrolled at 51 sites in 39 cities. Lung cancer prevalence was 83%. FDG-PET sensitivity was 82% (95% CI: 79“85) and specificity was 31% (95% CI: 23%“40%). Positive and negative predictive values were 85% and 26% respectively. Accuracy improved with lesion size. Of 80 false positive scans 69% were granulomas. False negative scans occurred in 101 patients with adenocarcinoma being the most frequent (64%) and eleven were ?10mm. The sensitivity varied from 68% to 91% (p=0.03) and the specificity ranged from 15% to 44% (p=0.72) across cities with > 25 participants. Conclusions In a national surgical population with clinical stage I NSCLC FDG-PET to diagnose lung cancer performed poorly compared to published studies. Tumour Biol Tumour Biol Tumour Biology 1010-4283 1423-0380 Springer Netherlands Dordrecht 24510347 4053595 1674 10.1007/s13277-014-1674-x Research The diagnostic and prognostic value of serum human kallikrein-related peptidases 11 in non-small cell lung cancer Xu Chun-Hua Zhang Yu Yu Li-Ke +86-25-8372-8558 +86-25-83728558 yulike_doctor163.com Department of Respiratory Medicine Nanjing Chest Hospital 215 Guangzhou Road Nanjing 210029 China Nanjing Clinical Center of Respiratory Diseases Nanjing China 9 2 2014 9 2 2014 6 2014 35 6 5199 5203 6 12 2013 22 1 2014 The Author(s) 2014 Open Access This is distributed under the terms of the Creative Commons Attribution License which permits any use distribution and reproduction in any medium provided the original author(s) and the source are credited. The aim of this study was to explore the diagnostic and prognostic value of serum human kallikrein-related peptidases 11 (KLK11) level in non-small cell lung cancer (NSCLC). Serum specimens from 138 patients with NSCLC and 40 healthy controls were collected. The concentration of KLK11 was measured by enzyme-linked immunosorbent assay (ELISA). The concentration of KLK11 in NSCLC was significantly higher compared to that in the controls (P?<?0.01). The serum KLK11 levels decreased with stage presence of lymph node and distant metastases regardless of histology age and sex. With a cutoff point of 1.05 ng/ml KLK11 showed a good diagnostic performance for NSCLC. Univariate analysis revealed that NSCLC patients with serum high KLK11 had a longer overall survival (OS) and progression-free survival (PFS) than those with low KLK11 (HR of 0.36 P?=?0.002; HR of 0.46 P?=?0.009). Cox multivariate analysis indicated that KLK11 was an independent prognostic indicator of PFS and OS (HR of 0.53 P?=?0.042; HR of 0.48 P?=?0.037). Kaplan“Meier survival curves further confirmed that patients with high KLK11 have longer PFS and OS (P?=?0.003 and P?=?0.018 respectively). In conclusion the measurement of KLK11 might be a useful diagnostic and prognostic test for NSCLC patients. Keywords Kallikrein-related peptidases 11 Non-small cell lung cancer Diagnosis Prognosis issue-copyright-statement International Society of Oncology and BioMarkers (ISOBM) 2014 Introduction Lung cancer is the leading cause of cancer-related death worldwide with more than 1.2 million deaths each year [1]. Non-small cell lung cancer (NSCLC) accounts for 80“85 % of total lung malignancies [2]. Although advances in noninvasive methods have improved our ability to detect lung cancer more than 75 % of lung cancer patients present an advanced stage of disease [3] and they have little prospect of effective and curative treatment with 5-year survival rates of less than 15 % [4]. Tumor markers play a key role in patient management for many malignancies. The potential uses of serum tumor markers include aiding early diagnosis determining prognosis prospectively predicting response or resistance to specific therapies and monitoring therapy in patients with advanced disease. Kallikrein-related peptidases 11 (KLK11) is a member of the human kallikrein gene family which localized on chromosome 19q13.4 [5]. Recent studies have reported that KLK11 has been expressed in many cancers including prostate cancer [6] ovarian cancer [7] gastric cancer [8] as well as rectal carcinoma [9]. An immunofluorometric assay study demonstrated that KLK11 expression in ovarian cancer tissues is a marker of favorable prognosis since patients with KLK-positive tumors exhibit a longer progression-free survival (PFS) and overall survival (OS) [10]. Additionally Sasaki et al. [11] reported that lower KLK11 mRNA expression in lung cancer is an indicator of poor prognosis in patients with lung cancer. However there seems to be a paucity of research concerned with serum KLK11 expression in NSCLC. For this reason the goal of the present study was to investigate the baseline serum levels of KLK11 in patients with NSCLC to determine its potential diagnostic and prognostic roles. Materials and methods Patients A total of 138 patients with NSCLC were examined at the Nanjing Chest Hospital between January 2006 and May 2008. The cohort of patients included 80 (58.0 %) male and 58 (42.0 %) female subjects with a median age of 56 years (range 45“68 years). The clinical features of the patients are summarized in Table 1. Follow-up lasted through December 2012 with a median follow-up period of 22 months for living patients (range 3“80 months). PFS was defined as the time interval between the date of diagnosis and the date of disease relapse. OS was defined as the time interval between the date of diagnosis and the date of death.Table 1Clinical characteristics of NSCLC patients and controlsVariablesNSCLCControl P valueSubject no.13840Age year57.8?±?10.254.6?±?7.80.614Male/Female80/5826/140.325Histology?AC78?SCC60 AC adenocarcinoma SCC squamous cell carcinoma The diagnosis of lung cancer was made using various methods: sputum cytology fine-needle aspiration or bronchoscopy as dictated by the patient™s presentation. Pathologists interpreted the cytology or histology of tissue biopsy. Lung cancer was staged using a widely used classification system and the staging procedure included a clinical examination; CT of the chest abdomen and brain; abdominal ultrasonography; bone scanning; and positron emission tomography. The study protocol was approved by the ethics committee of Nanjing Chest Hospital. All patients provided written informed consent before enrollment. Measurement of serum KLK11 levels Serum samples from each individual were obtained at the time of diagnosis before any therapeutic measures were started (surgery chemotherapy or radiation). Samples were centrifuged at 1500×g for 10 min at ?4 °C. The supernatant was stored at ?80 °C for assessment of the levels of KLK11. The KLK11 concentration was determined by ELISA with the commercial KLK11 ELISA Ready-SET-Go kit (eBioscience San Diego CA). All samples were blinded to the technologists running the assays and the code was broken to the statisticians after the database was constructed. Statistical analysis Statistical software (SPSS for Windows version 18) was used for the analysis. Differences between independent groups were examined by the Mann“Whitney U test. To determine the diagnostic accuracy of KLK11 receiver operating characteristic (ROC) curves were retrieved from logistic regression analysis and the area under the curve (AUC) was calculated. Univariate survival analysis was performed using the Kaplan“Meier method and the log-rank test. Multivariate analysis was conducted to determine an independent impact on survival using the Cox proportional hazard method. P?<?0.05 was considered statistically significant. Results Comparison of serum KLK11 levels between NSCLC patients and controls As shown in Fig. 1 the concentration of KLK11 was significantly higher in patients with NSCLC (2.04?±?0.86 ng/ml) than in those with the controls (0.93?±?0.52 ng/ml) (P?<?0.01).Fig. 1Levels of KLK11 in NSCLC. Among 138 NSCLC patients the serum levels of KLK11 were 2.04?±?0.86 ng/ml which were significantly higher than 0.93?±?0.52 ng/ml in healthy controls (P?<?0.01) Diagnostic value of KLK11 in NSCLC A ROC curve analysis was carried out to assess the value of KLK11 in NSCLC. The area under the ROC curve was 0.892 (confidence interval (95 % CI) 0.841“0.942). With a cutoff point of 1.05 ng/ml which was defined as the normal value based on the mean value plus two standard deviation obtained from healthy controls serum KLK11 has a sensitivity of 65.9 % (91/138) a specificity of 82.5 % (33/40) an accuracy of 69.7 % (124/178) a positive predictive value of 92.9 % (91/98) and a negative predictive value of 41.3 % (33/80) (Fig. 2).Fig. 2ROC of KLK11 for the diagnosis of NSCLC. Serum levels of KLK11 among 138 NSCLC patients and 40 healthy controls were determined. The diagnostic potentials of KLK11 were assessed by ROC curves. The AUC value was 0.892 Relationship between serum KLK11 levels and clinicopathologic factors The relationships between KLK11 levels and clinicopathologic factors of lung cancer patients are shown in Table 2. The serum KLK11 levels did not differ significantly with age (P?=?0.569) sex (P?=?0.505) or histology (P?=?0.713). The levels of KLK11 were significantly correlated with tumor-node-metastasis (TNM) stage (P?=?0.000) lymph node metastases (P?=?0.000) and distant metastases (P?=?0.000).Table 2The clinicopathological factors of NSCLC and the association with KLK11 levelsFactorsnKLk11 (ng/ml) P- valueAge year0.569??60622.07?±?0.77?<60762.12?±?0.66Gender0.505?Male802.16?±?0.82?Female581.99?±?0.53Histology0.713?AC782.05?±?0.85?SCC602.01?±?0.53TNM stage0.000?I“II882.51?±?0.61?III“IV501.76?±?0.63Lymph node metastases0.000?Absent682.41?±?0.64?Present701.65?±?0.57Distant metastases0.000?Absent982.38?±?0.59?Present401.89?±?0.71 AC adenocarcinoma SCC squamous cell carcinoma Association of serum KLK11 levels with survival Finally we determined whether the baseline serum concentration of KLK11 would be a prognostic marker in NSCLC. The cutoff point of 1.05 ng/ml was selected to categorize patients as KLK11-high or low. Univariate analysis showed that serum KLK11 level was significantly correlated OS (P?=?0.002) and PFS (P?=?0.009) (Table 3).Table 3Univariate and multivariate analysis of KLK11 status with regard to PFS and OSVariablesPFSOSHR95 % CI P valueHR95 % CI P valueUnivariate analysis?KLK11 (Low vs. High)0.460.25“0.820.0090.360.19“0.690.002?Age (?60 vs. <60)1.230.67“2.280.5061.180.59“2.130.792?Gender (Male vs. Female)1.320.71“1.820.7821.190.69“1.980.673?Histology (AC vs. SCC)1.830.59“2.130.7921.340.65“1.980.546?Stage (I“II vs. III“IV)1.330.65“2.210.0010.931.09“3.440.025?Lymph node metastases (absent vs. present)1.421.04“1.940.2711.770.32“1.660.347?Distant metastases (absent vs. present)1.981.03“3.010.0391.871.04“2.990.075Multivariate analysis?KLK11 (low vs. high)0.530.29-0.970.0420.480.24-0.950.037?Age (?60 vs. <60)0.980.52-1.940.8341.061.28-3.010.128?Gender (male vs. Female)1.280.67-1.890.6721.140.46-2.140.542?Histology (AC vs. SCC)1.371.04-2.330.3151.260.64-2.560.424?Stage (I“II vs. III“IV)1.250.56-2.260.0011.961.02-3.770.043?Lymph node metastases (absent vs. present)1.130.81-1.570.1481.840.33-1.720.334?Distant metastases (absent vs. present)1.440.85-1.970.0981.890.99-2.350.051 HR hazard ratio CI confidence interval In multivariate analysis high KLK11 was found to be significantly associated with a longer PFS and OS (HR 0.53 and 0.48; P?=?0.042 and P?=?0.037 respectively). Kaplan“Meier survival curves (Fig. 3) further demonstrate that lung cancer patients with high KLK11 have substantially longer PFS and OS (P?<?0.05) compared to those with low KLK11 cancer. As expected disease stage was found to be strongly associated with decreased PFS and OS in both univariate and multivariate analyses (P?<?0.05).Fig. 3Kaplan“Meier survival curves for PFS and OS in patients with KLK11-high and -low NSCLC. Log-rank test determined that the PFS and OS in high KLK11 group were significantly longer than those in the low KLK11 group (P?=?0.003; P?=?0.018) Discussion During the last few years numerous studies have been published which attempt to refine our understanding of determinants of prognosis in lung cancer by analyzing tumor-associated markers thought to be of biologic relevance in the carcinogenic process. Proteolytic enzymes of several catalytic classes have emerged as important prognostic factors in cancer [12]. Among these enzymes are many members of human tissue kallikrein family of secreted serine proteases including KLK11 a promising biomarker for lung cancer diagnosis and prognosis [1113]. In the present study serum KLK11 levels were significantly elevated in patients with lung cancer compared with control subjects making them potential adjunctive tools for diagnosis of lung cancer. Furthermore at a cutoff point of 1.05 ng/ml KLK11 had a sensitivity of 91.3 % and a specificity of 72.5 % for the prediction of lung cancer. Importantly the serum KLK11 levels did not differ significantly with age gender and histology. The levels of KLK11 were significantly correlated with TNM stage the presence of lymph node and distant metastases. Several previous studies have reported an association between kallikrein mRNA expression and cancer prognosis [14“16]. KLK5 and KLK4 have been associated with poor prognosis in ovarian cancer and KLK5 has also been shown to be associated with poor prognosis in breast cancer [1718]. In contrast KLK8 and KLK9 expression have been reported to be favorable prognosis in ovarian cancer [1920]. In addition KLK12 is reported to be an independent and favorable prognostic marker for breast cancer [21]. Sasaki et al. [11] "

Lung_Cancer

"Background Complement receptor 1 (CR1) the receptor for C3b/C4b complement peptides plays a crucial role in carcinogenesis. However the association of genetic variants of CR1 with susceptibility to lung cancer remains unexplored. Methods This case-control study included 470 non-small cell lung cancer (NSCLC) patients and 470 cancer-free controls. Based on the Chinese population data from HapMap database we used Haploview 4.2 program to select candidate tag SNPs. Odds ratios (ORs) and 95% confidence intervals (CIs) were computed by logistic regression to evaluate the association of each tag SNP with NSCLC. Results Multivariate regression analysis indicated that the rs7525160 CC genotype was associated with an increased risk of developing NSCLC (OR?=?1.52 95% CI?=?1.02-2.28; P?=?0.028) compared with the GG genotype. When stratified by smoking status the risk of NSCLC was associated with the rs7525160 C allele carriers in smokers with OR (95% CI) of 1.72 (1.15-2.79) but not in non-smokers with OR (95% CI) of 1.15 (0.81-1.65). When the interaction between smoking status and rs7525160 G?>?C variant was analyzed with cumulative smoking dose (pack-year). Similarly GC or CC genotype carriers have increased risk of NSCLC among heavy smokers (pack-year???25) with OR (95% CI) of 2.01 (1.26-3.20) but not among light smokers (pack-year <25) with OR (95% CI) of 1.32 (0.81-2.16). Conclusion CR1 rs7525160 G?>?C polymorphism was associated with an increased risk of developing NSCLC in Chinese population. The association displays a manner of gene-environmental interaction between CR1 rs7525160 tagSNP and smoking status. CR1 Polymorphism Tag SNPs Lung cancer Background The complement system plays a critical role in the process of carcinogenesis. Despite of significant research controversial viewpoints remain on the exact relationship of complement system with cancer. Classically the complement system fights against cancer by exerting the effects of immunosurveillance in the immunologic microenvironment of tumors [1]. Recently it was found that complement may contribute to tumor growth by a wide variety of mechanisms including dysregulation of mitogenic signaling pathways sustained cellular proliferation angiogenesis insensitivity to apoptosis invasion and migration and escape from complement cytotoxicity [2]. This suggested complement just like a double-edged sword plays a dual role in carcinogenesis. In particular component C3 and its receptors have been demonstrated to be a key link between innate and adaptive immunity [3]. Complement receptor type 1 (CR1 CD35) is a multifunctional polymorphic glycoprotein which binds to C3b fragment of C3 and to C4b with lower affinity [45]. CR1 belongs to the regulators of complement activation (RCA) family of proteins and is expressed in a wide spectrum of cells and involved in T-cell and B-cell mediated immune regulation [67]. CR1 also modulates the complement cascade activation by preventing formation of classical and alternative pathway convertases and by acting as a cofactor for factor I mediated inactivation of C3b and C4b [89]. It has been demonstrated that chronic inflammation can predispose to cancer development and spread [10] as a fundamental component of innate immunity the complement cascade consists of potential proinflammatory molecules especially C3 and C5. Moreover complement activation and abnormal expression in tumor tissues has been demonstrated [11]. Considering the important role of CR1 in complement activation innate immunity and chronic inflammation CR1 has emerged as a molecule of immense interest in gaining insight into the susceptibility to cancer. CR1 gene is located on the Chromosome 1 at the locus 1q32 [12]. Various polymorphisms have been studied including the intronic and exonic density polymorphism for their ability to alter the density of erythrocyte CR1 on the cell membranes [13-15]. There are also the molecular weight variants due to insertion-deletion polymorphisms [16]. Up to now there have been very few studies on the association of genetic variants of CR1 with susceptibility to autoimmune and inflammatory diseases. It has been proposed that genetic variant at CR1 gene (rs6656401) might influence the susceptibility to late-onset Alzheimer™s disease [17]. CR1 expression in Peripheral Blood Mononuclear Cells (PBMCs) may be a new biomarker for prognosis of nasopharyngeal carcinoma and a potential therapeutic target [18]. Recently it has been indicated that CR1 A3650G (His1208Arg) polymorphism plays a critical role in conferring genetic susceptibility to gallbladder cancer in north Indian population [19]. However the association of genetic variants of CR1 with risk of lung cancer remains unexplored. Worldwide lung cancer is the most common cancer in terms of both incidence and mortality [20]. NSCLC is the most common subtype of lung cancer and less aggressive and metastic than SCLC. Although cigarette smoking is the predominant risk factor for lung cancer inherited genetic characteristics are presumed to account in part for this interindividual variation in lung cancer susceptibility. Recently several genome-wide association studies have demonstrated the common genetic variations associated with susceptibility to lung cancer [21-24]. Given the involvement of the complement system in coordinating innate immunity and inflammatory response [25] further examination of the potential association between genetic variation of CR1 genes and lung cancer is warranted. In the current study we conducted a case-control study to investigate the association of tag SNPs in CR1 gene with the risk of NSCLC and effect of the interaction of gene-environment on the risk of NSCLC. Results Subject characteristics The frequency distributions of select characteristics in cases and control subjects were shown in . The mean age (±SD) was 59.6?±?10.5 years for the cancer patients and 57.2?±?13.3 years for the controls. No significant difference was found in the mean age between cases and controls (P?=?0.470). There was no significant difference in proportion of sex and smoking status between cases and controls (P?=?0.832 and P?=?0.321 respectively). However there was significant difference between cases and controls when compared by pack-year smoked (P = 0.001). The heavy smokers (?25 pack-year) accounted for 61.5% in cases but only 45.5% in controls which suggested that cigarette smoking was a prominent contributor to the risk of lung cancer. Of the 470 case patients 178 (37.9%) were diagnosed as adenocarcinoma 238 (50.6%) as squamous cell carcinoma and 100 (%) as other types including large cell carcinoma (n?=?49) and mixed cell carcinoma (n?=?5). Distributions of select characteristics in cases and control subjects Variables ???Cases (n?=?470) ???Controls (n?=?470) No (%) No (%) P a ???Sex 0.832 ???Male 324 68.9 328 69.8 ???Female 146 31.1 142 30.2 ???Age 0.470 ???<50 84 17.9 96 20.4 ???50-59 177 37.7 187 39.8 ???60-69 129 27.4 111 23.6 ????70 80 17.0 76 16.2 ???Smoking status 0.321 ???Non-smoker 265 56.4 281 59.8 ???Smoker 205 43.6 189 40.2 ???Pack-year smoked 0.001 ???<25 75 36.6 96 50.8 ????25 130 63.4 93 49.2 aTwo-sided ?2 test. Association of CR1 tag SNP with NSCLC risk Total 13 selected tag SNPs of CR1 in HapMap database among Chinese population were analyzed. Except for rs9429782 polymorphism the genotype distributions of other SNPs in controls were consistent to Hardy-Weinberg equilibrium. Therefore we excluded the rs9429782 from further analysis. In order to screen the genetic variants that confer the susceptibility to lung cancer 12 candidate tagSNPs were genotyped in a case-control study consisting of 470 lung cancer patients and 470 cancer-free controls as shown in . Importantly genotype frequency of one intronic SNP (rs7525160 G?>?C) in cases was found to be significantly different from those of controls (?2?=?6.339 P=0.042). Further multivariate regression model with adjustment for age gender and smoking status was used to assess the association between rs7525160 G?>?C polymorphism and the risk of NSCLC. The results indicated that the rs7525160 CC genotype was associated with an increased risk of developing NSCLC with OR (95% CI) of 1.52 (1.02-2.28) compared with the GG genotype. Other tagSNPs of CR1 were not significantly associated with the risk of NSCLC in our study population (P >0.05). Genotype frequencies of CRI among cases and controls and their association with non-small cell lung cancers CRI Genotypes ??Controls (n?=?470) ??Cases (n?=?470) OR (95% CI ) * P No (%) No (%) rs7525160 ??GG 176 37.5 139 29.6 1.00 (ref.) ??CG 228 48.5 256 54.5 1.38 (1.04-1.85) 0.041 ??CC 66 14.0 75 15.9 1.52 (1.02-2.28) 0.028 rs3886100 ??GG 117 24.9 105 22.4 1.00 (ref.) ??AG 223 47.4 253 53.8 1.33 (0.97-1.81) 0.078 ??AA 130 27.7 112 23.8 1.06 (0.73-1.54) 0.755 rs11118167 ??TT 348 74.1 353 75.1 1.00 (ref.) ??CT 111 23.6 102 21.7 0.89 (0.65-1.21) 0.457 ??CC 11 2.3 15 3.2 1.35 (0.61-3.01) 0.461 rs9429782 ??GG 250 53.2 261 55.5 1.00 (ref.) ??GT 220 46.8 209 44.5 0.89 (0.69-1.16) 0.388 rs10494885 ??CC 178 37.9 164 34.9 1.00 (ref.) ??CT 224 47.6 232 49.4 1.11 (0.83-1.47) 0.490 ??TT 68 14.5 74 15.7 1.20 (0.81-1.78) 0.365 rs7542544 ??CC 128 27.2 108 23.0 1.00 (ref.) ??AC 223 47.5 252 53.6 1.21 (0.88-1.67) 0.239 ??AA 119 25.3 110 23.4 0.90 (0.62-1.30) 0.897 rs6691117 ??AA 324 68.9 327 69.6 1.00 (ref.) ??AG 131 27.9 128 27.2 0.98 (0.73-1.31) 0.888 ??GG 15 3.2 15 3.2 0.96 (0.46-2.02) 0.923 rs6656401 ??GG 436 92.8 447 95.1 1.00 (ref.) ??AG 34 7.2 23 4.9 0.68 (0.39-1.18) 0.174 ??AA 0 0.0 0 0.0 NC§ rs2296160 ??CC 185 39.4 194 41.3 1.00 (ref.) ??CT 226 48.1 220 46.8 0.91 (0.69-1.21) 0.521 ??TT 59 12.5 56 11.9 0.90 (0.59-1.37) 0.606 rs9429942 ??TT 452 96.2 457 97.2 1.00 (ref.) ??CT 18 3.8 13 2.8 0.77 (0.37-1.61) 0.482 ??CC 0 0.0 0 0.0 NC§ rs4844600 ??GG 171 36.4 179 38.1 1.00 (ref.) ??AG 230 48.9 228 48.5 0.92 (0.70-1.22) 0.571 ??AA 69 14.7 63 13.4 0.87 (0.58-1.31) 0.513 rs3818361 ??CC 187 39.8 188 40.0 1.00 (ref.) ??CT 224 47.7 224 47.7 0.98 (0.74-1.29) 0.868 ??TT 59 12.5 58 12.3 0.96 (0.63-1.46) 0.848 rs17048010 ??TT 301 64.0 286 60.8 1.00 (ref.) ??CT 154 32.8 164 34.9 1.09 (0.82-1.43) 0.556 ??CC 15 3.2 20 4.3 1.40 (0.70-2.79) 0.343 *Adjusted by age sex and smoking status; §NC not calculated. Table 3 Summary of MDR gene-gene interaction results Models Training bal. acc. (%) Testing bal. acc. (%) P value Cross-validation consistency rs7525160 54.03 50.53 0.828 7/10 rs4844600 rs10494885 55.45 49.32 0.989 3/10 rs4844600 rs10494885 rs7525160 57.60 48.48 0.623 6/10 Generalized Multifactor Dimensionality Reduction (GMDR) was used to evaluate gene-gene interaction. The summary of gene-gene interaction models is listed in Table 3. The SNP rs7525160 in CR1 had the highest testing balanced accuracy among 12 SNPs. The three-way interaction model among rs4844600 rs10494885 and rs7525160 showed high testing balance accuracy and cross validation consistency but the testing balanced accuracy was lower than the two-way gene-gene interaction in NSCLC. For each model the interaction was not significant (P?>?0.05). Table 4 Risk of CR1 genotypes with NSCLC by smoking status Smoking status CR1 genotype GG * OR (95% CI) § P value CG?+?CC * OR (95% CI) § P value Non-smoker 84/99 1.00 (reference) 181/182 1.15 (0.81-1.65) 0.440 Smoker 55/77 0.86 (0.54-1.38) 0.528 150/112 1.72 (1.15-2.59) 0.009 <25 pack-years 19/41 0.59 (0.31-1.10) 0.099 56/55 1.32 (0.81-2.61) 0.266 ?25 pack-years 36/36 1.18 (0.67-2.08) 0.562 94/57 2.01 (1.26-3.20) 0.003 *Number of cases/number of controls. §Data were calculated by logistic regression and adjusted for age and gender. Interaction of CR1 SNP with smoking Cigarette smoking is a well-known risk for lung cancer so stratification by smoking status was performed to investigate the association of rs7525160 G?>?C variant with the risk of NSCLC. As shown in Table 4 the risk of NSCLC was associated with the rs7525160 C allele carriers in smokers with OR (95% CI) of 1.72 (1.15-2.59) but not in non-smokers with OR (95% CI) of 1.15 (0.81-1.65) suggesting that the CR1 rs7525160 G?>?C polymorphism is a smoking-modifying risk factor for susceptibility to NSCLC. When the interaction between smoking status and rs7525160 G?>?C variant was analyzed with cumulative smoking dose (pack-year) consistently GC or CC genotype carriers have increased risk of NSCLC among heavy smokers (pack-year???25) with OR (95% CI) of 2.01 (1.26-3.20) but not among light smokers (pack-year <25) with OR (95% CI) of 1.32 (0.81-2.16). The P value for heterogeneity of the stratification analysis by smoking status is 0.015. However the P value for interaction between rs7525160 polymorphism and smoking is 0.172 and the power for the interaction is 0.49. Discussion The chronic airway inflammation and dysfunctional immune system might promote pulmonary carcinogenesis. Implicated in the immune and inflammatory responses the complement cascade plays a pivotal role in the development of cancer. Thus it is likely that the genetic variants of CR1 in the complement system confer the susceptibility to lung cancer. In this study we have for the first time demonstrated that one intronic SNP (rs7525160 G?>?C) out of 13 tag SNPs of CR1 was associated with the risk of NSCLC in Chinese population. Notably the rs7525160 CC genotype was associated with an increased risk of developing NSCLC (OR?=?1.52 95% CI?=?1.02-2.28; P?=?0.028) compared with the GG genotype. MDR analysis also showed that there was no gene-gene interaction among 12 tag SNPs in CR1 gene. Moreover the risk of NSCLC was associated with the rs7525160 C allele carriers in smokers with OR (95% CI) of 1.72 (1.15-2.59) but not in non-smokers with OR (95% CI) of 1.15 (0.81-1.65) indicating this SNP is a smoking-modifying risk factor for susceptibility to NSCLC. To the best of our knowledge this study shed new insight into the interplay of genetic variation of CR1 with lung cancer risk. More importantly it highlights the potential gene-environmental interaction influences the susceptibility to lung cancer. The complement system has been proposed to get involved in innate immunity with the ability to œcomplement antibody-mediated elimination of immune complex and foreign pathogens [26]. Upon complement activation the biologically active peptides C5a and C3a elicit a lot of pro-inflammatory effects and could be closely associated with tumorigenesis [27]. Complement proteins play a dual role in the tumor microenvironment. On one hand they exert a defensive effect against tumor through complement or antibody-dependent cytotoxicity [128]. On the other hand they may escape from immunosurveillance and facilitate carcinogenesis [2]. Specifically a number of experimental evidence has suggested an association between complement activation and tumor growth [2930] which provides a strong biologically link between the abnormal expression and activity of complement cascade and carcinogenesis. Till now a few studies have been carried out to demonstrate the association of genetic variants in complement proteins with susceptibility to cancer. A significant association of CR2 SNP (rs3813946) with the development of nasopharyngeal carcinoma was indicated in Cantonese population [31] and the genetic variations of complement system genes C5 and C9 plays a potential role in susceptibility to non-Hodgkin lymphoma (NHL) [32]. Recently it has been shown that complement factor H Y402H polymorphism interact with cigarette smoking to confer the susceptibility to lung cancer [33]. Furthermore it has been indicated that CR1 A3650G (His1208Arg) polymorphism plays a critical role in conferring genetic susceptibility to gallbladder cancer in north Indian population [19]. However whether the genetic variants of CR1 are related to the risk of lung cancer remains unknown. In this case-control study we found an intronic SNP (rs7525160 G?>?C) with CC genotype was significantly associated with an increased risk of NSCLC. Consistently our results were in accordance with the study that genetic polymorphisms in innate immunity genes may play a role in the carcinogenesis of lung cancer [34]. It is likely that some genetic variations in strong link disequilibrium with this intronic SNP (rs7525160 G?>?C) are functional which provides a new insight into the hallmarks in susceptibility to lung cancer and further functional experiments are warranted to address the proposal. Functionally human CR1 exists on the surface of almost all peripheral blood cells and plays a key role in immune complex clearance and complement inhibition at the cell surface by binding to activated products C3b and C4b [435]. CR1 also possesses cofactor activity for the serum protease factor I and is thus involved in the generation of further fragments of C3/4b with the activation of complement cascade and the cellular immune response [4]. In our study the association of CR1 polymorphism with lung cancer is biologically plausible in that the intronic polymorphism could affect the density of CR1 molecules on the cell surface thereby contributing to autoimmune disorders and neoplasm. Tobacco smoking is an established risk factor for susceptibility to lung cancer. However not all people who suffer from lung cancer are smokers. Lung cancer in non-smokers can be induced by second hand smoke air pollutants and diesel exhaust [36-39]. Our present data showed significant difference of pack-year smoked but not smoking status between NSCLC cases and controls which suggested the important role of other environmental factors in the development of NSCLC. Tobacco could induce chronic and sustained inflammation in lung microenvironment contributing to pulmonary carcinogenesis in smokers [40]. Support also comes from the epidemiologic data regarding inflammation and lung cancer [41]. CR1 an important molecule implicated in immunity and inflammation could protect the host from invasion of exogenous chemicals derived from cigarette smoking. Genetic variant of CR1 could alter gene function and result in deregulation of the inflammatory and immune responses thereby modulating the susceptibility to lung cancer. More importantly we observed a potential interaction of this SNP (rs7525160 G?>?C) with smoking status suggesting the gene-environmental interaction plays a prominent role in the susceptibility to lung cancer. Our present study has its limitation. Our patients may not be representative of total NSCLC patients at large because they were recruited from only one hospital. In addition due to the relatively small sample size further case-control studies are still needed to replicate and extend our findings. Conclusion We conducted a case-control study in Chinese subjects and found an intronic SNP (rs7525160 G?>?C) of CR1 was significantly associated with lung cancer risk. To the best of our knowledge this study provides the first evidence that genetic variant of CR1 (rs7525160 G?>?C) was a smoking-modifying contributor to the development of lung cancer. Methods Study subjects This case-control study consisted of 470 patients with histopathologically confirmed NSCLC and 470 cancer-free controls. All subjects were genetic unrelated ethnic Han Chinese. Patients were recruited between January 2008 and December 2012 at Tangshan Gongren Hospital (Tangshan China). There were no age gender or stage restrictions however patients with previous malignancy or metastasized cancer from other organs were excluded. The response rate for patients was 94%. The controls were randomly selected from a pool of a cancer-free population from a nutritional survey conducted in the same region. The selection criteria for control subjects included: i) no individual history of cancer; ii) frequency matched to cases according to gender age (±5 years); iii) the residential region; and iv) the time period for blood sample collection. At recruitment informed consent was obtained from each subject and each participant was then interviewed to collect detailed information on demographic characteristics. This study was approved by the institutional review board of Hebei United University. Tag SNPs selection and genotyping Based on the Chinese population data from HapMap database we used Haploview 4.2 program to select candidate tag SNPs with an r2 threshold of 0.80 and minor allele frequency (MAF) greater than 1%. Furthermore we also added two potential functional polymorphisms rs9429942 and rs6691117 [4243]. Therefore we included 13 SNPs in our study which represents common genetic variants in Chinese population. Genotyping was performed at Bomiao Tech (Beijing China) using iPlex Gold Genotyping Asssy and Sequenom MassArray (Sequenom San Diego CA USA). Sequenom™s MassArray Designer was used to design PCR and extension primers for each SNP. Primer information for selected tag SNPs was listed in Table 5. Table 5 Primers used in this study SNP_ID Alleles 1st-PCR primer sequences 2nd-PCR primer sequences UEP sequences rs7525160 G/C ACGTTGGATGCAAAATCAAGGTTTAAAGTC ACGTTGGATGTTCTGACATGTACTGCCTGC CCCTGTTGCCTGGGTTTTTCT rs3886100 G/A ACGTTGGATGGGCCTCAGATCCTCAAAATC ACGTTGGATGTGAGCTGTTTCAGCCAAGAG GAGCCAAGAGGACACTTAG rs11118167 T/C ACGTTGGATGATGTGTGTAGTCACTTAGCC ACGTTGGATGATAATGGCAGATTTAAGGGC CAATGATAAATGAATACTGTGTTCTATC rs9429782 G/T ACGTTGGATGACACGCGGGATCCATCGGAA ACGTTGGATGAACGAGTTTCGCTGGCAGAG GGTGCAGCAGCAGAG rs10494885 C/T ACGTTGGATGGTGTAATGCCACAGACATGC ACGTTGGATGCCAGCCAACTGACCTTTATG CTTCTGATTTTCTTTCCTGTTAC rs7542544 C/A ACGTTGGATGGCTAAGAGCCATTAGTGTGC ACGTTGGATGAACGTGGTGGTGCCCAAACA CCATGACCCCAAAGC rs6691117 A/G ACGTTGGATGAGAGTACCAGGAAACAGGAG ACGTTGGATGACCCTACCATGACAAACCCG CCGGGCTGACATCTAAATCTGA rs6656401 G/A ACGTTGGATGAAAGGACACACACAGAGGAG ACGTTGGATGCGTTGATGTTCCTTGGCTTG CTCTGTCTCCATCTTCTC rs2296160 C/T ACGTTGGATGCCAGAATTCCTCAGCAAAAC ACGTTGGATGCCAGAGTGATGTTTTGTGAC CGTGCCTTTTGTCTTCCTTTTAGGT rs9429942 T/C ACGTTGGATGTACATGTGCACAACGTGCAG ACGTTGGATGAAGGACGAGTTAATGGGTGC GGGAACGTCGCACATGTAT rs4844600 G/A ACGTTGGATGGAATGGCTTCCATTTGCCAG ACGTTGGATGGGGCGGCATTCATAGTTCAG CCCAATGGGAAACTCAAA rs3818361 C/T ACGTTGGATGTGGAAAGGACAGTTCCAGAG ACGTTGGATGTTTTAAGCCCTCTGGTAAGC TAATCCCTCTGGTAAGCATAAGATATA rs17048010 T/C ACGTTGGATGTTTCAAGGCTGCTCCTTGTT ACGTTGGATGCCCAGTCTATGGAGTTTCTG AGACTGAGACAGTTGGT Statistical analysis We used Chi-square test to examine the differences in the distributions of demographic characteristics and genotype frequencies between cases and controls. The NSCLC risk associated with CR1 tag SNPs was estimated as odds ratios (OR) and 95% confidence intervals (CI) computed by logistic regression model adjusted for age gender and smoking status where it was appropriate. Smokers were considered current smokers if they smoked up to 1 year before the date of cancer diagnosis for NSCLC patients or before the date of the interview for controls. The number of pack-years smoked was determined as an indication of cumulative cigarette-dose level [pack-year?=?(cigarettes per day/20) × (years smoked)]. Light and heavy smokers were categorized by using the 50th percentile pack-year value of the controls as the cut points (i.e. ?25 and >25 pack-years). All statistical tests were 2 sided with P<?0.05 as the significant level. Statistical analyses were done using SPSS (version 16.0 SPSS Inc Chicago IL). Gene-gene and gene-smoking interactions were analyzed by open-resource GMDR software package (version 0.9) and Quanto (http://www.hydra.usc.edu/gxe) [4445]. Abbreviations CR1: Complement receptor 1; OR: Odds ratio; CI: Confidence interval; SNP: Single nucleotide polymorphism. Competing interests The authors declare no competing financial interest. Authors™ contributions XY drafted the article. XY and JR conducted genotyping of CR1. JL ZZ and LC collected clinical data and analyzed the data. XZ contributed the research plan and approved the data. All authors read and approved the final manuscript. Acknowledgements This work was supported by the National Natural Sciences Foundation of China to XZ (no. 81101483) Program for New Century Excellent Talents in University to XZ (NCET-11-0933) Science Fund for Distinguished Young Scholars of Hebei Scientific Committee to XZ (H2012401022) and Foundation for the Author of National Excellent Doctoral Dissertation of PR China (FANEDD) (no. 201274). Gelderman KA Tomlinson S Ross GD Gorter A Complement function in mAb-mediated cancer immunotherapy Trends Immunol 2004 25 158 164 10.1016/j.it.2004.01.008 15036044 Rutkowski MJ Sughrue ME Kane AJ Mills SA Parsa AT Cancer and the complement cascade Mol Cancer Res 2010 8 1453 1465 10.1158/1541-7786.MCR-10-0225 20870736 Liu D Niu ZX The structure genetic polymorphisms expression and biological functions of complement receptor type 1 (CR1/CD35) Immunopharmacol Immunotoxicol 2009 31 524 535 10.3109/08923970902845768 19874218 Ahearn JM Fearon DT Structure and function of the complement receptors CR1 (CD35) and CR2 (CD21) Adv Immunol 1989 46 183 219 2551147 Tas SW Klickstein LB Barbashov SF Nicholson-Weller A C1q and C4b bind simultaneously to CR1 and additively support erythrocyte adhesion J Immunol 1999 163 5056 5063 10528211 Wagner C Ochmann C Schoels M Giese T Stegmaier S Richter R Hug F Hansch GM The complement receptor 1 CR1 (CD35) mediates inhibitory signals in human T-lymphocytes Mol Immunol 2006 43 643 651 10.1016/j.molimm.2005.04.006 16360013 Jozsi M Prechl J Bajtay Z Erdei A Complement receptor type 1 (CD35) mediates inhibitory signals in human B lymphocytes J Immunol 2002 168 2782 2788 11884446 Rochowiak A Niemir ZI The structure and role of CR1 complement receptor in physiology Pol Merkur Lekarski 2010 28 79 83 20369732 Ross GD Lambris JD Cain JA Newman SL Generation of three different fragments of bound C3 with purified factor I or serum. I. Requirements for factor H vs CR1 cofactor activity J Immunol 1982 129 2051 2060 6214588 Coussens LM Werb Z Inflammation and cancer Nature 2002 420 860 867 10.1038/nature01322 12490959 Jurianz K Ziegler S Garcia-Schuler H Kraus S Bohana-Kashtan O Fishelson Z Kirschfink M Complement resistance of tumor cells: basal and induced mechanisms Mol Immunol 1999 36 929 939 10.1016/S0161-5890(99)00115-7 10698347 Weis JH Morton CC Bruns GA Weis JJ Klickstein LB Wong WW Fearon DT A complement receptor locus: genes encoding C3b/C4b receptor and C3d/Epstein-Barr virus receptor map to 1q32 J Immunol 1987 138 312 315 3782802 Wilson JG Wong WW Murphy EE 3rd Schur PH Fearon DT Deficiency of the C3b/C4b receptor (CR1)"

Lung_Cancer

"We retrospectively reviewed 91 patients with stage III NSCLC treated with definitive chemoradiation. All patients underwent a pretreatment diagnostic contrast enhanced CT (CE-CT) followed by a 4D-CT for treatment simulation. We used the average (average-CT) and expiratory (T50-CT) images from the 4D-CT along with the CE-CT for texture extraction. Histogram gradient co-occurrence gray-tone difference and filtration-based techniques were used for texture feature extraction. Penalized Cox regression implementing cross-validation was used for covariate selection and modeling. Models incorporating texture features from the 3 image types and CPFs were compared to models incorporating CPFs alone for overall survival (OS) local-regional control (LRC) and freedom from distant metastases (FFDM). Predictive Kaplan-Meier curves were generated using leave-one-out cross-validation. Patients were stratified based on their predicted outcome being above/below the median. Reproducibility of texture features was evaluated using test-retest scans from independent patients and quantified using concordance correlation coefficients (CCC). We compared models incorporating the reproducibility seen on test-retest scans to our original models and determined the classification reproducibility. Results Models incorporating both texture features and CPFs demonstrated a significant improvement in risk stratification compared to models using CPFs alone for OS (p=0.046) LRC (p=0.01) and FFDM (p=0.005). The average CCC was 0.890.91 and 0.67 for texture features extracted from the average-CT T50-CT and CE-CT respectively. Incorporating reproducibility within our models yielded 80.4 (SD=3.7) 78.3 (SD=4.0) and 78.8 (SD=3.9) percent classification reproducibility in terms of OS LRC and FFDM respectively. Conclusions Pretreatment tumor texture may provide prognostic information beyond what is obtained from CPFs. Models incorporating feature reproducibility achieved classification rates of ~80%. External validation would be required to establish texture as a prognostic factor. Br J Radiol Br J Radiol bjr The British Journal of Radiology 0007-1285 1748-880X The British Institute of Radiology. 25051977 4148827 14276 10.1259/bjr.20140276 Full Paper Cardiac/Chest Meta-analysis of CT-guided transthoracic needle biopsy for the evaluation of the ground-glass opacity pulmonary lesions J Yang et al Meta-analysis of CT-guided biopsy the GGO lesions Yang J-S MD 1 Liu Y-M MD 2 Mao Y-M MD 1 Yuan J-H MD 1 Yu W-Q MD 1 Cheng R-D MD 3 Hu T-Y MD 1 Cheng J-M MD 4 Wang H-y MD 5 1 Department of Radiology Zhejiang Provincial People's Hospital Hangzhou Zhejiang China 2 Department of Nephrology Zhejiang Provincial People's Hospital Hangzhou Zhejiang China 3 Department of Rehabilitation Medicine Zhejiang Provincial People's Hospital Hangzhou Zhejiang China 4 Department of Radiology Second Affiliated Hospital of Wenzhou Medical University Wenzhou Zhejiang China 5 Department of Sonography Hangzhou First People's Hospital Hangzhou Zhejiang China Address correspondence to: Mr Tingyang Hu. E-mail: hutingyangzj126.com 10 2014 October 2014 28 8 2014 87 1042 20140276 8 4 2014 Received on April 8 2014 3 7 2014 Revised on July 3 2014 21 7 2014 Accepted on July 21 2014 2014 The Authors. Published by the British Institute of Radiology 2014 The British Institute of Radiology Objective: This meta-analysis is to determine the overall diagnostic yield of CT-guided transthoracic needle biopsy (TNB) of ground-glass opacity (GGO) lesions. Methods: A PubMed search was performed using œground-glass opacity crossed with œcore biopsy and œneedle biopsy. Test performance characteristics with the use of forest plots summary receiver operating characteristic curves and bivariate random effects models were summarized. Adverse events if reported were recorded. Results: Our search identified 52 citations of which 6 diagnostic studies evaluated 341 patients. Pooled specificity estimates were 0.94 [95% confidence interval (CI) 0.84“0.98] and sensitivity estimates were 0.92 (95% CI 0.88“0.95) respectively. The positive likelihood ratio was 11.27 (95% CI 4.2“30.6) the negative likelihood ratio was 0.1 (95% CI 0.06“0.19) the diagnostic odds ratio was 131.38 (95% CI 39.6“436.0) and the area under the curve was 0.97. Conclusion: Our data suggest that the CT-guided TNB is likely to be a useful tool for tissue diagnosis and may serve as an alternative for further patient management with GGO lesions. However considering the limited studies and patients included large scale studies are needed to verify these findings. Advances in knowledge: Some studies about CT-guided TNB of GGO lesions have been published most have been small single-institution case series. To our knowledge our study is the first systematic analysis about CT-guided TNB of GGO lesions. ScientificWorldJournal ScientificWorldJournal TSWJ The Scientific World Journal 1537-744X Hindawi Publishing Corporation 24592197 3921948 10.1155/2014/902748 Research Oxidative Status and Acute Phase Reactants in Patients with Environmental Asbestos Exposure and Mesothelioma Sezgi Cengizhan 1 * Taylan Mahsuk 1 Selimoglu Sen Hadice 1 Evliyao?lu Osman 2 Kaya Halide 1 Abakay Ozlem 1 Abakay Abdurrahman 1 Tanr?kulu Abdullah Cetin 1 Senyi?it Abdurrahman 1 1Department of Pulmonary Diseases School of Medicine Dicle University 21280 Diyarbakir Turkey 2Department of Biochemistry School of Medicine Dicle University 21280 Diyarbakir Turkey *Cengizhan Sezgi: cengizhansezgigmail.com Academic Editors: E. Hopper-Be N. Sunaga and J. Thrasher 2014 23 1 2014 2014 902748 28 8 2013 19 11 2013 Copyright 2014 Cengizhan Sezgi et al. 2014 This is an open access distributed under the Creative Commons Attribution License which permits unrestricted use distribution and reproduction in any medium provided the original work is properly cited. Background and Objectives. The aim of this study was to investigate inflammatory indicators and oxidative status in patients with asbestos exposure with and without mesothelioma and to compare results with data from healthy subjects. Methods. Eighty people with exposure to environmental asbestos and without any disease 46 mesothelioma patients and a control group of 50 people without exposure to environmental asbestos were enrolled in this prospective study. Serum total oxidant level (TOL) total antioxidant capacity (TAC) and oxidative stress index (OSI) CRP transferrin ceruloplasmin ?-1 antitrypsin ferritin and copper levels were measured. Results. Mesothelioma group exhibited higher TOL OSI ?1-antitrypsin ferritin and copper levels as compared to the other groups (P < 0.001 P = 0.007 P < 0.0001 P < 0.001 and P < 0.001 resp.). Transferrin was lower in the mesothelioma group than in the other two groups (P < 0.001). The asbestos group had higher TOL TAC ?1-antitrypsin and transferrin levels (P < 0.001 P < 0.001 P < 0.001 and P < 0.001 resp.) as well as lower OSI and ferritin levels as compared to the control group (P < 0.001 and P < 0.001). Conclusions. We believe that elevated acute phase reactants and oxidative stress markers (TOL and OSI) in the mesothelioma group can be used as predictive markers for the development of asbestos-related malignancy. 1. Introduction Asbestos causes pulmonary fibrosis pleural diseases and malignancies. However the pathogenesis of asbestos-related diseases has not been clearly shown [1]. Recent studies indicate that increased production of reactive oxygen species (ROS) caused by asbestos plays an important role in this pathogenesis [2]. Oxidative stress occurs as a result of the failure to neutralize ROS with enzymatic and nonenzymatic systems [3]. Elevated levels of ROS lead to cell damage through peroxidation of double-chain fatty acids protein and DNA [4]. Moreover ROS have been shown to cause apoptosis inflammation and proliferation [5]. Previous studies have shown that exposure to asbestos leads to oxidative stress by revealing reduced levels of antioxidant enzymes such as superoxide dismutase catalase glutathione peroxidase and heme oxygenase [2 6]. However individual values of these enzymes may not correctly reflect total oxidant or total antioxidant status. Erel developed a new automated and colorimetric measurement method for total oxidant level (TOL) and total antioxidant capacity (TAC) while the ratio of these two parameters (TOL/TAC) is used for the calculation of oxidative stree index (OSI) which in turn allows the assessment of balance between ROS and antioxidant systems [7]. To our knowledge there is not any study evaluating oxidative stress in malignant mesothelioma (MM) and asbestos exposure in such detail in the literature. Chronic inflammation induced by different biologic and chemical factors has been shown to be a significant predisposing factor in the development of various an cancers [8]. For example chronic inflammatory bowel disease is a predisposing factor of colon cancer chronic B and C hepatitis are predisposing factors of hepatocellular carcinoma and chronic gastritis induced by Helicobacter pylori is a predisposing factor of gastric cancer [9“11]. Similarly there are studies investigating the link between chronic inflammation associated with long-term asbestos exposure and mesothelioma [12 13]. Authors claim that chronic inflammation triggered by asbestos exposure leads to increased production of ROS from inflammatory cells or alteration of immunocompetent cells and later reduction of tumor immunity [14 15]. "

Lung_Cancer

"reads in RNA-seq but only a few mutant reads in DNA-WES such as the example Luminal A tumor with a single DNA mutant read in the PIK3CA hotspot. This study's results support that RNA sequencing could be beneficial when added to DNA sequencing in clinical settings. Future studies could explore alternative ways to integrate DNA and RNA sequencing beyond UNCeqRMETA which is the first method of this kind. UNCeqRMETA applied the same quality filters for DNA and RNA and potentially different filters could be beneficial. UNCeqRMETA includes a basic indel realignment and integrated DNA and RNA reassembly could potentially be beneficial. Different statistical modeling could further advance the performance displayed by UNCeqRMETA over DNA only based methods. Balancing sensitivity and specificity is important in applying and developing mutation detectors. Receiver operating characteristic curve analysis such as that presented in this study enables assessment of sensitivity and specificity tradeoffs between alternate models. Integrated RNA-seq and DNA-WES mutation detection is important because it boosts sensitivity in low purity tumors in therapeutically-relevant genes and in driver genes relative to DNA-only detection. Integrated mutation detection could also enable more inclusive cohort profiling studies that censor tumors based on purity and could lead to more comprehensive characterizations of cancer genomes. In integrating DNA-WES and RNA-seq by UNCeqRMETA increases mutation detection performance and was extremely beneficial for low purity tumors. AVAILABILITY UNCeqR software is available at http://lbg.med.unc.edu/tools/unceqr. UNCeqR mutation detections for the lung and breast cohorts are available at ://tcga-data-secure.nci.nih.gov/tcgafiles/tcga4yeo/tumor/ and http://lbg.med.unc.edu/tools/unceqr. SUPPLEMENTARY DATASupplementary Data are available at NAR Online. SUPPLEMENTARY DATA FUNDING National Cancer Institute [F32CA142039 to M.D.W. Breast SPORE P50-CA058223 to C.M.P.]; National Institutes of Health [U24 CA143848 to C.M.P. D.N.H and U24 CA143848-02S1 to C.M.P. D.N.H.]. Funding for open access charge: National Institutes of Health. Conflict of interest statement. M.D.W. was a consultant for GeneCentric Diagnostics and Cancer Therapeutics Innovation Group. C.M.P. is an equity stock holder and Board of Director Member of BioClassifier LLC and GeneCentric Diagnostics. D.N.H. is equity stock holder and Board of Director Member GeneCentric Diagnostics. REFERENCES 1. Stratton M.R. Campbell P.J. Futreal P.A. The cancer genome Nature 2009 458 719 724 19360079 2. Roychowdhury S. Iyer M.K. Robinson D.R. Lonigro R.J. Wu Y.M. Cao X. Kalyana-Sundaram S. Sam L. Balbin O.A. Quist M.J. Personalized oncology through integrative high-throughput sequencing: a pilot study Sci. Transl. Med. 2011 3 111ra121 3. Korf B.R. Rehm H.L. New approaches to molecular diagnosis JAMA 2013 309 1511 1521 23571590 4. The Cancer Genome Atlas Research Network Comprehensive genomic characterization of squamous cell lung cancers Nature 2012 489 519 525 22960745 5. Wilkerson M.D. Yin X. Walter V. Zhao N. Cabanski C.R. Hayward M.C. Miller C.R. Socinski M.A. Parsons A.M. Thorne L.B. Differential pathogenesis of lung adenocarcinoma subtypes involving sequence mutations copy number chromosomal instability and methylation PLoS One 2012 7 e36530 22590557 6. The Cancer Genome Atlas Research Network Comprehensive molecular portraits of human breast tumours Nature 2012 490 61 70 23000897 7. The Cancer Genome Atlas Research Network Comprehensive molecular characterization of clear cell renal cell carcinoma Nature 2013 499 43 49 23792563 8. Meyerson M. Gabriel S. Getz G. Advances in understanding cancer genomes through second-generation sequencing Nat. Rev. Genet. 2010 11 685 696 20847746 9. Cibulskis K. Lawrence M.S. Carter S.L. Sivachenko A. Jaffe D. Sougnez C. Gabriel S. Meyerson M. Lander E.S. Getz G. Sensitive detection of somatic point mutations in impure and heterogeneous cancer samples Nat. Biotechnol. 2013 31 213 219 23396013 10. Kim S.Y. Speed T.P. Comparing somatic mutation-callers: Beyond Venn diagrams BMC Bioinformatics 2013 14 189 23758877 11. Ku C.S. Wu M. Cooper D.N. Naidoo N. Pawitan Y. Pang B. Iacopetta B. Soong R. Exome versus transcriptome sequencing in identifying coding region variants Expert Rev. Mol. Diagn. 2012 12 241 251 22468815 12. Carter S.L. Cibulskis K. Helman E. McKenna A. Shen H. Zack T. Laird P.W. Onofrio R.C. Winckler W. Weir B.A. Absolute quantification of somatic DNA alterations in human cancer Nat. Biotechnol. 2012 30 413 421 22544022 13. Goya R. Sun M.G. Morin R.D. Leung G. Ha G. Wiegand K.C. Senz J. Crisan A. Marra M.A. Hirst M. SNVMix: predicting single nucleotide variants from next-generation sequencing of tumors Bioinformatics 2010 26 730 736 20130035 14. Koboldt D.C. Chen K. Wylie T. Larson D.E. McLellan M.D. Mardis E.R. Weinstock G.M. Wilson R.K. Ding L. VarScan: variant detection in massively parallel sequencing of individual and pooled samples Bioinformatics 2009 25 2283 2285 19542151 15. Koboldt D.C. Zhang Q. Larson D.E. Shen D. McLellan M.D. Lin L. Miller C.A. Mardis E.R. Ding L. Wilson R.K. VarScan 2: somatic mutation and copy number alteration discovery in cancer by exome sequencing Genome Res. 2012 22 568 576 22300766 16. Larson D.E. Harris C.C. Chen K. Koboldt D.C. Abbott T.E. Dooling D.J. Ley T.J. Mardis E.R. Wilson R.K. Ding L. SomaticSniper: identification of somatic point mutations in whole genome sequencing data Bioinformatics 2012 28 311 317 22155872 17. Saunders C.T. Wong W.S. Swamy S. Becq J. Murray L.J. Cheetham R.K. Strelka: accurate somatic small-variant calling from sequenced tumor-normal sample pairs Bioinformatics 2012 28 1811 1817 22581179 18. Bamshad M.J. Ng S.B. Bigham A.W. Tabor H.K. Emond M.J. Nickerson D.A. Shendure J. Exome sequencing as a tool for Mendelian disease gene discovery Nat. Rev. Genet. 2011 12 745 755 21946919 19. Kolata G. Treatment for Leukemia Glimpses of the Future New York Times 2012 20. Wang Z. Gerstein M. Snyder M. RNA-Seq: a revolutionary tool for transcriptomics Nat. Rev. Genet. 2009 10 57 63 19015660 21. Cirulli E.T. Singh A. Shianna K.V. Ge D. Smith J.P. Maia J.M. Heinzen E.L. Goedert J.J. Goldstein D.B. Screening the human exome: a comparison of whole genome and whole transcriptome sequencing Genome Biol. 2010 11 R57 20598109 22. Xu X. Zhu K. Liu F. Wang Y. Shen J. Jin J. Wang Z. Chen L. Li J. Xu M. Identification of somatic mutations in human prostate cancer by RNA-Seq Gene 2013 519 343 347 23434521 23. Kridel R. Meissner B. Rogic S. Boyle M. Telenius A. Woolcock B. Gunawardana J. Jenkins C. Cochrane C. Ben-Neriah S. Whole transcriptome sequencing reveals recurrent NOTCH1 mutations in mantle cell lymphoma Blood 2012 119 1963 1971 22210878 24. Shah S.P. Kobel M. Senz J. Morin R.D. Clarke B.A. Wiegand K.C. Leung G. Zayed A. Mehl E. Kalloger S.E. Mutation of FOXL2 in granulosa-cell tumors of the ovary N. Engl. J. Med. 2009 360 2719 2729 19516027 25. Chandrasekharappa S.C. Lach F.P. Kimble D.C. Kamat A. Teer J.K. Donovan F.X. Flynn E. Sen S.K. Thongthip S. Sanborn E. Massively parallel sequencing aCGH and RNA-Seq technologies provide a comprehensive molecular diagnosis of Fanconi anemia Blood 2013 121 e138 e148 23613520 26. Miller A.C. Obholzer N.D. Shah A.N. Megason S.G. Moens C.B. RNA-seq-based mapping and candidate identification of mutations from forward genetic screens Genome Res. 2013 23 679 686 23299976 27. Hill J.T. Demarest B.L. Bisgrove B.W. Gorsi B. Su Y.C. Yost H.J. MMAPPR: mutation mapping analysis pipeline for pooled RNA-seq Genome Res. 2013 23 687 697 23299975 28. Kleinman C.L. Majewski J. Comment on œWidespread RNA and DNA sequence differences in the human transcriptome Science 2012 335 1302 author reply 1302 22422962 29. Lin W. Piskol R. Tan M.H. Li J.B. Comment on œWidespread RNA and DNA sequence differences in the human transcriptome Science 2012 335 1302 author reply 1302 22422964 30. Pickrell J.K. Gilad Y. Pritchard J.K. Comment on œWidespread RNA and DNA sequence differences in the human transcriptome Science 2012 335 1302 author reply 1302 22422963 31. Li H. Handsaker B. Wysoker A. Fennell T. Ruan J. Homer N. Marth G. Abecasis G. Durbin R. The sequence alignment/map format and SAMtools Bioinformatics 2009 25 2078 2079 19505943 32. Wang K. Singh D. Zeng Z. Coleman S.J. Huang Y. Savich G.L. He X. Mieczkowski P. Grimm S.A. Perou C.M. MapSplice: accurate mapping of RNA-seq reads for splice junction discovery Nucleic Acids Res. 2010 38 e178 20802226 33. Li H. Durbin R. Fast and accurate short read alignment with Burrows-Wheeler transform Bioinformatics 2009 25 1754 1760 19451168 34. Kleinman C.L. Adoue V. Majewski J. RNA editing of protein sequences: a rare event in human transcriptomes RNA 2012 18 1586 1596 22832026 35. Nemlich Y. Greenberg E. Ortenberg R. Besser M.J. Barshack I. Jacob-Hirsch J. Jacoby E. Eyal E. Rivkin L. Prieto V.G. MicroRNA-mediated loss of ADAR1 in metastatic melanoma promotes tumor growth J. Clin. Investig. 2013 123 2703 2718 23728176 36. Stouffer S.A. Suchman E.A. DeVinney L.C. Star S.A. Williams R.M. Studies in Social Pyschology in World War II 1949 Princeton New Jersey Princeton University Press 37. Mosteller F. Bush R. Llindzey G. Handbook of Social Pyschology 1954 Cambridge MA Addison-Wesley 289 334 38. Zaykin D.V. Optimally weighted Z-test is a powerful method for combining probabilities in meta-analysis J. Evol. Biol. 2011 24 1836 1841 21605215 39. Yee T. The {VGAM} package R News 2008 8 28 39 40. Karolchik D. Barber G.P. Casper J. Clawson H. Cline M.S. Diekhans M. Dreszer T.R. Fujita P.A. Guruvadoo L. Haeussler M. The UCSC genome browser database: 2014 update Nucleic Acids Res. 2014 42 D764 D770 24270787 41. Cabanski C.R. Wilkerson M.D. Soloway M. Parker J.S. Liu J. Prins J.F. Marron J.S. Perou C.M. Hayes D.N. BlackOPs: increasing confidence in variant detection through mappability filtering Nucleic Acids Res. 2013 41 e178 23935067 42. Wang K. Li M. Hakonarson H. ANNOVAR: functional annotation of genetic variants from high-throughput sequencing data Nucleic Acids Res. 2010 38 e164 20601685 43. Robinson J.T. Thorvaldsdottir H. Winckler W. Guttman M. Lander E.S. Getz G. Mesirov J.P. Integrative genomics viewer Nat. Biotechnol. 2011 29 24 26 21221095 44. Witten I.H. Frank E. Data Mining : Practical Machine Learning Tools and Techniques 2005 2nd edn Amsterdam; Boston MA Morgan Kaufman 45. Roberts N.D. Kortschak R.D. Parker W.T. Schreiber A.W. Branford S. Scott H.S. Glonek G. Adelson D.L. A comparative analysis of algorithms for somatic SNV detection in cancer Bioinformatics 2013 29 2223 2230 23842810 46. Iggo R. Gatter K. Bartek J. Lane D. Harris A.L. Increased expression of mutant forms of p53 oncogene in primary lung cancer Lancet 1990 335 675 679 1969059 47. Forbes S.A. Bindal N. Bamford S. Cole C. Kok C.Y. Beare D. Jia M. Shepherd R. Leung K. Menzies A. COSMIC: mining complete cancer genomes in the Catalogue of Somatic Mutations in Cancer Nucleic Acids Res. 2011 39 D945 950 20952405 48. Perou C.M. Sorlie T. Eisen M.B. van de Rijn M. Jeffrey S.S. Rees C.A. Pollack J.R. Ross D.T. Johnsen H. Akslen L.A. Molecular portraits of human breast tumours Nature 2000 406 747 752 10963602 49. Futreal P.A. Coin L. Marshall M. Down T. Hubbard T. Wooster R. Rahman N. Stratton M.R. A census of human cancer genes Nat. Rev. Cancer 2004 4 177 183 14993899 50. Wilkerson M.D. Yin X. Hoadley K.A. Liu Y. Hayward M.C. Cabanski C.R. Muldrew K. Miller C.R. Randell S.H. Socinski M.A. Lung squamous cell carcinoma mRNA expression subtypes are reproducible clinically important and correspond to normal cell types Clin. Cancer Res. 2010 16 4864 4875 20643781 51. Liao R.G. Jung J. Tchaicha J. Wilkerson M.D. Sivachenko A. Beauchamp E.M. Liu Q. Pugh T.J. Pedamallu C.S. Hayes D.N. Inhibitor-sensitive FGFR2 and FGFR3 mutations in lung squamous cell carcinoma Cancer Res. 2013 73 5195 5205 23786770 52. Bose R. Kavuri S.M. Searleman A.C. Shen W. Shen D. Koboldt D.C. Monsey J. Goel N. Aronson A.B. Li S. Activating HER2 mutations in HER2 gene amplification negative breast cancer Cancer Discov. 2013 3 224 237 23220880 Interact Cardiovasc Thorac Surg Interact Cardiovasc Thorac Surg icvts icvtsurg Interactive Cardiovascular and Thoracic Surgery 1569-9293 1569-9285 Oxford University Press 24130089 3867036 10.1093/icvts/ivt419 ivt419 New Ideas Thoracic Comparison of local tissue damage: monopolar cutter versus Nd:YAG laser for lung parenchyma resection. An experimental study Kirschbaum Andreas a * Braun Steve b Rexin Peter c Bartsch Detlef K. a Seyfer Perla b aVisceral Thoracic and Vascular Surgery Clinic University Hospital Giessen and Marburg GmbH Marburg Germany bClinic of Diagnostic and Interventional Radiology University Hospital Giessen and Marburg Marburg Germany cInstitute of Pathology University Hospital Giessen and Marburg Marburg Germany *Corresponding author: Visceral Thoracic and Vascular Surgery Clinic University Hospital Giessen and Marburg GmbH Baldingerstraße 35033 Marburg Germany. Tel: +49-6421-5862561; fax: +49-6421-5866593; e-mail: akirschb@med.uni-marburg.de (A. Kirschbaum). 1 2014 14 10 2013 18 1 1 6 26 4 2013 17 7 2013 19 8 2013 © The Author 2013. Published by Oxford University Press on behalf of the European Association for Cardio-Thoracic Surgery. All rights reserved. 2013 OBJECTIVES Lung metastases are non-anatomically resected while sparing as much parenchyma as possible. For this purpose a few surgeons use the Nd:YAG Laser LIMAX® 120 whereas the majority of surgeons use a monopolar cutter like the MAXIUM®. The aim of this experimental study was to investigate which instrument causes less lung-tissue damage at the same power output. METHODS These experiments were conducted on left lungs (n = 6) taken from freshly slaughtered pigs. The laser and the monopolar cutter were fixed in a hydraulic mover. The laser was focused at a distance of 3 cm to the lung tissue and the monopolar cutter was fixed in pressure-free contact with the lung surface. Both instruments were manoeuvred at a speed of 5 10 and 20 mm/s in a straight line at an output of 100 watts over the lung surface. The lung lesions that ensued were then examined macro- and microscopically. The same procedures were repeated at a distance of 1 cm creating parallel lesions in order to analyse the lung tissue in between the lesions for thermal damage. In addition two implanted capsules in the lung tissue simulating a lung nodule were resected with either the laser or the monopolar cutter. The resection surfaces were then examined by magnetic resonance imaging and histology for tissue damage. Finally we created a 2-cm wide mark on the lung surface to test the resection capacity of both instruments within 1 min. RESULTS The laser created sharply delineated lesions with a vaporization and coagulation zone without thermal damage of the surrounding lung tissue. With lowering the working speed each zone was extended. At a working speed of 10 mm/s the mean vaporization depth using the laser was 1.74 ± 0.1 mm and the mean coagulation depth was 1.55 ± 0.09 mm. At the same working speed the monopolar cutter demonstrated a greater cutting effect (mean vaporization depth 2.7 ± 0.11 mm; P < 0.001) without leaving much coagulation on the resection surface (mean coagulation depth 1.25 ± 0.1 mm; P = 0.002). In contrast to the laser the monopolar cutter caused thermal damage of the adjacent lung tissue. The adjacent tissue injury was detected in histological examination as well as in the MRI findings. Adjacent lung tissue after lung metastasectomy using the monopolar cutter was hyper-intensive in T2-weighted MR imaging indicating a severe tissue damage. No significant changes in signal intensity were observed in T2-weighted imaging of the adjacent lung tissue after using the laser for lung resection. One minute of laser applied at a 100-watt output penetrated a lung surface area of 3.8 ± 0.4 cm2 compared with 4.8 ± 0.6 cm2 of surface after application of the monopolar cutter (P = 0.001). CONCLUSIONS The monopolar cutter possesses indeed a greater cutting capacity than the laser but it also causes more adjacent tissue injury. Thus laser resection might be preferred for lung metastasectomy. Electrosurgical scalpel Laser Lung metastases Lung resection Tissue damage BMC Urol BMC Urol BMC "

Lung_Cancer

"involvement to disclose. 1 Nakashima S Watanabe A Obama T Yamada G Takahashi H Higami T Need for preoperative computed tomography-guided localization in video-assisted thoracoscopic surgery pulmonary resections of metastatic pulmonary nodules Ann Thorac Surg 2010 89 212 218 20103238 2 Chen S Zhou J Zhang J Hu H Luo X Zhang Y Chen H Video-assisted thoracoscopic solitary pulmonary nodule resection after CT-guided hookwire localization: 43 cases report and literature review Surg Endosc 2011 25 1723 1729 21181200 3 Ciriaco P Negri G Puglisi A Nicoletti R Del Maschio A Zannini P Video-assisted thoracoscopic surgery for pulmonary nodules: rationale for preoperative computed tomography-guided hookwire localization Eur J Cardiothorac Surg 2004 25 429 433 15019673 4 Suzuki K Nagai K Yoshida J Ohmatsu H Takahashi K Nishimura M Nishiwaki Y Video-assisted thoracoscopic surgery for small indeterminate pulmonary nodules: indications for preoperative marking Chest 1999 115 563 568 10027460 5 Seo JM Lee HY Kim HK Choi YS Kim J Shim YM Lee KS Factors determining successful computed tomography-guided localization of lung nodules J Thorac Cardiovasc Surg 2012 143 809 814 22104686 6 Gossot D Miaux Y Guermazi A Celerier M Friga J The hook-wire technique for localization of pulmonary nodules during thoracoscopic resection Chest 1994 105 1467 1469 8181339 7 Pittet O Christodoulou M Pezzetta E Schmidt S Schnyder P Ris HB Video-assisted thoracoscopic resection of a small pulmonary nodule after computed tomography-guided localization with a hook-wire system: experience in 45 consecutive patients World J Surg 2007 31 575 578 17318707 8 Chen W Chen L Yang S Chen Z Qian G Zhang S Jing J A novel technique for localization of small pulmonary nodules Chest 2007 131 1526 1531 17494801 9 Bernard A Resection of pulmonary nodules using video-assisted thoracic surgery: the Thorax Group Ann Thorac Surg 1996 61 202 204 8561553 10 Martin AE Chen JY Muratore CS Mayo-Smith WW Luks FI Dual localization technique for thoracoscopic resection of lung lesions in children J Laparoendosc Adv Surg Tech A 2009 19 S161 S164 18999984 11 Kawanaka K Nomori H Mori T Ikeda K Ikeda O Tomiguchi S Yamashita Y Marking of small pulmonary nodules before thoracoscopic resection: injection of lipiodol under CT-fluoroscopic guidance Acad Radiol 2009 16 39 45 19064210 12 Yamagami T Miura H Yoshimatsu R Tanaka O Ono S Iehara T Hosoi H Nishimura T Experience of fluoroscopy-aided thoracoscopic resection of pulmonary nodule localised with Lipiodol in a child J Med Imaging Radiat Oncol 2011 55 401 403 21843175 13 Iwasaki Y Nagata K Yuba T Hosogi S Kohno K Ohsugi S Kuwahara H Takemura Y Yokomura I Fluoroscopy-guided barium marking for localizing small pulmonary lesions before video-assisted thoracic surgery Respir Med 2005 99 285 289 15733503 14 Yoshida J Nagai K Nishimura M Takahashi K Computed tomography-fluoroscopy guided injection of cyanoacrylate to mark a pulmonary nodule for thoracoscopic resection Jpn J Thorac Cardiovasc Surg 1999 47 210 213 10402768 15 Nomori H Horio H Colored collagen is a long-lasting point marker for small pulmonary nodules in thoracoscopic operations Ann Thorac Surg 1996 61 1070 1073 8607658 16 McConnell PI Feola GP Meyers RL Methylene blue-stained autologous blood for needle localization and thoracoscopic resection of deep pulmonary nodules J Pediatr Surg 2002 37 1729 1731 12483642 17 Hu J Zhang C Sun L Localization of small pulmonary nodules for videothoracoscopic surgery ANZ J Surg 2006 76 649 651 16813634 18 Wicky S Mayor B Cuttat JF Schnyder P CT-guided localizations of pulmonary nodules with methylene blue injections for thoracoscopic resections Chest 1994 106 1326 1328 7956378 19 Vandoni RE Cuttat JF Wicky S Suter M CT-guided methylene-blue labelling before thoracoscopic resection of pulmonary nodules Eur J Cardiothorac Surg 1998 14 265 270 9761435 20 Lenglinger FX Schwarz CD Artmann W Localization of pulmonary nodules before thoracoscopic surgery: value of percutaneous staining with methylene blue AJR Am J Roentgenol 1994 163 297 300 7518642 21 Ikeda K Nomori H Mori T Kobayashi H Iwatani K Yoshimoto K Kawanaka K Impalpable pulmonary nodules with ground-glass opacity: success for making pathologic sections with preoperative marking by lipiodol Chest 2007 131 502 506 17296654 22 Nomori H Horio H Naruke T Suemasu K Fluoroscopy-assisted thoracoscopic resection of lung nodules marked with lipiodol Ann Thorac Surg 2002 74 170 173 12118752 23 Watanabe K Nomori H Ohtsuka T Kaji M Naruke T Suemasu K Usefulness and complications of computed tomography-guided lipiodol marking for fluoroscopy-assisted thoracoscopic resection of small pulmonary nodules: experience with 174 nodules J Thorac Cardiovasc Surg 2006 132 320 324 16872957 24 Kim YD Jeong YJ I H Cho JS Lee JW Kim HJ Lee SH Kim DH Localization of pulmonary nodules with lipiodol prior to thoracoscopic surgery Acta Radiol 2011 52 64 69 21498328 25 Mayo JR Clifton JC Powell TI English JC Evans KG Yee J McWilliams AM Lam SC Finley RJ Lung nodules: CT-guided placement of microcoils to direct video-assisted thoracoscopic surgical resection Radiology 2009 250 576 585 19188326 26 Lee NK Park CM Kang CH Jeon YK Choo JY Lee HJ Goo JM CT-guided percutaneous transthoracic localization of pulmonary nodules prior to video-assisted thoracoscopic surgery using barium suspension Korean J Radiol 2012 13 694 701 23118567 27 Kamiyoshihara M Ishikawa S Morishita Y Pulmonary cryptococcosis diagnosed by video-assisted thoracoscopic surgery with CT-guided localization: report of a case Kyobu Geka 2000 53 795 797 10935411 28 Kwon WJ Kim HJ Jeong YJ Lee CH Kim KI Kim YD Lee JH Direct lipiodol injection used for a radio-opaque lung marker: stability and histopathologic effects Exp Lung Res 2011 37 310 317 21574876 29 Jang HS Effect of drugs for preoperative localization of thoracoscopy to histopathologic change in rabbit lung Seoul the Catholic University of Korea 2000 27 Dissertation 30 Okumura T Kondo H Suzuki K Asamura H Kobayashi T Kaneko M Tsuchiya R Fluoroscopy-assisted thoracoscopic surgery after computed tomography-guided bronchoscopic barium marking Ann Thorac Surg 2001 71 439 442 11235684 Fig. 1 Overview of the experimental design. Animals were randomly divided into two groups: Group A (n = 12) was sacrificed 6 hr after percutaneous injection and Group B (n = 12) was sacrificed 24 hr after a CT guided percutaneous injection of MLM and methylene blue. Fig. 2 Examples of evaluation of staining on the lung surface. Photographs show (A) the extensive staining (score 1) (B) localized dispersion of staining (score 2) and (C) minimal dispersion of staining (score 3). The white lines on the bottom of the figure are markings of the ruler. The distance between two lines is one centimeter. Fig. 3 Examples of assessment of radio-opacity on the fluoroscopic examinations. The fluoroscopic images show (A) a minimally increased opacity (arrow) (score 1) (B) a low density of increased opacity (arrow) (score 2) and (C) a compact nodular increased opacity (arrow) (score 3). Fig. 4 CT and corresponding photomicrograph of lung specimen. MLM in Group B (A-D); (A) discrete and compact nodular opacity (arrowheads) (B) focal neutrophil infiltration necrosis and hemorrhage (arrowheads) (H&E —12.5) (C) scattered small nodular opacities of lipiodol (long arrows) and faint nodular opacity (arrowheads) (D) focal hemorrhage and necrosis (arrowheads) with diffuse neutrophil infiltration (short arrows) (H&E —12.5). MLM in Group A (E F); (E) faint nodular lipiodol opacity (arrows) (F) focal hemorrhage (arrows) with diffuse neutrophil infiltration (arrowheads) (H&E —12.5). Methylene blue in Group A (G H); (G) faint nodular opacity (arrowheads) and (H) focal extent of neutrophil infiltration necrosis and hemorrhage (arrowheads) (H&E —12.5). Staining extent and localization ability of MLM versus methylene blue Data are mean±standard deviation. Numbers in parentheses are ranges. N/A indicates not available. *Non-parametric Mann-Whitney test was performed to compare the average score of MLM and methylene blue. MLM mixture of lipiodol and methylene blue. Localization ability score of staining and radio-opacity for MLM as well as methylene blue Data are numbers of subjects. Numbers in parentheses are percentages. MLM mixture of lipiodol and methylene blue. Table 3 Comparison of localization ability between MLM and methylene blue in total subjects (n = 42) We considered a score of 2 or 3 as appropriate and 3 as excellent for localization respectively. Numbers in parentheses are percentages. *Fisher's exact test compared the proportion of appropriate or excellent staining between the mixture and methylene blue. MLM mixture of lipiodol and methylene blue. Table 4 Localization ability of MLM: Evaluation of radio-opacity and staining score Data are given as numbers of subjects. Numbers in parentheses are percentages. MLM mixture of lipiodol and methylene blue. Table 5 Histopathologic findings of lung specimens after percutaneous injections Data are numbers of subjects. Numbers in parentheses are percentages. N/A indicates not available. *Linear by linear association was performed between material and the extent of the histopathologic findings. € Linear by linear association was performed between groups and the extent of the histopathologic findings. MLM mixture of lipiodol and methylene blue. PLoS One PLoS ONE plos plosone PLoS ONE 1932-6203 Public Library of Science San Francisco USA 24819391 4018408 PONE-D-13-46027 10.1371/journal.pone.0096911 Research Article Biology and Life Sciences Biochemistry Biomarkers Genetics Heredity Medicine and Health Sciences Diagnostic Medicine Epidemiology Biomarker Epidemiology Cancer Epidemiology Health Care Environmental Health Oncology Cancer Risk Factors Environmental Causes of Cancer Pathology and Laboratory Medicine Public and Occupational Health Pulmonology Environmental and Occupational Lung Diseases Single Nucleotide Polymorphism in ATM Gene Cooking Oil Fumes and Lung Adenocarcinoma Susceptibility in Chinese Female Non-Smokers: A Case-Control Study ATM Polymorphism and Risk of Lung Adenocarcinoma Shen Li 1 2 Yin Zhihua 1 2 Wu Wei 1 2 Ren Yangwu 1 2 Li Xuelian 1 2 Zhou Baosen 1 2 * 1 Department of Epidemiology School of Public Health China Medical University Heping District Shenyang Liaoning Province China 2 Key Laboratory of Cancer Etiology and Intervention University of Liaoning Province China Chang Jeffrey S. Editor National Health Research Institutes Taiwan * E-mail: bszhou@mail.cmu.edu.cn Competing Interests: The authors have declared that no competing interests exist. Conceived and designed the experiments: LS. Performed the experiments: LS YR XL. Analyzed the data: LS WW ZY. Contributed reagents/materials/analysis tools: LS ZY XL BZ. Wrote the paper: LS. Obtained informed consent from subjects: Baosen Zhou. 2014 12 5 2014 9 5 e96911 3 11 2013 12 4 2014 2014 Shen et al This is an open-access article distributed under the terms of the Creative Commons Attribution License which permits unrestricted use distribution and reproduction in any medium provided the original author and source are credited. Background The ataxia-telangiectasia mutated (ATM) gene plays an important role in the DNA double-strand breaks repair pathway. Single nucleotide polymorphisms (SNPs) of DNA repair genes are suspected to influence the risk of lung cancer. This study aimed to investigate the association between the ATM -111G>A (rs189037) polymorphism environmental risk factors and the risk of lung adenocarcinoma in Chinese female non-smokers. Methods A hospital-based case-control study of 487 lung cancer patients and 516 matched cancer-free controls was conducted. Information concerning demographic and environmental risk factors was obtained for each case and control by a trained interviewer. After informed consent was obtained 10 ml venous blood was collected from each subject for biomarker testing. Single nucleotide polymorphism was determined by using TaqMan method. Results This study showed that the individuals with ATM rs189037 AA genotype were at an increased risk for lung adenocarcinoma compared with those carrying the GA or GG genotype (adjusted odds ratios (OR) 1.44 95% confidence interval (CI) 1.02€“2.02 P?=?0.039). The stratified analysis suggested that increased risk associated with ATM rs189037 AA genotype in individuals who never or seldom were exposed to cooking oil fumes (adjusted OR 1.89 95%CI 1.03€“3.49 P?=?0.040). Conclusions ATM rs189037 might be associated with the risk of lung adenocarcinoma in Chinese non-smoking females. Furthermore ATM rs189037 AA genotype might be a risk factor of lung adenocarcinoma among female non-smokers without cooking oil fume exposure. This study was supported by grant no. 81272293 from National Natural Science Foundation of China grant no. 81102194 from National Natural Science Foundation of China and grant no. 00726 from China Medical Board. The funders had no role in study design data collection and analysis decision to publish or preparation of the manuscript. Introduction Lung cancer is the leading cause of cancer-related deaths both worldwide and in China. Although cigarette smoke is the major risk factor for lung cancer only a fraction of smokers develop this disease [1] suggesting that host genetic susceptibility may play an important role in the development of lung cancer. Recent genetic susceptibility studies of lung cancer have focused on single nucleotide polymorphisms (SNPs) in candidate genes among which DNA repair genes are increasingly studied because of their critical role in maintain genome integrity. Genetic variations in DNA repair genes are thought to affect DNA repair capacity and deficits in DNA repair capacity may lead to genetic instability and carcinogenesis [2] [3]. As one of the DNA repair genes ataxia-telangiectasia mutated (ATM) gene which is responsible for the multisystem autoxomal recessive disorder ataxia-telangiectasia (A€“T) plays a crucial role in the recognition signaling and repair of DNA damage especially DNA double-strand breaks (DSBs) [4] [5]. The ATM "

Lung_Cancer

"Therefore using the combined sample from the LSC and PLuSS ROC curves were generated using the 3-gene model the full 11-gene model and covariates-only model in male former smokers (Figure 1). Likelihood ratio tests confirmed that both the 3-gene and 11-gene models are significantly more discriminative than the covariates only model (p?=?0.0002 and p?=?0.002 respectively); however the 3- and 11-gene models were not significantly different from each other (p?=?0.29). Areas under the curve (AUC) were 0.74 and 0.80 for the 3- and 11-gene models respectively while the AUC was 0.55 for the covariates only model. Although sample sizes were small in cohort-stratified analyses of male former smokers these analyses demonstrate that the increased discriminative power of the 3-gene model is observed in two independent cohorts (Additional file 1: Figure S1). ROC curves comparing the sensitivity and specificity of 3- and 11-gene methylation panels for classifying CMH. ROC curves were generated by applying logistic regression models to male former smokers (n?=?139) from the combined PLuSS and LSC. The covariates included age pack years education and COPD. AUC is indicated in parentheses. Discussion This study demonstrates a significant association between CMH and prevalence of promoter methylation in sputum of lung cancer risk genes in two geographically distinct cohorts. This association was especially strong in males and in former smokers and SULF2 was the most consistently associated gene. Importantly the overall association between CMH and methylation and the specific effects of sex and smoking status were observed independently in both cohorts. Combining the two cohorts strengthened the statistical significance of these associations. The central finding of our study is that male former smokers with unresolved CMH may be at an increased risk of lung cancer. Given that 50% of persons diagnosed with lung cancer are former smokers prospective studies evaluating the methylation status of former smokers with CMH who subsequently develop lung cancer are needed [26]. The eleven genes examined in this study were selected based on prior evidence that they are associated with lung cancer risk [1718]. Therefore increased prevalence of methylation of these genes may predict lung cancer among subjects with CMH. These gene promoters have all been shown to be methylated in tumors [2728] and are proposed to represent an expanding field of precancerous epigenetic changes in the aerodigestive tract of smokers [1729]. This hypothesis is supported by the observation that the methylation prevalence of these gene promoters increases as the time to lung cancer diagnosis decreases [17]. Mounting evidence indicates that these changes are causal for tumor initiation [30-33]. The association between methylation and CMH was markedly stronger in males than in females (Table 4). Univariate analysis of males and females in both cohorts (Additional file 1: Tables S3 and S4) reveals that females with CMH are significantly younger than female controls in the LSC; however this was not true in the PLuSS. Additionally age was a covariate in all adjusted analyses and thus is unlikely to account for the lack of association between methylation and CMH in females. This apparent protective mechanism in females warrants further study. The association between methylation and CMH was also stronger in former than in current smokers (Table 5). The increase in effect size in former smokers may be due to several reasons: (1) the CMH phenotype in former smokers may not be confounded by cough and phlegm caused by irritation due to current smoking; (2) in susceptible smokers CMH that persists in spite of smoking cessation may represent a phenotype with a more distinct molecular pathology; (3) The association between CMH and gene promoter methylation may be stronger with age. In the LSC and PLuSS cohorts former smokers were significantly older than current smokers (mean age difference 4.2 years data not shown). This age difference between former and current smokers also likely explains the puzzling observation that current smokers have lower overall methylation compared to former smokers (Additional file 1: Table S2); current smokers are younger and younger age is associated with less total methylation in these lung cancer risk genes. Numerous studies have demonstrated that prior CMH significantly increases the risk for later development of lung cancer (reviewed in [1516]). Assessment of the latency period between diagnosis of CMH and diagnosis of lung cancer has shown that this risk increases with time since diagnosis of CMH [34]. In one study [34] the odds ratio nearly quadrupled at latency >15 years compared to latency 1“5 years. Importantly this suggests that CMH may serve as a precursor to lung carcinogenesis [34]. We hypothesize that the increased prevalence for methylation of the lung cancer risk genes seen in this study may help explain the epidemiological link between CMH and lung cancer. Further studies are needed to establish a direct link between gene methylation and lung cancer. Interestingly while SULF2 p16 JPH3 and PCDH20 all demonstrate evidence for association with CMH in the current study a previous study determined that GATA4 promoter methylation was associated with airflow obstruction [35]. These findings suggest that major differences exist in the genes affected by aberrant promoter methylation in distinct COPD sub-phenotypes. This is consistent with the major pathophysiological differences that underlie emphysema and chronic mucous hypersecretion [36] and suggests the role basal cell hyperplasia may play in development of lung cancer [37]. Of the 11 genes analyzed SULF2 demonstrated the strongest association with CMH. SULF-2 is an extracellular enzyme that catalyzes the hydrolysis of 6-O-sulfo groups from heparan sulfate polysaccharides [38-40]. Heparan sulfate proteoglycans (HSPGs) are widely distributed on cell membranes and the extracellular matrix and serve as coreceptors for many growth factors and cytokines [41] and the position of 6-O sulfates is of particular importance for ligand binding [38-40]. Epigenetic inactivation of SULF2 either by siRNA treatment or promoter methylation activates numerous type I interferon (IFN)-inducible genes [42]. It was proposed that silencing of SULF2 prevents the removal of sulfate groups from IFN-binding sites which may preserve either the binding affinity or bioavailability of interferons leading to increased transcription of multiple IFN-inducible genes [42]. It is plausible that CMH caused by metaplastic mucous cells that are sustained due to dysregulated cell death mechanisms that involve IFN signaling [43-45] creates an inflammatory milieu which causes methylation of SULF2. In turn the type 1 interferon response induced by methylation of SULF2 may help to perpetuate the inflammation associated with CMH. This is the first report of epigenetic changes in the airways of individuals with CMH. Strengths of the study include the use of the large well-characterized LSC for the initial phase of study and excellent replication of all main findings in the geographically distinct PLuSS. We chose the standard definition for chronic bronchitis in the LSC and a definition that most closely captured the standard clinical definition of chronic bronchitis in the PLuSS. While the differences in questionnaires used to define CMH could be considered a limitation in the study the definition for CMH was applied to PLuSS subjects prior to any data analysis and was not subsequently modified. We propose that this approach improves the rigor of our validation. "

Lung_Cancer